diff --git a/CHANGELOG.md b/CHANGELOG.md index 16e79693..9e59f784 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -9,6 +9,8 @@ * `rsem/rsem_calculate_expression`: Calculate expression levels (PR #93). +* `nanoplot`: Plotting tool for long read sequencing data and alignments (PR #95). + ## BREAKING CHANGES * `falco`: Fix a typo in the `--reverse_complement` argument (PR #157). @@ -189,8 +191,6 @@ - `bbmap_bbsplit`: Split sequencing reads by mapping them to multiple references simultaneously (PR #138). - - ## MINOR CHANGES * Uniformize component metadata (PR #23). diff --git a/src/nanoplot/config.vsh.yaml b/src/nanoplot/config.vsh.yaml new file mode 100644 index 00000000..1c22775f --- /dev/null +++ b/src/nanoplot/config.vsh.yaml @@ -0,0 +1,230 @@ +name: nanoplot +description: | + Run NanoPlot on nanopore-sequenced reads. + NanoPlot is a plotting tool for long read sequencing data and alignments. +keywords: ["fastq", "sequencing summary", "nanopore"] +links: + repository: https://github.com/wdecoster/NanoPlot + homepage: http://nanoplot.bioinf.be/ + documentation: https://github.com/wdecoster/NanoPlot +references: + doi: 10.1093/bioinformatics/btad311 +license: MIT +argument_groups: + - name: Inputs + arguments: + - name: --fastq + type: file + description: Input fastq file(s), separated by ";". + example: read.fq + direction: input + multiple: true + - name: --fasta + type: file + description: Input fasta file(s), separated by ";". + example: read.fa + direction: input + multiple: true + - name: --fastq_rich + type: file + description: | + Input fastq file(s) generated by albacore or + MinKNOW with additional information concerning channel and time, separated by ";". + example: read.fq + direction: input + multiple: true + - name: --fastq_minimal + type: file + description: | + Input fastq file(s) generated by albacore or MinKNOW with + additional information concerning channel and time. Minimal data is extracted + swiftly without elaborate checks. Separated by ";". + example: read.fq + direction: input + multiple: true + - name: --summary + type: file + description: | + Input summary file(s) generated by albacore or guppy, separated by ";". + example: read.txt + direction: input + multiple: true + - name: --bam + type: file + description: Input sorted bam file(s), separated by ";". + example: read.bam + direction: input + multiple: true + - name: --ubam + type: file + description: Input unmapped bam file(s), separated by ";". + example: read.ubam + direction: input + multiple: true + - name: --cram + type: file + description: Input sorted cram file(s), separated by ";". + example: read.cram + direction: input + multiple: true + - name: --pickle + type: file + description: Input pickle file stored earlier, separated by ";". + example: read.pkl + direction: input + multiple: true + - name: --feather + alternatives: [--arrow] + type: file + description: Input feather file(s), separated by ";". + example: read.arrow + direction: input + multiple: true + - name: Outputs + arguments: + - name: --outdir + alternatives: [-o] + type: file + direction: output + description: Specify directory in which output has to be created. + required: true + - name: Options + arguments: + - name: --verbose + type: boolean_true + description: Write log messages also to terminal + - name: --store + type: boolean_true + description: Store the extracted data in a pickle file for future plotting. + - name: --raw + type: boolean_true + description: Store the extracted data in tab separated file. + - name: --huge + type: boolean_true + description: Input data is one very large file. + - name: --no_static + type: boolean_false + description: Do not make static (png) plots. + - name: --prefix + alternatives: [-p] + type: string + description: Specify an optional prefix to be used for the output files. + - name: --tsv_stats + type: boolean_true + description: Output the stats file as a properly formatted TSV. + - name: --only_report + type: boolean_true + description: Output only the report. + - name: --info_in_report + type: boolean_true + description: Add NanoPlot run info in the report. + - name: Filtering or transforming input + arguments: + - name: --maxlength + type: integer + description: Drop reads longer than length specified. + - name: --minlength + type: integer + description: Drop reads shorter than length specified. + - name: --drop_outliers + type: boolean_false + description: Drop outlier reads with extreme long length. + - name: --downsample + type: integer + description: Reduce dataset to N reads by random sampling. + - name: --loglength + type: boolean_true + description: Logarithmic scaling of lengths in plots. + - name: --percentqual + type: boolean_true + description: Use qualities as theoretical percent identities. + - name: --alength + type: boolean_true + description: Use aligned read lengths rather than sequenced length (bam mode). + - name: --minqual + type: integer + description: Drop reads with an average quality lower than specified. + - name: --runtime_until + type: integer + description: Only take the N first hours of a run. + - name: --readtype + type: string + description: | + Which read type to extract information about from summary. + Options are 1D, 2D, 1D2 + - name: --barcoded + type: boolean_true + description: Use if you want to split the summary file by barcode. + - name: --no_supplementary + type: boolean_false + description: Use if you want to remove supplementary alignments. + - name: Customizing plots + arguments: + - name: --color + alternatives: [-c] + type: string + description: Specify a color for the plots, must be a valid matplotlib color. + - name: --colormap + alternatives: [-cm] + type: string + description: Specify a valid matplotlib colormap for the heatmap. + - name: --format + alternatives: [-f] + type: string + default: png + description: | + Specify the output format of the plots. + {eps,jpeg,jpg,pdf,pgf,png,ps,raw,rgba,svg,svgz,tif,tiff} + - name: --plots + type: string + description: | + Specify which bivariate plots have to be made. + [{kde,hex,dot} ...] + - name: --legacy + type: string + description: | + Specify which bivariate plots have to be made (legacy mode). + [{kde,dot,hex} ...] + - name: --listcolors + type: boolean_true + description: List the colors which are available for plotting and exit. + - name: --listcolormaps + type: boolean_true + description: List the colormaps which are available for plotting and exit. + - name: --no_N50 + type: boolean_false + description: Hide the N50 mark in the read length histogram. + - name: --N50 + type: boolean_true + description: Show the N50 mark in the read length histogram. + - name: --title + type: string + description: Add a title to all plots, requires quoting if using spaces. + - name: --font_scale + type: double + description: Scale the font of the plots by a factor. + - name: --dpi + type: integer + description: Set the dpi for saving images. + - name: --hide_stats + type: boolean_false + description: Not adding Pearson R stats in some bivariate plots. +resources: + - type: bash_script + path: script.sh +test_resources: + - type: bash_script + path: test.sh + - type: file + path: test_data +engines: + - type: docker + image: quay.io/biocontainers/nanoplot:1.43.0--pyhdfd78af_1 + setup: + - type: docker + run: | + version=$(NanoPlot --version) && \ + echo "$version" > /var/software_versions.txt +runners: + - type: executable + - type: nextflow \ No newline at end of file diff --git a/src/nanoplot/help.txt b/src/nanoplot/help.txt new file mode 100644 index 00000000..79869392 --- /dev/null +++ b/src/nanoplot/help.txt @@ -0,0 +1,96 @@ +usage: NanoPlot [-h] [-v] [-t THREADS] [--verbose] [--store] [--raw] [--huge] + [-o OUTDIR] [--no_static] [-p PREFIX] [--tsv_stats] + [--only-report] [--info_in_report] [--maxlength N] + [--minlength N] [--drop_outliers] [--downsample N] + [--loglength] [--percentqual] [--alength] [--minqual N] + [--runtime_until N] [--readtype {1D,2D,1D2}] [--barcoded] + [--no_supplementary] [-c COLOR] [-cm COLORMAP] + [-f [{png,jpg,jpeg,webp,svg,pdf,eps,json} ...]] + [--plots [{kde,hex,dot} ...]] [--legacy [{kde,dot,hex} ...]] + [--listcolors] [--listcolormaps] [--no-N50] [--N50] + [--title TITLE] [--font_scale FONT_SCALE] [--dpi DPI] + [--hide_stats] + (--fastq file [file ...] | --fasta file [file ...] | --fastq_rich file [file ...] | --fastq_minimal file [file ...] | --summary file [file ...] | --bam file [file ...] | --ubam file [file ...] | --cram file [file ...] | --pickle pickle | --feather file [file ...]) + +CREATES VARIOUS PLOTS FOR LONG READ SEQUENCING DATA. + +General options: + -h, --help show the help and exit + -v, --version Print version and exit. + -t, --threads THREADS + Set the allowed number of threads to be used by the script + --verbose Write log messages also to terminal. + --store Store the extracted data in a pickle file for future plotting. + --raw Store the extracted data in tab separated file. + --huge Input data is one very large file. + -o, --outdir OUTDIR Specify directory in which output has to be created. + --no_static Do not make static (png) plots. + -p, --prefix PREFIX Specify an optional prefix to be used for the output files. + --tsv_stats Output the stats file as a properly formatted TSV. + --only-report Output only the report + --info_in_report Add NanoPlot run info in the report. + +Options for filtering or transforming input prior to plotting: + --maxlength N Hide reads longer than length specified. + --minlength N Hide reads shorter than length specified. + --drop_outliers Drop outlier reads with extreme long length. + --downsample N Reduce dataset to N reads by random sampling. + --loglength Additionally show logarithmic scaling of lengths in plots. + --percentqual Use qualities as theoretical percent identities. + --alength Use aligned read lengths rather than sequenced length (bam mode) + --minqual N Drop reads with an average quality lower than specified. + --runtime_until N Only take the N first hours of a run + --readtype {1D,2D,1D2} + Which read type to extract information about from summary. Options are 1D, 2D, + 1D2 + --barcoded Use if you want to split the summary file by barcode + --no_supplementary Use if you want to remove supplementary alignments + +Options for customizing the plots created: + -c, --color COLOR Specify a valid matplotlib color for the plots + -cm, --colormap COLORMAP + Specify a valid matplotlib colormap for the heatmap + -f, --format [{png,jpg,jpeg,webp,svg,pdf,eps,json} ...] + Specify the output format of the plots, which are in addition to the html files + --plots [{kde,hex,dot} ...] + Specify which bivariate plots have to be made. + --legacy [{kde,dot,hex} ...] + Specify which bivariate plots have to be made (legacy mode). + --listcolors List the colors which are available for plotting and exit. + --listcolormaps List the colors which are available for plotting and exit. + --no-N50 Hide the N50 mark in the read length histogram + --N50 Show the N50 mark in the read length histogram + --title TITLE Add a title to all plots, requires quoting if using spaces + --font_scale FONT_SCALE + Scale the font of the plots by a factor + --dpi DPI Set the dpi for saving images + --hide_stats Not adding Pearson R stats in some bivariate plots + +Input data sources, one of these is required.: + --fastq file [file ...] + Data is in one or more default fastq file(s). + --fasta file [file ...] + Data is in one or more fasta file(s). + --fastq_rich file [file ...] + Data is in one or more fastq file(s) generated by albacore, MinKNOW or guppy + with additional information concerning channel and time. + --fastq_minimal file [file ...] + Data is in one or more fastq file(s) generated by albacore, MinKNOW or guppy + with additional information concerning channel and time. Is extracted swiftly + without elaborate checks. + --summary file [file ...] + Data is in one or more summary file(s) generated by albacore or guppy. + --bam file [file ...] + Data is in one or more sorted bam file(s). + --ubam file [file ...] + Data is in one or more unmapped bam file(s). + --cram file [file ...] + Data is in one or more sorted cram file(s). + --pickle pickle Data is a pickle file stored earlier. + --feather, --arrow file [file ...] + Data is in one or more feather file(s). + +EXAMPLES: + NanoPlot --summary sequencing_summary.txt --loglength -o summary-plots-log-transformed + NanoPlot -t 2 --fastq reads1.fastq.gz reads2.fastq.gz --maxlength 40000 --plots hex dot + NanoPlot --color yellow --bam alignment1.bam alignment2.bam alignment3.bam --downsample 10000 \ No newline at end of file diff --git a/src/nanoplot/script.sh b/src/nanoplot/script.sh new file mode 100644 index 00000000..fc198e89 --- /dev/null +++ b/src/nanoplot/script.sh @@ -0,0 +1,129 @@ +#!/bin/bash + +set -eo pipefail + +## VIASH START +## VIASH END + +# Unset flags +unset_if_false=( + par_verbose + par_store + par_raw + par_huge + par_no_static + par_tsv_stats + par_only_report + par_info_in_report + par_drop_outliers + par_loglength + par_percentqual + par_alength + par_barcoded + par_no_supplementary + par_listcolors + par_listcolormaps + par_no_N50 + par_N50 + par_hide_stats +) + +for var in "${unset_if_false[@]}"; do + test_val="${!var}" + [[ "$test_val" == "false" ]] && unset $var +done + +par_fastq="${par_fastq//;/ }" +par_fasta="${par_fasta//;/ }" +par_fastq_rich="${par_fastq_rich//;/ }" +par_fastq_minimal="${par_fastq_minimal//;/ }" +par_summary="${par_summary//;/ }" +par_bam="${par_bam//;/ }" +par_ubam="${par_ubam//;/ }" +par_cram="${par_cram//;/ }" +par_pickle="${par_pickle//;/ }" +par_feather="${par_feather//;/ }" + + +inputs=( + "$par_fastq" + "$par_fasta" + "$par_fastq_rich" + "$par_fastq_minimal" + "$par_summary" + "$par_bam" + "$par_ubam" + "$par_cram" + "$par_pickle" + "$par_feather" +) + +one_input=false +for var in "${inputs[@]}"; do + if [ -n "$var" ]; then # if the parameter is not empty + if [ "$one_input" = "false" ]; then + one_input=true + else # Multiple input file types specified + echo "Error: Multiple input file types specified." + exit 1 + fi + fi +done + +if [ ! "$one_input" ]; then + echo "Error: No input file type specified." + exit 1 +fi + + + +# Run NanoPlot +NanoPlot \ + ${par_fastq:+--fastq $par_fastq} \ + ${par_fasta:+--fasta $par_fasta} \ + ${par_fastq_rich:+--fastq_rich $par_fastq_rich} \ + ${par_fastq_minimal:+--fastq_minimal $par_fastq_minimal} \ + ${par_summary:+--summary $par_summary} \ + ${par_bam:+--bam $par_bam} \ + ${par_ubam:+--ubam $par_ubam} \ + ${par_cram:+--cram $par_cram} \ + ${par_pickle:+--pickle $par_pickle} \ + ${par_feather:+--feather $par_feather} \ + ${par_verbose:+--verbose} \ + ${par_store:+--store} \ + ${par_raw:+--raw} \ + ${par_huge:+--huge} \ + ${par_no_static:+--no_static} \ + ${par_prefix:+--prefix "$par_prefix"} \ + ${par_tsv_stats:+--tsv_stats} \ + ${par_only_report:+--only-report} \ + ${par_info_in_report:+--info_in_report} \ + ${par_maxlength:+--maxlength "$par_maxlength"} \ + ${par_minlength:+--minlength "$par_minlength"} \ + ${par_drop_outliers:+--drop_outliers} \ + ${par_downsample:+--downsample "$par_downsample"} \ + ${par_loglength:+--loglength} \ + ${par_percentqual:+--percentqual} \ + ${par_alength:+--alength} \ + ${par_minqual:+--minqual "$par_minqual"} \ + ${par_runtime_until:+--runtime_until "$par_runtime_until"} \ + ${par_readtype:+--readtype "$par_readtype"} \ + ${par_barcoded:+--barcoded} \ + ${par_no_supplementary:+--no_supplementary} \ + ${par_color:+--color "$par_color"} \ + ${par_colormap:+--colormap "$par_colormap"} \ + ${par_format:+--format "$par_format"} \ + ${par_plots:+--plots "$par_plots"} \ + ${par_legacy:+--legacy "$par_legacy"} \ + ${par_listcolors:+--listcolors} \ + ${par_listcolormaps:+--listcolormaps} \ + ${par_no_N50:+--no-N50} \ + ${par_N50:+--N50} \ + ${par_title:+--title "$par_title"} \ + ${par_font_scale:+--font_scale "$par_font_scale"} \ + ${par_dpi:+--dpi "$par_dpi"} \ + ${par_hide_stats:+--hide_stats} \ + ${meta_cpus:+--threads "$meta_cpus"} \ + --outdir "$par_outdir" + +exit 0 diff --git a/src/nanoplot/test.sh b/src/nanoplot/test.sh new file mode 100644 index 00000000..cac10c17 --- /dev/null +++ b/src/nanoplot/test.sh @@ -0,0 +1,549 @@ +#!/bin/bash + +set -eo pipefail + +## VIASH START +## VIASH END + +# Files at runtime (.gz, .pickle and .feather) +wget https://github.com/wdecoster/nanotest/archive/refs/heads/master.zip +unzip master.zip + +########################################################################### + +# Test 1: Run NanoPlot with only input parameter (Fastq) + +mkdir test1 +pushd test1 > /dev/null # cd test1 (stack) + +echo "> Run Test 1: one input (Fastq)" +"$meta_executable" \ + --fastq "$meta_resources_dir/test_data/test1.fastq" \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then # Apart from log file + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null # Remove directory from stack (LIFO) + +echo "Test 1 succeeded." + +########################################################################### + +# Test 2: Run NanoPlot with multiple inputs (Fastq) + +mkdir test2 +pushd test2 > /dev/null + +echo "> Run Test 2: multiple inputs (Fastq)" +"$meta_executable" \ + --fastq "$meta_resources_dir/test_data/test1.fastq;$meta_resources_dir/test_data/test2.fastq" \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 2 succeeded." + +########################################################################### + +# Test 3: Run NanoPlot with multiple options-1 + +mkdir test3 +pushd test3 > /dev/null + +echo "> Run Test 3: multiple options-1" +"$meta_executable" \ + --fastq "$meta_resources_dir/test_data/test1.fastq" \ + --maxlength 40000 \ + --format jpg \ + --prefix biobox_ \ + --store \ + --color "yellow" \ + --info_in_report \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then + echo "Output files are not found!" + exit 1 +fi + +# Check if the extracted data exists (--store) +if ! ls output/*.pickle > /dev/null 2>&1; then + echo "Extracted data is not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi +if find output -name "*.pickle" -type f -size 0 | grep -q .; then + echo "Extracted data is empty." + exit 1 +fi + +# Check if the output file starts with "biobox" prefix +if ! ls output/biobox* > /dev/null 2>&1; then + echo "The prefix is not added to the output files." + exit 1 +fi + +popd > /dev/null + +echo "Test 3 succeeded." + +########################################################################### + +# Test 4: Run NanoPlot with multiple options-2 + +mkdir test4 +pushd test4 > /dev/null + +echo "> Run Test 4: multiple options-2" +"$meta_executable" \ + --fastq "$meta_resources_dir/test_data/test1.fastq" \ + --maxlength 40000 \ + --only_report \ + --raw \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -ne 4 ]; then # 4 output files + echo "Output files are not found!" + exit 1 +fi + +# Check if the extracted data exists (--raw) +if ! ls output/*.tsv.gz > /dev/null 2>&1; then + echo "Extracted data is not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "NanoPlot-report.html" -type f -size 0 | grep -q .; then + echo "NanoPlot report is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi +if find output -name "*.tsv.gz" -type f -size 0 | grep -q .; then + echo "Extracted data is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 4 succeeded." + +########################################################################### + +# Test 5: Run NanoPlot with different input (Fasta) + +mkdir test5 +pushd test5 > /dev/null + +echo "> Run Test 5: Input Fasta" +"$meta_executable" \ + --fasta "$meta_resources_dir/test_data/test.fasta" \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then # Apart from log file + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 5 succeeded." + +########################################################################### + +# Test 6: Run NanoPlot with different input (Fastq_rich) + +mkdir test6 +pushd test6 > /dev/null + +echo "> Run Test 6: Input Fastq_rich" +"$meta_executable" \ + --fastq_rich "$meta_resources_dir/test_data/test_rich.fastq" \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then # Apart from log file + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 6 succeeded." + +########################################################################### + +# Test 7: Run NanoPlot with different input (Fastq_minimal) + +mkdir test7 +pushd test7 > /dev/null + +echo "> Run Test 7: Input Fasta" +"$meta_executable" \ + --fastq_minimal "../nanotest-master/reads.fastq.gz" \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then # Apart from log file + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 7 succeeded." + +########################################################################### + +# Test 8: Run NanoPlot with different input (Summary) + +mkdir test8 +pushd test8 > /dev/null + +echo "> Run Test 8: Input Summary" +"$meta_executable" \ + --summary "$meta_resources_dir/test_data/summary.txt" \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then # Apart from log file + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 8 succeeded." + +########################################################################### + +# Test 9: Run NanoPlot with different input (BAM) + +mkdir test9 +pushd test9 > /dev/null + +echo "> Run Test 9: Input BAM" +"$meta_executable" \ + --bam "$meta_resources_dir/test_data/test.bam" \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then # Apart from log file + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 9 succeeded." + +########################################################################### + +# Test 10: Run NanoPlot with different input (pickle) + +mkdir test10 +pushd test10 > /dev/null + +echo "> Run Test 10: Input pickle" +"$meta_executable" \ + --pickle "../nanotest-master/alignment.pickle" \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then # Apart from log file + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 10 succeeded." + +########################################################################### + +# Test 11: Run NanoPlot with different input (feather) + +mkdir test11 +pushd test11 > /dev/null + +echo "> Run Test 11: Input feather" +"$meta_executable" \ + --arrow "../nanotest-master/summary1.feather" \ + --outdir output + +# Check if output directory exists +if [[ ! -d output ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "output" | wc -l)" -lt 1 ]; then # Apart from log file + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find output -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find output -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find output -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 11 succeeded." + +########################################################################### + +# Test 12: Run NanoPlot with different output directory + +mkdir test12 +pushd test12 > /dev/null + +echo "> Run Test 12: different output directory" +"$meta_executable" \ + --fastq "$meta_resources_dir/test_data/test1.fastq" \ + --outdir out + +# Check if output directory exists +if [[ ! -d out ]]; then + echo "Output directory not found!" + exit 1 +fi + +# Check if output files are generated +if [ "$(ls -1 "out" | wc -l)" -lt 1 ]; then + echo "Output files are not found!" + exit 1 +fi + +# Check if files are empty +if find out -name "*.html" -type f -size 0 | grep -q .; then + echo "At least one HTML file is empty." + exit 1 +fi +if find out -name "*.png" -type f -size 0 | grep -q .; then + echo "At least one plot is empty." + exit 1 +fi +if find out -name "*.txt" -type f -size 0 | grep -q .; then + echo "NanoPlot summary file is empty." + exit 1 +fi + +popd > /dev/null + +echo "Test 12 succeeded." + +########################################################################### + +echo "All tests successfully completed!" \ No newline at end of file diff --git a/src/nanoplot/test_data/script.sh b/src/nanoplot/test_data/script.sh new file mode 100644 index 00000000..9bb6ffd6 --- /dev/null +++ b/src/nanoplot/test_data/script.sh @@ -0,0 +1,102 @@ +#!/bin/bash + +## Fastq file ## +# Define the number of reads +NUM_READS=10 +OUTPUT_FILE="./src/nanoplot/test_data/test1.fastq" + +# Function to generate a random DNA sequence of given length +generate_sequence() { + local length=$1 #assigns it the value of the first argument passed to the function + cat /dev/urandom | tr -dc 'ACGT' | fold -w $length | head -n 1 +} + +# Function to generate random quality scores of given length +generate_quality() { + local length=$1 + local average_quality=$2 + local quality="" + for ((i=0; i $OUTPUT_FILE #Create the fastq file +for i in $(seq 1 $NUM_READS); do + # Randomly determine the read length (between 20 and 100 bases) + read_length=$(shuf -i 20-100 -n 1) + # Randomly determine the average quality (between 30 and 40) + average_quality=$(shuf -i 0-40 -n 1) + sequence=$(generate_sequence $read_length) + quality=$(generate_quality $read_length $average_quality) + echo "@read_$i" >> $OUTPUT_FILE + echo $sequence >> $OUTPUT_FILE + echo "+" >> $OUTPUT_FILE + echo $quality >> $OUTPUT_FILE + echo >> $OUTPUT_FILE # Add a blank line between reads +done + +NUM_READS=7 +OUTPUT_FILE="./src/nanoplot/test_data/test2.fastq" +echo -n "" > $OUTPUT_FILE #Create another fastq file +for i in $(seq 1 $NUM_READS); do + # Randomly determine the read length (between 20 and 100 bases) + read_length=$(shuf -i 20-100 -n 1) + # Randomly determine the average quality (between 30 and 40) + average_quality=$(shuf -i 0-40 -n 1) + sequence=$(generate_sequence $read_length) + quality=$(generate_quality $read_length $average_quality) + echo "@read_$i" >> $OUTPUT_FILE + echo $sequence >> $OUTPUT_FILE + echo "+" >> $OUTPUT_FILE + echo $quality >> $OUTPUT_FILE + echo >> $OUTPUT_FILE # Add a blank line between reads +done + +######################################################################################### + +## Fasta file ## +wget -O src/nanoplot/test_data/test.fasta https://raw.githubusercontent.com/merenlab/reads-for-assembly/master/examples/files/fasta_01.fa +# reduced the size of each sequence to ~300 bp. + +######################################################################################### + +## Fastq_rich file ## +wget -O src/nanoplot/test_data/test_rich.fastq.gz https://github.com/epi2me-labs/fastcat/raw/master/test/data/bc0.fastq.gz + +# Unzip file +gunzip -c src/nanoplot/test_data/test_rich.fastq.gz > src/nanoplot/test_data/test_rich.fastq + +rm src/nanoplot/test_data/test_rich.fastq.gz + +######################################################################################### + +## Summary file ## +if [ ! -d nanotest ]; then + git clone --depth 1 --single-branch --branch master https://github.com/wdecoster/nanotest/ +fi + +mv nanotest/sequencing_summary.txt src/nanoplot/test_data/test_summary.txt +# reduce to first 101 lines +head -n 51 src/nanoplot/test_data/test_summary.txt > src/nanoplot/test_data/summary.txt + +rm -rf nanotest + +######################################################################################### + +## BAM file ## +if [ ! -d /tmp/snakemake-wrappers ]; then + git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers +fi + +cp /tmp/snakemake-wrappers/bio/biobambam2/bamsormadup/test/mapped/a.bam src/nanoplot/test_data/test.bam + +# samtools view -h test.bam | head -n 44 > test_sm.sam +# samtools view -bS test_sm.sam > test_sm.bam +# samtools index test_sm.bam +# rm test.bam +# mv test_sm.bam test.bam +# mv test_sm.bam.bai test.bam.bai +# rm test_sm.sam \ No newline at end of file diff --git a/src/nanoplot/test_data/summary.txt b/src/nanoplot/test_data/summary.txt new file mode 100644 index 00000000..b566d6ec --- /dev/null +++ b/src/nanoplot/test_data/summary.txt @@ -0,0 +1,51 @@ +filename read_id run_id channel start_time duration num_events passes_filtering template_start num_events_template template_duration num_called_template sequence_length_template mean_qscore_template strand_score_template +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch124_read148_strand.fast5 170fb1c5-979b-4df7-864f-c5c14689a14c b5e83402e47ea9927694cb6e80d61180dfc8a49a 124 3733.02575 22.56375 12875 True 0.031 12875 22.53275 12875 8242 10.049 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch320_read27_strand.fast5 6d0956c2-c161-48f4-b2fa-142ca872406f b5e83402e47ea9927694cb6e80d61180dfc8a49a 320 1826.8425 123.37625 34771 True 62.52675 34771 60.8495 34771 16881 11.164 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch496_read2_strand.fast5 e9a32f7d-4aa6-4b85-9f76-6764769ad99c b5e83402e47ea9927694cb6e80d61180dfc8a49a 496 7.1315 121.414 52102 True 30.235 52102 91.179 52102 19346 9.822 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch485_read15_strand.fast5 b01da059-de21-4ed3-9eb8-6126ea59cb00 b5e83402e47ea9927694cb6e80d61180dfc8a49a 485 2586.54825 107.53375 36399 True 43.834 36399 63.69975 36399 19861 10.17 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch362_read219_strand.fast5 4d253e4f-2090-4adb-aa3e-16dc5e4d5e55 b5e83402e47ea9927694cb6e80d61180dfc8a49a 362 2720.77225 14.9615 2577 True 10.45175 2577 4.50975 2577 1672 12.663 -0.0004 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch163_read69_strand.fast5 4629b40a-aea4-4c92-9458-0e66ef4ecc17 b5e83402e47ea9927694cb6e80d61180dfc8a49a 163 673.69725 185.45225 95287 True 18.699 95287 166.75325 95287 59133 9.573 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch502_read25_strand.fast5 a8785b36-b442-4de7-9e43-5ddae6e39fdb b5e83402e47ea9927694cb6e80d61180dfc8a49a 502 884.39875 187.91175 83750 True 41.3485 83750 146.56325 83750 55323 11.985 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch355_read19_strand.fast5 436405ef-1e7d-43a5-99b4-929e31897043 b5e83402e47ea9927694cb6e80d61180dfc8a49a 355 571.15325 94.5895 11586 True 74.31375 11586 20.27575 11586 7636 11.865 -0.0003 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch240_read291_strand.fast5 f31d3457-2065-4acf-a9d5-966a4818564c b5e83402e47ea9927694cb6e80d61180dfc8a49a 240 3511.1415 57.23625 19778 True 22.62325 19778 34.613 19778 6176 8.535 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch124_read242_strand.fast5 d67b506a-b026-450d-803e-1e12bd1facaa b5e83402e47ea9927694cb6e80d61180dfc8a49a 124 6315.02775 53.26525 8709 True 38.023 8709 15.24225 8709 5765 12.3 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch217_read62_strand.fast5 68a01ec4-bf8f-4aa4-8763-39cd9a15b8aa b5e83402e47ea9927694cb6e80d61180dfc8a49a 217 3506.43875 16.38525 2944 True 11.23225 2944 5.153 2944 2011 9.229 -0.0007 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch321_read18_strand.fast5 63fcec17-46fd-4cdc-a381-7b09d6f652e9 b5e83402e47ea9927694cb6e80d61180dfc8a49a 321 820.995 47.1295 25668 True 2.21 25668 44.9195 25668 17575 12.18 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch235_read49_strand.fast5 45eb23a8-63d1-4870-9a31-c349836cc728 b5e83402e47ea9927694cb6e80d61180dfc8a49a 235 3662.59625 250.6945 122186 True 36.86825 122186 213.82625 122186 20295 8.707 -0.0003 +nanopore2_20170302_FNFAF09967_MN17024_sequencing_run_170301_MG1655_PC_RAD002_87615_ch150_read334_strand.fast5 1b05de41-d66d-4947-8533-c27bdafeee69 b5e83402e47ea9927694cb6e80d61180dfc8a49a 150 4017.1535 183.56 97579 True 12.79625 97579 170.76375 97579 61111 9.709 -0.0002 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch5_read33_strand.fast5 b5b5833b-9341-4886-9ffd-7dd7f876c009 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 5 142.765 25.96625 9812 True 8.79475 9812 17.1715 9812 225 7.694 -0.0002 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch438_read26_strand.fast5 76a5b578-7c92-458b-9981-437f48b82455 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 438 160.71825 55.85775 31896 True 0.03975 31896 55.818 31896 21845 10.004 -0.0002 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch450_read2842_strand.fast5 26cfa987-1a6d-4137-b4b7-19f84f990bfc 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 450 362.60825 76.74075 43851 True 0.0 43851 76.74075 43851 29248 10.348 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_10881_ch151_read88_strand.fast5 6e2f5cdb-c978-4403-9611-4faaa35722f8 a3f8b1fb56e77905d115a86ef283e1f838d7476d 151 184.193 8.241 4709 True 0.0 4709 8.241 4709 2638 10.235 -0.0004 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch402_read37_strand.fast5 32762878-4ef4-4f27-bfcd-5fe902fb6497 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 402 250.694 77.26225 25086 True 33.3605 25086 43.90175 25086 16574 11.969 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_10881_ch206_read39_strand.fast5 d52c84b1-7a31-4639-b41e-cf5847681395 a3f8b1fb56e77905d115a86ef283e1f838d7476d 206 164.9445 36.5865 20906 True 0.0 20906 36.5865 20906 10700 7.348 -0.0003 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch174_read239_strand.fast5 c61d655a-fa49-4376-a266-d1710fffdc60 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 174 140.031 20.596 11726 True 0.07425 11726 20.52175 11726 5285 7.139 -0.0003 +nanopore2_20170302_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_10881_ch240_read28_strand.fast5 e32e01c1-79ad-4436-96a6-afb4414bccab a3f8b1fb56e77905d115a86ef283e1f838d7476d 240 96.7155 34.78475 3500 True 28.65875 3500 6.126 3500 2284 11.446 -0.0003 +nanopore2_20170302_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_10881_ch461_read3_strand.fast5 d7c4f400-faf1-4574-933c-14cfe563ecdb a3f8b1fb56e77905d115a86ef283e1f838d7476d 461 22.223 40.1695 1803 True 37.0135 1803 3.156 1803 1216 11.478 -0.0006 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch142_read28_strand.fast5 0a779938-c2f0-4fe9-937b-19b8172322b3 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 142 152.8475 63.728 36416 True 0.0 36416 63.728 36416 22419 10.38 -0.0002 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch220_read62_strand.fast5 53d223e3-8341-4fb2-82a9-534b29d917f0 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 220 250.694 22.03525 10606 True 3.47325 10606 18.562 10606 7053 12.447 -0.0003 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch17_read37_strand.fast5 6cd9b908-7d7c-4df2-887b-557631f4ecc4 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 17 320.315 7.64125 4343 True 0.04025 4343 7.601 4343 1726 10.341 -0.0005 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch119_read68_strand.fast5 c1050d07-d676-4f09-bb50-5af9a0d36719 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 119 274.408 2.05275 1157 True 0.02775 1157 2.025 1157 804 11.135 -0.0024 +nanopore2_20170302_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_10881_ch260_read26_strand.fast5 e681ea0c-485a-4170-bb87-13e86878f0d5 a3f8b1fb56e77905d115a86ef283e1f838d7476d 260 280.141 2.97125 1281 True 0.728 1281 2.24325 1281 750 7.439 -0.0013 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch427_read24_strand.fast5 e4208eb0-c817-4512-a0d6-3472748d09a3 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 427 125.59 12.975 7397 True 0.02925 7397 12.94575 7397 4747 12.276 -0.0001 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch507_read3_strand.fast5 cd6e4550-22d9-49e5-8d4a-dc2d54eb78b9 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 507 22.127 64.9935 23188 True 24.41425 23188 40.57925 23188 5082 10.188 -0.0003 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch144_read32_strand.fast5 1ba73b61-7f74-46ce-acbe-643b8946ee07 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 144 147.0335 4.7515 2698 True 0.0285 2698 4.723 2698 1895 10.679 -0.0003 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch222_read21_strand.fast5 a045f9b2-93dd-467f-a7d9-ceb6d72a4f67 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 222 130.9055 1.071 612 True 0.0 612 1.071 612 392 7.268 -0.0036 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch363_read164_strand.fast5 49e5d9e0-b87d-4bb2-867b-fbc6a321bcf8 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 363 431.1165 8.23225 4674 True 0.05125 4674 8.181 4674 3212 11.092 -0.0001 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch170_read40_strand.fast5 7d15ba0b-67c8-4307-961e-5ddeb79b1056 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 170 232.9605 17.50725 9980 True 0.0415 9980 17.46575 9980 5658 10.647 -0.0002 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch410_read30_strand.fast5 a7fc1f72-648d-471e-87f9-e2186b246627 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 410 141.0205 5.52325 3140 True 0.02725 3140 5.496 3140 1913 11.971 -0.0003 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch349_read69_strand.fast5 17df9262-7bf6-4711-bc7d-a0569f473cd3 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 349 307.5495 20.40675 11647 True 0.02425 11647 20.3825 11647 7829 12.098 -0.0004 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch10_read65_strand.fast5 1bc8d128-eed3-41c2-baea-3ca8cd9f0dc9 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 10 250.694 35.269 9451 True 18.72825 9451 16.54075 9451 6468 10.704 -0.0002 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch67_read26_strand.fast5 09437fae-3ba4-40cd-b02a-40b67a067ffe 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 67 127.99425 10.7565 6059 True 0.15325 6059 10.60325 6059 4117 9.926 -0.0004 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch234_read31_strand.fast5 30a2e325-06d5-4c30-843c-153da097c13b 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 234 129.3055 9.26275 5270 True 0.04 5270 9.22275 5270 3704 11.268 -0.0005 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch237_read27_strand.fast5 740be0f7-60f5-4fc5-96d9-225eda8ff83e 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 237 250.6935 35.98925 15850 True 8.251 15850 27.73825 15850 10192 11.631 -0.0002 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch464_read31_strand.fast5 b298c02b-4e8e-4636-b7d2-4920b7e8c292 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 464 157.44275 12.122 6913 True 0.02375 6913 12.09825 6913 4148 10.846 -0.0003 +nanopore2_20170302_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_10881_ch192_read3_strand.fast5 7dd06578-5b15-4485-988f-b039a2d86ead a3f8b1fb56e77905d115a86ef283e1f838d7476d 192 22.223 40.16925 21038 True 3.35275 21038 36.8165 21038 8534 8.957 -0.0003 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch507_read7_strand.fast5 94b3ba2e-2cc3-4a7c-a319-9b1bf976aeff 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 507 98.27225 5.3885 3073 True 0.01025 3073 5.37825 3073 1819 10.48 -0.0006 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch170_read42_strand.fast5 3eec21b1-872f-480b-8d11-daa41209338b 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 170 250.694 77.2625 44150 True 0.0 44150 77.2625 44150 24787 11.046 -0.0002 +nanopore2_20170302_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_10881_ch212_read68_strand.fast5 778f7330-179c-42f3-bdfe-f7c5ccddea01 a3f8b1fb56e77905d115a86ef283e1f838d7476d 212 164.93525 36.59575 20911 True 0.0 20911 36.59575 20911 14734 11.492 -0.0002 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch406_read32_strand.fast5 1592d38b-2bec-4892-8021-1a51507c6327 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 406 250.69425 77.26175 35190 True 15.6785 35190 61.58325 35190 19989 8.682 -0.0002 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch226_read66_strand.fast5 5f428477-799c-443a-986f-2ebd5b84ab18 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 226 351.44525 10.95275 6253 True 0.00925 6253 10.9435 6253 3877 11.287 -0.0004 +nanopore2_20170303_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_26713_ch275_read39_strand.fast5 890ec449-f329-40c8-9e57-f4eb2c358b4c 9ff0fede59c6669aa7f0d860aa73a4f0959d4b99 275 250.69425 8.092 4624 True 0.0 4624 8.092 4624 3122 12.351 -0.0005 +nanopore2_20170302_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_10881_ch466_read71_strand.fast5 db1765d2-0daa-4154-9a6d-6aed0cb13803 a3f8b1fb56e77905d115a86ef283e1f838d7476d 466 217.31975 17.3305 7267 True 4.6125 7267 12.718 7267 4838 11.926 -0.0003 +nanopore2_20170302_FNFAF09967_MN17024_mux_scan_170301_MG1655_PC_RAD002_10881_ch212_read32_strand.fast5 56ab6b26-7b8f-4447-93b8-331d2dea9a99 a3f8b1fb56e77905d115a86ef283e1f838d7476d 212 94.6505 1.855 1048 True 0.02075 1048 1.83425 1048 759 12.249 -0.0014 diff --git a/src/nanoplot/test_data/test.bam b/src/nanoplot/test_data/test.bam new file mode 100644 index 00000000..041bceb9 Binary files /dev/null and b/src/nanoplot/test_data/test.bam differ diff --git a/src/nanoplot/test_data/test.bam.bai b/src/nanoplot/test_data/test.bam.bai new file mode 100644 index 00000000..1bf27ec2 Binary files /dev/null and b/src/nanoplot/test_data/test.bam.bai differ diff --git a/src/nanoplot/test_data/test.fasta b/src/nanoplot/test_data/test.fasta new file mode 100644 index 00000000..78c66827 --- /dev/null +++ b/src/nanoplot/test_data/test.fasta @@ -0,0 +1,35 @@ +>640612206 slice:0-298 +TTTCTATTTGCCATTCATACCACCTAGTCTCGTTTAAACAGGTCGCGTG +TATAGACCTTGTCCGCCACGTCCGCGAGCTCGTCGCTCCAGCGGTTGGC +GACGATCACGTCGCAGCCGGCCTTGAAGGCCTCCAGGTCGTGCGTGACC +TCGGAGCCGAAAAACTCCGGCGCGTCCAGCGTGGGCTCGTAGACCACCA +CGGGCACGCCCTTGGCTTTCACGCGCTTCATGACGCCCTGGATGGAGCT +CGCGCGGAAGTTGTCGGAGTTGGACTTCATCGTCAGGCGGTACACGCCC +>640612206 slice:15000-15298 +GCTTTTACCTGCGGTTTTAATATCACCAAAATGCCTGTGGTTGAGATCA +TTCAATTCGTCGTAGTAAACCGAAGTACTTTTGTTTGGCTACAAACAGT +ATCGGTATAGGCGATTATGAATATCGCTATAATTTGGATGGTAAAACGA +TTTTCTAGGACAACCGTTCGCCGATGGTAAACGGATGTTGTTTATACAG +CCTGTGTACAACAGATATACTTACATCCTGTGCGTAAAGCCCATGGCCA +GCAGGCCATGATTCTATCGAACTGGACCGTACTATGAGATTGATACACA +>640612206 slice:30000-30298 +GAACCAACAGCGACAGCAGCGTCAACAACGACAGCAGCACCAGGCAAAC +GGCAATGCGCCCAAGCAGCCCCCCACGCACGCTCGAGGCGATCGCGGCC +CCGCGCGCAAGTCCGCCGGCAACAATAAGTCGGGCAAAAAGACGACGCT +CTTTGTCGTCCTGGGTCTAATCGTCATTGTCTATATCGTTGGCGTCGTA +GCATTTTCGCAGGTAGCCTACCCCAACACCATCATCGCCGGCGTCGACG +TCTCGTTCTCTAACGCTTCGTCTGCCGCCACCAAGGTCAACTCGGCTTG +>640612206 slice:45000-45298 +TCCTCGTAGTAGAACGAGAACGCCTCGTCACGCGCGACGGCGATGATGG +GCCGCGCTCCCGCGATCGGCTCAAACCGGTAAGGTTCCTCGCAGATATC +GGGTGCCGTCGCCGCTATTTCGAGCAAGCGGTCGACGTCGACGCTCTTT +TCCACCAGCTCGGCCATCTTATCGATGCGCGCGGAGAGCTGCTCCACCT +CGTCGGCGGTCACAAGCCCCAGATGCCGGCTTTCGAGCGAGAACGCCTC +GTCGGCGGGGATATTCCCCAAAACCGCGACGCCCGTGTGCTTCTCGATC +>640612206 slice:60000-60298 +TCGGCACGCTTAAGGTCCATGAGCTCGTCAATCAGGCGGGCCGTGTCGA +CGCCCTCACCCGAAAGCGCGCGCATCATATTGAGCAGGCAGGAGCGCTC +GGGGCGCAGCGGCTTGTCGTGATATTTGATGAGCAGGCACACGTCGCGC +ACCAGGTCGTGCGAGAGCGCCAGGCGATCCATAATGACGCGCGCTTTCT +TGGCGCCGAGCTCGGGATGACCGTAGAAGTGTCCGCTGCCGGCGTGATC +GACCGTGAAACACTCGGGCTTGGACACATCGTGCAAAAACGCCGCCCAC diff --git a/src/nanoplot/test_data/test1.fastq b/src/nanoplot/test_data/test1.fastq new file mode 100644 index 00000000..f262027d --- /dev/null +++ b/src/nanoplot/test_data/test1.fastq @@ -0,0 +1,49 @@ +@read_1 +TCCTAAGTTCGTTGGTTCAAGCCTCGCTTGCCAACGGCGCATGTCAGACCCGATGGAGTAGTGCACCGGA ++ +MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM + +@read_2 +CCAGGACCAACAGAGTCTCTCAATACCGAGGCTGCGGAGGTAAAATACATCTACTCGAAGAAGAAAAAGCCGTACTACGTTTGTT ++ +00000000))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) + +@read_3 +AAAAGCGGATCGGGTTGGTGGTTCCTCGAAGAGATTTGAATGGCACAATTCTCACAGCGGCTGACCCCGATATAGCCAAGTCAAATCATACGGTT ++ +/////////////////////////////////////////////////////////////////////////////////////////////// + +@read_4 +GTTCGGAGATCAGAAAGAGAAACCCAACAAAGAGATGGCTCTA ++ +@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ + +@read_5 +GCTCCACCCAACATTGAACGACCCCCAACTTAATATGCTTGGG ++ +4444444444444444444444444444444444444444444 + +@read_6 +AGCTATCACGTTAAATATATCAAACCCCTCGGTGAAAAGCAAGGCTCCGGTTAGCACGCCACGCTTAAGTAATTAGCTACCTAGTT ++ +22222222222222222222222222222222222222222222222222222222222222222222222222222222222222 + +@read_7 +GGCACTCCATCACCGTACTTAACCTGTAAGTTACCTCGCCGAGCAAA ++ +99999999999999999999999999999999999999999999999 + +@read_8 +CAGACTACTGGCAGACATCGGAAATGCCTTGCCTCGGTTTCGCTGTAGCGGT ++ +GGGGGGGGGGKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK + +@read_9 +AACGTTAAAGCAGGGACGCGTGTTCCCTCCGA ++ +DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD + +@read_10 +ACTGGTATGTCGTGGTACCCTTGA ++ +111111111111111111111111 \ No newline at end of file diff --git a/src/nanoplot/test_data/test2.fastq b/src/nanoplot/test_data/test2.fastq new file mode 100644 index 00000000..b9283728 --- /dev/null +++ b/src/nanoplot/test_data/test2.fastq @@ -0,0 +1,34 @@ +@read_1 +TCAGGATCCGACCGTTTTGG ++ +55555555555555555555 + +@read_2 +CGTCAGGTCTTAATGTCGTGGTTGTGATTGTTAATAATATACTCTATGTTC ++ +777777777777777777777777777777777777777777777777777 + +@read_3 +GCTATCTTCCGAAAGAGGCTATTTCAGGTCCTTCGTGGCTCGCCACTTAT ++ +22222222222222222222222222222222222222222222222222 + +@read_4 +ACGGGATCGCCGGTCCATACTGGTTCGGGAACCTCTCTAACTTAACCATGAGAGGTTCGAGTCC ++ +MMMMMMMMMMMMMMMMMMMMKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK + +@read_5 +ATTTCTAAGTCTGTGGCTTATGGACTGGCTCCATGCTCGGGCTGGTATACCGTT ++ +'''''''''''''''''''''''''''''''''''''''''''''''''''''' + +@read_6 +CAAAGCCGACCCAAATATTTTCCTAGCCTCTCACCCCGTAGTCGCTCGACCGTCACTGTTCCCTTATCATATTACACTCTG ++ +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + +@read_7 +AATAAAGCCCGTTCCACACTTTAGCAATGTCAAGACTGTATCATCGACAGCGGTAGTTATGTAGCCAGCACATTTCATTACCCCCTCGC ++ +77777777777777777777777777777777777777777777777777777777777777777777777777777777777777777 \ No newline at end of file diff --git a/src/nanoplot/test_data/test_rich.fastq b/src/nanoplot/test_data/test_rich.fastq new file mode 100644 index 00000000..d47af6ae --- /dev/null +++ b/src/nanoplot/test_data/test_rich.fastq @@ -0,0 +1,40 @@ +@32e13a1c-4171-4706-b6ce-a32c0f65fa16 runid=5a21d8a6996146deceeaea3784244c52741cae93 read=9 ch=282 start_time=2021-04-20T17:00:40Z flow_cell_id=FAP67897 protocol_group_id=2021-04-20_UKBC sample_id=RNAsst10002_spike_BA barcode=unclassified barcode_alias=unclassified +GATCTGGGTGTTTTAACTTGATCCCGCTAATGGCTTCTAACTTCGTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTCGTGCGCCGCTTCACATGTTACCTTCTTCATCTACAATAAAATTGTTGATGAGCCCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACAATTTATGATGAACCGACGACGACTACCAGTGCCTTTGTAAGCACAGCTGATGAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACACGTTAATAGTTAATAGCGTACTTCTTTTG ++ +$#$#%&).6/*.-,,'##$.)*46$$$,$$;77;?B=6::<<>::9<228;<>DA;A<7>@=6.550.47===>0095731+0;667?==>C@A79??6;.7/*++-1')69<=>>>??AD@=@8:?=@?GDC>A:50# +@b87f011e-b802-4993-8f56-fd240b2e784f runid=5a21d8a6996146deceeaea3784244c52741cae93 read=19 ch=213 start_time=2021-04-20T17:00:41Z flow_cell_id=FAP67897 protocol_group_id=2021-04-20_UKBC sample_id=RNAsst10002_spike_BA barcode=unclassified barcode_alias=unclassified +TTGTACTTCGTTCGGTGCAGATGGTGTTTAACCTCAATCAAAGACGACAGGTGTTTTCGCATTTATCGTGAAACGCTTTCGCCCAGCATTTTCGTCCCGCCACTTCACTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAACTTCACAACTGCTCCTGCCATTTGTCTGGAAACACTTTCTGTGAAGGTGTCTTTGTTTCAAGTAAACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACACACAACATTTGTGTCTGGTAACTGTGATGTTGCTTAGCGGAATTGTCAACAACACAGTTTATGATCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACGTACCAGATGTTGGTTGGGAA ++ +%&$&#&'('*,-.'))%%$%#%%'2157//+2/037764-+*(*)''&((496;@<4,'(**.1+++(*))6:6).-///%&*&''(&(+++('($&$'((($$%%%&%.,.004+31211.++,..534;;8<6;)53430(,9<54/8958./0/-'&'**/84/42*'(*,*+3343.'$#/06350>678;>>9>C59/0&&''&&(%%#(17'$-20//557-&),+-1;::6878840,1())78<>D;8<:4'8:;=>/<;;=0'143//../(+)%2435(0*'$$(($$$'%))*-/0+-21-*'''90<-'+-//.$,('.)))%.$%'+2+++,==>=<:=<74-&')/740.-.485776<87-.699::0//4'&)7=;:7623-%&0*%'%## +@6f64aedb-bb8e-4777-b494-43e661841e06 runid=5a21d8a6996146deceeaea3784244c52741cae93 read=13 ch=67 start_time=2021-04-20T17:00:41Z flow_cell_id=FAP67897 protocol_group_id=2021-04-20_UKBC sample_id=RNAsst10002_spike_BA barcode=unclassified barcode_alias=unclassified +ATAGCCGCCGTTCATTGCATCTTAACGCGTTCAGTTATATTTGTTGGAATTGTTTAACCCTTATCCAGGGTTTAACCAGCAACTTTGTTTTCGCATTTATCGTGAAAACGCTTTCGCGTTTTCAATTGCGCCGCTTCAACATTACAAATACCATTTGCTATGCAAATGGCTTATAGATTTAATGGTATTGGAGTTACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAA ++ +&%$'(($'%,12'(&($$$%&'*&$$')/*..+36(#&#$%$(&'''&((+5870.(&'&%)%57-&((('0*%%#$&%(((&%264;ACC=:ADCD@@B:+-(%&$$$$'''$$&('$(%&&%%&0+6586*057;455&&)1235908>@BABF?D:DBAFGH>;;:>@@;9('$%%)((%%),,,.7.0==<76@<@=A=<;1F=C9A64=>ADEDC9?7<967435>=:<=@EFHIJOKH>=G?D>DAE>?C@C;>:@>>EIG>CD>?H><;HIJ:BDC<>?GDEPIIH=@?7*6AB>DB>??-37>A=AA@A97-. +@c372fb2c-dd45-4feb-81b2-c167c3d1ce93 runid=5a21d8a6996146deceeaea3784244c52741cae93 read=18 ch=337 start_time=2021-04-20T17:00:41Z flow_cell_id=FAP67897 protocol_group_id=2021-04-20_UKBC sample_id=RNAsst10002_spike_BA barcode=unclassified barcode_alias=unclassified +ATACTTCGTTCAGTTATCGAAGGTGGGTGTGGCTTGCTGGTGTGTCCTGACGGTAGGTTCACCATTTATCAGTGAGCATTTCACAGAGTTTTGCACAATTGCGCCCTTCCCCATGGTAGATGGGTAAAGTGGGAGGCATCCTGCAAACCTGCTCTGAAGTGGCAGAACTCCTCTCCCATTCTCTGGACCTGCCATGTGGCCACATCCAGCTTCAGGGAGTTTGGGAGGGCCCAGAAGAAAGAAGGGAAACATTGTGTGGGCACACACCAACCCACCTGTCTCAACTCCCCTCAGCTGGTAACAGGAAGAGAATCCTT ++ +'0%''(&.00,+/0-#&$&&$&&-(,,)(&%&##$#$'%'*(($(*,&*,*(*''+02*&$$%('+&'(&'&('%%$$#'(*$$#&#'#&%$$$$%%%'/'&&&&(,45751(+$&%&&&''*+)675+:35-''&+013*%*2/1,+48:8<:78344(%%64A@71$$&%&),'('%%&%$#$%%))$$##$$$''%%#&##$#$&(('$%%%%%$&%&)%&%,%%#%%&(#&$##($$$$,.+-,*++(%.$$-+5(796:B@7**,%&$$,-*.5,,**%%%&$%%&%,+#&%'))(**))0+255596564:<<>92:<57%*''''$%%%$%'*$$%%%%$%&%.&+)&%#$$%%%&#%((($$%#-,06871)..0,.')1'&&),/04*0%&&%#&87@HF;;B?=?A=9('%&''%)(#%+18-17*976;F<=?ACDAAC=6(;<>@=DBB:;;55780/56675571-73/2*/334653($$(%$%%(&#$)'.--,*+9489>7<3532%%%%&$'$,&/*,&%.,'%./(2-+).,222,'110('*(+(%.6;:88,%&%(($',)/5-234-')&%'.,)$*-22%+++./3;555,'&(+50/%)-23*'$(%++//341-BDF7;:99.((92+%,+)%-+-.&)*&-%&%&&&##'(#$)+29:;3'9>>=>3).001)%$%'%%&-,'&$$#$%$%/(%$$$%-7(0*,$(+*,0162233))*$+$))&&$&###%#&$)10566655-&%%(&''*--''6>AAAAC;:344)@A@B<@;?9)6('',$-)*()0-,000(&%.-)()&%)#$$)$###%%(%).*%)'##(##(%%,)%9=AH==>>?>;?@54G@@9?A<57?A>=@<=<96321-(,.11,*7:9:;A=9B4==?@1+)&&(''++)*/0,,77(3.)++2+ADD9EFI@>.*21/&&&&()4883>>989;.*+/-+,..3,3,,*0,''.2.5/256&*7778*('-**'-/655..,9;=64&%&('**('( +@aa81ca34-9310-42fd-9893-33112e283acc runid=5a21d8a6996146deceeaea3784244c52741cae93 read=19 ch=244 start_time=2021-04-20T17:00:41Z flow_cell_id=FAP67897 protocol_group_id=2021-04-20_UKBC sample_id=RNAsst10002_spike_BA barcode=unclassified barcode_alias=unclassified +TACATGTACTTCGTTCAGGCTAGGTGTTTTTAACCGTAACCTATCGTGTTTCCCCTAGTTTTCGCATTTATCGTGCATTGCTTTCGCGTTTTTCGTGCGCCGCTTCATCTGGCATTAATGCTTCCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATGAATCTCTGTCGATCTCCAAGAACTTGGAAAGTATGACAGTATATAAATGACATGTACATTTGGCTAGGTTTTTATAGCTGGCTTGATTGCCATATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTAACTTTGAAGCAAGGTGAAATCAGGATGCTACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATGCCGATACAAGCCTCACTCCCTTTCGGATGGCTTATTGTTGGCGTTGCACTTCTTGCTGTTTTTCATAGCGCTTCCAAAATCATAACCCTCAAAGAGATGGCAACTAGCACTCTCCAGATTGTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAA ++ +#$$###'(334306/&$&$%+-34>:?CA=;92).&))(48>BD>9A;AAEB;=05014?D:<-4469:5:5*%$$$#'+--1002A;@HLI=999:A/:<3'';ABC@BA::444.')&%$&$,*8@E70::47@AA;=>9)$/33135>>:0>CDDCG=@>H>3<)5/%'116@AB@9;@GHGHFE>DDFAG?B?ANH<87-*%&<54<:@?FF?6BAA8EGA@B?B@AC:<;?68?@D:?A58?>=@87<..37<88>>@2???BA@9:AB???8?GCDCFGBDBFEEDBGE;./66;>:9513/&),,,/&&$##$''1264(%+(326)1<-77AA.C=CEFF=@6=G??DFACBEFHH>,B@>-('14554./(*/(&&%59=<==)44-:;A=2=@==>;@=948;<5<;>E>>>?A?98=;?@=?B@HH222(&39EHEFGIG@=>--@@HF>=A51%.6;@BC>@22;($:.("$$$#&#'$%(35)6$547??DDD8J@@BF?EF@FF@CAA54&& +@c746fb2f-78f6-4a0a-9c75-39465c855c8d runid=5a21d8a6996146deceeaea3784244c52741cae93 read=35 ch=379 start_time=2021-04-20T17:00:42Z flow_cell_id=FAP67897 protocol_group_id=2021-04-20_UKBC sample_id=RNAsst10002_spike_BA barcode=unclassified barcode_alias=unclassified +GTCATGGCGCTGGTTCAGCTCGATCTTGTACTTCGTTCCAGTTCAGTGGGTGTTTAACGAGTGGAAAAGGCTGGAGACCGTTTTCGCATTTATCGTTTCGCGTTTTTCGTGCGCCGCTTCATTGTTTGATGAAGCCAGCATCTCGTGTCACTTTGTTGAAAATGAATCTTCAATAAATGACCTCTTGCTTA ++ +%,)$$%'+**)()-**&$&(-))*)$$$&&&&&*02751.,$(%#$&$&%+'+,)#&&)(*/)-0/.,--8.-+(.2489>@@80%%*-.-//)+%%969@@ADGD>86;')*78587:?=ED@FGGECC>9.562.9:79.'&%**$*0357;49<5363''$$6;9;>18;:;:$8:980:<=<+00/$ +@99a108d2-8e72-42bf-bebf-ad8373cfe450 runid=5a21d8a6996146deceeaea3784244c52741cae93 read=38 ch=177 start_time=2021-04-20T17:00:42Z flow_cell_id=FAP67897 protocol_group_id=2021-04-20_UKBC sample_id=RNAsst10002_spike_BA barcode=unclassified barcode_alias=unclassified +TGTGGCCTTTTAATTCAGTTACTGATTTGGTGTTTAACCTCGCCACACTCATAGAGGTCACACGGTGTCGCATTTATGAAACGCTTTCGCGCGTTTTTCGTGCGCCACTTCACTGAAAAATGCATTAGGTAAAAGACTGTGGCTAGCATTACACAGTTACTTCACTTCAGACTATTACCGACATACTCAACTCAATTGGTGCAGACATAAGTGTTGAACATATTTACCTTCTTCATCTACAATAAAATTGATGATGAACCTGAAAATTTATGTCCAAATTCCACTAATCGACGGTTCATCAGGTTGACCCAATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACAGACTTGTAGCACTCATTCGTTTCGGGAAGAGACAGGTACGTTAATAGTTAACTTAATATGCTTCTTTT ++ +($.((('&'&$$(()#$'*'##%#%$%++,/.*+)435256573%14=90,)'$%-),-%)%&$''%(&$&')/.++(*,)((&&)).''%564=A?<777/..00(8898:5.14314.))'&')%)7:>?6/);7,/&&%%*($')-3)%'&%&4;:=??::6<;99894&$%'&'&%#%%&%*0565@?90-01%(+&&%$$$%'&**5358$$3.-6((@B<<@BGBEDBAKDDC?DE@B=6)**,$/)&%''$-'((,('&$&$%%445;47//8-($$$')('()(&/79.66)%0(('&&&,,12/:4224<=??C@>9;%=ACFCB=<>3/,-55++'$'/4;A87:A@?;(1+7846??>;><:@A@;?A.,,7-*+-..-%%%(+00:979<75*-DAB(,45.(?;<;;9>:4,+%&2.-,$$&&&%#%$**3**0-* +@5d01447f-f17b-4acb-b87e-d60d8aeeccc8 runid=5a21d8a6996146deceeaea3784244c52741cae93 read=21 ch=417 start_time=2021-04-20T17:00:41Z flow_cell_id=FAP67897 protocol_group_id=2021-04-20_UKBC sample_id=RNAsst10002_spike_BA barcode=unclassified barcode_alias=unclassified +ATGATGGCCTTCTAGATTTCAGGCATTTGGTGTTTAACCCGACGTAAGTGGTTTTCGCATTTATCGTGGCTTTCGCGTTTTTCGTTGCCGCTTCATTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAGACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCGGATTTTTGTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAATAAGACAAAAACACCCAAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCGCCAATTAAAGATTTTGGTGGTTTAATTTTTCACAAATATTGTAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCCATCAAACAATATGGTGATTGCCTTGGTGATATTGCTGCTAGGGCCATTTGTGCACAAAGTTTAGCGGCCTTACTGTTTTGCCACCTTGCTCACAGATGAAATGACCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATGCTATAGAGTTTAATGGTATTGAGTTACA ++ +(*+*+''%&),$&&%%%+(($)(&$#&%$&3*/2-/.($(%%&(()&,*)-2>?<6096688'<-1,++1/28277;@?996*,+)%%%&148456;A9=?=>==E?>=C@>:4326=IJGBFILJBAB54831($%)+%'$148;86744.21312BH???>GCFGK@C?BC<*(2$(.045?@6CB8?=<;@A:*=>>>90146>>:@A?AA:GHGFF>,./0.'&%(%%)4ABEFRQOHFGBGCG=8,=@CEEFDEAC38/5#%1.11/241-/,-/0-174+)39=DB>791;=@>B@?>;;?B:===;?45<942246*>ABCDBA<><66?>AGHG:C@BBA?==::1.-/.21016.1&%('$&*.'<78..==3-?A@:%?7:ADCF/EE?>BB=21:8?3=?,,.),2>@AA;8:=6220143=:32>?DJIGE=>D;?8,++,.)**2::358=@?>==6882424;<<;+/0,).166($-&+--/67?@==GEFHEFA8962-%#%(%%%$'&<:77C=<><>?@*=<>:;% +@b0279f8e-e988-44c5-895f-201b68217623 runid=5a21d8a6996146deceeaea3784244c52741cae93 read=32 ch=435 start_time=2021-04-20T17:00:43Z flow_cell_id=FAP67897 protocol_group_id=2021-04-20_UKBC sample_id=RNAsst10002_spike_BA barcode=unclassified barcode_alias=unclassified +AAATCATGGCCACTTCGTTCAGTTACGGAAAGGTAAGATTGTTTAACCGTCGATACTGGTTCTCATGGACCGCATTTATCGTGAAGCGCTTTCGCGCGTTTTCGTCGCCCGCTTCATGAAAATTAAAACCACCAAAATCTTTAATTGAATTTTGGTGTTTTGTAAATTTGTTTGACTTGTGCAAAAACTTCTTGGGTGTTTTTGTCTTGTTCAACAGCTATTCCAGTTAAAG ++ +('&.-'&&(((&**+'-./-,-/0&%&&**-,,*.03..77<>CAB??;@6542,+**&%)$(($%%&%$$#%&')-094)'%'($%$&.12..($44871.+()#%*-(*,2648A?GFA?-CCBC9:@11?@B@=69AA:+++,,###%(*14:6<<<4.4=;99:A=>=/33365%+#%9;BC<8GH>BCC3=96>>GLIBAA812+:&<><;<8-'.::;;0' diff --git a/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml index 72ea0a76..332fbc1a 100644 --- a/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml @@ -235,9 +235,9 @@ build_info: output: "target/executable/agat/agat_convert_bed2gff" executable: "target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff b/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff index c795d7ea..e9bcd569 100755 --- a/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff +++ b/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff @@ -515,9 +515,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_bed2gff" -LABEL org.opencontainers.image.created="2024-10-18T09:18:56Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:51Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml index e383351e..b2789c79 100644 --- a/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml @@ -225,9 +225,9 @@ build_info: output: "target/executable/agat/agat_convert_embl2gff" executable: "target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff b/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff index 20986469..4479c304 100755 --- a/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff +++ b/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff @@ -505,9 +505,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_embl2gff" -LABEL org.opencontainers.image.created="2024-10-18T09:18:55Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:50Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml index f271bd7b..f0d739ae 100644 --- a/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml @@ -230,9 +230,9 @@ build_info: output: "target/executable/agat/agat_convert_genscan2gff" executable: "target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff b/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff index 2de031e0..d98c860e 100755 --- a/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff +++ b/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff @@ -514,9 +514,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_genscan2gff" -LABEL org.opencontainers.image.created="2024-10-18T09:18:55Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:49Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml b/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml index 3fc459ca..c2b37924 100644 --- a/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml @@ -228,9 +228,9 @@ build_info: output: "target/executable/agat/agat_convert_sp_gff2gtf" executable: "target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf b/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf index 4c687bda..09260d50 100755 --- a/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf +++ b/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf @@ -519,9 +519,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2gtf" -LABEL org.opencontainers.image.created="2024-10-18T09:18:56Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:50Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml b/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml index 4e108d35..2c2a5abf 100644 --- a/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml @@ -188,9 +188,9 @@ build_info: output: "target/executable/agat/agat_convert_sp_gff2tsv" executable: "target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv b/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv index 7d3bc5c7..47d12126 100755 --- a/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv +++ b/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv @@ -484,9 +484,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2tsv" -LABEL org.opencontainers.image.created="2024-10-18T09:18:55Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:50Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml b/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml index 851308b8..550a5ca9 100644 --- a/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml @@ -195,9 +195,9 @@ build_info: output: "target/executable/agat/agat_convert_sp_gxf2gxf" executable: "target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf b/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf index 8d081218..c8aae341 100755 --- a/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf +++ b/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf @@ -493,9 +493,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gxf2gxf" -LABEL org.opencontainers.image.created="2024-10-18T09:18:54Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:49Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/arriba/.config.vsh.yaml b/target/executable/arriba/.config.vsh.yaml index ce6efbe2..df6a366b 100644 --- a/target/executable/arriba/.config.vsh.yaml +++ b/target/executable/arriba/.config.vsh.yaml @@ -706,9 +706,9 @@ build_info: output: "target/executable/arriba" executable: "target/executable/arriba/arriba" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/arriba/arriba b/target/executable/arriba/arriba index 40059e2c..d7e74f06 100755 --- a/target/executable/arriba/arriba +++ b/target/executable/arriba/arriba @@ -754,9 +754,9 @@ RUN arriba -h | grep 'Version:' 2>&1 | sed 's/Version:\s\(.*\)/arriba: "\1"/' > LABEL org.opencontainers.image.authors="Robrecht Cannoodt" LABEL org.opencontainers.image.description="Companion container for running component arriba" -LABEL org.opencontainers.image.created="2024-10-18T09:18:56Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:51Z" LABEL org.opencontainers.image.source="https://github.com/suhrig/arriba" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml b/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml index 39893010..34a88214 100644 --- a/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml +++ b/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml @@ -359,9 +359,9 @@ build_info: output: "target/executable/bbmap/bbmap_bbsplit" executable: "target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit b/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit index c99ceb0c..b61d5c25 100755 --- a/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit +++ b/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit @@ -600,9 +600,9 @@ cp -r bbmap/* /usr/local/bin RUN bbsplit.sh --version 2>&1 | awk '/BBMap version/{print "BBMAP:", $NF}' > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component bbmap bbmap_bbsplit" -LABEL org.opencontainers.image.created="2024-10-18T09:18:59Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:54Z" LABEL org.opencontainers.image.source="https://github.com/BioInfoTools/BBMap/blob/master/sh/bbsplit.sh" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml b/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml index 6c8beba1..fe77f5eb 100644 --- a/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml @@ -469,9 +469,9 @@ build_info: output: "target/executable/bcftools/bcftools_annotate" executable: "target/executable/bcftools/bcftools_annotate/bcftools_annotate" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_annotate/bcftools_annotate b/target/executable/bcftools/bcftools_annotate/bcftools_annotate index 6eef6eec..9635826b 100755 --- a/target/executable/bcftools/bcftools_annotate/bcftools_annotate +++ b/target/executable/bcftools/bcftools_annotate/bcftools_annotate @@ -650,9 +650,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_annotate" -LABEL org.opencontainers.image.created="2024-10-18T09:18:48Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:42Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_concat/.config.vsh.yaml b/target/executable/bcftools/bcftools_concat/.config.vsh.yaml index 6576e69f..067851d0 100644 --- a/target/executable/bcftools/bcftools_concat/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_concat/.config.vsh.yaml @@ -335,9 +335,9 @@ build_info: output: "target/executable/bcftools/bcftools_concat" executable: "target/executable/bcftools/bcftools_concat/bcftools_concat" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_concat/bcftools_concat b/target/executable/bcftools/bcftools_concat/bcftools_concat index 256e1fda..84c4ddb6 100755 --- a/target/executable/bcftools/bcftools_concat/bcftools_concat +++ b/target/executable/bcftools/bcftools_concat/bcftools_concat @@ -566,9 +566,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_concat" -LABEL org.opencontainers.image.created="2024-10-18T09:18:49Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:43Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_norm/.config.vsh.yaml b/target/executable/bcftools/bcftools_norm/.config.vsh.yaml index 698c91bb..7dc50335 100644 --- a/target/executable/bcftools/bcftools_norm/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_norm/.config.vsh.yaml @@ -416,9 +416,9 @@ build_info: output: "target/executable/bcftools/bcftools_norm" executable: "target/executable/bcftools/bcftools_norm/bcftools_norm" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_norm/bcftools_norm b/target/executable/bcftools/bcftools_norm/bcftools_norm index 7b31c47e..5da999b0 100755 --- a/target/executable/bcftools/bcftools_norm/bcftools_norm +++ b/target/executable/bcftools/bcftools_norm/bcftools_norm @@ -589,9 +589,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_norm" -LABEL org.opencontainers.image.created="2024-10-18T09:18:49Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:44Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_sort/.config.vsh.yaml b/target/executable/bcftools/bcftools_sort/.config.vsh.yaml index 589abfe4..a52af99d 100644 --- a/target/executable/bcftools/bcftools_sort/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_sort/.config.vsh.yaml @@ -185,9 +185,9 @@ build_info: output: "target/executable/bcftools/bcftools_sort" executable: "target/executable/bcftools/bcftools_sort/bcftools_sort" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_sort/bcftools_sort b/target/executable/bcftools/bcftools_sort/bcftools_sort index 2bf2161b..7108f710 100755 --- a/target/executable/bcftools/bcftools_sort/bcftools_sort +++ b/target/executable/bcftools/bcftools_sort/bcftools_sort @@ -483,9 +483,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_sort" -LABEL org.opencontainers.image.created="2024-10-18T09:18:49Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:44Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_stats/.config.vsh.yaml b/target/executable/bcftools/bcftools_stats/.config.vsh.yaml index 6d66b211..a6d63527 100644 --- a/target/executable/bcftools/bcftools_stats/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_stats/.config.vsh.yaml @@ -458,9 +458,9 @@ build_info: output: "target/executable/bcftools/bcftools_stats" executable: "target/executable/bcftools/bcftools_stats/bcftools_stats" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_stats/bcftools_stats b/target/executable/bcftools/bcftools_stats/bcftools_stats index 5f0955b4..8c9179b3 100755 --- a/target/executable/bcftools/bcftools_stats/bcftools_stats +++ b/target/executable/bcftools/bcftools_stats/bcftools_stats @@ -626,9 +626,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_stats" -LABEL org.opencontainers.image.created="2024-10-18T09:18:48Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:43Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcl_convert/.config.vsh.yaml b/target/executable/bcl_convert/.config.vsh.yaml index 91ca5897..2c48e103 100644 --- a/target/executable/bcl_convert/.config.vsh.yaml +++ b/target/executable/bcl_convert/.config.vsh.yaml @@ -418,9 +418,9 @@ build_info: output: "target/executable/bcl_convert" executable: "target/executable/bcl_convert/bcl_convert" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcl_convert/bcl_convert b/target/executable/bcl_convert/bcl_convert index 066aa6eb..c2c246eb 100755 --- a/target/executable/bcl_convert/bcl_convert +++ b/target/executable/bcl_convert/bcl_convert @@ -599,9 +599,9 @@ RUN echo "bcl-convert: \"$(bcl-convert -V 2>&1 >/dev/null | sed -n '/Version/ s/ LABEL org.opencontainers.image.authors="Toni Verbeiren, Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component bcl_convert" -LABEL org.opencontainers.image.created="2024-10-18T09:18:54Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:49Z" LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml index 38d2a62a..4b59fbbd 100644 --- a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml +++ b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml @@ -274,9 +274,9 @@ build_info: output: "target/executable/bd_rhapsody/bd_rhapsody_make_reference" executable: "target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference index caf59e5c..f533c49a 100755 --- a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference +++ b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference @@ -554,9 +554,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1) RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz" LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_make_reference" -LABEL org.opencontainers.image.created="2024-10-18T09:18:52Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:46Z" LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1/Extra_Utilities/" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml index 33fab7f9..be8fcc28 100644 --- a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml +++ b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml @@ -1115,9 +1115,9 @@ build_info: output: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis" executable: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis index eaa8ee43..0998366e 100755 --- a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis +++ b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis @@ -954,9 +954,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1) RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz" LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_sequence_analysis" -LABEL org.opencontainers.image.created="2024-10-18T09:18:52Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:47Z" LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml b/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml index 97e5273b..83022dce 100644 --- a/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml @@ -187,9 +187,9 @@ build_info: output: "target/executable/bedtools/bedtools_bamtofastq" executable: "target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq b/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq index a33b13c1..d6e24e86 100755 --- a/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq +++ b/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq @@ -483,9 +483,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bamtofastq" -LABEL org.opencontainers.image.created="2024-10-18T09:18:55Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:50Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml b/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml index b7c7761c..f3365365 100644 --- a/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml @@ -176,9 +176,9 @@ build_info: output: "target/executable/bedtools/bedtools_bed12tobed6" executable: "target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6 b/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6 index 2fe07ae9..a20eab99 100755 --- a/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6 +++ b/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6 @@ -480,9 +480,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bed12tobed6" -LABEL org.opencontainers.image.created="2024-10-18T09:18:56Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:51Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml b/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml index 00451084..c282d272 100644 --- a/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml @@ -214,9 +214,9 @@ build_info: output: "target/executable/bedtools/bedtools_bedtobam" executable: "target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam b/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam index 44b1462e..2d836d80 100755 --- a/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam +++ b/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam @@ -496,9 +496,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bedtobam" -LABEL org.opencontainers.image.created="2024-10-18T09:18:58Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:52Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml b/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml index 48c78f3c..e9b45998 100644 --- a/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml @@ -337,9 +337,9 @@ build_info: output: "target/executable/bedtools/bedtools_genomecov" executable: "target/executable/bedtools/bedtools_genomecov/bedtools_genomecov" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov b/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov index 76eb9321..ce018aab 100755 --- a/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov +++ b/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov @@ -591,9 +591,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_genomecov" -LABEL org.opencontainers.image.created="2024-10-18T09:18:55Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:50Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml b/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml index 5475ec26..31ccdbdd 100644 --- a/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml @@ -232,9 +232,9 @@ build_info: output: "target/executable/bedtools/bedtools_getfasta" executable: "target/executable/bedtools/bedtools_getfasta/bedtools_getfasta" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta b/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta index c888d898..1c178cfa 100755 --- a/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta +++ b/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta @@ -526,9 +526,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Dries Schaumont" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_getfasta" -LABEL org.opencontainers.image.created="2024-10-18T09:18:57Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:51Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml b/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml index b29b6285..3a5481b4 100644 --- a/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml @@ -273,9 +273,9 @@ build_info: output: "target/executable/bedtools/bedtools_groupby" executable: "target/executable/bedtools/bedtools_groupby/bedtools_groupby" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_groupby/bedtools_groupby b/target/executable/bedtools/bedtools_groupby/bedtools_groupby index 1fce0870..5f47151f 100755 --- a/target/executable/bedtools/bedtools_groupby/bedtools_groupby +++ b/target/executable/bedtools/bedtools_groupby/bedtools_groupby @@ -552,9 +552,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_groupby" -LABEL org.opencontainers.image.created="2024-10-18T09:18:57Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:51Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml b/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml index 2e32d5fc..b9b22b80 100644 --- a/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml @@ -410,9 +410,9 @@ build_info: output: "target/executable/bedtools/bedtools_intersect" executable: "target/executable/bedtools/bedtools_intersect/bedtools_intersect" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_intersect/bedtools_intersect b/target/executable/bedtools/bedtools_intersect/bedtools_intersect index 4dbdf219..b7ce7ebf 100755 --- a/target/executable/bedtools/bedtools_intersect/bedtools_intersect +++ b/target/executable/bedtools/bedtools_intersect/bedtools_intersect @@ -633,9 +633,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_intersect" -LABEL org.opencontainers.image.created="2024-10-18T09:18:54Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:49Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_links/.config.vsh.yaml b/target/executable/bedtools/bedtools_links/.config.vsh.yaml index 6b5be203..1cc9f689 100644 --- a/target/executable/bedtools/bedtools_links/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_links/.config.vsh.yaml @@ -210,9 +210,9 @@ build_info: output: "target/executable/bedtools/bedtools_links" executable: "target/executable/bedtools/bedtools_links/bedtools_links" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_links/bedtools_links b/target/executable/bedtools/bedtools_links/bedtools_links index 27743834..a2b610c6 100755 --- a/target/executable/bedtools/bedtools_links/bedtools_links +++ b/target/executable/bedtools/bedtools_links/bedtools_links @@ -500,9 +500,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_links" -LABEL org.opencontainers.image.created="2024-10-18T09:18:56Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:50Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_merge/.config.vsh.yaml b/target/executable/bedtools/bedtools_merge/.config.vsh.yaml index ef8c0d37..8eaf6cbb 100644 --- a/target/executable/bedtools/bedtools_merge/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_merge/.config.vsh.yaml @@ -279,9 +279,9 @@ build_info: output: "target/executable/bedtools/bedtools_merge" executable: "target/executable/bedtools/bedtools_merge/bedtools_merge" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_merge/bedtools_merge b/target/executable/bedtools/bedtools_merge/bedtools_merge index 6bd395f7..55b3ce7e 100755 --- a/target/executable/bedtools/bedtools_merge/bedtools_merge +++ b/target/executable/bedtools/bedtools_merge/bedtools_merge @@ -558,9 +558,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_merge" -LABEL org.opencontainers.image.created="2024-10-18T09:18:57Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:51Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_sort/.config.vsh.yaml b/target/executable/bedtools/bedtools_sort/.config.vsh.yaml index 47a81082..dd2b4778 100644 --- a/target/executable/bedtools/bedtools_sort/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_sort/.config.vsh.yaml @@ -222,9 +222,9 @@ build_info: output: "target/executable/bedtools/bedtools_sort" executable: "target/executable/bedtools/bedtools_sort/bedtools_sort" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_sort/bedtools_sort b/target/executable/bedtools/bedtools_sort/bedtools_sort index aa2f0862..bf7292e0 100755 --- a/target/executable/bedtools/bedtools_sort/bedtools_sort +++ b/target/executable/bedtools/bedtools_sort/bedtools_sort @@ -509,9 +509,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_sort" -LABEL org.opencontainers.image.created="2024-10-18T09:18:55Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:49Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/busco/busco_download_datasets/.config.vsh.yaml b/target/executable/busco/busco_download_datasets/.config.vsh.yaml index a65a3b72..1a141d06 100644 --- a/target/executable/busco/busco_download_datasets/.config.vsh.yaml +++ b/target/executable/busco/busco_download_datasets/.config.vsh.yaml @@ -158,9 +158,9 @@ build_info: output: "target/executable/busco/busco_download_datasets" executable: "target/executable/busco/busco_download_datasets/busco_download_datasets" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/busco/busco_download_datasets/busco_download_datasets b/target/executable/busco/busco_download_datasets/busco_download_datasets index a41f8792..108264fe 100755 --- a/target/executable/busco/busco_download_datasets/busco_download_datasets +++ b/target/executable/busco/busco_download_datasets/busco_download_datasets @@ -475,9 +475,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component busco busco_download_datasets" -LABEL org.opencontainers.image.created="2024-10-18T09:18:54Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:49Z" LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/busco/busco_list_datasets/.config.vsh.yaml b/target/executable/busco/busco_list_datasets/.config.vsh.yaml index 79542272..1a605f2e 100644 --- a/target/executable/busco/busco_list_datasets/.config.vsh.yaml +++ b/target/executable/busco/busco_list_datasets/.config.vsh.yaml @@ -145,9 +145,9 @@ build_info: output: "target/executable/busco/busco_list_datasets" executable: "target/executable/busco/busco_list_datasets/busco_list_datasets" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/busco/busco_list_datasets/busco_list_datasets b/target/executable/busco/busco_list_datasets/busco_list_datasets index 49dec20f..9e344194 100755 --- a/target/executable/busco/busco_list_datasets/busco_list_datasets +++ b/target/executable/busco/busco_list_datasets/busco_list_datasets @@ -465,9 +465,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component busco busco_list_datasets" -LABEL org.opencontainers.image.created="2024-10-18T09:18:53Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:48Z" LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/busco/busco_run/.config.vsh.yaml b/target/executable/busco/busco_run/.config.vsh.yaml index 98b45f08..e00af531 100644 --- a/target/executable/busco/busco_run/.config.vsh.yaml +++ b/target/executable/busco/busco_run/.config.vsh.yaml @@ -423,9 +423,9 @@ build_info: output: "target/executable/busco/busco_run" executable: "target/executable/busco/busco_run/busco_run" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/busco/busco_run/busco_run b/target/executable/busco/busco_run/busco_run index 6c943bac..87c8a53a 100755 --- a/target/executable/busco/busco_run/busco_run +++ b/target/executable/busco/busco_run/busco_run @@ -632,9 +632,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component busco busco_run" -LABEL org.opencontainers.image.created="2024-10-18T09:18:53Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:48Z" LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/cutadapt/.config.vsh.yaml b/target/executable/cutadapt/.config.vsh.yaml index 1c2303a4..2581b55d 100644 --- a/target/executable/cutadapt/.config.vsh.yaml +++ b/target/executable/cutadapt/.config.vsh.yaml @@ -740,9 +740,9 @@ build_info: output: "target/executable/cutadapt" executable: "target/executable/cutadapt/cutadapt" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/cutadapt/cutadapt b/target/executable/cutadapt/cutadapt index 7e5feb44..deda9dc7 100755 --- a/target/executable/cutadapt/cutadapt +++ b/target/executable/cutadapt/cutadapt @@ -831,9 +831,9 @@ RUN cutadapt --version | sed 's/\(.*\)/cutadapt: "\1"/' > /var/software_versions LABEL org.opencontainers.image.authors="Toni Verbeiren" LABEL org.opencontainers.image.description="Companion container for running component cutadapt" -LABEL org.opencontainers.image.created="2024-10-18T09:18:45Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:40Z" LABEL org.opencontainers.image.source="https://github.com/marcelm/cutadapt" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/falco/.config.vsh.yaml b/target/executable/falco/.config.vsh.yaml index e8b3ea1c..2faac781 100644 --- a/target/executable/falco/.config.vsh.yaml +++ b/target/executable/falco/.config.vsh.yaml @@ -317,9 +317,9 @@ build_info: output: "target/executable/falco" executable: "target/executable/falco/falco" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/falco/falco b/target/executable/falco/falco index 8cec8837..6f9c17be 100755 --- a/target/executable/falco/falco +++ b/target/executable/falco/falco @@ -589,9 +589,9 @@ RUN echo "falco: \"$(falco -v | sed -n 's/^falco //p')\"" > /var/software_versio LABEL org.opencontainers.image.authors="Toni Verbeiren" LABEL org.opencontainers.image.description="Companion container for running component falco" -LABEL org.opencontainers.image.created="2024-10-18T09:18:47Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:42Z" LABEL org.opencontainers.image.source="https://github.com/smithlabcode/falco" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/fastp/.config.vsh.yaml b/target/executable/fastp/.config.vsh.yaml index fb80d8ad..343a99fe 100644 --- a/target/executable/fastp/.config.vsh.yaml +++ b/target/executable/fastp/.config.vsh.yaml @@ -1083,9 +1083,9 @@ build_info: output: "target/executable/fastp" executable: "target/executable/fastp/fastp" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/fastp/fastp b/target/executable/fastp/fastp index aa86be46..adef46fd 100755 --- a/target/executable/fastp/fastp +++ b/target/executable/fastp/fastp @@ -1028,9 +1028,9 @@ RUN fastp --version 2>&1 | sed 's# #: "#;s#$#"#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Robrecht Cannoodt" LABEL org.opencontainers.image.description="Companion container for running component fastp" -LABEL org.opencontainers.image.created="2024-10-18T09:18:51Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:46Z" LABEL org.opencontainers.image.source="https://github.com/OpenGene/fastp" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/fastqc/.config.vsh.yaml b/target/executable/fastqc/.config.vsh.yaml index d09d7f8c..0ace19d4 100644 --- a/target/executable/fastqc/.config.vsh.yaml +++ b/target/executable/fastqc/.config.vsh.yaml @@ -340,9 +340,9 @@ build_info: output: "target/executable/fastqc" executable: "target/executable/fastqc/fastqc" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/fastqc/fastqc b/target/executable/fastqc/fastqc index a5698623..e4c599a9 100755 --- a/target/executable/fastqc/fastqc +++ b/target/executable/fastqc/fastqc @@ -601,9 +601,9 @@ RUN echo "fastqc: $(fastqc --version | sed -n 's/^FastQC //p')" > /var/software_ LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component fastqc" -LABEL org.opencontainers.image.created="2024-10-18T09:18:52Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:46Z" LABEL org.opencontainers.image.source="https://github.com/s-andrews/FastQC" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/featurecounts/.config.vsh.yaml b/target/executable/featurecounts/.config.vsh.yaml index 06848158..57275688 100644 --- a/target/executable/featurecounts/.config.vsh.yaml +++ b/target/executable/featurecounts/.config.vsh.yaml @@ -645,9 +645,9 @@ build_info: output: "target/executable/featurecounts" executable: "target/executable/featurecounts/featurecounts" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/featurecounts/featurecounts b/target/executable/featurecounts/featurecounts index ee1ac284..cbe51b98 100755 --- a/target/executable/featurecounts/featurecounts +++ b/target/executable/featurecounts/featurecounts @@ -754,9 +754,9 @@ RUN featureCounts -v 2>&1 | sed 's/featureCounts v\([0-9.]*\)/featureCounts: \1/ LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component featurecounts" -LABEL org.opencontainers.image.created="2024-10-18T09:18:47Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:42Z" LABEL org.opencontainers.image.source="https://github.com/ShiLab-Bioinformatics/subread" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/fq_subsample/.config.vsh.yaml b/target/executable/fq_subsample/.config.vsh.yaml index 54b22c07..4002b5e8 100644 --- a/target/executable/fq_subsample/.config.vsh.yaml +++ b/target/executable/fq_subsample/.config.vsh.yaml @@ -190,9 +190,9 @@ build_info: output: "target/executable/fq_subsample" executable: "target/executable/fq_subsample/fq_subsample" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/fq_subsample/fq_subsample b/target/executable/fq_subsample/fq_subsample index 8106ed60..29f31092 100755 --- a/target/executable/fq_subsample/fq_subsample +++ b/target/executable/fq_subsample/fq_subsample @@ -493,9 +493,9 @@ mv target/release/fq /usr/local/bin/ && \ cd / && rm -rf /fq LABEL org.opencontainers.image.description="Companion container for running component fq_subsample" -LABEL org.opencontainers.image.created="2024-10-18T09:18:48Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:43Z" LABEL org.opencontainers.image.source="https://github.com/stjude-rust-labs/fq" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/gffread/.config.vsh.yaml b/target/executable/gffread/.config.vsh.yaml index a5de0477..3265ace6 100644 --- a/target/executable/gffread/.config.vsh.yaml +++ b/target/executable/gffread/.config.vsh.yaml @@ -685,9 +685,9 @@ build_info: output: "target/executable/gffread" executable: "target/executable/gffread/gffread" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/gffread/gffread b/target/executable/gffread/gffread index 6999510f..9f48243b 100755 --- a/target/executable/gffread/gffread +++ b/target/executable/gffread/gffread @@ -807,9 +807,9 @@ RUN echo "gffread: \"$(gffread --version 2>&1)\"" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component gffread" -LABEL org.opencontainers.image.created="2024-10-18T09:18:51Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:46Z" LABEL org.opencontainers.image.source="https://github.com/gpertea/gffread" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/kallisto/kallisto_index/.config.vsh.yaml b/target/executable/kallisto/kallisto_index/.config.vsh.yaml index 5a1a21f5..c8833f19 100644 --- a/target/executable/kallisto/kallisto_index/.config.vsh.yaml +++ b/target/executable/kallisto/kallisto_index/.config.vsh.yaml @@ -218,9 +218,9 @@ build_info: output: "target/executable/kallisto/kallisto_index" executable: "target/executable/kallisto/kallisto_index/kallisto_index" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/kallisto/kallisto_index/kallisto_index b/target/executable/kallisto/kallisto_index/kallisto_index index 3bf66c76..3fe24fdc 100755 --- a/target/executable/kallisto/kallisto_index/kallisto_index +++ b/target/executable/kallisto/kallisto_index/kallisto_index @@ -506,9 +506,9 @@ tar -xzf kallisto_linux-v0.50.1.tar.gz && \ mv kallisto/kallisto /usr/local/bin/ LABEL org.opencontainers.image.description="Companion container for running component kallisto kallisto_index" -LABEL org.opencontainers.image.created="2024-10-18T09:18:57Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:51Z" LABEL org.opencontainers.image.source="https://github.com/pachterlab/kallisto" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/kallisto/kallisto_quant/.config.vsh.yaml b/target/executable/kallisto/kallisto_quant/.config.vsh.yaml index 27c29d4b..82995dd6 100644 --- a/target/executable/kallisto/kallisto_quant/.config.vsh.yaml +++ b/target/executable/kallisto/kallisto_quant/.config.vsh.yaml @@ -234,9 +234,9 @@ build_info: output: "target/executable/kallisto/kallisto_quant" executable: "target/executable/kallisto/kallisto_quant/kallisto_quant" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/kallisto/kallisto_quant/kallisto_quant b/target/executable/kallisto/kallisto_quant/kallisto_quant index 161eb1b9..1472fde0 100755 --- a/target/executable/kallisto/kallisto_quant/kallisto_quant +++ b/target/executable/kallisto/kallisto_quant/kallisto_quant @@ -518,9 +518,9 @@ mv kallisto/kallisto /usr/local/bin/ RUN echo "kallisto: $(kallisto version | sed 's/kallisto, version //')" > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component kallisto kallisto_quant" -LABEL org.opencontainers.image.created="2024-10-18T09:18:57Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:52Z" LABEL org.opencontainers.image.source="https://github.com/pachterlab/kallisto" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/lofreq/lofreq_call/.config.vsh.yaml b/target/executable/lofreq/lofreq_call/.config.vsh.yaml index d27ce62f..3b11978d 100644 --- a/target/executable/lofreq/lofreq_call/.config.vsh.yaml +++ b/target/executable/lofreq/lofreq_call/.config.vsh.yaml @@ -507,9 +507,9 @@ build_info: output: "target/executable/lofreq/lofreq_call" executable: "target/executable/lofreq/lofreq_call/lofreq_call" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/lofreq/lofreq_call/lofreq_call b/target/executable/lofreq/lofreq_call/lofreq_call index ce8b0ed1..85d99750 100755 --- a/target/executable/lofreq/lofreq_call/lofreq_call +++ b/target/executable/lofreq/lofreq_call/lofreq_call @@ -656,9 +656,9 @@ echo "lofreq: $version" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Kai Waldrant" LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_call" -LABEL org.opencontainers.image.created="2024-10-18T09:18:58Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:52Z" LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml b/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml index 8da4d953..2c224381 100644 --- a/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml +++ b/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml @@ -215,9 +215,9 @@ build_info: output: "target/executable/lofreq/lofreq_indelqual" executable: "target/executable/lofreq/lofreq_indelqual/lofreq_indelqual" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual b/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual index c590e351..01095302 100755 --- a/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual +++ b/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual @@ -501,9 +501,9 @@ echo "lofreq: $version" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Kai Waldrant" LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_indelqual" -LABEL org.opencontainers.image.created="2024-10-18T09:18:58Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:53Z" LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/multiqc/.config.vsh.yaml b/target/executable/multiqc/.config.vsh.yaml index 477eb16c..9cda38f0 100644 --- a/target/executable/multiqc/.config.vsh.yaml +++ b/target/executable/multiqc/.config.vsh.yaml @@ -456,9 +456,9 @@ build_info: output: "target/executable/multiqc" executable: "target/executable/multiqc/multiqc" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/multiqc/multiqc b/target/executable/multiqc/multiqc index 5eb72c26..8fed1aac 100755 --- a/target/executable/multiqc/multiqc +++ b/target/executable/multiqc/multiqc @@ -637,9 +637,9 @@ RUN multiqc --version | sed 's/multiqc, version\s\(.*\)/multiqc: "\1"/' > /var/s LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component multiqc" -LABEL org.opencontainers.image.created="2024-10-18T09:18:53Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:48Z" LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/nanoplot/.config.vsh.yaml b/target/executable/nanoplot/.config.vsh.yaml new file mode 100644 index 00000000..a5e46673 --- /dev/null +++ b/target/executable/nanoplot/.config.vsh.yaml @@ -0,0 +1,519 @@ +name: "nanoplot" +version: "main" +argument_groups: +- name: "Inputs" + arguments: + - type: "file" + name: "--fastq" + description: "Input fastq file(s), separated by \";\"." + info: null + example: + - "read.fq" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--fasta" + description: "Input fasta file(s), separated by \";\"." + info: null + example: + - "read.fa" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--fastq_rich" + description: "Input fastq file(s) generated by albacore or \nMinKNOW with additional\ + \ information concerning channel and time, separated by \";\".\n" + info: null + example: + - "read.fq" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--fastq_minimal" + description: "Input fastq file(s) generated by albacore or MinKNOW with\nadditional\ + \ information concerning channel and time. Minimal data is extracted\nswiftly\ + \ without elaborate checks. Separated by \";\".\n" + info: null + example: + - "read.fq" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--summary" + description: "Input summary file(s) generated by albacore or guppy, separated\ + \ by \";\".\n" + info: null + example: + - "read.txt" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--bam" + description: "Input sorted bam file(s), separated by \";\"." + info: null + example: + - "read.bam" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--ubam" + description: "Input unmapped bam file(s), separated by \";\"." + info: null + example: + - "read.ubam" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--cram" + description: "Input sorted cram file(s), separated by \";\"." + info: null + example: + - "read.cram" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--pickle" + description: "Input pickle file stored earlier, separated by \";\"." + info: null + example: + - "read.pkl" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--feather" + alternatives: + - "--arrow" + description: "Input feather file(s), separated by \";\"." + info: null + example: + - "read.arrow" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" +- name: "Outputs" + arguments: + - type: "file" + name: "--outdir" + alternatives: + - "-o" + description: "Specify directory in which output has to be created." + info: null + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: false + multiple_sep: ";" +- name: "Options" + arguments: + - type: "boolean_true" + name: "--verbose" + description: "Write log messages also to terminal" + info: null + direction: "input" + - type: "boolean_true" + name: "--store" + description: "Store the extracted data in a pickle file for future plotting." + info: null + direction: "input" + - type: "boolean_true" + name: "--raw" + description: "Store the extracted data in tab separated file." + info: null + direction: "input" + - type: "boolean_true" + name: "--huge" + description: "Input data is one very large file." + info: null + direction: "input" + - type: "boolean_false" + name: "--no_static" + description: "Do not make static (png) plots." + info: null + direction: "input" + - type: "string" + name: "--prefix" + alternatives: + - "-p" + description: "Specify an optional prefix to be used for the output files." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--tsv_stats" + description: "Output the stats file as a properly formatted TSV." + info: null + direction: "input" + - type: "boolean_true" + name: "--only_report" + description: "Output only the report." + info: null + direction: "input" + - type: "boolean_true" + name: "--info_in_report" + description: "Add NanoPlot run info in the report." + info: null + direction: "input" +- name: "Filtering or transforming input" + arguments: + - type: "integer" + name: "--maxlength" + description: "Drop reads longer than length specified." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--minlength" + description: "Drop reads shorter than length specified." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_false" + name: "--drop_outliers" + description: "Drop outlier reads with extreme long length." + info: null + direction: "input" + - type: "integer" + name: "--downsample" + description: "Reduce dataset to N reads by random sampling." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--loglength" + description: "Logarithmic scaling of lengths in plots." + info: null + direction: "input" + - type: "boolean_true" + name: "--percentqual" + description: "Use qualities as theoretical percent identities." + info: null + direction: "input" + - type: "boolean_true" + name: "--alength" + description: "Use aligned read lengths rather than sequenced length (bam mode)." + info: null + direction: "input" + - type: "integer" + name: "--minqual" + description: "Drop reads with an average quality lower than specified." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--runtime_until" + description: "Only take the N first hours of a run." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--readtype" + description: "Which read type to extract information about from summary.\nOptions\ + \ are 1D, 2D, 1D2\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--barcoded" + description: "Use if you want to split the summary file by barcode." + info: null + direction: "input" + - type: "boolean_false" + name: "--no_supplementary" + description: "Use if you want to remove supplementary alignments." + info: null + direction: "input" +- name: "Customizing plots" + arguments: + - type: "string" + name: "--color" + alternatives: + - "-c" + description: "Specify a color for the plots, must be a valid matplotlib color." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--colormap" + alternatives: + - "-cm" + description: "Specify a valid matplotlib colormap for the heatmap." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--format" + alternatives: + - "-f" + description: "Specify the output format of the plots.\n{eps,jpeg,jpg,pdf,pgf,png,ps,raw,rgba,svg,svgz,tif,tiff}\n" + info: null + default: + - "png" + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--plots" + description: "Specify which bivariate plots have to be made.\n[{kde,hex,dot} ...]\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--legacy" + description: "Specify which bivariate plots have to be made (legacy mode).\n[{kde,dot,hex}\ + \ ...]\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--listcolors" + description: "List the colors which are available for plotting and exit." + info: null + direction: "input" + - type: "boolean_true" + name: "--listcolormaps" + description: "List the colormaps which are available for plotting and exit." + info: null + direction: "input" + - type: "boolean_false" + name: "--no_N50" + description: "Hide the N50 mark in the read length histogram." + info: null + direction: "input" + - type: "boolean_true" + name: "--N50" + description: "Show the N50 mark in the read length histogram." + info: null + direction: "input" + - type: "string" + name: "--title" + description: "Add a title to all plots, requires quoting if using spaces." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "double" + name: "--font_scale" + description: "Scale the font of the plots by a factor." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--dpi" + description: "Set the dpi for saving images." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_false" + name: "--hide_stats" + description: "Not adding Pearson R stats in some bivariate plots." + info: null + direction: "input" +resources: +- type: "bash_script" + path: "script.sh" + is_executable: true +description: "Run NanoPlot on nanopore-sequenced reads.\nNanoPlot is a plotting tool\ + \ for long read sequencing data and alignments.\n" +test_resources: +- type: "bash_script" + path: "test.sh" + is_executable: true +- type: "file" + path: "test_data" +info: null +status: "enabled" +requirements: + commands: + - "ps" +keywords: +- "fastq" +- "sequencing summary" +- "nanopore" +license: "MIT" +references: + doi: + - "10.1093/bioinformatics/btad311" +links: + repository: "https://github.com/wdecoster/NanoPlot" + homepage: "http://nanoplot.bioinf.be/" + documentation: "https://github.com/wdecoster/NanoPlot" +runners: +- type: "executable" + id: "executable" + docker_setup_strategy: "ifneedbepullelsecachedbuild" +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "docker" + id: "docker" + image: "quay.io/biocontainers/nanoplot:1.43.0--pyhdfd78af_1" + target_registry: "images.viash-hub.com" + target_tag: "main" + namespace_separator: "/" + setup: + - type: "docker" + run: + - "version=$(NanoPlot --version) && \\\necho \"$version\" > /var/software_versions.txt\n" + entrypoint: [] + cmd: null +- type: "native" + id: "native" +build_info: + config: "src/nanoplot/config.vsh.yaml" + runner: "executable" + engine: "docker|native" + output: "target/executable/nanoplot" + executable: "target/executable/nanoplot/nanoplot" + viash_version: "0.9.0" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" +package_config: + name: "biobox" + version: "main" + description: "A collection of bioinformatics tools for working with sequence data.\n" + info: null + viash_version: "0.9.0" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'main'" + keywords: + - "bioinformatics" + - "modules" + - "sequencing" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/biobox" + issue_tracker: "https://github.com/viash-hub/biobox/issues" diff --git a/target/executable/nanoplot/nanoplot b/target/executable/nanoplot/nanoplot new file mode 100755 index 00000000..d60e077c --- /dev/null +++ b/target/executable/nanoplot/nanoplot @@ -0,0 +1,2459 @@ +#!/usr/bin/env bash + +# nanoplot main +# +# This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative +# work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data +# Intuitive. +# +# The component may contain files which fall under a different license. The +# authors of this component should specify the license in the header of such +# files, or include a separate license file detailing the licenses of all included +# files. + +set -e + +if [ -z "$VIASH_TEMP" ]; then + VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$VIASH_TEMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMP} + VIASH_TEMP=${VIASH_TEMP:-$TMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$TMP} + VIASH_TEMP=${VIASH_TEMP:-$TEMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$TEMP} + VIASH_TEMP=${VIASH_TEMP:-/tmp} +fi + +# define helper functions +# ViashQuote: put quotes around non flag values +# $1 : unquoted string +# return : possibly quoted string +# examples: +# ViashQuote --foo # returns --foo +# ViashQuote bar # returns 'bar' +# Viashquote --foo=bar # returns --foo='bar' +function ViashQuote { + if [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+=.+$ ]]; then + echo "$1" | sed "s#=\(.*\)#='\1'#" + elif [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+$ ]]; then + echo "$1" + else + echo "'$1'" + fi +} +# ViashRemoveFlags: Remove leading flag +# $1 : string with a possible leading flag +# return : string without possible leading flag +# examples: +# ViashRemoveFlags --foo=bar # returns bar +function ViashRemoveFlags { + echo "$1" | sed 's/^--*[a-zA-Z0-9_\-]*=//' +} +# ViashSourceDir: return the path of a bash file, following symlinks +# usage : ViashSourceDir ${BASH_SOURCE[0]} +# $1 : Should always be set to ${BASH_SOURCE[0]} +# returns : The absolute path of the bash file +function ViashSourceDir { + local source="$1" + while [ -h "$source" ]; do + local dir="$( cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd )" + source="$(readlink "$source")" + [[ $source != /* ]] && source="$dir/$source" + done + cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd +} +# ViashFindTargetDir: return the path of the '.build.yaml' file, following symlinks +# usage : ViashFindTargetDir 'ScriptPath' +# $1 : The location from where to start the upward search +# returns : The absolute path of the '.build.yaml' file +function ViashFindTargetDir { + local source="$1" + while [[ "$source" != "" && ! -e "$source/.build.yaml" ]]; do + source=${source%/*} + done + echo $source +} +# see https://en.wikipedia.org/wiki/Syslog#Severity_level +VIASH_LOGCODE_EMERGENCY=0 +VIASH_LOGCODE_ALERT=1 +VIASH_LOGCODE_CRITICAL=2 +VIASH_LOGCODE_ERROR=3 +VIASH_LOGCODE_WARNING=4 +VIASH_LOGCODE_NOTICE=5 +VIASH_LOGCODE_INFO=6 +VIASH_LOGCODE_DEBUG=7 +VIASH_VERBOSITY=$VIASH_LOGCODE_NOTICE + +# ViashLog: Log events depending on the verbosity level +# usage: ViashLog 1 alert Oh no something went wrong! +# $1: required verbosity level +# $2: display tag +# $3+: messages to display +# stdout: Your input, prepended by '[$2] '. +function ViashLog { + local required_level="$1" + local display_tag="$2" + shift 2 + if [ $VIASH_VERBOSITY -ge $required_level ]; then + >&2 echo "[$display_tag]" "$@" + fi +} + +# ViashEmergency: log events when the system is unstable +# usage: ViashEmergency Oh no something went wrong. +# stdout: Your input, prepended by '[emergency] '. +function ViashEmergency { + ViashLog $VIASH_LOGCODE_EMERGENCY emergency "$@" +} + +# ViashAlert: log events when actions must be taken immediately (e.g. corrupted system database) +# usage: ViashAlert Oh no something went wrong. +# stdout: Your input, prepended by '[alert] '. +function ViashAlert { + ViashLog $VIASH_LOGCODE_ALERT alert "$@" +} + +# ViashCritical: log events when a critical condition occurs +# usage: ViashCritical Oh no something went wrong. +# stdout: Your input, prepended by '[critical] '. +function ViashCritical { + ViashLog $VIASH_LOGCODE_CRITICAL critical "$@" +} + +# ViashError: log events when an error condition occurs +# usage: ViashError Oh no something went wrong. +# stdout: Your input, prepended by '[error] '. +function ViashError { + ViashLog $VIASH_LOGCODE_ERROR error "$@" +} + +# ViashWarning: log potentially abnormal events +# usage: ViashWarning Something may have gone wrong. +# stdout: Your input, prepended by '[warning] '. +function ViashWarning { + ViashLog $VIASH_LOGCODE_WARNING warning "$@" +} + +# ViashNotice: log significant but normal events +# usage: ViashNotice This just happened. +# stdout: Your input, prepended by '[notice] '. +function ViashNotice { + ViashLog $VIASH_LOGCODE_NOTICE notice "$@" +} + +# ViashInfo: log normal events +# usage: ViashInfo This just happened. +# stdout: Your input, prepended by '[info] '. +function ViashInfo { + ViashLog $VIASH_LOGCODE_INFO info "$@" +} + +# ViashDebug: log all events, for debugging purposes +# usage: ViashDebug This just happened. +# stdout: Your input, prepended by '[debug] '. +function ViashDebug { + ViashLog $VIASH_LOGCODE_DEBUG debug "$@" +} + +# find source folder of this component +VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}` + +# find the root of the built components & dependencies +VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR` + +# define meta fields +VIASH_META_NAME="nanoplot" +VIASH_META_FUNCTIONALITY_NAME="nanoplot" +VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME" +VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml" +VIASH_META_TEMP_DIR="$VIASH_TEMP" + + +# ViashHelp: Display helpful explanation about this executable +function ViashHelp { + echo "nanoplot main" + echo "" + echo "Run NanoPlot on nanopore-sequenced reads." + echo "NanoPlot is a plotting tool for long read sequencing data and alignments." + echo "" + echo "Inputs:" + echo " --fastq" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.fq" + echo " Input fastq file(s), separated by \";\"." + echo "" + echo " --fasta" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.fa" + echo " Input fasta file(s), separated by \";\"." + echo "" + echo " --fastq_rich" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.fq" + echo " Input fastq file(s) generated by albacore or" + echo " MinKNOW with additional information concerning channel and time," + echo " separated by \";\"." + echo "" + echo " --fastq_minimal" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.fq" + echo " Input fastq file(s) generated by albacore or MinKNOW with" + echo " additional information concerning channel and time. Minimal data is" + echo " extracted" + echo " swiftly without elaborate checks. Separated by \";\"." + echo "" + echo " --summary" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.txt" + echo " Input summary file(s) generated by albacore or guppy, separated by \";\"." + echo "" + echo " --bam" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.bam" + echo " Input sorted bam file(s), separated by \";\"." + echo "" + echo " --ubam" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.ubam" + echo " Input unmapped bam file(s), separated by \";\"." + echo "" + echo " --cram" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.cram" + echo " Input sorted cram file(s), separated by \";\"." + echo "" + echo " --pickle" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.pkl" + echo " Input pickle file stored earlier, separated by \";\"." + echo "" + echo " --arrow, --feather" + echo " type: file, multiple values allowed, file must exist" + echo " example: read.arrow" + echo " Input feather file(s), separated by \";\"." + echo "" + echo "Outputs:" + echo " -o, --outdir" + echo " type: file, required parameter, output, file must exist" + echo " Specify directory in which output has to be created." + echo "" + echo "Options:" + echo " --verbose" + echo " type: boolean_true" + echo " Write log messages also to terminal" + echo "" + echo " --store" + echo " type: boolean_true" + echo " Store the extracted data in a pickle file for future plotting." + echo "" + echo " --raw" + echo " type: boolean_true" + echo " Store the extracted data in tab separated file." + echo "" + echo " --huge" + echo " type: boolean_true" + echo " Input data is one very large file." + echo "" + echo " --no_static" + echo " type: boolean_false" + echo " Do not make static (png) plots." + echo "" + echo " -p, --prefix" + echo " type: string" + echo " Specify an optional prefix to be used for the output files." + echo "" + echo " --tsv_stats" + echo " type: boolean_true" + echo " Output the stats file as a properly formatted TSV." + echo "" + echo " --only_report" + echo " type: boolean_true" + echo " Output only the report." + echo "" + echo " --info_in_report" + echo " type: boolean_true" + echo " Add NanoPlot run info in the report." + echo "" + echo "Filtering or transforming input:" + echo " --maxlength" + echo " type: integer" + echo " Drop reads longer than length specified." + echo "" + echo " --minlength" + echo " type: integer" + echo " Drop reads shorter than length specified." + echo "" + echo " --drop_outliers" + echo " type: boolean_false" + echo " Drop outlier reads with extreme long length." + echo "" + echo " --downsample" + echo " type: integer" + echo " Reduce dataset to N reads by random sampling." + echo "" + echo " --loglength" + echo " type: boolean_true" + echo " Logarithmic scaling of lengths in plots." + echo "" + echo " --percentqual" + echo " type: boolean_true" + echo " Use qualities as theoretical percent identities." + echo "" + echo " --alength" + echo " type: boolean_true" + echo " Use aligned read lengths rather than sequenced length (bam mode)." + echo "" + echo " --minqual" + echo " type: integer" + echo " Drop reads with an average quality lower than specified." + echo "" + echo " --runtime_until" + echo " type: integer" + echo " Only take the N first hours of a run." + echo "" + echo " --readtype" + echo " type: string" + echo " Which read type to extract information about from summary." + echo " Options are 1D, 2D, 1D2" + echo "" + echo " --barcoded" + echo " type: boolean_true" + echo " Use if you want to split the summary file by barcode." + echo "" + echo " --no_supplementary" + echo " type: boolean_false" + echo " Use if you want to remove supplementary alignments." + echo "" + echo "Customizing plots:" + echo " -c, --color" + echo " type: string" + echo " Specify a color for the plots, must be a valid matplotlib color." + echo "" + echo " -cm, --colormap" + echo " type: string" + echo " Specify a valid matplotlib colormap for the heatmap." + echo "" + echo " -f, --format" + echo " type: string" + echo " default: png" + echo " Specify the output format of the plots." + echo " {eps,jpeg,jpg,pdf,pgf,png,ps,raw,rgba,svg,svgz,tif,tiff}" + echo "" + echo " --plots" + echo " type: string" + echo " Specify which bivariate plots have to be made." + echo " [{kde,hex,dot} ...]" + echo "" + echo " --legacy" + echo " type: string" + echo " Specify which bivariate plots have to be made (legacy mode)." + echo " [{kde,dot,hex} ...]" + echo "" + echo " --listcolors" + echo " type: boolean_true" + echo " List the colors which are available for plotting and exit." + echo "" + echo " --listcolormaps" + echo " type: boolean_true" + echo " List the colormaps which are available for plotting and exit." + echo "" + echo " --no_N50" + echo " type: boolean_false" + echo " Hide the N50 mark in the read length histogram." + echo "" + echo " --N50" + echo " type: boolean_true" + echo " Show the N50 mark in the read length histogram." + echo "" + echo " --title" + echo " type: string" + echo " Add a title to all plots, requires quoting if using spaces." + echo "" + echo " --font_scale" + echo " type: double" + echo " Scale the font of the plots by a factor." + echo "" + echo " --dpi" + echo " type: integer" + echo " Set the dpi for saving images." + echo "" + echo " --hide_stats" + echo " type: boolean_false" + echo " Not adding Pearson R stats in some bivariate plots." +} + +# initialise variables +VIASH_MODE='run' +VIASH_ENGINE_ID='docker' + +######## Helper functions for setting up Docker images for viash ######## +# expects: ViashDockerBuild + +# ViashDockerInstallationCheck: check whether Docker is installed correctly +# +# examples: +# ViashDockerInstallationCheck +function ViashDockerInstallationCheck { + ViashDebug "Checking whether Docker is installed" + if [ ! command -v docker &> /dev/null ]; then + ViashCritical "Docker doesn't seem to be installed. See 'https://docs.docker.com/get-docker/' for instructions." + exit 1 + fi + + ViashDebug "Checking whether the Docker daemon is running" + local save=$-; set +e + local docker_version=$(docker version --format '{{.Client.APIVersion}}' 2> /dev/null) + local out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashCritical "Docker daemon does not seem to be running. Try one of the following:" + ViashCritical "- Try running 'dockerd' in the command line" + ViashCritical "- See https://docs.docker.com/config/daemon/" + exit 1 + fi +} + +# ViashDockerRemoteTagCheck: check whether a Docker image is available +# on a remote. Assumes `docker login` has been performed, if relevant. +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# ViashDockerRemoteTagCheck python:latest +# echo $? # returns '0' +# ViashDockerRemoteTagCheck sdaizudceahifu +# echo $? # returns '1' +function ViashDockerRemoteTagCheck { + docker manifest inspect $1 > /dev/null 2> /dev/null +} + +# ViashDockerLocalTagCheck: check whether a Docker image is available locally +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# docker pull python:latest +# ViashDockerLocalTagCheck python:latest +# echo $? # returns '0' +# ViashDockerLocalTagCheck sdaizudceahifu +# echo $? # returns '1' +function ViashDockerLocalTagCheck { + [ -n "$(docker images -q $1)" ] +} + +# ViashDockerPull: pull a Docker image +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# ViashDockerPull python:latest +# echo $? # returns '0' +# ViashDockerPull sdaizudceahifu +# echo $? # returns '1' +function ViashDockerPull { + ViashNotice "Checking if Docker image is available at '$1'" + if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then + docker pull $1 && return 0 || return 1 + else + local save=$-; set +e + docker pull $1 2> /dev/null > /dev/null + local out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashWarning "Could not pull from '$1'. Docker image doesn't exist or is not accessible." + fi + return $out + fi +} + +# ViashDockerPush: push a Docker image +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# ViashDockerPush python:latest +# echo $? # returns '0' +# ViashDockerPush sdaizudceahifu +# echo $? # returns '1' +function ViashDockerPush { + ViashNotice "Pushing image to '$1'" + local save=$-; set +e + local out + if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then + docker push $1 + out=$? + else + docker push $1 2> /dev/null > /dev/null + out=$? + fi + [[ $save =~ e ]] && set -e + if [ $out -eq 0 ]; then + ViashNotice "Container '$1' push succeeded." + else + ViashError "Container '$1' push errored. You might not be logged in or have the necessary permissions." + fi + return $out +} + +# ViashDockerPullElseBuild: pull a Docker image, else build it +# +# $1 : image identifier with format `[registry/]image[:tag]` +# ViashDockerBuild : a Bash function which builds a docker image, takes image identifier as argument. +# examples: +# ViashDockerPullElseBuild mynewcomponent +function ViashDockerPullElseBuild { + local save=$-; set +e + ViashDockerPull $1 + local out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashDockerBuild $@ + fi +} + +# ViashDockerSetup: create a Docker image, according to specified docker setup strategy +# +# $1 : image identifier with format `[registry/]image[:tag]` +# $2 : docker setup strategy, see DockerSetupStrategy.scala +# examples: +# ViashDockerSetup mynewcomponent alwaysbuild +function ViashDockerSetup { + local image_id="$1" + local setup_strategy="$2" + if [ "$setup_strategy" == "alwaysbuild" -o "$setup_strategy" == "build" -o "$setup_strategy" == "b" ]; then + ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "alwayspull" -o "$setup_strategy" == "pull" -o "$setup_strategy" == "p" ]; then + ViashDockerPull $image_id + elif [ "$setup_strategy" == "alwayspullelsebuild" -o "$setup_strategy" == "pullelsebuild" ]; then + ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "alwayspullelsecachedbuild" -o "$setup_strategy" == "pullelsecachedbuild" ]; then + ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "alwayscachedbuild" -o "$setup_strategy" == "cachedbuild" -o "$setup_strategy" == "cb" ]; then + ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id") + elif [[ "$setup_strategy" =~ ^ifneedbe ]]; then + local save=$-; set +e + ViashDockerLocalTagCheck $image_id + local outCheck=$? + [[ $save =~ e ]] && set -e + if [ $outCheck -eq 0 ]; then + ViashInfo "Image $image_id already exists" + elif [ "$setup_strategy" == "ifneedbebuild" ]; then + ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "ifneedbecachedbuild" ]; then + ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "ifneedbepull" ]; then + ViashDockerPull $image_id + elif [ "$setup_strategy" == "ifneedbepullelsebuild" ]; then + ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "ifneedbepullelsecachedbuild" ]; then + ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id") + else + ViashError "Unrecognised Docker strategy: $setup_strategy" + exit 1 + fi + elif [ "$setup_strategy" == "push" -o "$setup_strategy" == "forcepush" -o "$setup_strategy" == "alwayspush" ]; then + ViashDockerPush "$image_id" + elif [ "$setup_strategy" == "pushifnotpresent" -o "$setup_strategy" == "gentlepush" -o "$setup_strategy" == "maybepush" ]; then + local save=$-; set +e + ViashDockerRemoteTagCheck $image_id + local outCheck=$? + [[ $save =~ e ]] && set -e + if [ $outCheck -eq 0 ]; then + ViashNotice "Container '$image_id' exists, doing nothing." + else + ViashNotice "Container '$image_id' does not yet exist." + ViashDockerPush "$image_id" + fi + elif [ "$setup_strategy" == "donothing" -o "$setup_strategy" == "meh" ]; then + ViashNotice "Skipping setup." + else + ViashError "Unrecognised Docker strategy: $setup_strategy" + exit 1 + fi +} + +# ViashDockerCheckCommands: Check whether a docker container has the required commands +# +# $1 : image identifier with format `[registry/]image[:tag]` +# $@ : commands to verify being present +# examples: +# ViashDockerCheckCommands bash:4.0 bash ps foo +function ViashDockerCheckCommands { + local image_id="$1" + shift 1 + local commands="$@" + local save=$-; set +e + local missing # mark 'missing' as local in advance, otherwise the exit code of the command will be missing and always be '0' + missing=$(docker run --rm --entrypoint=sh "$image_id" -c "for command in $commands; do command -v \$command >/dev/null 2>&1; if [ \$? -ne 0 ]; then echo \$command; exit 1; fi; done") + local outCheck=$? + [[ $save =~ e ]] && set -e + if [ $outCheck -ne 0 ]; then + ViashError "Docker container '$image_id' does not contain command '$missing'." + exit 1 + fi +} + +# ViashDockerBuild: build a docker image +# $1 : image identifier with format `[registry/]image[:tag]` +# $... : additional arguments to pass to docker build +# $VIASH_META_TEMP_DIR : temporary directory to store dockerfile & optional resources in +# $VIASH_META_NAME : name of the component +# $VIASH_META_RESOURCES_DIR : directory containing the resources +# $VIASH_VERBOSITY : verbosity level +# exit code $? : whether or not the image was built successfully +function ViashDockerBuild { + local image_id="$1" + shift 1 + + # create temporary directory to store dockerfile & optional resources in + local tmpdir=$(mktemp -d "$VIASH_META_TEMP_DIR/dockerbuild-$VIASH_META_NAME-XXXXXX") + local dockerfile="$tmpdir/Dockerfile" + function clean_up { + rm -rf "$tmpdir" + } + trap clean_up EXIT + + # store dockerfile and resources + ViashDockerfile "$VIASH_ENGINE_ID" > "$dockerfile" + + # generate the build command + local docker_build_cmd="docker build -t '$image_id' $@ '$VIASH_META_RESOURCES_DIR' -f '$dockerfile'" + + # build the container + ViashNotice "Building container '$image_id' with Dockerfile" + ViashInfo "$docker_build_cmd" + local save=$-; set +e + if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then + eval $docker_build_cmd + else + eval $docker_build_cmd &> "$tmpdir/docker_build.log" + fi + + # check exit code + local out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashError "Error occurred while building container '$image_id'" + if [ $VIASH_VERBOSITY -lt $VIASH_LOGCODE_INFO ]; then + ViashError "Transcript: --------------------------------" + cat "$tmpdir/docker_build.log" + ViashError "End of transcript --------------------------" + fi + exit 1 + fi +} + +######## End of helper functions for setting up Docker images for viash ######## + +# ViashDockerFile: print the dockerfile to stdout +# $1 : engine identifier +# return : dockerfile required to run this component +# examples: +# ViashDockerFile +function ViashDockerfile { + local engine_id="$1" + + if [[ "$engine_id" == "docker" ]]; then + cat << 'VIASHDOCKER' +FROM quay.io/biocontainers/nanoplot:1.43.0--pyhdfd78af_1 +ENTRYPOINT [] +RUN version=$(NanoPlot --version) && \ +echo "$version" > /var/software_versions.txt + +LABEL org.opencontainers.image.description="Companion container for running component nanoplot" +LABEL org.opencontainers.image.created="2024-10-26T09:56:48Z" +LABEL org.opencontainers.image.source="https://github.com/wdecoster/NanoPlot" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" +LABEL org.opencontainers.image.version="main" + +VIASHDOCKER + fi +} + +# ViashDockerBuildArgs: return the arguments to pass to docker build +# $1 : engine identifier +# return : arguments to pass to docker build +function ViashDockerBuildArgs { + local engine_id="$1" + + if [[ "$engine_id" == "docker" ]]; then + echo "" + fi +} + +# ViashAbsolutePath: generate absolute path from relative path +# borrowed from https://stackoverflow.com/a/21951256 +# $1 : relative filename +# return : absolute path +# examples: +# ViashAbsolutePath some_file.txt # returns /path/to/some_file.txt +# ViashAbsolutePath /foo/bar/.. # returns /foo +function ViashAbsolutePath { + local thePath + local parr + local outp + local len + if [[ ! "$1" =~ ^/ ]]; then + thePath="$PWD/$1" + else + thePath="$1" + fi + echo "$thePath" | ( + IFS=/ + read -a parr + declare -a outp + for i in "${parr[@]}"; do + case "$i" in + ''|.) continue ;; + ..) + len=${#outp[@]} + if ((len==0)); then + continue + else + unset outp[$((len-1))] + fi + ;; + *) + len=${#outp[@]} + outp[$len]="$i" + ;; + esac + done + echo /"${outp[*]}" + ) +} +# ViashDockerAutodetectMount: auto configuring docker mounts from parameters +# $1 : The parameter value +# returns : New parameter +# $VIASH_DIRECTORY_MOUNTS : Added another parameter to be passed to docker +# $VIASH_DOCKER_AUTOMOUNT_PREFIX : The prefix to be used for the automounts +# examples: +# ViashDockerAutodetectMount /path/to/bar # returns '/viash_automount/path/to/bar' +# ViashDockerAutodetectMountArg /path/to/bar # returns '--volume="/path/to:/viash_automount/path/to"' +function ViashDockerAutodetectMount { + local abs_path=$(ViashAbsolutePath "$1") + local mount_source + local base_name + if [ -d "$abs_path" ]; then + mount_source="$abs_path" + base_name="" + else + mount_source=`dirname "$abs_path"` + base_name=`basename "$abs_path"` + fi + local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source" + if [ -z "$base_name" ]; then + echo "$mount_target" + else + echo "$mount_target/$base_name" + fi +} +function ViashDockerAutodetectMountArg { + local abs_path=$(ViashAbsolutePath "$1") + local mount_source + local base_name + if [ -d "$abs_path" ]; then + mount_source="$abs_path" + base_name="" + else + mount_source=`dirname "$abs_path"` + base_name=`basename "$abs_path"` + fi + local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source" + ViashDebug "ViashDockerAutodetectMountArg $1 -> $mount_source -> $mount_target" + echo "--volume=\"$mount_source:$mount_target\"" +} +function ViashDockerStripAutomount { + local abs_path=$(ViashAbsolutePath "$1") + echo "${abs_path#$VIASH_DOCKER_AUTOMOUNT_PREFIX}" +} +# initialise variables +VIASH_DIRECTORY_MOUNTS=() + +# configure default docker automount prefix if it is unset +if [ -z "${VIASH_DOCKER_AUTOMOUNT_PREFIX+x}" ]; then + VIASH_DOCKER_AUTOMOUNT_PREFIX="/viash_automount" +fi + +# initialise docker variables +VIASH_DOCKER_RUN_ARGS=(-i --rm) + +# initialise array +VIASH_POSITIONAL_ARGS='' + +while [[ $# -gt 0 ]]; do + case "$1" in + -h|--help) + ViashHelp + exit + ;; + ---v|---verbose) + let "VIASH_VERBOSITY=VIASH_VERBOSITY+1" + shift 1 + ;; + ---verbosity) + VIASH_VERBOSITY="$2" + shift 2 + ;; + ---verbosity=*) + VIASH_VERBOSITY="$(ViashRemoveFlags "$1")" + shift 1 + ;; + --version) + echo "nanoplot main" + exit + ;; + --fastq) + if [ -z "$VIASH_PAR_FASTQ" ]; then + VIASH_PAR_FASTQ="$2" + else + VIASH_PAR_FASTQ="$VIASH_PAR_FASTQ;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --fastq. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --fastq=*) + if [ -z "$VIASH_PAR_FASTQ" ]; then + VIASH_PAR_FASTQ=$(ViashRemoveFlags "$1") + else + VIASH_PAR_FASTQ="$VIASH_PAR_FASTQ;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --fasta) + if [ -z "$VIASH_PAR_FASTA" ]; then + VIASH_PAR_FASTA="$2" + else + VIASH_PAR_FASTA="$VIASH_PAR_FASTA;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --fasta. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --fasta=*) + if [ -z "$VIASH_PAR_FASTA" ]; then + VIASH_PAR_FASTA=$(ViashRemoveFlags "$1") + else + VIASH_PAR_FASTA="$VIASH_PAR_FASTA;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --fastq_rich) + if [ -z "$VIASH_PAR_FASTQ_RICH" ]; then + VIASH_PAR_FASTQ_RICH="$2" + else + VIASH_PAR_FASTQ_RICH="$VIASH_PAR_FASTQ_RICH;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --fastq_rich. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --fastq_rich=*) + if [ -z "$VIASH_PAR_FASTQ_RICH" ]; then + VIASH_PAR_FASTQ_RICH=$(ViashRemoveFlags "$1") + else + VIASH_PAR_FASTQ_RICH="$VIASH_PAR_FASTQ_RICH;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --fastq_minimal) + if [ -z "$VIASH_PAR_FASTQ_MINIMAL" ]; then + VIASH_PAR_FASTQ_MINIMAL="$2" + else + VIASH_PAR_FASTQ_MINIMAL="$VIASH_PAR_FASTQ_MINIMAL;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --fastq_minimal. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --fastq_minimal=*) + if [ -z "$VIASH_PAR_FASTQ_MINIMAL" ]; then + VIASH_PAR_FASTQ_MINIMAL=$(ViashRemoveFlags "$1") + else + VIASH_PAR_FASTQ_MINIMAL="$VIASH_PAR_FASTQ_MINIMAL;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --summary) + if [ -z "$VIASH_PAR_SUMMARY" ]; then + VIASH_PAR_SUMMARY="$2" + else + VIASH_PAR_SUMMARY="$VIASH_PAR_SUMMARY;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --summary. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --summary=*) + if [ -z "$VIASH_PAR_SUMMARY" ]; then + VIASH_PAR_SUMMARY=$(ViashRemoveFlags "$1") + else + VIASH_PAR_SUMMARY="$VIASH_PAR_SUMMARY;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --bam) + if [ -z "$VIASH_PAR_BAM" ]; then + VIASH_PAR_BAM="$2" + else + VIASH_PAR_BAM="$VIASH_PAR_BAM;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --bam. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --bam=*) + if [ -z "$VIASH_PAR_BAM" ]; then + VIASH_PAR_BAM=$(ViashRemoveFlags "$1") + else + VIASH_PAR_BAM="$VIASH_PAR_BAM;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --ubam) + if [ -z "$VIASH_PAR_UBAM" ]; then + VIASH_PAR_UBAM="$2" + else + VIASH_PAR_UBAM="$VIASH_PAR_UBAM;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --ubam. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --ubam=*) + if [ -z "$VIASH_PAR_UBAM" ]; then + VIASH_PAR_UBAM=$(ViashRemoveFlags "$1") + else + VIASH_PAR_UBAM="$VIASH_PAR_UBAM;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --cram) + if [ -z "$VIASH_PAR_CRAM" ]; then + VIASH_PAR_CRAM="$2" + else + VIASH_PAR_CRAM="$VIASH_PAR_CRAM;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --cram. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --cram=*) + if [ -z "$VIASH_PAR_CRAM" ]; then + VIASH_PAR_CRAM=$(ViashRemoveFlags "$1") + else + VIASH_PAR_CRAM="$VIASH_PAR_CRAM;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --pickle) + if [ -z "$VIASH_PAR_PICKLE" ]; then + VIASH_PAR_PICKLE="$2" + else + VIASH_PAR_PICKLE="$VIASH_PAR_PICKLE;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --pickle. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --pickle=*) + if [ -z "$VIASH_PAR_PICKLE" ]; then + VIASH_PAR_PICKLE=$(ViashRemoveFlags "$1") + else + VIASH_PAR_PICKLE="$VIASH_PAR_PICKLE;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --feather) + if [ -z "$VIASH_PAR_FEATHER" ]; then + VIASH_PAR_FEATHER="$2" + else + VIASH_PAR_FEATHER="$VIASH_PAR_FEATHER;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --feather. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --feather=*) + if [ -z "$VIASH_PAR_FEATHER" ]; then + VIASH_PAR_FEATHER=$(ViashRemoveFlags "$1") + else + VIASH_PAR_FEATHER="$VIASH_PAR_FEATHER;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --arrow) + if [ -z "$VIASH_PAR_FEATHER" ]; then + VIASH_PAR_FEATHER="$2" + else + VIASH_PAR_FEATHER="$VIASH_PAR_FEATHER;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --arrow. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --outdir) + [ -n "$VIASH_PAR_OUTDIR" ] && ViashError Bad arguments for option \'--outdir\': \'$VIASH_PAR_OUTDIR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_OUTDIR="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --outdir. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --outdir=*) + [ -n "$VIASH_PAR_OUTDIR" ] && ViashError Bad arguments for option \'--outdir=*\': \'$VIASH_PAR_OUTDIR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_OUTDIR=$(ViashRemoveFlags "$1") + shift 1 + ;; + -o) + [ -n "$VIASH_PAR_OUTDIR" ] && ViashError Bad arguments for option \'-o\': \'$VIASH_PAR_OUTDIR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_OUTDIR="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -o. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --verbose) + [ -n "$VIASH_PAR_VERBOSE" ] && ViashError Bad arguments for option \'--verbose\': \'$VIASH_PAR_VERBOSE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_VERBOSE=true + shift 1 + ;; + --store) + [ -n "$VIASH_PAR_STORE" ] && ViashError Bad arguments for option \'--store\': \'$VIASH_PAR_STORE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_STORE=true + shift 1 + ;; + --raw) + [ -n "$VIASH_PAR_RAW" ] && ViashError Bad arguments for option \'--raw\': \'$VIASH_PAR_RAW\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_RAW=true + shift 1 + ;; + --huge) + [ -n "$VIASH_PAR_HUGE" ] && ViashError Bad arguments for option \'--huge\': \'$VIASH_PAR_HUGE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_HUGE=true + shift 1 + ;; + --no_static) + [ -n "$VIASH_PAR_NO_STATIC" ] && ViashError Bad arguments for option \'--no_static\': \'$VIASH_PAR_NO_STATIC\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_NO_STATIC=false + shift 1 + ;; + --prefix) + [ -n "$VIASH_PAR_PREFIX" ] && ViashError Bad arguments for option \'--prefix\': \'$VIASH_PAR_PREFIX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PREFIX="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --prefix. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --prefix=*) + [ -n "$VIASH_PAR_PREFIX" ] && ViashError Bad arguments for option \'--prefix=*\': \'$VIASH_PAR_PREFIX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PREFIX=$(ViashRemoveFlags "$1") + shift 1 + ;; + -p) + [ -n "$VIASH_PAR_PREFIX" ] && ViashError Bad arguments for option \'-p\': \'$VIASH_PAR_PREFIX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PREFIX="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -p. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --tsv_stats) + [ -n "$VIASH_PAR_TSV_STATS" ] && ViashError Bad arguments for option \'--tsv_stats\': \'$VIASH_PAR_TSV_STATS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_TSV_STATS=true + shift 1 + ;; + --only_report) + [ -n "$VIASH_PAR_ONLY_REPORT" ] && ViashError Bad arguments for option \'--only_report\': \'$VIASH_PAR_ONLY_REPORT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_ONLY_REPORT=true + shift 1 + ;; + --info_in_report) + [ -n "$VIASH_PAR_INFO_IN_REPORT" ] && ViashError Bad arguments for option \'--info_in_report\': \'$VIASH_PAR_INFO_IN_REPORT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_INFO_IN_REPORT=true + shift 1 + ;; + --maxlength) + [ -n "$VIASH_PAR_MAXLENGTH" ] && ViashError Bad arguments for option \'--maxlength\': \'$VIASH_PAR_MAXLENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MAXLENGTH="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --maxlength. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --maxlength=*) + [ -n "$VIASH_PAR_MAXLENGTH" ] && ViashError Bad arguments for option \'--maxlength=*\': \'$VIASH_PAR_MAXLENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MAXLENGTH=$(ViashRemoveFlags "$1") + shift 1 + ;; + --minlength) + [ -n "$VIASH_PAR_MINLENGTH" ] && ViashError Bad arguments for option \'--minlength\': \'$VIASH_PAR_MINLENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MINLENGTH="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --minlength. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --minlength=*) + [ -n "$VIASH_PAR_MINLENGTH" ] && ViashError Bad arguments for option \'--minlength=*\': \'$VIASH_PAR_MINLENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MINLENGTH=$(ViashRemoveFlags "$1") + shift 1 + ;; + --drop_outliers) + [ -n "$VIASH_PAR_DROP_OUTLIERS" ] && ViashError Bad arguments for option \'--drop_outliers\': \'$VIASH_PAR_DROP_OUTLIERS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_DROP_OUTLIERS=false + shift 1 + ;; + --downsample) + [ -n "$VIASH_PAR_DOWNSAMPLE" ] && ViashError Bad arguments for option \'--downsample\': \'$VIASH_PAR_DOWNSAMPLE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_DOWNSAMPLE="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --downsample. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --downsample=*) + [ -n "$VIASH_PAR_DOWNSAMPLE" ] && ViashError Bad arguments for option \'--downsample=*\': \'$VIASH_PAR_DOWNSAMPLE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_DOWNSAMPLE=$(ViashRemoveFlags "$1") + shift 1 + ;; + --loglength) + [ -n "$VIASH_PAR_LOGLENGTH" ] && ViashError Bad arguments for option \'--loglength\': \'$VIASH_PAR_LOGLENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_LOGLENGTH=true + shift 1 + ;; + --percentqual) + [ -n "$VIASH_PAR_PERCENTQUAL" ] && ViashError Bad arguments for option \'--percentqual\': \'$VIASH_PAR_PERCENTQUAL\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PERCENTQUAL=true + shift 1 + ;; + --alength) + [ -n "$VIASH_PAR_ALENGTH" ] && ViashError Bad arguments for option \'--alength\': \'$VIASH_PAR_ALENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_ALENGTH=true + shift 1 + ;; + --minqual) + [ -n "$VIASH_PAR_MINQUAL" ] && ViashError Bad arguments for option \'--minqual\': \'$VIASH_PAR_MINQUAL\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MINQUAL="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --minqual. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --minqual=*) + [ -n "$VIASH_PAR_MINQUAL" ] && ViashError Bad arguments for option \'--minqual=*\': \'$VIASH_PAR_MINQUAL\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MINQUAL=$(ViashRemoveFlags "$1") + shift 1 + ;; + --runtime_until) + [ -n "$VIASH_PAR_RUNTIME_UNTIL" ] && ViashError Bad arguments for option \'--runtime_until\': \'$VIASH_PAR_RUNTIME_UNTIL\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_RUNTIME_UNTIL="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --runtime_until. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --runtime_until=*) + [ -n "$VIASH_PAR_RUNTIME_UNTIL" ] && ViashError Bad arguments for option \'--runtime_until=*\': \'$VIASH_PAR_RUNTIME_UNTIL\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_RUNTIME_UNTIL=$(ViashRemoveFlags "$1") + shift 1 + ;; + --readtype) + [ -n "$VIASH_PAR_READTYPE" ] && ViashError Bad arguments for option \'--readtype\': \'$VIASH_PAR_READTYPE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_READTYPE="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --readtype. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --readtype=*) + [ -n "$VIASH_PAR_READTYPE" ] && ViashError Bad arguments for option \'--readtype=*\': \'$VIASH_PAR_READTYPE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_READTYPE=$(ViashRemoveFlags "$1") + shift 1 + ;; + --barcoded) + [ -n "$VIASH_PAR_BARCODED" ] && ViashError Bad arguments for option \'--barcoded\': \'$VIASH_PAR_BARCODED\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_BARCODED=true + shift 1 + ;; + --no_supplementary) + [ -n "$VIASH_PAR_NO_SUPPLEMENTARY" ] && ViashError Bad arguments for option \'--no_supplementary\': \'$VIASH_PAR_NO_SUPPLEMENTARY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_NO_SUPPLEMENTARY=false + shift 1 + ;; + --color) + [ -n "$VIASH_PAR_COLOR" ] && ViashError Bad arguments for option \'--color\': \'$VIASH_PAR_COLOR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_COLOR="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --color. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --color=*) + [ -n "$VIASH_PAR_COLOR" ] && ViashError Bad arguments for option \'--color=*\': \'$VIASH_PAR_COLOR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_COLOR=$(ViashRemoveFlags "$1") + shift 1 + ;; + -c) + [ -n "$VIASH_PAR_COLOR" ] && ViashError Bad arguments for option \'-c\': \'$VIASH_PAR_COLOR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_COLOR="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -c. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --colormap) + [ -n "$VIASH_PAR_COLORMAP" ] && ViashError Bad arguments for option \'--colormap\': \'$VIASH_PAR_COLORMAP\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_COLORMAP="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --colormap. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --colormap=*) + [ -n "$VIASH_PAR_COLORMAP" ] && ViashError Bad arguments for option \'--colormap=*\': \'$VIASH_PAR_COLORMAP\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_COLORMAP=$(ViashRemoveFlags "$1") + shift 1 + ;; + -cm) + [ -n "$VIASH_PAR_COLORMAP" ] && ViashError Bad arguments for option \'-cm\': \'$VIASH_PAR_COLORMAP\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_COLORMAP="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -cm. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --format) + [ -n "$VIASH_PAR_FORMAT" ] && ViashError Bad arguments for option \'--format\': \'$VIASH_PAR_FORMAT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FORMAT="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --format. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --format=*) + [ -n "$VIASH_PAR_FORMAT" ] && ViashError Bad arguments for option \'--format=*\': \'$VIASH_PAR_FORMAT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FORMAT=$(ViashRemoveFlags "$1") + shift 1 + ;; + -f) + [ -n "$VIASH_PAR_FORMAT" ] && ViashError Bad arguments for option \'-f\': \'$VIASH_PAR_FORMAT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FORMAT="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -f. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --plots) + [ -n "$VIASH_PAR_PLOTS" ] && ViashError Bad arguments for option \'--plots\': \'$VIASH_PAR_PLOTS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PLOTS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --plots. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --plots=*) + [ -n "$VIASH_PAR_PLOTS" ] && ViashError Bad arguments for option \'--plots=*\': \'$VIASH_PAR_PLOTS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PLOTS=$(ViashRemoveFlags "$1") + shift 1 + ;; + --legacy) + [ -n "$VIASH_PAR_LEGACY" ] && ViashError Bad arguments for option \'--legacy\': \'$VIASH_PAR_LEGACY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_LEGACY="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --legacy. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --legacy=*) + [ -n "$VIASH_PAR_LEGACY" ] && ViashError Bad arguments for option \'--legacy=*\': \'$VIASH_PAR_LEGACY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_LEGACY=$(ViashRemoveFlags "$1") + shift 1 + ;; + --listcolors) + [ -n "$VIASH_PAR_LISTCOLORS" ] && ViashError Bad arguments for option \'--listcolors\': \'$VIASH_PAR_LISTCOLORS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_LISTCOLORS=true + shift 1 + ;; + --listcolormaps) + [ -n "$VIASH_PAR_LISTCOLORMAPS" ] && ViashError Bad arguments for option \'--listcolormaps\': \'$VIASH_PAR_LISTCOLORMAPS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_LISTCOLORMAPS=true + shift 1 + ;; + --no_N50) + [ -n "$VIASH_PAR_NO_N50" ] && ViashError Bad arguments for option \'--no_N50\': \'$VIASH_PAR_NO_N50\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_NO_N50=false + shift 1 + ;; + --N50) + [ -n "$VIASH_PAR_N50" ] && ViashError Bad arguments for option \'--N50\': \'$VIASH_PAR_N50\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_N50=true + shift 1 + ;; + --title) + [ -n "$VIASH_PAR_TITLE" ] && ViashError Bad arguments for option \'--title\': \'$VIASH_PAR_TITLE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_TITLE="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --title. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --title=*) + [ -n "$VIASH_PAR_TITLE" ] && ViashError Bad arguments for option \'--title=*\': \'$VIASH_PAR_TITLE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_TITLE=$(ViashRemoveFlags "$1") + shift 1 + ;; + --font_scale) + [ -n "$VIASH_PAR_FONT_SCALE" ] && ViashError Bad arguments for option \'--font_scale\': \'$VIASH_PAR_FONT_SCALE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FONT_SCALE="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --font_scale. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --font_scale=*) + [ -n "$VIASH_PAR_FONT_SCALE" ] && ViashError Bad arguments for option \'--font_scale=*\': \'$VIASH_PAR_FONT_SCALE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FONT_SCALE=$(ViashRemoveFlags "$1") + shift 1 + ;; + --dpi) + [ -n "$VIASH_PAR_DPI" ] && ViashError Bad arguments for option \'--dpi\': \'$VIASH_PAR_DPI\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_DPI="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --dpi. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --dpi=*) + [ -n "$VIASH_PAR_DPI" ] && ViashError Bad arguments for option \'--dpi=*\': \'$VIASH_PAR_DPI\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_DPI=$(ViashRemoveFlags "$1") + shift 1 + ;; + --hide_stats) + [ -n "$VIASH_PAR_HIDE_STATS" ] && ViashError Bad arguments for option \'--hide_stats\': \'$VIASH_PAR_HIDE_STATS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_HIDE_STATS=false + shift 1 + ;; + ---engine) + VIASH_ENGINE_ID="$2" + shift 2 + ;; + ---engine=*) + VIASH_ENGINE_ID="$(ViashRemoveFlags "$1")" + shift 1 + ;; + ---setup) + VIASH_MODE='setup' + VIASH_SETUP_STRATEGY="$2" + shift 2 + ;; + ---setup=*) + VIASH_MODE='setup' + VIASH_SETUP_STRATEGY="$(ViashRemoveFlags "$1")" + shift 1 + ;; + ---dockerfile) + VIASH_MODE='dockerfile' + shift 1 + ;; + ---docker_run_args) + VIASH_DOCKER_RUN_ARGS+=("$2") + shift 2 + ;; + ---docker_run_args=*) + VIASH_DOCKER_RUN_ARGS+=("$(ViashRemoveFlags "$1")") + shift 1 + ;; + ---docker_image_id) + VIASH_MODE='docker_image_id' + shift 1 + ;; + ---debug) + VIASH_MODE='debug' + shift 1 + ;; + ---cpus) + [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_CPUS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to ---cpus. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + ---cpus=*) + [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus=*\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_CPUS=$(ViashRemoveFlags "$1") + shift 1 + ;; + ---memory) + [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_MEMORY="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to ---memory. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + ---memory=*) + [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory=*\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_MEMORY=$(ViashRemoveFlags "$1") + shift 1 + ;; + *) # positional arg or unknown option + # since the positional args will be eval'd, can we always quote, instead of using ViashQuote + VIASH_POSITIONAL_ARGS="$VIASH_POSITIONAL_ARGS '$1'" + [[ $1 == -* ]] && ViashWarning $1 looks like a parameter but is not a defined parameter and will instead be treated as a positional argument. Use "--help" to get more information on the parameters. + shift # past argument + ;; + esac +done + +# parse positional parameters +eval set -- $VIASH_POSITIONAL_ARGS + + +if [ "$VIASH_ENGINE_ID" == "native" ] ; then + VIASH_ENGINE_TYPE='native' +elif [ "$VIASH_ENGINE_ID" == "docker" ] ; then + VIASH_ENGINE_TYPE='docker' +else + ViashError "Engine '$VIASH_ENGINE_ID' is not recognized. Options are: docker, native." + exit 1 +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # check if docker is installed properly + ViashDockerInstallationCheck + + # determine docker image id + if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then + VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/nanoplot:main' + fi + + # print dockerfile + if [ "$VIASH_MODE" == "dockerfile" ]; then + ViashDockerfile "$VIASH_ENGINE_ID" + exit 0 + + elif [ "$VIASH_MODE" == "docker_image_id" ]; then + echo "$VIASH_DOCKER_IMAGE_ID" + exit 0 + + # enter docker container + elif [[ "$VIASH_MODE" == "debug" ]]; then + VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} -v '$(pwd)':/pwd --workdir /pwd -t $VIASH_DOCKER_IMAGE_ID" + ViashNotice "+ $VIASH_CMD" + eval $VIASH_CMD + exit + + # build docker image + elif [ "$VIASH_MODE" == "setup" ]; then + ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" "$VIASH_SETUP_STRATEGY" + ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash' + exit 0 + fi + + # check if docker image exists + ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" ifneedbepullelsecachedbuild + ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash' +fi + +# setting computational defaults + +# helper function for parsing memory strings +function ViashMemoryAsBytes { + local memory=`echo "$1" | tr '[:upper:]' '[:lower:]' | tr -d '[:space:]'` + local memory_regex='^([0-9]+)([kmgtp]i?b?|b)$' + if [[ $memory =~ $memory_regex ]]; then + local number=${memory/[^0-9]*/} + local symbol=${memory/*[0-9]/} + + case $symbol in + b) memory_b=$number ;; + kb|k) memory_b=$(( $number * 1000 )) ;; + mb|m) memory_b=$(( $number * 1000 * 1000 )) ;; + gb|g) memory_b=$(( $number * 1000 * 1000 * 1000 )) ;; + tb|t) memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 )) ;; + pb|p) memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 * 1000 )) ;; + kib|ki) memory_b=$(( $number * 1024 )) ;; + mib|mi) memory_b=$(( $number * 1024 * 1024 )) ;; + gib|gi) memory_b=$(( $number * 1024 * 1024 * 1024 )) ;; + tib|ti) memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 )) ;; + pib|pi) memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 * 1024 )) ;; + esac + echo "$memory_b" + fi +} +# compute memory in different units +if [ ! -z ${VIASH_META_MEMORY+x} ]; then + VIASH_META_MEMORY_B=`ViashMemoryAsBytes $VIASH_META_MEMORY` + # do not define other variables if memory_b is an empty string + if [ ! -z "$VIASH_META_MEMORY_B" ]; then + VIASH_META_MEMORY_KB=$(( ($VIASH_META_MEMORY_B+999) / 1000 )) + VIASH_META_MEMORY_MB=$(( ($VIASH_META_MEMORY_KB+999) / 1000 )) + VIASH_META_MEMORY_GB=$(( ($VIASH_META_MEMORY_MB+999) / 1000 )) + VIASH_META_MEMORY_TB=$(( ($VIASH_META_MEMORY_GB+999) / 1000 )) + VIASH_META_MEMORY_PB=$(( ($VIASH_META_MEMORY_TB+999) / 1000 )) + VIASH_META_MEMORY_KIB=$(( ($VIASH_META_MEMORY_B+1023) / 1024 )) + VIASH_META_MEMORY_MIB=$(( ($VIASH_META_MEMORY_KIB+1023) / 1024 )) + VIASH_META_MEMORY_GIB=$(( ($VIASH_META_MEMORY_MIB+1023) / 1024 )) + VIASH_META_MEMORY_TIB=$(( ($VIASH_META_MEMORY_GIB+1023) / 1024 )) + VIASH_META_MEMORY_PIB=$(( ($VIASH_META_MEMORY_TIB+1023) / 1024 )) + else + # unset memory if string is empty + unset $VIASH_META_MEMORY_B + fi +fi +# unset nproc if string is empty +if [ -z "$VIASH_META_CPUS" ]; then + unset $VIASH_META_CPUS +fi + + +# check whether required parameters exist +if [ -z ${VIASH_PAR_OUTDIR+x} ]; then + ViashError '--outdir' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_NAME+x} ]; then + ViashError 'name' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then + ViashError 'functionality_name' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_RESOURCES_DIR+x} ]; then + ViashError 'resources_dir' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_EXECUTABLE+x} ]; then + ViashError 'executable' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_CONFIG+x} ]; then + ViashError 'config' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_TEMP_DIR+x} ]; then + ViashError 'temp_dir' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi + +# filling in defaults +if [ -z ${VIASH_PAR_VERBOSE+x} ]; then + VIASH_PAR_VERBOSE="false" +fi +if [ -z ${VIASH_PAR_STORE+x} ]; then + VIASH_PAR_STORE="false" +fi +if [ -z ${VIASH_PAR_RAW+x} ]; then + VIASH_PAR_RAW="false" +fi +if [ -z ${VIASH_PAR_HUGE+x} ]; then + VIASH_PAR_HUGE="false" +fi +if [ -z ${VIASH_PAR_NO_STATIC+x} ]; then + VIASH_PAR_NO_STATIC="true" +fi +if [ -z ${VIASH_PAR_TSV_STATS+x} ]; then + VIASH_PAR_TSV_STATS="false" +fi +if [ -z ${VIASH_PAR_ONLY_REPORT+x} ]; then + VIASH_PAR_ONLY_REPORT="false" +fi +if [ -z ${VIASH_PAR_INFO_IN_REPORT+x} ]; then + VIASH_PAR_INFO_IN_REPORT="false" +fi +if [ -z ${VIASH_PAR_DROP_OUTLIERS+x} ]; then + VIASH_PAR_DROP_OUTLIERS="true" +fi +if [ -z ${VIASH_PAR_LOGLENGTH+x} ]; then + VIASH_PAR_LOGLENGTH="false" +fi +if [ -z ${VIASH_PAR_PERCENTQUAL+x} ]; then + VIASH_PAR_PERCENTQUAL="false" +fi +if [ -z ${VIASH_PAR_ALENGTH+x} ]; then + VIASH_PAR_ALENGTH="false" +fi +if [ -z ${VIASH_PAR_BARCODED+x} ]; then + VIASH_PAR_BARCODED="false" +fi +if [ -z ${VIASH_PAR_NO_SUPPLEMENTARY+x} ]; then + VIASH_PAR_NO_SUPPLEMENTARY="true" +fi +if [ -z ${VIASH_PAR_FORMAT+x} ]; then + VIASH_PAR_FORMAT="png" +fi +if [ -z ${VIASH_PAR_LISTCOLORS+x} ]; then + VIASH_PAR_LISTCOLORS="false" +fi +if [ -z ${VIASH_PAR_LISTCOLORMAPS+x} ]; then + VIASH_PAR_LISTCOLORMAPS="false" +fi +if [ -z ${VIASH_PAR_NO_N50+x} ]; then + VIASH_PAR_NO_N50="true" +fi +if [ -z ${VIASH_PAR_N50+x} ]; then + VIASH_PAR_N50="false" +fi +if [ -z ${VIASH_PAR_HIDE_STATS+x} ]; then + VIASH_PAR_HIDE_STATS="true" +fi + +# check whether required files exist +if [ ! -z "$VIASH_PAR_FASTQ" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_FASTQ; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_FASTA" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_FASTA; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_FASTQ_RICH" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_FASTQ_RICH; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_FASTQ_MINIMAL" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_FASTQ_MINIMAL; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_SUMMARY" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_SUMMARY; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_BAM" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_BAM; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_UBAM" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_UBAM; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_CRAM" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_CRAM; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_PICKLE" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_PICKLE; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_FEATHER" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_FEATHER; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi + +# check whether parameters values are of the right type +if [[ -n "$VIASH_PAR_VERBOSE" ]]; then + if ! [[ "$VIASH_PAR_VERBOSE" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--verbose' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_STORE" ]]; then + if ! [[ "$VIASH_PAR_STORE" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--store' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_RAW" ]]; then + if ! [[ "$VIASH_PAR_RAW" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--raw' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_HUGE" ]]; then + if ! [[ "$VIASH_PAR_HUGE" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--huge' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_NO_STATIC" ]]; then + if ! [[ "$VIASH_PAR_NO_STATIC" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--no_static' has to be a boolean_false. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_TSV_STATS" ]]; then + if ! [[ "$VIASH_PAR_TSV_STATS" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--tsv_stats' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_ONLY_REPORT" ]]; then + if ! [[ "$VIASH_PAR_ONLY_REPORT" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--only_report' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_INFO_IN_REPORT" ]]; then + if ! [[ "$VIASH_PAR_INFO_IN_REPORT" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--info_in_report' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_MAXLENGTH" ]]; then + if ! [[ "$VIASH_PAR_MAXLENGTH" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--maxlength' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_MINLENGTH" ]]; then + if ! [[ "$VIASH_PAR_MINLENGTH" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--minlength' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_DROP_OUTLIERS" ]]; then + if ! [[ "$VIASH_PAR_DROP_OUTLIERS" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--drop_outliers' has to be a boolean_false. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_DOWNSAMPLE" ]]; then + if ! [[ "$VIASH_PAR_DOWNSAMPLE" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--downsample' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_LOGLENGTH" ]]; then + if ! [[ "$VIASH_PAR_LOGLENGTH" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--loglength' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_PERCENTQUAL" ]]; then + if ! [[ "$VIASH_PAR_PERCENTQUAL" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--percentqual' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_ALENGTH" ]]; then + if ! [[ "$VIASH_PAR_ALENGTH" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--alength' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_MINQUAL" ]]; then + if ! [[ "$VIASH_PAR_MINQUAL" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--minqual' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_RUNTIME_UNTIL" ]]; then + if ! [[ "$VIASH_PAR_RUNTIME_UNTIL" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--runtime_until' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_BARCODED" ]]; then + if ! [[ "$VIASH_PAR_BARCODED" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--barcoded' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_NO_SUPPLEMENTARY" ]]; then + if ! [[ "$VIASH_PAR_NO_SUPPLEMENTARY" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--no_supplementary' has to be a boolean_false. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_LISTCOLORS" ]]; then + if ! [[ "$VIASH_PAR_LISTCOLORS" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--listcolors' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_LISTCOLORMAPS" ]]; then + if ! [[ "$VIASH_PAR_LISTCOLORMAPS" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--listcolormaps' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_NO_N50" ]]; then + if ! [[ "$VIASH_PAR_NO_N50" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--no_N50' has to be a boolean_false. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_N50" ]]; then + if ! [[ "$VIASH_PAR_N50" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--N50' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_FONT_SCALE" ]]; then + if ! [[ "$VIASH_PAR_FONT_SCALE" =~ ^[-+]?(\.[0-9]+|[0-9]+(\.[0-9]*)?)([eE][-+]?[0-9]+)?$ ]]; then + ViashError '--font_scale' has to be a double. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_DPI" ]]; then + if ! [[ "$VIASH_PAR_DPI" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--dpi' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_HIDE_STATS" ]]; then + if ! [[ "$VIASH_PAR_HIDE_STATS" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--hide_stats' has to be a boolean_false. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_CPUS" ]]; then + if ! [[ "$VIASH_META_CPUS" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'cpus' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_B" ]]; then + if ! [[ "$VIASH_META_MEMORY_B" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_b' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_KB" ]]; then + if ! [[ "$VIASH_META_MEMORY_KB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_kb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_MB" ]]; then + if ! [[ "$VIASH_META_MEMORY_MB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_mb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_GB" ]]; then + if ! [[ "$VIASH_META_MEMORY_GB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_gb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_TB" ]]; then + if ! [[ "$VIASH_META_MEMORY_TB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_tb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_PB" ]]; then + if ! [[ "$VIASH_META_MEMORY_PB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_pb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_KIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_KIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_kib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_MIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_MIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_mib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_GIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_GIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_gib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_TIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_TIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_tib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_PIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_PIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_pib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi + +# create parent directories of output files, if so desired +if [ ! -z "$VIASH_PAR_OUTDIR" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTDIR")" ]; then + mkdir -p "$(dirname "$VIASH_PAR_OUTDIR")" +fi + +if [ "$VIASH_ENGINE_ID" == "native" ] ; then + if [ "$VIASH_MODE" == "run" ]; then + VIASH_CMD="bash" + else + ViashError "Engine '$VIASH_ENGINE_ID' does not support mode '$VIASH_MODE'." + exit 1 + fi +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # detect volumes from file arguments + VIASH_CHOWN_VARS=() +if [ ! -z "$VIASH_PAR_FASTQ" ]; then + VIASH_TEST_FASTQ=() + IFS=';' + for var in $VIASH_PAR_FASTQ; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_FASTQ+=( "$var" ) + done + VIASH_PAR_FASTQ=$(IFS=';' ; echo "${VIASH_TEST_FASTQ[*]}") +fi +if [ ! -z "$VIASH_PAR_FASTA" ]; then + VIASH_TEST_FASTA=() + IFS=';' + for var in $VIASH_PAR_FASTA; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_FASTA+=( "$var" ) + done + VIASH_PAR_FASTA=$(IFS=';' ; echo "${VIASH_TEST_FASTA[*]}") +fi +if [ ! -z "$VIASH_PAR_FASTQ_RICH" ]; then + VIASH_TEST_FASTQ_RICH=() + IFS=';' + for var in $VIASH_PAR_FASTQ_RICH; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_FASTQ_RICH+=( "$var" ) + done + VIASH_PAR_FASTQ_RICH=$(IFS=';' ; echo "${VIASH_TEST_FASTQ_RICH[*]}") +fi +if [ ! -z "$VIASH_PAR_FASTQ_MINIMAL" ]; then + VIASH_TEST_FASTQ_MINIMAL=() + IFS=';' + for var in $VIASH_PAR_FASTQ_MINIMAL; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_FASTQ_MINIMAL+=( "$var" ) + done + VIASH_PAR_FASTQ_MINIMAL=$(IFS=';' ; echo "${VIASH_TEST_FASTQ_MINIMAL[*]}") +fi +if [ ! -z "$VIASH_PAR_SUMMARY" ]; then + VIASH_TEST_SUMMARY=() + IFS=';' + for var in $VIASH_PAR_SUMMARY; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_SUMMARY+=( "$var" ) + done + VIASH_PAR_SUMMARY=$(IFS=';' ; echo "${VIASH_TEST_SUMMARY[*]}") +fi +if [ ! -z "$VIASH_PAR_BAM" ]; then + VIASH_TEST_BAM=() + IFS=';' + for var in $VIASH_PAR_BAM; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_BAM+=( "$var" ) + done + VIASH_PAR_BAM=$(IFS=';' ; echo "${VIASH_TEST_BAM[*]}") +fi +if [ ! -z "$VIASH_PAR_UBAM" ]; then + VIASH_TEST_UBAM=() + IFS=';' + for var in $VIASH_PAR_UBAM; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_UBAM+=( "$var" ) + done + VIASH_PAR_UBAM=$(IFS=';' ; echo "${VIASH_TEST_UBAM[*]}") +fi +if [ ! -z "$VIASH_PAR_CRAM" ]; then + VIASH_TEST_CRAM=() + IFS=';' + for var in $VIASH_PAR_CRAM; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_CRAM+=( "$var" ) + done + VIASH_PAR_CRAM=$(IFS=';' ; echo "${VIASH_TEST_CRAM[*]}") +fi +if [ ! -z "$VIASH_PAR_PICKLE" ]; then + VIASH_TEST_PICKLE=() + IFS=';' + for var in $VIASH_PAR_PICKLE; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_PICKLE+=( "$var" ) + done + VIASH_PAR_PICKLE=$(IFS=';' ; echo "${VIASH_TEST_PICKLE[*]}") +fi +if [ ! -z "$VIASH_PAR_FEATHER" ]; then + VIASH_TEST_FEATHER=() + IFS=';' + for var in $VIASH_PAR_FEATHER; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_FEATHER+=( "$var" ) + done + VIASH_PAR_FEATHER=$(IFS=';' ; echo "${VIASH_TEST_FEATHER[*]}") +fi +if [ ! -z "$VIASH_PAR_OUTDIR" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTDIR")" ) + VIASH_PAR_OUTDIR=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTDIR") + VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTDIR" ) +fi +if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" ) + VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR") +fi +if [ ! -z "$VIASH_META_EXECUTABLE" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_EXECUTABLE")" ) + VIASH_META_EXECUTABLE=$(ViashDockerAutodetectMount "$VIASH_META_EXECUTABLE") +fi +if [ ! -z "$VIASH_META_CONFIG" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_CONFIG")" ) + VIASH_META_CONFIG=$(ViashDockerAutodetectMount "$VIASH_META_CONFIG") +fi +if [ ! -z "$VIASH_META_TEMP_DIR" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_TEMP_DIR")" ) + VIASH_META_TEMP_DIR=$(ViashDockerAutodetectMount "$VIASH_META_TEMP_DIR") +fi + + # get unique mounts + VIASH_UNIQUE_MOUNTS=($(for val in "${VIASH_DIRECTORY_MOUNTS[@]}"; do echo "$val"; done | sort -u)) +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # change file ownership + function ViashPerformChown { + if (( ${#VIASH_CHOWN_VARS[@]} )); then + set +e + VIASH_CMD="docker run --entrypoint=bash --rm ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID -c 'chown $(id -u):$(id -g) --silent --recursive ${VIASH_CHOWN_VARS[@]}'" + ViashDebug "+ $VIASH_CMD" + eval $VIASH_CMD + set -e + fi + } + trap ViashPerformChown EXIT +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # helper function for filling in extra docker args + if [ ! -z "$VIASH_META_MEMORY_B" ]; then + VIASH_DOCKER_RUN_ARGS+=("--memory=${VIASH_META_MEMORY_B}") + fi + if [ ! -z "$VIASH_META_CPUS" ]; then + VIASH_DOCKER_RUN_ARGS+=("--cpus=${VIASH_META_CPUS}") + fi +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID" +fi + + +# set dependency paths + + +ViashDebug "Running command: $(echo $VIASH_CMD)" +cat << VIASHEOF | eval $VIASH_CMD +set -e +tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-nanoplot-XXXXXX").sh +function clean_up { + rm "\$tempscript" +} +function interrupt { + echo -e "\nCTRL-C Pressed..." + exit 1 +} +trap clean_up EXIT +trap interrupt INT SIGINT +cat > "\$tempscript" << 'VIASHMAIN' +#!/bin/bash + +set -eo pipefail + +## VIASH START +# The following code has been auto-generated by Viash. +$( if [ ! -z ${VIASH_PAR_FASTQ+x} ]; then echo "${VIASH_PAR_FASTQ}" | sed "s#'#'\"'\"'#g;s#.*#par_fastq='&'#" ; else echo "# par_fastq="; fi ) +$( if [ ! -z ${VIASH_PAR_FASTA+x} ]; then echo "${VIASH_PAR_FASTA}" | sed "s#'#'\"'\"'#g;s#.*#par_fasta='&'#" ; else echo "# par_fasta="; fi ) +$( if [ ! -z ${VIASH_PAR_FASTQ_RICH+x} ]; then echo "${VIASH_PAR_FASTQ_RICH}" | sed "s#'#'\"'\"'#g;s#.*#par_fastq_rich='&'#" ; else echo "# par_fastq_rich="; fi ) +$( if [ ! -z ${VIASH_PAR_FASTQ_MINIMAL+x} ]; then echo "${VIASH_PAR_FASTQ_MINIMAL}" | sed "s#'#'\"'\"'#g;s#.*#par_fastq_minimal='&'#" ; else echo "# par_fastq_minimal="; fi ) +$( if [ ! -z ${VIASH_PAR_SUMMARY+x} ]; then echo "${VIASH_PAR_SUMMARY}" | sed "s#'#'\"'\"'#g;s#.*#par_summary='&'#" ; else echo "# par_summary="; fi ) +$( if [ ! -z ${VIASH_PAR_BAM+x} ]; then echo "${VIASH_PAR_BAM}" | sed "s#'#'\"'\"'#g;s#.*#par_bam='&'#" ; else echo "# par_bam="; fi ) +$( if [ ! -z ${VIASH_PAR_UBAM+x} ]; then echo "${VIASH_PAR_UBAM}" | sed "s#'#'\"'\"'#g;s#.*#par_ubam='&'#" ; else echo "# par_ubam="; fi ) +$( if [ ! -z ${VIASH_PAR_CRAM+x} ]; then echo "${VIASH_PAR_CRAM}" | sed "s#'#'\"'\"'#g;s#.*#par_cram='&'#" ; else echo "# par_cram="; fi ) +$( if [ ! -z ${VIASH_PAR_PICKLE+x} ]; then echo "${VIASH_PAR_PICKLE}" | sed "s#'#'\"'\"'#g;s#.*#par_pickle='&'#" ; else echo "# par_pickle="; fi ) +$( if [ ! -z ${VIASH_PAR_FEATHER+x} ]; then echo "${VIASH_PAR_FEATHER}" | sed "s#'#'\"'\"'#g;s#.*#par_feather='&'#" ; else echo "# par_feather="; fi ) +$( if [ ! -z ${VIASH_PAR_OUTDIR+x} ]; then echo "${VIASH_PAR_OUTDIR}" | sed "s#'#'\"'\"'#g;s#.*#par_outdir='&'#" ; else echo "# par_outdir="; fi ) +$( if [ ! -z ${VIASH_PAR_VERBOSE+x} ]; then echo "${VIASH_PAR_VERBOSE}" | sed "s#'#'\"'\"'#g;s#.*#par_verbose='&'#" ; else echo "# par_verbose="; fi ) +$( if [ ! -z ${VIASH_PAR_STORE+x} ]; then echo "${VIASH_PAR_STORE}" | sed "s#'#'\"'\"'#g;s#.*#par_store='&'#" ; else echo "# par_store="; fi ) +$( if [ ! -z ${VIASH_PAR_RAW+x} ]; then echo "${VIASH_PAR_RAW}" | sed "s#'#'\"'\"'#g;s#.*#par_raw='&'#" ; else echo "# par_raw="; fi ) +$( if [ ! -z ${VIASH_PAR_HUGE+x} ]; then echo "${VIASH_PAR_HUGE}" | sed "s#'#'\"'\"'#g;s#.*#par_huge='&'#" ; else echo "# par_huge="; fi ) +$( if [ ! -z ${VIASH_PAR_NO_STATIC+x} ]; then echo "${VIASH_PAR_NO_STATIC}" | sed "s#'#'\"'\"'#g;s#.*#par_no_static='&'#" ; else echo "# par_no_static="; fi ) +$( if [ ! -z ${VIASH_PAR_PREFIX+x} ]; then echo "${VIASH_PAR_PREFIX}" | sed "s#'#'\"'\"'#g;s#.*#par_prefix='&'#" ; else echo "# par_prefix="; fi ) +$( if [ ! -z ${VIASH_PAR_TSV_STATS+x} ]; then echo "${VIASH_PAR_TSV_STATS}" | sed "s#'#'\"'\"'#g;s#.*#par_tsv_stats='&'#" ; else echo "# par_tsv_stats="; fi ) +$( if [ ! -z ${VIASH_PAR_ONLY_REPORT+x} ]; then echo "${VIASH_PAR_ONLY_REPORT}" | sed "s#'#'\"'\"'#g;s#.*#par_only_report='&'#" ; else echo "# par_only_report="; fi ) +$( if [ ! -z ${VIASH_PAR_INFO_IN_REPORT+x} ]; then echo "${VIASH_PAR_INFO_IN_REPORT}" | sed "s#'#'\"'\"'#g;s#.*#par_info_in_report='&'#" ; else echo "# par_info_in_report="; fi ) +$( if [ ! -z ${VIASH_PAR_MAXLENGTH+x} ]; then echo "${VIASH_PAR_MAXLENGTH}" | sed "s#'#'\"'\"'#g;s#.*#par_maxlength='&'#" ; else echo "# par_maxlength="; fi ) +$( if [ ! -z ${VIASH_PAR_MINLENGTH+x} ]; then echo "${VIASH_PAR_MINLENGTH}" | sed "s#'#'\"'\"'#g;s#.*#par_minlength='&'#" ; else echo "# par_minlength="; fi ) +$( if [ ! -z ${VIASH_PAR_DROP_OUTLIERS+x} ]; then echo "${VIASH_PAR_DROP_OUTLIERS}" | sed "s#'#'\"'\"'#g;s#.*#par_drop_outliers='&'#" ; else echo "# par_drop_outliers="; fi ) +$( if [ ! -z ${VIASH_PAR_DOWNSAMPLE+x} ]; then echo "${VIASH_PAR_DOWNSAMPLE}" | sed "s#'#'\"'\"'#g;s#.*#par_downsample='&'#" ; else echo "# par_downsample="; fi ) +$( if [ ! -z ${VIASH_PAR_LOGLENGTH+x} ]; then echo "${VIASH_PAR_LOGLENGTH}" | sed "s#'#'\"'\"'#g;s#.*#par_loglength='&'#" ; else echo "# par_loglength="; fi ) +$( if [ ! -z ${VIASH_PAR_PERCENTQUAL+x} ]; then echo "${VIASH_PAR_PERCENTQUAL}" | sed "s#'#'\"'\"'#g;s#.*#par_percentqual='&'#" ; else echo "# par_percentqual="; fi ) +$( if [ ! -z ${VIASH_PAR_ALENGTH+x} ]; then echo "${VIASH_PAR_ALENGTH}" | sed "s#'#'\"'\"'#g;s#.*#par_alength='&'#" ; else echo "# par_alength="; fi ) +$( if [ ! -z ${VIASH_PAR_MINQUAL+x} ]; then echo "${VIASH_PAR_MINQUAL}" | sed "s#'#'\"'\"'#g;s#.*#par_minqual='&'#" ; else echo "# par_minqual="; fi ) +$( if [ ! -z ${VIASH_PAR_RUNTIME_UNTIL+x} ]; then echo "${VIASH_PAR_RUNTIME_UNTIL}" | sed "s#'#'\"'\"'#g;s#.*#par_runtime_until='&'#" ; else echo "# par_runtime_until="; fi ) +$( if [ ! -z ${VIASH_PAR_READTYPE+x} ]; then echo "${VIASH_PAR_READTYPE}" | sed "s#'#'\"'\"'#g;s#.*#par_readtype='&'#" ; else echo "# par_readtype="; fi ) +$( if [ ! -z ${VIASH_PAR_BARCODED+x} ]; then echo "${VIASH_PAR_BARCODED}" | sed "s#'#'\"'\"'#g;s#.*#par_barcoded='&'#" ; else echo "# par_barcoded="; fi ) +$( if [ ! -z ${VIASH_PAR_NO_SUPPLEMENTARY+x} ]; then echo "${VIASH_PAR_NO_SUPPLEMENTARY}" | sed "s#'#'\"'\"'#g;s#.*#par_no_supplementary='&'#" ; else echo "# par_no_supplementary="; fi ) +$( if [ ! -z ${VIASH_PAR_COLOR+x} ]; then echo "${VIASH_PAR_COLOR}" | sed "s#'#'\"'\"'#g;s#.*#par_color='&'#" ; else echo "# par_color="; fi ) +$( if [ ! -z ${VIASH_PAR_COLORMAP+x} ]; then echo "${VIASH_PAR_COLORMAP}" | sed "s#'#'\"'\"'#g;s#.*#par_colormap='&'#" ; else echo "# par_colormap="; fi ) +$( if [ ! -z ${VIASH_PAR_FORMAT+x} ]; then echo "${VIASH_PAR_FORMAT}" | sed "s#'#'\"'\"'#g;s#.*#par_format='&'#" ; else echo "# par_format="; fi ) +$( if [ ! -z ${VIASH_PAR_PLOTS+x} ]; then echo "${VIASH_PAR_PLOTS}" | sed "s#'#'\"'\"'#g;s#.*#par_plots='&'#" ; else echo "# par_plots="; fi ) +$( if [ ! -z ${VIASH_PAR_LEGACY+x} ]; then echo "${VIASH_PAR_LEGACY}" | sed "s#'#'\"'\"'#g;s#.*#par_legacy='&'#" ; else echo "# par_legacy="; fi ) +$( if [ ! -z ${VIASH_PAR_LISTCOLORS+x} ]; then echo "${VIASH_PAR_LISTCOLORS}" | sed "s#'#'\"'\"'#g;s#.*#par_listcolors='&'#" ; else echo "# par_listcolors="; fi ) +$( if [ ! -z ${VIASH_PAR_LISTCOLORMAPS+x} ]; then echo "${VIASH_PAR_LISTCOLORMAPS}" | sed "s#'#'\"'\"'#g;s#.*#par_listcolormaps='&'#" ; else echo "# par_listcolormaps="; fi ) +$( if [ ! -z ${VIASH_PAR_NO_N50+x} ]; then echo "${VIASH_PAR_NO_N50}" | sed "s#'#'\"'\"'#g;s#.*#par_no_N50='&'#" ; else echo "# par_no_N50="; fi ) +$( if [ ! -z ${VIASH_PAR_N50+x} ]; then echo "${VIASH_PAR_N50}" | sed "s#'#'\"'\"'#g;s#.*#par_N50='&'#" ; else echo "# par_N50="; fi ) +$( if [ ! -z ${VIASH_PAR_TITLE+x} ]; then echo "${VIASH_PAR_TITLE}" | sed "s#'#'\"'\"'#g;s#.*#par_title='&'#" ; else echo "# par_title="; fi ) +$( if [ ! -z ${VIASH_PAR_FONT_SCALE+x} ]; then echo "${VIASH_PAR_FONT_SCALE}" | sed "s#'#'\"'\"'#g;s#.*#par_font_scale='&'#" ; else echo "# par_font_scale="; fi ) +$( if [ ! -z ${VIASH_PAR_DPI+x} ]; then echo "${VIASH_PAR_DPI}" | sed "s#'#'\"'\"'#g;s#.*#par_dpi='&'#" ; else echo "# par_dpi="; fi ) +$( if [ ! -z ${VIASH_PAR_HIDE_STATS+x} ]; then echo "${VIASH_PAR_HIDE_STATS}" | sed "s#'#'\"'\"'#g;s#.*#par_hide_stats='&'#" ; else echo "# par_hide_stats="; fi ) +$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi ) +$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi ) +$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi ) +$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\"'\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi ) +$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi ) +$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi ) +$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\"'\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi ) + +## VIASH END + +# Unset flags +unset_if_false=( + par_verbose + par_store + par_raw + par_huge + par_no_static + par_tsv_stats + par_only_report + par_info_in_report + par_drop_outliers + par_loglength + par_percentqual + par_alength + par_barcoded + par_no_supplementary + par_listcolors + par_listcolormaps + par_no_N50 + par_N50 + par_hide_stats +) + +for var in "\${unset_if_false[@]}"; do + test_val="\${!var}" + [[ "\$test_val" == "false" ]] && unset \$var +done + +par_fastq="\${par_fastq//;/ }" +par_fasta="\${par_fasta//;/ }" +par_fastq_rich="\${par_fastq_rich//;/ }" +par_fastq_minimal="\${par_fastq_minimal//;/ }" +par_summary="\${par_summary//;/ }" +par_bam="\${par_bam//;/ }" +par_ubam="\${par_ubam//;/ }" +par_cram="\${par_cram//;/ }" +par_pickle="\${par_pickle//;/ }" +par_feather="\${par_feather//;/ }" + + +inputs=( + "\$par_fastq" + "\$par_fasta" + "\$par_fastq_rich" + "\$par_fastq_minimal" + "\$par_summary" + "\$par_bam" + "\$par_ubam" + "\$par_cram" + "\$par_pickle" + "\$par_feather" +) + +one_input=false +for var in "\${inputs[@]}"; do + if [ -n "\$var" ]; then # if the parameter is not empty + if [ "\$one_input" = "false" ]; then + one_input=true + else # Multiple input file types specified + echo "Error: Multiple input file types specified." + exit 1 + fi + fi +done + +if [ ! "\$one_input" ]; then + echo "Error: No input file type specified." + exit 1 +fi + + + +# Run NanoPlot +NanoPlot \\ + \${par_fastq:+--fastq \$par_fastq} \\ + \${par_fasta:+--fasta \$par_fasta} \\ + \${par_fastq_rich:+--fastq_rich \$par_fastq_rich} \\ + \${par_fastq_minimal:+--fastq_minimal \$par_fastq_minimal} \\ + \${par_summary:+--summary \$par_summary} \\ + \${par_bam:+--bam \$par_bam} \\ + \${par_ubam:+--ubam \$par_ubam} \\ + \${par_cram:+--cram \$par_cram} \\ + \${par_pickle:+--pickle \$par_pickle} \\ + \${par_feather:+--feather \$par_feather} \\ + \${par_verbose:+--verbose} \\ + \${par_store:+--store} \\ + \${par_raw:+--raw} \\ + \${par_huge:+--huge} \\ + \${par_no_static:+--no_static} \\ + \${par_prefix:+--prefix "\$par_prefix"} \\ + \${par_tsv_stats:+--tsv_stats} \\ + \${par_only_report:+--only-report} \\ + \${par_info_in_report:+--info_in_report} \\ + \${par_maxlength:+--maxlength "\$par_maxlength"} \\ + \${par_minlength:+--minlength "\$par_minlength"} \\ + \${par_drop_outliers:+--drop_outliers} \\ + \${par_downsample:+--downsample "\$par_downsample"} \\ + \${par_loglength:+--loglength} \\ + \${par_percentqual:+--percentqual} \\ + \${par_alength:+--alength} \\ + \${par_minqual:+--minqual "\$par_minqual"} \\ + \${par_runtime_until:+--runtime_until "\$par_runtime_until"} \\ + \${par_readtype:+--readtype "\$par_readtype"} \\ + \${par_barcoded:+--barcoded} \\ + \${par_no_supplementary:+--no_supplementary} \\ + \${par_color:+--color "\$par_color"} \\ + \${par_colormap:+--colormap "\$par_colormap"} \\ + \${par_format:+--format "\$par_format"} \\ + \${par_plots:+--plots "\$par_plots"} \\ + \${par_legacy:+--legacy "\$par_legacy"} \\ + \${par_listcolors:+--listcolors} \\ + \${par_listcolormaps:+--listcolormaps} \\ + \${par_no_N50:+--no-N50} \\ + \${par_N50:+--N50} \\ + \${par_title:+--title "\$par_title"} \\ + \${par_font_scale:+--font_scale "\$par_font_scale"} \\ + \${par_dpi:+--dpi "\$par_dpi"} \\ + \${par_hide_stats:+--hide_stats} \\ + \${meta_cpus:+--threads "\$meta_cpus"} \\ + --outdir "\$par_outdir" + +exit 0 +VIASHMAIN +bash "\$tempscript" & +wait "\$!" + +VIASHEOF + + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # strip viash automount from file paths + + if [ ! -z "$VIASH_PAR_FASTQ" ]; then + unset VIASH_TEST_FASTQ + IFS=';' + for var in $VIASH_PAR_FASTQ; do + unset IFS + if [ -z "$VIASH_TEST_FASTQ" ]; then + VIASH_TEST_FASTQ="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_FASTQ="$VIASH_TEST_FASTQ;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_FASTQ="$VIASH_TEST_FASTQ" + fi + if [ ! -z "$VIASH_PAR_FASTA" ]; then + unset VIASH_TEST_FASTA + IFS=';' + for var in $VIASH_PAR_FASTA; do + unset IFS + if [ -z "$VIASH_TEST_FASTA" ]; then + VIASH_TEST_FASTA="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_FASTA="$VIASH_TEST_FASTA;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_FASTA="$VIASH_TEST_FASTA" + fi + if [ ! -z "$VIASH_PAR_FASTQ_RICH" ]; then + unset VIASH_TEST_FASTQ_RICH + IFS=';' + for var in $VIASH_PAR_FASTQ_RICH; do + unset IFS + if [ -z "$VIASH_TEST_FASTQ_RICH" ]; then + VIASH_TEST_FASTQ_RICH="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_FASTQ_RICH="$VIASH_TEST_FASTQ_RICH;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_FASTQ_RICH="$VIASH_TEST_FASTQ_RICH" + fi + if [ ! -z "$VIASH_PAR_FASTQ_MINIMAL" ]; then + unset VIASH_TEST_FASTQ_MINIMAL + IFS=';' + for var in $VIASH_PAR_FASTQ_MINIMAL; do + unset IFS + if [ -z "$VIASH_TEST_FASTQ_MINIMAL" ]; then + VIASH_TEST_FASTQ_MINIMAL="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_FASTQ_MINIMAL="$VIASH_TEST_FASTQ_MINIMAL;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_FASTQ_MINIMAL="$VIASH_TEST_FASTQ_MINIMAL" + fi + if [ ! -z "$VIASH_PAR_SUMMARY" ]; then + unset VIASH_TEST_SUMMARY + IFS=';' + for var in $VIASH_PAR_SUMMARY; do + unset IFS + if [ -z "$VIASH_TEST_SUMMARY" ]; then + VIASH_TEST_SUMMARY="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_SUMMARY="$VIASH_TEST_SUMMARY;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_SUMMARY="$VIASH_TEST_SUMMARY" + fi + if [ ! -z "$VIASH_PAR_BAM" ]; then + unset VIASH_TEST_BAM + IFS=';' + for var in $VIASH_PAR_BAM; do + unset IFS + if [ -z "$VIASH_TEST_BAM" ]; then + VIASH_TEST_BAM="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_BAM="$VIASH_TEST_BAM;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_BAM="$VIASH_TEST_BAM" + fi + if [ ! -z "$VIASH_PAR_UBAM" ]; then + unset VIASH_TEST_UBAM + IFS=';' + for var in $VIASH_PAR_UBAM; do + unset IFS + if [ -z "$VIASH_TEST_UBAM" ]; then + VIASH_TEST_UBAM="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_UBAM="$VIASH_TEST_UBAM;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_UBAM="$VIASH_TEST_UBAM" + fi + if [ ! -z "$VIASH_PAR_CRAM" ]; then + unset VIASH_TEST_CRAM + IFS=';' + for var in $VIASH_PAR_CRAM; do + unset IFS + if [ -z "$VIASH_TEST_CRAM" ]; then + VIASH_TEST_CRAM="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_CRAM="$VIASH_TEST_CRAM;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_CRAM="$VIASH_TEST_CRAM" + fi + if [ ! -z "$VIASH_PAR_PICKLE" ]; then + unset VIASH_TEST_PICKLE + IFS=';' + for var in $VIASH_PAR_PICKLE; do + unset IFS + if [ -z "$VIASH_TEST_PICKLE" ]; then + VIASH_TEST_PICKLE="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_PICKLE="$VIASH_TEST_PICKLE;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_PICKLE="$VIASH_TEST_PICKLE" + fi + if [ ! -z "$VIASH_PAR_FEATHER" ]; then + unset VIASH_TEST_FEATHER + IFS=';' + for var in $VIASH_PAR_FEATHER; do + unset IFS + if [ -z "$VIASH_TEST_FEATHER" ]; then + VIASH_TEST_FEATHER="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_FEATHER="$VIASH_TEST_FEATHER;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_FEATHER="$VIASH_TEST_FEATHER" + fi + if [ ! -z "$VIASH_PAR_OUTDIR" ]; then + VIASH_PAR_OUTDIR=$(ViashDockerStripAutomount "$VIASH_PAR_OUTDIR") + fi + if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then + VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR") + fi + if [ ! -z "$VIASH_META_EXECUTABLE" ]; then + VIASH_META_EXECUTABLE=$(ViashDockerStripAutomount "$VIASH_META_EXECUTABLE") + fi + if [ ! -z "$VIASH_META_CONFIG" ]; then + VIASH_META_CONFIG=$(ViashDockerStripAutomount "$VIASH_META_CONFIG") + fi + if [ ! -z "$VIASH_META_TEMP_DIR" ]; then + VIASH_META_TEMP_DIR=$(ViashDockerStripAutomount "$VIASH_META_TEMP_DIR") + fi +fi + + +# check whether required files exist +if [ ! -z "$VIASH_PAR_OUTDIR" ] && [ ! -e "$VIASH_PAR_OUTDIR" ]; then + ViashError "Output file '$VIASH_PAR_OUTDIR' does not exist." + exit 1 +fi + + +exit 0 diff --git a/target/executable/pear/.config.vsh.yaml b/target/executable/pear/.config.vsh.yaml index d1fe7863..296cb415 100644 --- a/target/executable/pear/.config.vsh.yaml +++ b/target/executable/pear/.config.vsh.yaml @@ -398,9 +398,9 @@ build_info: output: "target/executable/pear" executable: "target/executable/pear/pear" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/pear/pear b/target/executable/pear/pear index 000c66c4..d2e8a171 100755 --- a/target/executable/pear/pear +++ b/target/executable/pear/pear @@ -597,9 +597,9 @@ echo "pear: $version" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Kai Waldrant" LABEL org.opencontainers.image.description="Companion container for running component pear" -LABEL org.opencontainers.image.created="2024-10-18T09:18:44Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:39Z" LABEL org.opencontainers.image.source="https://github.com/tseemann/PEAR" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml b/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml index 7e39cf28..b104dda8 100644 --- a/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml +++ b/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml @@ -264,9 +264,9 @@ build_info: output: "target/executable/qualimap/qualimap_rnaseq" executable: "target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq b/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq index b258c2e2..22d67bbe 100755 --- a/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq +++ b/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq @@ -527,9 +527,9 @@ RUN echo QualiMap: $(qualimap 2>&1 | grep QualiMap | sed 's/^.*QualiMap//') > /v LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component qualimap qualimap_rnaseq" -LABEL org.opencontainers.image.created="2024-10-18T09:18:49Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:43Z" LABEL org.opencontainers.image.source="https://bitbucket.org/kokonech/qualimap/commits/branch/master" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml b/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml index 8d2b2888..7d8b41f5 100644 --- a/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml +++ b/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml @@ -852,9 +852,9 @@ build_info: output: "target/executable/rsem/rsem_calculate_expression" executable: "target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression b/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression index 9d43a95e..2113d996 100755 --- a/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression +++ b/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression @@ -991,9 +991,9 @@ echo "bowtie: `bowtie --version | grep -oP 'bowtie-align-s version \K\d+\.\d+\.\ echo "HISAT2: `hisat2 --version | grep -oP 'hisat2-align-s version \K\d+\.\d+\.\d+'`" >> /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component rsem rsem_calculate_expression" -LABEL org.opencontainers.image.created="2024-10-18T09:18:46Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:41Z" LABEL org.opencontainers.image.source="https://github.com/deweylab/RSEM" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml b/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml index 645e4f2d..433ff31e 100644 --- a/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml +++ b/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml @@ -416,9 +416,9 @@ build_info: output: "target/executable/rsem/rsem_prepare_reference" executable: "target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference b/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference index 8004ec1e..92d69355 100755 --- a/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference +++ b/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference @@ -656,9 +656,9 @@ echo "HISAT2: `hisat2 --version | grep -oP 'hisat2-align-s version \K\d+\.\d+\.\ LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component rsem rsem_prepare_reference" -LABEL org.opencontainers.image.created="2024-10-18T09:18:46Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:40Z" LABEL org.opencontainers.image.source="https://github.com/deweylab/RSEM" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/salmon/salmon_index/.config.vsh.yaml b/target/executable/salmon/salmon_index/.config.vsh.yaml index 369f2daf..a095beb6 100644 --- a/target/executable/salmon/salmon_index/.config.vsh.yaml +++ b/target/executable/salmon/salmon_index/.config.vsh.yaml @@ -277,9 +277,9 @@ build_info: output: "target/executable/salmon/salmon_index" executable: "target/executable/salmon/salmon_index/salmon_index" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/salmon/salmon_index/salmon_index b/target/executable/salmon/salmon_index/salmon_index index b8a8f5d4..eca4aa89 100755 --- a/target/executable/salmon/salmon_index/salmon_index +++ b/target/executable/salmon/salmon_index/salmon_index @@ -546,9 +546,9 @@ RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/softwar LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_index" -LABEL org.opencontainers.image.created="2024-10-18T09:18:53Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:47Z" LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/salmon/salmon_quant/.config.vsh.yaml b/target/executable/salmon/salmon_quant/.config.vsh.yaml index ec745bd0..7c447111 100644 --- a/target/executable/salmon/salmon_quant/.config.vsh.yaml +++ b/target/executable/salmon/salmon_quant/.config.vsh.yaml @@ -1173,9 +1173,9 @@ build_info: output: "target/executable/salmon/salmon_quant" executable: "target/executable/salmon/salmon_quant/salmon_quant" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/salmon/salmon_quant/salmon_quant b/target/executable/salmon/salmon_quant/salmon_quant index f8323867..532de0f6 100755 --- a/target/executable/salmon/salmon_quant/salmon_quant +++ b/target/executable/salmon/salmon_quant/salmon_quant @@ -1168,9 +1168,9 @@ RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/softwar LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_quant" -LABEL org.opencontainers.image.created="2024-10-18T09:18:52Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:47Z" LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_collate/.config.vsh.yaml b/target/executable/samtools/samtools_collate/.config.vsh.yaml index d4c49549..a0543212 100644 --- a/target/executable/samtools/samtools_collate/.config.vsh.yaml +++ b/target/executable/samtools/samtools_collate/.config.vsh.yaml @@ -264,9 +264,9 @@ build_info: output: "target/executable/samtools/samtools_collate" executable: "target/executable/samtools/samtools_collate/samtools_collate" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_collate/samtools_collate b/target/executable/samtools/samtools_collate/samtools_collate index ca72adbc..614ca401 100755 --- a/target/executable/samtools/samtools_collate/samtools_collate +++ b/target/executable/samtools/samtools_collate/samtools_collate @@ -519,9 +519,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_collate" -LABEL org.opencontainers.image.created="2024-10-18T09:18:46Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:41Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_faidx/.config.vsh.yaml b/target/executable/samtools/samtools_faidx/.config.vsh.yaml index 29c248be..78aa3a0f 100644 --- a/target/executable/samtools/samtools_faidx/.config.vsh.yaml +++ b/target/executable/samtools/samtools_faidx/.config.vsh.yaml @@ -243,9 +243,9 @@ build_info: output: "target/executable/samtools/samtools_faidx" executable: "target/executable/samtools/samtools_faidx/samtools_faidx" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_faidx/samtools_faidx b/target/executable/samtools/samtools_faidx/samtools_faidx index 345d2c70..1d55ff08 100755 --- a/target/executable/samtools/samtools_faidx/samtools_faidx +++ b/target/executable/samtools/samtools_faidx/samtools_faidx @@ -512,9 +512,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_faidx" -LABEL org.opencontainers.image.created="2024-10-18T09:18:46Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:40Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_fasta/.config.vsh.yaml b/target/executable/samtools/samtools_fasta/.config.vsh.yaml index 150c5265..dfb5981a 100644 --- a/target/executable/samtools/samtools_fasta/.config.vsh.yaml +++ b/target/executable/samtools/samtools_fasta/.config.vsh.yaml @@ -433,9 +433,9 @@ build_info: output: "target/executable/samtools/samtools_fasta" executable: "target/executable/samtools/samtools_fasta/samtools_fasta" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_fasta/samtools_fasta b/target/executable/samtools/samtools_fasta/samtools_fasta index 6e8d9265..fce75365 100755 --- a/target/executable/samtools/samtools_fasta/samtools_fasta +++ b/target/executable/samtools/samtools_fasta/samtools_fasta @@ -625,9 +625,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_fasta" -LABEL org.opencontainers.image.created="2024-10-18T09:18:46Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:41Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_fastq/.config.vsh.yaml b/target/executable/samtools/samtools_fastq/.config.vsh.yaml index 9d759cbc..5b924cec 100644 --- a/target/executable/samtools/samtools_fastq/.config.vsh.yaml +++ b/target/executable/samtools/samtools_fastq/.config.vsh.yaml @@ -433,9 +433,9 @@ build_info: output: "target/executable/samtools/samtools_fastq" executable: "target/executable/samtools/samtools_fastq/samtools_fastq" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_fastq/samtools_fastq b/target/executable/samtools/samtools_fastq/samtools_fastq index 0d58e9bb..c9d8f9b3 100755 --- a/target/executable/samtools/samtools_fastq/samtools_fastq +++ b/target/executable/samtools/samtools_fastq/samtools_fastq @@ -626,9 +626,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_fastq" -LABEL org.opencontainers.image.created="2024-10-18T09:18:47Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:42Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_flagstat/.config.vsh.yaml b/target/executable/samtools/samtools_flagstat/.config.vsh.yaml index 9a3d4e20..a5b6eb6f 100644 --- a/target/executable/samtools/samtools_flagstat/.config.vsh.yaml +++ b/target/executable/samtools/samtools_flagstat/.config.vsh.yaml @@ -173,9 +173,9 @@ build_info: output: "target/executable/samtools/samtools_flagstat" executable: "target/executable/samtools/samtools_flagstat/samtools_flagstat" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_flagstat/samtools_flagstat b/target/executable/samtools/samtools_flagstat/samtools_flagstat index 9305b316..e13af34b 100755 --- a/target/executable/samtools/samtools_flagstat/samtools_flagstat +++ b/target/executable/samtools/samtools_flagstat/samtools_flagstat @@ -474,9 +474,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_flagstat" -LABEL org.opencontainers.image.created="2024-10-18T09:18:58Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:53Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_idxstats/.config.vsh.yaml b/target/executable/samtools/samtools_idxstats/.config.vsh.yaml index 5dd3d2a4..1bd107b4 100644 --- a/target/executable/samtools/samtools_idxstats/.config.vsh.yaml +++ b/target/executable/samtools/samtools_idxstats/.config.vsh.yaml @@ -183,9 +183,9 @@ build_info: output: "target/executable/samtools/samtools_idxstats" executable: "target/executable/samtools/samtools_idxstats/samtools_idxstats" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_idxstats/samtools_idxstats b/target/executable/samtools/samtools_idxstats/samtools_idxstats index 0165ed38..66567b15 100755 --- a/target/executable/samtools/samtools_idxstats/samtools_idxstats +++ b/target/executable/samtools/samtools_idxstats/samtools_idxstats @@ -478,9 +478,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_idxstats" -LABEL org.opencontainers.image.created="2024-10-18T09:18:59Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:53Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_index/.config.vsh.yaml b/target/executable/samtools/samtools_index/.config.vsh.yaml index c0370865..5ea2fb26 100644 --- a/target/executable/samtools/samtools_index/.config.vsh.yaml +++ b/target/executable/samtools/samtools_index/.config.vsh.yaml @@ -189,9 +189,9 @@ build_info: output: "target/executable/samtools/samtools_index" executable: "target/executable/samtools/samtools_index/samtools_index" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_index/samtools_index b/target/executable/samtools/samtools_index/samtools_index index ee03bc9b..14b04720 100755 --- a/target/executable/samtools/samtools_index/samtools_index +++ b/target/executable/samtools/samtools_index/samtools_index @@ -485,9 +485,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_index" -LABEL org.opencontainers.image.created="2024-10-18T09:18:45Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:39Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_sort/.config.vsh.yaml b/target/executable/samtools/samtools_sort/.config.vsh.yaml index 5d903f1d..9e976211 100644 --- a/target/executable/samtools/samtools_sort/.config.vsh.yaml +++ b/target/executable/samtools/samtools_sort/.config.vsh.yaml @@ -332,9 +332,9 @@ build_info: output: "target/executable/samtools/samtools_sort" executable: "target/executable/samtools/samtools_sort/samtools_sort" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_sort/samtools_sort b/target/executable/samtools/samtools_sort/samtools_sort index c0a0c376..84e408b5 100755 --- a/target/executable/samtools/samtools_sort/samtools_sort +++ b/target/executable/samtools/samtools_sort/samtools_sort @@ -556,9 +556,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_sort" -LABEL org.opencontainers.image.created="2024-10-18T09:18:47Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:42Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_stats/.config.vsh.yaml b/target/executable/samtools/samtools_stats/.config.vsh.yaml index 069e4b4a..4a2e144a 100644 --- a/target/executable/samtools/samtools_stats/.config.vsh.yaml +++ b/target/executable/samtools/samtools_stats/.config.vsh.yaml @@ -401,9 +401,9 @@ build_info: output: "target/executable/samtools/samtools_stats" executable: "target/executable/samtools/samtools_stats/samtools_stats" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_stats/samtools_stats b/target/executable/samtools/samtools_stats/samtools_stats index 342819fd..cb350994 100755 --- a/target/executable/samtools/samtools_stats/samtools_stats +++ b/target/executable/samtools/samtools_stats/samtools_stats @@ -575,9 +575,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_stats" -LABEL org.opencontainers.image.created="2024-10-18T09:18:58Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:52Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_view/.config.vsh.yaml b/target/executable/samtools/samtools_view/.config.vsh.yaml index 6ea3d7f5..f3033213 100644 --- a/target/executable/samtools/samtools_view/.config.vsh.yaml +++ b/target/executable/samtools/samtools_view/.config.vsh.yaml @@ -665,9 +665,9 @@ build_info: output: "target/executable/samtools/samtools_view" executable: "target/executable/samtools/samtools_view/samtools_view" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_view/samtools_view b/target/executable/samtools/samtools_view/samtools_view index 34cc58a2..2d9906a0 100755 --- a/target/executable/samtools/samtools_view/samtools_view +++ b/target/executable/samtools/samtools_view/samtools_view @@ -825,9 +825,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_view" -LABEL org.opencontainers.image.created="2024-10-18T09:18:45Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:39Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/seqtk/seqtk_sample/.config.vsh.yaml b/target/executable/seqtk/seqtk_sample/.config.vsh.yaml index 52b7a94d..8e76a2dd 100644 --- a/target/executable/seqtk/seqtk_sample/.config.vsh.yaml +++ b/target/executable/seqtk/seqtk_sample/.config.vsh.yaml @@ -173,9 +173,9 @@ build_info: output: "target/executable/seqtk/seqtk_sample" executable: "target/executable/seqtk/seqtk_sample/seqtk_sample" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/seqtk/seqtk_sample/seqtk_sample b/target/executable/seqtk/seqtk_sample/seqtk_sample index a7f9a5c3..b0972334 100755 --- a/target/executable/seqtk/seqtk_sample/seqtk_sample +++ b/target/executable/seqtk/seqtk_sample/seqtk_sample @@ -481,9 +481,9 @@ FROM quay.io/biocontainers/seqtk:1.4--he4a0461_2 ENTRYPOINT [] LABEL org.opencontainers.image.authors="Jakub Majercik" LABEL org.opencontainers.image.description="Companion container for running component seqtk seqtk_sample" -LABEL org.opencontainers.image.created="2024-10-18T09:18:58Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:53Z" LABEL org.opencontainers.image.source="https://github.com/lh3/seqtk/tree/v1.4" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml b/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml index a607056d..636b5dd2 100644 --- a/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml +++ b/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml @@ -196,9 +196,9 @@ build_info: output: "target/executable/seqtk/seqtk_subseq" executable: "target/executable/seqtk/seqtk_subseq/seqtk_subseq" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/seqtk/seqtk_subseq/seqtk_subseq b/target/executable/seqtk/seqtk_subseq/seqtk_subseq index dc7a9780..6626eea6 100755 --- a/target/executable/seqtk/seqtk_subseq/seqtk_subseq +++ b/target/executable/seqtk/seqtk_subseq/seqtk_subseq @@ -491,9 +491,9 @@ RUN echo $(echo $(seqtk 2>&1) | sed -n 's/.*\(Version: [^ ]*\).*/\1/p') > /var/s LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component seqtk seqtk_subseq" -LABEL org.opencontainers.image.created="2024-10-18T09:18:59Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:53Z" LABEL org.opencontainers.image.source="https://github.com/lh3/seqtk/tree/v1.4" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/snpeff/.config.vsh.yaml b/target/executable/snpeff/.config.vsh.yaml index f168b7f4..0e9a9bd7 100644 --- a/target/executable/snpeff/.config.vsh.yaml +++ b/target/executable/snpeff/.config.vsh.yaml @@ -628,9 +628,9 @@ build_info: output: "target/executable/snpeff" executable: "target/executable/snpeff/snpeff" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/snpeff/snpeff b/target/executable/snpeff/snpeff index abe61db9..d3610e16 100755 --- a/target/executable/snpeff/snpeff +++ b/target/executable/snpeff/snpeff @@ -756,9 +756,9 @@ version_trimmed=$(echo "$version" | awk '{print $1, $2}') && \ echo "$version_trimmed" > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component snpeff" -LABEL org.opencontainers.image.created="2024-10-18T09:18:51Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:45Z" LABEL org.opencontainers.image.source="https://github.com/pcingola/SnpEff" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/sortmerna/.config.vsh.yaml b/target/executable/sortmerna/.config.vsh.yaml index daa1700a..25671a9c 100644 --- a/target/executable/sortmerna/.config.vsh.yaml +++ b/target/executable/sortmerna/.config.vsh.yaml @@ -591,9 +591,9 @@ build_info: output: "target/executable/sortmerna" executable: "target/executable/sortmerna/sortmerna" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/sortmerna/sortmerna b/target/executable/sortmerna/sortmerna index efc9edb3..b4cd00bd 100755 --- a/target/executable/sortmerna/sortmerna +++ b/target/executable/sortmerna/sortmerna @@ -744,9 +744,9 @@ wget --no-check-certificate https://github.com/sortmerna/sortmerna/releases/down bash sortmerna-4.3.6-Linux.sh --skip-license LABEL org.opencontainers.image.description="Companion container for running component sortmerna" -LABEL org.opencontainers.image.created="2024-10-18T09:18:48Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:42Z" LABEL org.opencontainers.image.source="https://github.com/sortmerna/sortmerna" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/star/star_align_reads/.config.vsh.yaml b/target/executable/star/star_align_reads/.config.vsh.yaml index 293aa376..2e62b8f0 100644 --- a/target/executable/star/star_align_reads/.config.vsh.yaml +++ b/target/executable/star/star_align_reads/.config.vsh.yaml @@ -2663,9 +2663,9 @@ build_info: output: "target/executable/star/star_align_reads" executable: "target/executable/star/star_align_reads/star_align_reads" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/star/star_align_reads/star_align_reads b/target/executable/star/star_align_reads/star_align_reads index 54a558f7..3a5d61f4 100755 --- a/target/executable/star/star_align_reads/star_align_reads +++ b/target/executable/star/star_align_reads/star_align_reads @@ -1920,9 +1920,9 @@ RUN STAR --version | sed 's#\(.*\)#star: "\1"#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Angela Oliveira Pisco, Robrecht Cannoodt" LABEL org.opencontainers.image.description="Companion container for running component star star_align_reads" -LABEL org.opencontainers.image.created="2024-10-18T09:18:50Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:44Z" LABEL org.opencontainers.image.source="https://github.com/alexdobin/STAR" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/star/star_genome_generate/.config.vsh.yaml b/target/executable/star/star_genome_generate/.config.vsh.yaml index 64297536..b13ccdb6 100644 --- a/target/executable/star/star_genome_generate/.config.vsh.yaml +++ b/target/executable/star/star_genome_generate/.config.vsh.yaml @@ -333,9 +333,9 @@ build_info: output: "target/executable/star/star_genome_generate" executable: "target/executable/star/star_genome_generate/star_genome_generate" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/star/star_genome_generate/star_genome_generate b/target/executable/star/star_genome_generate/star_genome_generate index a5a0ed33..c8657b67 100755 --- a/target/executable/star/star_genome_generate/star_genome_generate +++ b/target/executable/star/star_genome_generate/star_genome_generate @@ -577,9 +577,9 @@ RUN STAR --version | sed 's#\(.*\)#star: "\1"#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component star star_genome_generate" -LABEL org.opencontainers.image.created="2024-10-18T09:18:49Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:44Z" LABEL org.opencontainers.image.source="https://github.com/alexdobin/STAR" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/trimgalore/.config.vsh.yaml b/target/executable/trimgalore/.config.vsh.yaml index db3d7b9d..fe2e8193 100644 --- a/target/executable/trimgalore/.config.vsh.yaml +++ b/target/executable/trimgalore/.config.vsh.yaml @@ -770,9 +770,9 @@ build_info: output: "target/executable/trimgalore" executable: "target/executable/trimgalore/trimgalore" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/trimgalore/trimgalore b/target/executable/trimgalore/trimgalore index fc3d5545..ea70bbd3 100755 --- a/target/executable/trimgalore/trimgalore +++ b/target/executable/trimgalore/trimgalore @@ -881,9 +881,9 @@ RUN echo "TrimGalore: `trim_galore --version | sed -n 's/.*version\s\+\([0-9]\+\ LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component trimgalore" -LABEL org.opencontainers.image.created="2024-10-18T09:18:53Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:47Z" LABEL org.opencontainers.image.source="https://github.com/FelixKrueger/TrimGalore" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml b/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml index 9f2c7f8c..94899693 100644 --- a/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml +++ b/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml @@ -611,9 +611,9 @@ build_info: output: "target/executable/umi_tools/umi_tools_dedup" executable: "target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup b/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup index a029da00..56fac7ec 100755 --- a/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup +++ b/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup @@ -770,9 +770,9 @@ RUN umi_tools -v | sed 's/ version//g' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component umi_tools umi_tools_dedup" -LABEL org.opencontainers.image.created="2024-10-18T09:18:50Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:45Z" LABEL org.opencontainers.image.source="https://github.com/CGATOxford/UMI-tools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml b/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml index d6076dd9..1b3821b4 100644 --- a/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml +++ b/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml @@ -449,9 +449,9 @@ build_info: output: "target/executable/umi_tools/umi_tools_extract" executable: "target/executable/umi_tools/umi_tools_extract/umi_tools_extract" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/umi_tools/umi_tools_extract/umi_tools_extract b/target/executable/umi_tools/umi_tools_extract/umi_tools_extract index 7ad6609c..1cbdeba2 100755 --- a/target/executable/umi_tools/umi_tools_extract/umi_tools_extract +++ b/target/executable/umi_tools/umi_tools_extract/umi_tools_extract @@ -637,9 +637,9 @@ ENTRYPOINT [] RUN umi_tools -v | sed 's/ version//g' > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component umi_tools umi_tools_extract" -LABEL org.opencontainers.image.created="2024-10-18T09:18:50Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:45Z" LABEL org.opencontainers.image.source="https://github.com/CGATOxford/UMI-tools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml b/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml index d168dc82..b5b63e95 100644 --- a/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml +++ b/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml @@ -256,9 +256,9 @@ build_info: output: "target/executable/umi_tools/umi_tools_prepareforrsem" executable: "target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem b/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem index b194e52e..05ae8135 100755 --- a/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem +++ b/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem @@ -519,9 +519,9 @@ ENTRYPOINT [] RUN umi_tools -v | sed 's/ version//g' > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component umi_tools umi_tools_prepareforrsem" -LABEL org.opencontainers.image.created="2024-10-18T09:18:50Z" +LABEL org.opencontainers.image.created="2024-10-26T09:56:45Z" LABEL org.opencontainers.image.source="https://github.com/CGATOxford/UMI-tools" -LABEL org.opencontainers.image.revision="7fb67a98539868b9af788338fb5f46d34ab742f7" +LABEL org.opencontainers.image.revision="6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml index 8cfbadb2..65769cfc 100644 --- a/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml @@ -235,9 +235,9 @@ build_info: output: "target/nextflow/agat/agat_convert_bed2gff" executable: "target/nextflow/agat/agat_convert_bed2gff/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_bed2gff/main.nf b/target/nextflow/agat/agat_convert_bed2gff/main.nf index f374d2d6..bcde2b67 100644 --- a/target/nextflow/agat/agat_convert_bed2gff/main.nf +++ b/target/nextflow/agat/agat_convert_bed2gff/main.nf @@ -3092,9 +3092,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_bed2gff", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml index 7e64221e..5f3f9480 100644 --- a/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml @@ -225,9 +225,9 @@ build_info: output: "target/nextflow/agat/agat_convert_embl2gff" executable: "target/nextflow/agat/agat_convert_embl2gff/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_embl2gff/main.nf b/target/nextflow/agat/agat_convert_embl2gff/main.nf index 6f9d0d7a..a019efb3 100644 --- a/target/nextflow/agat/agat_convert_embl2gff/main.nf +++ b/target/nextflow/agat/agat_convert_embl2gff/main.nf @@ -3085,9 +3085,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_embl2gff", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml index f0cb7284..2e1886e9 100644 --- a/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml @@ -230,9 +230,9 @@ build_info: output: "target/nextflow/agat/agat_convert_genscan2gff" executable: "target/nextflow/agat/agat_convert_genscan2gff/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_genscan2gff/main.nf b/target/nextflow/agat/agat_convert_genscan2gff/main.nf index 461e61fb..8670f3a5 100644 --- a/target/nextflow/agat/agat_convert_genscan2gff/main.nf +++ b/target/nextflow/agat/agat_convert_genscan2gff/main.nf @@ -3087,9 +3087,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_genscan2gff", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml b/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml index ab568264..daddc5ea 100644 --- a/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml @@ -228,9 +228,9 @@ build_info: output: "target/nextflow/agat/agat_convert_sp_gff2gtf" executable: "target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf b/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf index 0dc9dcbe..e0d771e6 100644 --- a/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf +++ b/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf @@ -3068,9 +3068,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_sp_gff2gtf", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml b/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml index 36fe78cb..e79c8ba6 100644 --- a/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml @@ -188,9 +188,9 @@ build_info: output: "target/nextflow/agat/agat_convert_sp_gff2tsv" executable: "target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf b/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf index fe3a7b4e..8c734aa2 100644 --- a/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf +++ b/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf @@ -3046,9 +3046,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_sp_gff2tsv", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml b/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml index ab5d057b..ffbd4917 100644 --- a/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml @@ -195,9 +195,9 @@ build_info: output: "target/nextflow/agat/agat_convert_sp_gxf2gxf" executable: "target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf b/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf index ef4e3017..d282710b 100644 --- a/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf +++ b/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf @@ -3046,9 +3046,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_sp_gxf2gxf", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/arriba/.config.vsh.yaml b/target/nextflow/arriba/.config.vsh.yaml index 39830d87..8d351156 100644 --- a/target/nextflow/arriba/.config.vsh.yaml +++ b/target/nextflow/arriba/.config.vsh.yaml @@ -706,9 +706,9 @@ build_info: output: "target/nextflow/arriba" executable: "target/nextflow/arriba/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/arriba/main.nf b/target/nextflow/arriba/main.nf index c6f59769..16deaf2c 100644 --- a/target/nextflow/arriba/main.nf +++ b/target/nextflow/arriba/main.nf @@ -3592,9 +3592,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/arriba", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml b/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml index a94ce928..7c8e5e82 100644 --- a/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml +++ b/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml @@ -359,9 +359,9 @@ build_info: output: "target/nextflow/bbmap/bbmap_bbsplit" executable: "target/nextflow/bbmap/bbmap_bbsplit/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bbmap/bbmap_bbsplit/main.nf b/target/nextflow/bbmap/bbmap_bbsplit/main.nf index 3341a376..9d9994fe 100644 --- a/target/nextflow/bbmap/bbmap_bbsplit/main.nf +++ b/target/nextflow/bbmap/bbmap_bbsplit/main.nf @@ -3207,9 +3207,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bbmap/bbmap_bbsplit", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml index 379ee3f3..a32a7179 100644 --- a/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml @@ -469,9 +469,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_annotate" executable: "target/nextflow/bcftools/bcftools_annotate/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_annotate/main.nf b/target/nextflow/bcftools/bcftools_annotate/main.nf index da22a8f3..92db5605 100644 --- a/target/nextflow/bcftools/bcftools_annotate/main.nf +++ b/target/nextflow/bcftools/bcftools_annotate/main.nf @@ -3335,9 +3335,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_annotate", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml index e3b85a17..8e91c175 100644 --- a/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml @@ -335,9 +335,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_concat" executable: "target/nextflow/bcftools/bcftools_concat/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_concat/main.nf b/target/nextflow/bcftools/bcftools_concat/main.nf index afbf8c66..fe0342ff 100644 --- a/target/nextflow/bcftools/bcftools_concat/main.nf +++ b/target/nextflow/bcftools/bcftools_concat/main.nf @@ -3207,9 +3207,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_concat", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml index baddd32d..e3a87343 100644 --- a/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml @@ -416,9 +416,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_norm" executable: "target/nextflow/bcftools/bcftools_norm/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_norm/main.nf b/target/nextflow/bcftools/bcftools_norm/main.nf index 025ce250..ed1b6f6d 100644 --- a/target/nextflow/bcftools/bcftools_norm/main.nf +++ b/target/nextflow/bcftools/bcftools_norm/main.nf @@ -3300,9 +3300,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_norm", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml index 77a85c20..a7f0d805 100644 --- a/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml @@ -185,9 +185,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_sort" executable: "target/nextflow/bcftools/bcftools_sort/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_sort/main.nf b/target/nextflow/bcftools/bcftools_sort/main.nf index 7308be35..128287cf 100644 --- a/target/nextflow/bcftools/bcftools_sort/main.nf +++ b/target/nextflow/bcftools/bcftools_sort/main.nf @@ -3048,9 +3048,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_sort", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml index 2b2da89a..79a11095 100644 --- a/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml @@ -458,9 +458,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_stats" executable: "target/nextflow/bcftools/bcftools_stats/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_stats/main.nf b/target/nextflow/bcftools/bcftools_stats/main.nf index 4002ba5f..a025f77b 100644 --- a/target/nextflow/bcftools/bcftools_stats/main.nf +++ b/target/nextflow/bcftools/bcftools_stats/main.nf @@ -3337,9 +3337,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_stats", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcl_convert/.config.vsh.yaml b/target/nextflow/bcl_convert/.config.vsh.yaml index c31c960b..87ebccf1 100644 --- a/target/nextflow/bcl_convert/.config.vsh.yaml +++ b/target/nextflow/bcl_convert/.config.vsh.yaml @@ -418,9 +418,9 @@ build_info: output: "target/nextflow/bcl_convert" executable: "target/nextflow/bcl_convert/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcl_convert/main.nf b/target/nextflow/bcl_convert/main.nf index 0c40d7bc..1772efcd 100644 --- a/target/nextflow/bcl_convert/main.nf +++ b/target/nextflow/bcl_convert/main.nf @@ -3329,9 +3329,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcl_convert", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml index e587c1a6..4d68cbcc 100644 --- a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml +++ b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml @@ -274,9 +274,9 @@ build_info: output: "target/nextflow/bd_rhapsody/bd_rhapsody_make_reference" executable: "target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf index 644ddccb..6135662c 100644 --- a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf +++ b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf @@ -3146,9 +3146,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bd_rhapsody/bd_rhapsody_make_reference", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml index d1268836..ce95b590 100644 --- a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml +++ b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml @@ -1115,9 +1115,9 @@ build_info: output: "target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis" executable: "target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf index bc10bd46..7918cc84 100644 --- a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf +++ b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf @@ -4193,9 +4193,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml index 22157bcc..ed448d54 100644 --- a/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml @@ -187,9 +187,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_bamtofastq" executable: "target/nextflow/bedtools/bedtools_bamtofastq/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_bamtofastq/main.nf b/target/nextflow/bedtools/bedtools_bamtofastq/main.nf index 25a01e05..d5166764 100644 --- a/target/nextflow/bedtools/bedtools_bamtofastq/main.nf +++ b/target/nextflow/bedtools/bedtools_bamtofastq/main.nf @@ -3050,9 +3050,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_bamtofastq", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml index eb7c9e4a..f9961cab 100644 --- a/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml @@ -176,9 +176,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_bed12tobed6" executable: "target/nextflow/bedtools/bedtools_bed12tobed6/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf b/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf index 5215a25a..242c0281 100644 --- a/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf +++ b/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf @@ -3035,9 +3035,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_bed12tobed6", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml index 0742849d..4d455308 100644 --- a/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml @@ -214,9 +214,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_bedtobam" executable: "target/nextflow/bedtools/bedtools_bedtobam/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_bedtobam/main.nf b/target/nextflow/bedtools/bedtools_bedtobam/main.nf index 152115e8..fa4be79c 100644 --- a/target/nextflow/bedtools/bedtools_bedtobam/main.nf +++ b/target/nextflow/bedtools/bedtools_bedtobam/main.nf @@ -3083,9 +3083,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_bedtobam", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml index 388dda09..0d57f800 100644 --- a/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml @@ -337,9 +337,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_genomecov" executable: "target/nextflow/bedtools/bedtools_genomecov/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_genomecov/main.nf b/target/nextflow/bedtools/bedtools_genomecov/main.nf index 4465e475..b0fa5de6 100644 --- a/target/nextflow/bedtools/bedtools_genomecov/main.nf +++ b/target/nextflow/bedtools/bedtools_genomecov/main.nf @@ -3207,9 +3207,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_genomecov", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml index 1953409e..fabe3127 100644 --- a/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml @@ -232,9 +232,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_getfasta" executable: "target/nextflow/bedtools/bedtools_getfasta/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_getfasta/main.nf b/target/nextflow/bedtools/bedtools_getfasta/main.nf index 0a9bc296..dc0c49b7 100644 --- a/target/nextflow/bedtools/bedtools_getfasta/main.nf +++ b/target/nextflow/bedtools/bedtools_getfasta/main.nf @@ -3086,9 +3086,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_getfasta", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml index 615b9e99..62586915 100644 --- a/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml @@ -273,9 +273,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_groupby" executable: "target/nextflow/bedtools/bedtools_groupby/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_groupby/main.nf b/target/nextflow/bedtools/bedtools_groupby/main.nf index 8cbba9ee..6514beef 100644 --- a/target/nextflow/bedtools/bedtools_groupby/main.nf +++ b/target/nextflow/bedtools/bedtools_groupby/main.nf @@ -3130,9 +3130,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_groupby", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml index 5ff83713..3e1921cc 100644 --- a/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml @@ -410,9 +410,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_intersect" executable: "target/nextflow/bedtools/bedtools_intersect/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_intersect/main.nf b/target/nextflow/bedtools/bedtools_intersect/main.nf index d3c63bc5..445ce8dc 100644 --- a/target/nextflow/bedtools/bedtools_intersect/main.nf +++ b/target/nextflow/bedtools/bedtools_intersect/main.nf @@ -3282,9 +3282,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_intersect", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml index 57ae0020..f39cf920 100644 --- a/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml @@ -210,9 +210,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_links" executable: "target/nextflow/bedtools/bedtools_links/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_links/main.nf b/target/nextflow/bedtools/bedtools_links/main.nf index cbb2bd88..6c74a50b 100644 --- a/target/nextflow/bedtools/bedtools_links/main.nf +++ b/target/nextflow/bedtools/bedtools_links/main.nf @@ -3073,9 +3073,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_links", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml index 8bc8a017..930202a3 100644 --- a/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml @@ -279,9 +279,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_merge" executable: "target/nextflow/bedtools/bedtools_merge/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_merge/main.nf b/target/nextflow/bedtools/bedtools_merge/main.nf index 3af70cc8..d1dfeb39 100644 --- a/target/nextflow/bedtools/bedtools_merge/main.nf +++ b/target/nextflow/bedtools/bedtools_merge/main.nf @@ -3134,9 +3134,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_merge", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml index af9a1914..458301c5 100644 --- a/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml @@ -222,9 +222,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_sort" executable: "target/nextflow/bedtools/bedtools_sort/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_sort/main.nf b/target/nextflow/bedtools/bedtools_sort/main.nf index 8143c3ca..9691a4a5 100644 --- a/target/nextflow/bedtools/bedtools_sort/main.nf +++ b/target/nextflow/bedtools/bedtools_sort/main.nf @@ -3092,9 +3092,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_sort", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml b/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml index a9c6652d..0aba6a2c 100644 --- a/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml +++ b/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml @@ -158,9 +158,9 @@ build_info: output: "target/nextflow/busco/busco_download_datasets" executable: "target/nextflow/busco/busco_download_datasets/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/busco/busco_download_datasets/main.nf b/target/nextflow/busco/busco_download_datasets/main.nf index 67e931bd..989f3677 100644 --- a/target/nextflow/busco/busco_download_datasets/main.nf +++ b/target/nextflow/busco/busco_download_datasets/main.nf @@ -3011,9 +3011,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/busco/busco_download_datasets", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml b/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml index fff6266d..0dc9f81c 100644 --- a/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml +++ b/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml @@ -145,9 +145,9 @@ build_info: output: "target/nextflow/busco/busco_list_datasets" executable: "target/nextflow/busco/busco_list_datasets/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/busco/busco_list_datasets/main.nf b/target/nextflow/busco/busco_list_datasets/main.nf index ab9732d6..cd4042e7 100644 --- a/target/nextflow/busco/busco_list_datasets/main.nf +++ b/target/nextflow/busco/busco_list_datasets/main.nf @@ -2997,9 +2997,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/busco/busco_list_datasets", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/busco/busco_run/.config.vsh.yaml b/target/nextflow/busco/busco_run/.config.vsh.yaml index 533fcba3..9e27b0f1 100644 --- a/target/nextflow/busco/busco_run/.config.vsh.yaml +++ b/target/nextflow/busco/busco_run/.config.vsh.yaml @@ -423,9 +423,9 @@ build_info: output: "target/nextflow/busco/busco_run" executable: "target/nextflow/busco/busco_run/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/busco/busco_run/main.nf b/target/nextflow/busco/busco_run/main.nf index 72a46f2c..f4cb1d92 100644 --- a/target/nextflow/busco/busco_run/main.nf +++ b/target/nextflow/busco/busco_run/main.nf @@ -3309,9 +3309,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/busco/busco_run", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/cutadapt/.config.vsh.yaml b/target/nextflow/cutadapt/.config.vsh.yaml index d61ba10b..d51ccdac 100644 --- a/target/nextflow/cutadapt/.config.vsh.yaml +++ b/target/nextflow/cutadapt/.config.vsh.yaml @@ -740,9 +740,9 @@ build_info: output: "target/nextflow/cutadapt" executable: "target/nextflow/cutadapt/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/cutadapt/main.nf b/target/nextflow/cutadapt/main.nf index 07efa1c9..01651e49 100644 --- a/target/nextflow/cutadapt/main.nf +++ b/target/nextflow/cutadapt/main.nf @@ -3619,9 +3619,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/cutadapt", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/falco/.config.vsh.yaml b/target/nextflow/falco/.config.vsh.yaml index 4a545338..35337644 100644 --- a/target/nextflow/falco/.config.vsh.yaml +++ b/target/nextflow/falco/.config.vsh.yaml @@ -317,9 +317,9 @@ build_info: output: "target/nextflow/falco" executable: "target/nextflow/falco/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/falco/main.nf b/target/nextflow/falco/main.nf index 4df81cc0..8a27a274 100644 --- a/target/nextflow/falco/main.nf +++ b/target/nextflow/falco/main.nf @@ -3170,9 +3170,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/falco", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/fastp/.config.vsh.yaml b/target/nextflow/fastp/.config.vsh.yaml index 7c4cda3b..221983f8 100644 --- a/target/nextflow/fastp/.config.vsh.yaml +++ b/target/nextflow/fastp/.config.vsh.yaml @@ -1083,9 +1083,9 @@ build_info: output: "target/nextflow/fastp" executable: "target/nextflow/fastp/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/fastp/main.nf b/target/nextflow/fastp/main.nf index b50efecf..dcbd591b 100644 --- a/target/nextflow/fastp/main.nf +++ b/target/nextflow/fastp/main.nf @@ -4023,9 +4023,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/fastp", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/fastqc/.config.vsh.yaml b/target/nextflow/fastqc/.config.vsh.yaml index a8995745..d23bac0e 100644 --- a/target/nextflow/fastqc/.config.vsh.yaml +++ b/target/nextflow/fastqc/.config.vsh.yaml @@ -340,9 +340,9 @@ build_info: output: "target/nextflow/fastqc" executable: "target/nextflow/fastqc/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/fastqc/main.nf b/target/nextflow/fastqc/main.nf index a09aa5a6..477addaa 100644 --- a/target/nextflow/fastqc/main.nf +++ b/target/nextflow/fastqc/main.nf @@ -3182,9 +3182,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/fastqc", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/featurecounts/.config.vsh.yaml b/target/nextflow/featurecounts/.config.vsh.yaml index a542225a..528adfd6 100644 --- a/target/nextflow/featurecounts/.config.vsh.yaml +++ b/target/nextflow/featurecounts/.config.vsh.yaml @@ -645,9 +645,9 @@ build_info: output: "target/nextflow/featurecounts" executable: "target/nextflow/featurecounts/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/featurecounts/main.nf b/target/nextflow/featurecounts/main.nf index 667c27d2..f3932c4d 100644 --- a/target/nextflow/featurecounts/main.nf +++ b/target/nextflow/featurecounts/main.nf @@ -3549,9 +3549,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/featurecounts", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/fq_subsample/.config.vsh.yaml b/target/nextflow/fq_subsample/.config.vsh.yaml index 85d0415d..1562240d 100644 --- a/target/nextflow/fq_subsample/.config.vsh.yaml +++ b/target/nextflow/fq_subsample/.config.vsh.yaml @@ -190,9 +190,9 @@ build_info: output: "target/nextflow/fq_subsample" executable: "target/nextflow/fq_subsample/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/fq_subsample/main.nf b/target/nextflow/fq_subsample/main.nf index 11bb5fa5..4b395fc2 100644 --- a/target/nextflow/fq_subsample/main.nf +++ b/target/nextflow/fq_subsample/main.nf @@ -3032,9 +3032,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/fq_subsample", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/gffread/.config.vsh.yaml b/target/nextflow/gffread/.config.vsh.yaml index aa089675..7aa26a95 100644 --- a/target/nextflow/gffread/.config.vsh.yaml +++ b/target/nextflow/gffread/.config.vsh.yaml @@ -685,9 +685,9 @@ build_info: output: "target/nextflow/gffread" executable: "target/nextflow/gffread/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/gffread/main.nf b/target/nextflow/gffread/main.nf index 739241da..00326467 100644 --- a/target/nextflow/gffread/main.nf +++ b/target/nextflow/gffread/main.nf @@ -3606,9 +3606,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/gffread", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml b/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml index 3e42f876..8efcb9c0 100644 --- a/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml +++ b/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml @@ -218,9 +218,9 @@ build_info: output: "target/nextflow/kallisto/kallisto_index" executable: "target/nextflow/kallisto/kallisto_index/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/kallisto/kallisto_index/main.nf b/target/nextflow/kallisto/kallisto_index/main.nf index ac8cf864..92a2b913 100644 --- a/target/nextflow/kallisto/kallisto_index/main.nf +++ b/target/nextflow/kallisto/kallisto_index/main.nf @@ -3071,9 +3071,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/kallisto/kallisto_index", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml b/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml index 296430a3..46a429b6 100644 --- a/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml +++ b/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml @@ -234,9 +234,9 @@ build_info: output: "target/nextflow/kallisto/kallisto_quant" executable: "target/nextflow/kallisto/kallisto_quant/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/kallisto/kallisto_quant/main.nf b/target/nextflow/kallisto/kallisto_quant/main.nf index ffa97552..cc3773e4 100644 --- a/target/nextflow/kallisto/kallisto_quant/main.nf +++ b/target/nextflow/kallisto/kallisto_quant/main.nf @@ -3092,9 +3092,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/kallisto/kallisto_quant", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml b/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml index 614fd3e1..39b8b4c2 100644 --- a/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml +++ b/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml @@ -507,9 +507,9 @@ build_info: output: "target/nextflow/lofreq/lofreq_call" executable: "target/nextflow/lofreq/lofreq_call/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/lofreq/lofreq_call/main.nf b/target/nextflow/lofreq/lofreq_call/main.nf index 1dc0f1da..b9f4dd6e 100644 --- a/target/nextflow/lofreq/lofreq_call/main.nf +++ b/target/nextflow/lofreq/lofreq_call/main.nf @@ -3414,9 +3414,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/lofreq/lofreq_call", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml b/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml index b13e457d..c26e6d97 100644 --- a/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml +++ b/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml @@ -215,9 +215,9 @@ build_info: output: "target/nextflow/lofreq/lofreq_indelqual" executable: "target/nextflow/lofreq/lofreq_indelqual/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/lofreq/lofreq_indelqual/main.nf b/target/nextflow/lofreq/lofreq_indelqual/main.nf index 78745c21..07469981 100644 --- a/target/nextflow/lofreq/lofreq_indelqual/main.nf +++ b/target/nextflow/lofreq/lofreq_indelqual/main.nf @@ -3077,9 +3077,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/lofreq/lofreq_indelqual", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/multiqc/.config.vsh.yaml b/target/nextflow/multiqc/.config.vsh.yaml index 0ec1371e..353ff7c6 100644 --- a/target/nextflow/multiqc/.config.vsh.yaml +++ b/target/nextflow/multiqc/.config.vsh.yaml @@ -456,9 +456,9 @@ build_info: output: "target/nextflow/multiqc" executable: "target/nextflow/multiqc/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/multiqc/main.nf b/target/nextflow/multiqc/main.nf index 49798d21..137889fb 100644 --- a/target/nextflow/multiqc/main.nf +++ b/target/nextflow/multiqc/main.nf @@ -3366,9 +3366,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/multiqc", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/nanoplot/.config.vsh.yaml b/target/nextflow/nanoplot/.config.vsh.yaml new file mode 100644 index 00000000..313e6dba --- /dev/null +++ b/target/nextflow/nanoplot/.config.vsh.yaml @@ -0,0 +1,519 @@ +name: "nanoplot" +version: "main" +argument_groups: +- name: "Inputs" + arguments: + - type: "file" + name: "--fastq" + description: "Input fastq file(s), separated by \";\"." + info: null + example: + - "read.fq" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--fasta" + description: "Input fasta file(s), separated by \";\"." + info: null + example: + - "read.fa" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--fastq_rich" + description: "Input fastq file(s) generated by albacore or \nMinKNOW with additional\ + \ information concerning channel and time, separated by \";\".\n" + info: null + example: + - "read.fq" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--fastq_minimal" + description: "Input fastq file(s) generated by albacore or MinKNOW with\nadditional\ + \ information concerning channel and time. Minimal data is extracted\nswiftly\ + \ without elaborate checks. Separated by \";\".\n" + info: null + example: + - "read.fq" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--summary" + description: "Input summary file(s) generated by albacore or guppy, separated\ + \ by \";\".\n" + info: null + example: + - "read.txt" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--bam" + description: "Input sorted bam file(s), separated by \";\"." + info: null + example: + - "read.bam" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--ubam" + description: "Input unmapped bam file(s), separated by \";\"." + info: null + example: + - "read.ubam" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--cram" + description: "Input sorted cram file(s), separated by \";\"." + info: null + example: + - "read.cram" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--pickle" + description: "Input pickle file stored earlier, separated by \";\"." + info: null + example: + - "read.pkl" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--feather" + alternatives: + - "--arrow" + description: "Input feather file(s), separated by \";\"." + info: null + example: + - "read.arrow" + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" +- name: "Outputs" + arguments: + - type: "file" + name: "--outdir" + alternatives: + - "-o" + description: "Specify directory in which output has to be created." + info: null + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: false + multiple_sep: ";" +- name: "Options" + arguments: + - type: "boolean_true" + name: "--verbose" + description: "Write log messages also to terminal" + info: null + direction: "input" + - type: "boolean_true" + name: "--store" + description: "Store the extracted data in a pickle file for future plotting." + info: null + direction: "input" + - type: "boolean_true" + name: "--raw" + description: "Store the extracted data in tab separated file." + info: null + direction: "input" + - type: "boolean_true" + name: "--huge" + description: "Input data is one very large file." + info: null + direction: "input" + - type: "boolean_false" + name: "--no_static" + description: "Do not make static (png) plots." + info: null + direction: "input" + - type: "string" + name: "--prefix" + alternatives: + - "-p" + description: "Specify an optional prefix to be used for the output files." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--tsv_stats" + description: "Output the stats file as a properly formatted TSV." + info: null + direction: "input" + - type: "boolean_true" + name: "--only_report" + description: "Output only the report." + info: null + direction: "input" + - type: "boolean_true" + name: "--info_in_report" + description: "Add NanoPlot run info in the report." + info: null + direction: "input" +- name: "Filtering or transforming input" + arguments: + - type: "integer" + name: "--maxlength" + description: "Drop reads longer than length specified." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--minlength" + description: "Drop reads shorter than length specified." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_false" + name: "--drop_outliers" + description: "Drop outlier reads with extreme long length." + info: null + direction: "input" + - type: "integer" + name: "--downsample" + description: "Reduce dataset to N reads by random sampling." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--loglength" + description: "Logarithmic scaling of lengths in plots." + info: null + direction: "input" + - type: "boolean_true" + name: "--percentqual" + description: "Use qualities as theoretical percent identities." + info: null + direction: "input" + - type: "boolean_true" + name: "--alength" + description: "Use aligned read lengths rather than sequenced length (bam mode)." + info: null + direction: "input" + - type: "integer" + name: "--minqual" + description: "Drop reads with an average quality lower than specified." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--runtime_until" + description: "Only take the N first hours of a run." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--readtype" + description: "Which read type to extract information about from summary.\nOptions\ + \ are 1D, 2D, 1D2\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--barcoded" + description: "Use if you want to split the summary file by barcode." + info: null + direction: "input" + - type: "boolean_false" + name: "--no_supplementary" + description: "Use if you want to remove supplementary alignments." + info: null + direction: "input" +- name: "Customizing plots" + arguments: + - type: "string" + name: "--color" + alternatives: + - "-c" + description: "Specify a color for the plots, must be a valid matplotlib color." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--colormap" + alternatives: + - "-cm" + description: "Specify a valid matplotlib colormap for the heatmap." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--format" + alternatives: + - "-f" + description: "Specify the output format of the plots.\n{eps,jpeg,jpg,pdf,pgf,png,ps,raw,rgba,svg,svgz,tif,tiff}\n" + info: null + default: + - "png" + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--plots" + description: "Specify which bivariate plots have to be made.\n[{kde,hex,dot} ...]\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--legacy" + description: "Specify which bivariate plots have to be made (legacy mode).\n[{kde,dot,hex}\ + \ ...]\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--listcolors" + description: "List the colors which are available for plotting and exit." + info: null + direction: "input" + - type: "boolean_true" + name: "--listcolormaps" + description: "List the colormaps which are available for plotting and exit." + info: null + direction: "input" + - type: "boolean_false" + name: "--no_N50" + description: "Hide the N50 mark in the read length histogram." + info: null + direction: "input" + - type: "boolean_true" + name: "--N50" + description: "Show the N50 mark in the read length histogram." + info: null + direction: "input" + - type: "string" + name: "--title" + description: "Add a title to all plots, requires quoting if using spaces." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "double" + name: "--font_scale" + description: "Scale the font of the plots by a factor." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--dpi" + description: "Set the dpi for saving images." + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_false" + name: "--hide_stats" + description: "Not adding Pearson R stats in some bivariate plots." + info: null + direction: "input" +resources: +- type: "bash_script" + path: "script.sh" + is_executable: true +description: "Run NanoPlot on nanopore-sequenced reads.\nNanoPlot is a plotting tool\ + \ for long read sequencing data and alignments.\n" +test_resources: +- type: "bash_script" + path: "test.sh" + is_executable: true +- type: "file" + path: "test_data" +info: null +status: "enabled" +requirements: + commands: + - "ps" +keywords: +- "fastq" +- "sequencing summary" +- "nanopore" +license: "MIT" +references: + doi: + - "10.1093/bioinformatics/btad311" +links: + repository: "https://github.com/wdecoster/NanoPlot" + homepage: "http://nanoplot.bioinf.be/" + documentation: "https://github.com/wdecoster/NanoPlot" +runners: +- type: "executable" + id: "executable" + docker_setup_strategy: "ifneedbepullelsecachedbuild" +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "docker" + id: "docker" + image: "quay.io/biocontainers/nanoplot:1.43.0--pyhdfd78af_1" + target_registry: "images.viash-hub.com" + target_tag: "main" + namespace_separator: "/" + setup: + - type: "docker" + run: + - "version=$(NanoPlot --version) && \\\necho \"$version\" > /var/software_versions.txt\n" + entrypoint: [] + cmd: null +- type: "native" + id: "native" +build_info: + config: "src/nanoplot/config.vsh.yaml" + runner: "nextflow" + engine: "docker|native" + output: "target/nextflow/nanoplot" + executable: "target/nextflow/nanoplot/main.nf" + viash_version: "0.9.0" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" +package_config: + name: "biobox" + version: "main" + description: "A collection of bioinformatics tools for working with sequence data.\n" + info: null + viash_version: "0.9.0" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'main'" + keywords: + - "bioinformatics" + - "modules" + - "sequencing" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/biobox" + issue_tracker: "https://github.com/viash-hub/biobox/issues" diff --git a/target/nextflow/nanoplot/main.nf b/target/nextflow/nanoplot/main.nf new file mode 100644 index 00000000..fac6ed70 --- /dev/null +++ b/target/nextflow/nanoplot/main.nf @@ -0,0 +1,4115 @@ +// nanoplot main +// +// This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative +// work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data +// Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def runIf_ = args.runIf + def id_ = args.id + + assert !runIf_ || runIf_ instanceof Closure: "runEach: must pass a Closure to runIf." + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def chPassthrough = null + def chRun = null + if (runIf_) { + def idRunIfBranch = id_ch.branch{ tup -> + run: runIf_(tup[0], tup[1], comp_) + passthrough: true + } + chPassthrough = idRunIfBranch.passthrough + chRun = idRunIfBranch.run + } else { + chRun = id_ch + chPassthrough = Channel.empty() + } + def data_ch = chRun | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + def return_ch = post_ch + | concat(chPassthrough) + + return_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(":") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey', or 'newKey:oldKey;newKey:oldKey' in case of multiple values" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$\\{id\\}', id_) + .replaceAll('\\$key', key_) + .replaceAll('\\$\\{key\\}', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$\\{id\\}', id_) + .replaceAll('\\$key', key_) + .replaceAll('\\$\\{key\\}', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$\\{id\\}', id_) + .replaceAll('\\$key', key_) + .replaceAll('\\$\\{key\\}', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModified.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModified + chPassthrough = Channel.empty() + } + + def chRunFiltered = workflowArgs.filter ? + chRun | filter{workflowArgs.filter(it)} : + chRun + + def chArgs = workflowArgs.fromState ? + chRunFiltered | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRunFiltered | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chRunFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "nanoplot", + "version" : "main", + "argument_groups" : [ + { + "name" : "Inputs", + "arguments" : [ + { + "type" : "file", + "name" : "--fastq", + "description" : "Input fastq file(s), separated by \\";\\".", + "example" : [ + "read.fq" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--fasta", + "description" : "Input fasta file(s), separated by \\";\\".", + "example" : [ + "read.fa" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--fastq_rich", + "description" : "Input fastq file(s) generated by albacore or \nMinKNOW with additional information concerning channel and time, separated by \\";\\".\n", + "example" : [ + "read.fq" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--fastq_minimal", + "description" : "Input fastq file(s) generated by albacore or MinKNOW with\nadditional information concerning channel and time. Minimal data is extracted\nswiftly without elaborate checks. Separated by \\";\\".\n", + "example" : [ + "read.fq" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--summary", + "description" : "Input summary file(s) generated by albacore or guppy, separated by \\";\\".\n", + "example" : [ + "read.txt" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--bam", + "description" : "Input sorted bam file(s), separated by \\";\\".", + "example" : [ + "read.bam" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--ubam", + "description" : "Input unmapped bam file(s), separated by \\";\\".", + "example" : [ + "read.ubam" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--cram", + "description" : "Input sorted cram file(s), separated by \\";\\".", + "example" : [ + "read.cram" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--pickle", + "description" : "Input pickle file stored earlier, separated by \\";\\".", + "example" : [ + "read.pkl" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--feather", + "alternatives" : [ + "--arrow" + ], + "description" : "Input feather file(s), separated by \\";\\".", + "example" : [ + "read.arrow" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Outputs", + "arguments" : [ + { + "type" : "file", + "name" : "--outdir", + "alternatives" : [ + "-o" + ], + "description" : "Specify directory in which output has to be created.", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Options", + "arguments" : [ + { + "type" : "boolean_true", + "name" : "--verbose", + "description" : "Write log messages also to terminal", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--store", + "description" : "Store the extracted data in a pickle file for future plotting.", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--raw", + "description" : "Store the extracted data in tab separated file.", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--huge", + "description" : "Input data is one very large file.", + "direction" : "input" + }, + { + "type" : "boolean_false", + "name" : "--no_static", + "description" : "Do not make static (png) plots.", + "direction" : "input" + }, + { + "type" : "string", + "name" : "--prefix", + "alternatives" : [ + "-p" + ], + "description" : "Specify an optional prefix to be used for the output files.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--tsv_stats", + "description" : "Output the stats file as a properly formatted TSV.", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--only_report", + "description" : "Output only the report.", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--info_in_report", + "description" : "Add NanoPlot run info in the report.", + "direction" : "input" + } + ] + }, + { + "name" : "Filtering or transforming input", + "arguments" : [ + { + "type" : "integer", + "name" : "--maxlength", + "description" : "Drop reads longer than length specified.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--minlength", + "description" : "Drop reads shorter than length specified.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_false", + "name" : "--drop_outliers", + "description" : "Drop outlier reads with extreme long length.", + "direction" : "input" + }, + { + "type" : "integer", + "name" : "--downsample", + "description" : "Reduce dataset to N reads by random sampling.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--loglength", + "description" : "Logarithmic scaling of lengths in plots.", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--percentqual", + "description" : "Use qualities as theoretical percent identities.", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--alength", + "description" : "Use aligned read lengths rather than sequenced length (bam mode).", + "direction" : "input" + }, + { + "type" : "integer", + "name" : "--minqual", + "description" : "Drop reads with an average quality lower than specified.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--runtime_until", + "description" : "Only take the N first hours of a run.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--readtype", + "description" : "Which read type to extract information about from summary.\nOptions are 1D, 2D, 1D2\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--barcoded", + "description" : "Use if you want to split the summary file by barcode.", + "direction" : "input" + }, + { + "type" : "boolean_false", + "name" : "--no_supplementary", + "description" : "Use if you want to remove supplementary alignments.", + "direction" : "input" + } + ] + }, + { + "name" : "Customizing plots", + "arguments" : [ + { + "type" : "string", + "name" : "--color", + "alternatives" : [ + "-c" + ], + "description" : "Specify a color for the plots, must be a valid matplotlib color.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--colormap", + "alternatives" : [ + "-cm" + ], + "description" : "Specify a valid matplotlib colormap for the heatmap.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--format", + "alternatives" : [ + "-f" + ], + "description" : "Specify the output format of the plots.\n{eps,jpeg,jpg,pdf,pgf,png,ps,raw,rgba,svg,svgz,tif,tiff}\n", + "default" : [ + "png" + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--plots", + "description" : "Specify which bivariate plots have to be made.\n[{kde,hex,dot} ...]\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--legacy", + "description" : "Specify which bivariate plots have to be made (legacy mode).\n[{kde,dot,hex} ...]\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--listcolors", + "description" : "List the colors which are available for plotting and exit.", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--listcolormaps", + "description" : "List the colormaps which are available for plotting and exit.", + "direction" : "input" + }, + { + "type" : "boolean_false", + "name" : "--no_N50", + "description" : "Hide the N50 mark in the read length histogram.", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--N50", + "description" : "Show the N50 mark in the read length histogram.", + "direction" : "input" + }, + { + "type" : "string", + "name" : "--title", + "description" : "Add a title to all plots, requires quoting if using spaces.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "double", + "name" : "--font_scale", + "description" : "Scale the font of the plots by a factor.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--dpi", + "description" : "Set the dpi for saving images.", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_false", + "name" : "--hide_stats", + "description" : "Not adding Pearson R stats in some bivariate plots.", + "direction" : "input" + } + ] + } + ], + "resources" : [ + { + "type" : "bash_script", + "path" : "script.sh", + "is_executable" : true + } + ], + "description" : "Run NanoPlot on nanopore-sequenced reads.\nNanoPlot is a plotting tool for long read sequencing data and alignments.\n", + "test_resources" : [ + { + "type" : "bash_script", + "path" : "test.sh", + "is_executable" : true + }, + { + "type" : "file", + "path" : "test_data" + } + ], + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "keywords" : [ + "fastq", + "sequencing summary", + "nanopore" + ], + "license" : "MIT", + "references" : { + "doi" : [ + "10.1093/bioinformatics/btad311" + ] + }, + "links" : { + "repository" : "https://github.com/wdecoster/NanoPlot", + "homepage" : "http://nanoplot.bioinf.be/", + "documentation" : "https://github.com/wdecoster/NanoPlot" + }, + "runners" : [ + { + "type" : "executable", + "id" : "executable", + "docker_setup_strategy" : "ifneedbepullelsecachedbuild" + }, + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "docker", + "id" : "docker", + "image" : "quay.io/biocontainers/nanoplot:1.43.0--pyhdfd78af_1", + "target_registry" : "images.viash-hub.com", + "target_tag" : "main", + "namespace_separator" : "/", + "setup" : [ + { + "type" : "docker", + "run" : [ + "version=$(NanoPlot --version) && \\\\\necho \\"$version\\" > /var/software_versions.txt\n" + ] + } + ] + }, + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/nanoplot/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "docker|native", + "output" : "target/nextflow/nanoplot", + "viash_version" : "0.9.0", + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" + }, + "package_config" : { + "name" : "biobox", + "version" : "main", + "description" : "A collection of bioinformatics tools for working with sequence data.\n", + "viash_version" : "0.9.0", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'main'" + ], + "keywords" : [ + "bioinformatics", + "modules", + "sequencing" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/biobox", + "issue_tracker" : "https://github.com/viash-hub/biobox/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// inner workflow hook +def innerWorkflowFactory(args) { + def rawScript = '''set -e +tempscript=".viash_script.sh" +cat > "$tempscript" << VIASHMAIN +#!/bin/bash + +set -eo pipefail + +## VIASH START +# The following code has been auto-generated by Viash. +$( if [ ! -z ${VIASH_PAR_FASTQ+x} ]; then echo "${VIASH_PAR_FASTQ}" | sed "s#'#'\\"'\\"'#g;s#.*#par_fastq='&'#" ; else echo "# par_fastq="; fi ) +$( if [ ! -z ${VIASH_PAR_FASTA+x} ]; then echo "${VIASH_PAR_FASTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_fasta='&'#" ; else echo "# par_fasta="; fi ) +$( if [ ! -z ${VIASH_PAR_FASTQ_RICH+x} ]; then echo "${VIASH_PAR_FASTQ_RICH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_fastq_rich='&'#" ; else echo "# par_fastq_rich="; fi ) +$( if [ ! -z ${VIASH_PAR_FASTQ_MINIMAL+x} ]; then echo "${VIASH_PAR_FASTQ_MINIMAL}" | sed "s#'#'\\"'\\"'#g;s#.*#par_fastq_minimal='&'#" ; else echo "# par_fastq_minimal="; fi ) +$( if [ ! -z ${VIASH_PAR_SUMMARY+x} ]; then echo "${VIASH_PAR_SUMMARY}" | sed "s#'#'\\"'\\"'#g;s#.*#par_summary='&'#" ; else echo "# par_summary="; fi ) +$( if [ ! -z ${VIASH_PAR_BAM+x} ]; then echo "${VIASH_PAR_BAM}" | sed "s#'#'\\"'\\"'#g;s#.*#par_bam='&'#" ; else echo "# par_bam="; fi ) +$( if [ ! -z ${VIASH_PAR_UBAM+x} ]; then echo "${VIASH_PAR_UBAM}" | sed "s#'#'\\"'\\"'#g;s#.*#par_ubam='&'#" ; else echo "# par_ubam="; fi ) +$( if [ ! -z ${VIASH_PAR_CRAM+x} ]; then echo "${VIASH_PAR_CRAM}" | sed "s#'#'\\"'\\"'#g;s#.*#par_cram='&'#" ; else echo "# par_cram="; fi ) +$( if [ ! -z ${VIASH_PAR_PICKLE+x} ]; then echo "${VIASH_PAR_PICKLE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_pickle='&'#" ; else echo "# par_pickle="; fi ) +$( if [ ! -z ${VIASH_PAR_FEATHER+x} ]; then echo "${VIASH_PAR_FEATHER}" | sed "s#'#'\\"'\\"'#g;s#.*#par_feather='&'#" ; else echo "# par_feather="; fi ) +$( if [ ! -z ${VIASH_PAR_OUTDIR+x} ]; then echo "${VIASH_PAR_OUTDIR}" | sed "s#'#'\\"'\\"'#g;s#.*#par_outdir='&'#" ; else echo "# par_outdir="; fi ) +$( if [ ! -z ${VIASH_PAR_VERBOSE+x} ]; then echo "${VIASH_PAR_VERBOSE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_verbose='&'#" ; else echo "# par_verbose="; fi ) +$( if [ ! -z ${VIASH_PAR_STORE+x} ]; then echo "${VIASH_PAR_STORE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_store='&'#" ; else echo "# par_store="; fi ) +$( if [ ! -z ${VIASH_PAR_RAW+x} ]; then echo "${VIASH_PAR_RAW}" | sed "s#'#'\\"'\\"'#g;s#.*#par_raw='&'#" ; else echo "# par_raw="; fi ) +$( if [ ! -z ${VIASH_PAR_HUGE+x} ]; then echo "${VIASH_PAR_HUGE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_huge='&'#" ; else echo "# par_huge="; fi ) +$( if [ ! -z ${VIASH_PAR_NO_STATIC+x} ]; then echo "${VIASH_PAR_NO_STATIC}" | sed "s#'#'\\"'\\"'#g;s#.*#par_no_static='&'#" ; else echo "# par_no_static="; fi ) +$( if [ ! -z ${VIASH_PAR_PREFIX+x} ]; then echo "${VIASH_PAR_PREFIX}" | sed "s#'#'\\"'\\"'#g;s#.*#par_prefix='&'#" ; else echo "# par_prefix="; fi ) +$( if [ ! -z ${VIASH_PAR_TSV_STATS+x} ]; then echo "${VIASH_PAR_TSV_STATS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_tsv_stats='&'#" ; else echo "# par_tsv_stats="; fi ) +$( if [ ! -z ${VIASH_PAR_ONLY_REPORT+x} ]; then echo "${VIASH_PAR_ONLY_REPORT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_only_report='&'#" ; else echo "# par_only_report="; fi ) +$( if [ ! -z ${VIASH_PAR_INFO_IN_REPORT+x} ]; then echo "${VIASH_PAR_INFO_IN_REPORT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_info_in_report='&'#" ; else echo "# par_info_in_report="; fi ) +$( if [ ! -z ${VIASH_PAR_MAXLENGTH+x} ]; then echo "${VIASH_PAR_MAXLENGTH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_maxlength='&'#" ; else echo "# par_maxlength="; fi ) +$( if [ ! -z ${VIASH_PAR_MINLENGTH+x} ]; then echo "${VIASH_PAR_MINLENGTH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_minlength='&'#" ; else echo "# par_minlength="; fi ) +$( if [ ! -z ${VIASH_PAR_DROP_OUTLIERS+x} ]; then echo "${VIASH_PAR_DROP_OUTLIERS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_drop_outliers='&'#" ; else echo "# par_drop_outliers="; fi ) +$( if [ ! -z ${VIASH_PAR_DOWNSAMPLE+x} ]; then echo "${VIASH_PAR_DOWNSAMPLE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_downsample='&'#" ; else echo "# par_downsample="; fi ) +$( if [ ! -z ${VIASH_PAR_LOGLENGTH+x} ]; then echo "${VIASH_PAR_LOGLENGTH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_loglength='&'#" ; else echo "# par_loglength="; fi ) +$( if [ ! -z ${VIASH_PAR_PERCENTQUAL+x} ]; then echo "${VIASH_PAR_PERCENTQUAL}" | sed "s#'#'\\"'\\"'#g;s#.*#par_percentqual='&'#" ; else echo "# par_percentqual="; fi ) +$( if [ ! -z ${VIASH_PAR_ALENGTH+x} ]; then echo "${VIASH_PAR_ALENGTH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_alength='&'#" ; else echo "# par_alength="; fi ) +$( if [ ! -z ${VIASH_PAR_MINQUAL+x} ]; then echo "${VIASH_PAR_MINQUAL}" | sed "s#'#'\\"'\\"'#g;s#.*#par_minqual='&'#" ; else echo "# par_minqual="; fi ) +$( if [ ! -z ${VIASH_PAR_RUNTIME_UNTIL+x} ]; then echo "${VIASH_PAR_RUNTIME_UNTIL}" | sed "s#'#'\\"'\\"'#g;s#.*#par_runtime_until='&'#" ; else echo "# par_runtime_until="; fi ) +$( if [ ! -z ${VIASH_PAR_READTYPE+x} ]; then echo "${VIASH_PAR_READTYPE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_readtype='&'#" ; else echo "# par_readtype="; fi ) +$( if [ ! -z ${VIASH_PAR_BARCODED+x} ]; then echo "${VIASH_PAR_BARCODED}" | sed "s#'#'\\"'\\"'#g;s#.*#par_barcoded='&'#" ; else echo "# par_barcoded="; fi ) +$( if [ ! -z ${VIASH_PAR_NO_SUPPLEMENTARY+x} ]; then echo "${VIASH_PAR_NO_SUPPLEMENTARY}" | sed "s#'#'\\"'\\"'#g;s#.*#par_no_supplementary='&'#" ; else echo "# par_no_supplementary="; fi ) +$( if [ ! -z ${VIASH_PAR_COLOR+x} ]; then echo "${VIASH_PAR_COLOR}" | sed "s#'#'\\"'\\"'#g;s#.*#par_color='&'#" ; else echo "# par_color="; fi ) +$( if [ ! -z ${VIASH_PAR_COLORMAP+x} ]; then echo "${VIASH_PAR_COLORMAP}" | sed "s#'#'\\"'\\"'#g;s#.*#par_colormap='&'#" ; else echo "# par_colormap="; fi ) +$( if [ ! -z ${VIASH_PAR_FORMAT+x} ]; then echo "${VIASH_PAR_FORMAT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_format='&'#" ; else echo "# par_format="; fi ) +$( if [ ! -z ${VIASH_PAR_PLOTS+x} ]; then echo "${VIASH_PAR_PLOTS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_plots='&'#" ; else echo "# par_plots="; fi ) +$( if [ ! -z ${VIASH_PAR_LEGACY+x} ]; then echo "${VIASH_PAR_LEGACY}" | sed "s#'#'\\"'\\"'#g;s#.*#par_legacy='&'#" ; else echo "# par_legacy="; fi ) +$( if [ ! -z ${VIASH_PAR_LISTCOLORS+x} ]; then echo "${VIASH_PAR_LISTCOLORS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_listcolors='&'#" ; else echo "# par_listcolors="; fi ) +$( if [ ! -z ${VIASH_PAR_LISTCOLORMAPS+x} ]; then echo "${VIASH_PAR_LISTCOLORMAPS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_listcolormaps='&'#" ; else echo "# par_listcolormaps="; fi ) +$( if [ ! -z ${VIASH_PAR_NO_N50+x} ]; then echo "${VIASH_PAR_NO_N50}" | sed "s#'#'\\"'\\"'#g;s#.*#par_no_N50='&'#" ; else echo "# par_no_N50="; fi ) +$( if [ ! -z ${VIASH_PAR_N50+x} ]; then echo "${VIASH_PAR_N50}" | sed "s#'#'\\"'\\"'#g;s#.*#par_N50='&'#" ; else echo "# par_N50="; fi ) +$( if [ ! -z ${VIASH_PAR_TITLE+x} ]; then echo "${VIASH_PAR_TITLE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_title='&'#" ; else echo "# par_title="; fi ) +$( if [ ! -z ${VIASH_PAR_FONT_SCALE+x} ]; then echo "${VIASH_PAR_FONT_SCALE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_font_scale='&'#" ; else echo "# par_font_scale="; fi ) +$( if [ ! -z ${VIASH_PAR_DPI+x} ]; then echo "${VIASH_PAR_DPI}" | sed "s#'#'\\"'\\"'#g;s#.*#par_dpi='&'#" ; else echo "# par_dpi="; fi ) +$( if [ ! -z ${VIASH_PAR_HIDE_STATS+x} ]; then echo "${VIASH_PAR_HIDE_STATS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_hide_stats='&'#" ; else echo "# par_hide_stats="; fi ) +$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi ) +$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi ) +$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi ) +$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi ) +$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi ) +$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi ) +$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi ) + +## VIASH END + +# Unset flags +unset_if_false=( + par_verbose + par_store + par_raw + par_huge + par_no_static + par_tsv_stats + par_only_report + par_info_in_report + par_drop_outliers + par_loglength + par_percentqual + par_alength + par_barcoded + par_no_supplementary + par_listcolors + par_listcolormaps + par_no_N50 + par_N50 + par_hide_stats +) + +for var in "\\${unset_if_false[@]}"; do + test_val="\\${!var}" + [[ "\\$test_val" == "false" ]] && unset \\$var +done + +par_fastq="\\${par_fastq//;/ }" +par_fasta="\\${par_fasta//;/ }" +par_fastq_rich="\\${par_fastq_rich//;/ }" +par_fastq_minimal="\\${par_fastq_minimal//;/ }" +par_summary="\\${par_summary//;/ }" +par_bam="\\${par_bam//;/ }" +par_ubam="\\${par_ubam//;/ }" +par_cram="\\${par_cram//;/ }" +par_pickle="\\${par_pickle//;/ }" +par_feather="\\${par_feather//;/ }" + + +inputs=( + "\\$par_fastq" + "\\$par_fasta" + "\\$par_fastq_rich" + "\\$par_fastq_minimal" + "\\$par_summary" + "\\$par_bam" + "\\$par_ubam" + "\\$par_cram" + "\\$par_pickle" + "\\$par_feather" +) + +one_input=false +for var in "\\${inputs[@]}"; do + if [ -n "\\$var" ]; then # if the parameter is not empty + if [ "\\$one_input" = "false" ]; then + one_input=true + else # Multiple input file types specified + echo "Error: Multiple input file types specified." + exit 1 + fi + fi +done + +if [ ! "\\$one_input" ]; then + echo "Error: No input file type specified." + exit 1 +fi + + + +# Run NanoPlot +NanoPlot \\\\ + \\${par_fastq:+--fastq \\$par_fastq} \\\\ + \\${par_fasta:+--fasta \\$par_fasta} \\\\ + \\${par_fastq_rich:+--fastq_rich \\$par_fastq_rich} \\\\ + \\${par_fastq_minimal:+--fastq_minimal \\$par_fastq_minimal} \\\\ + \\${par_summary:+--summary \\$par_summary} \\\\ + \\${par_bam:+--bam \\$par_bam} \\\\ + \\${par_ubam:+--ubam \\$par_ubam} \\\\ + \\${par_cram:+--cram \\$par_cram} \\\\ + \\${par_pickle:+--pickle \\$par_pickle} \\\\ + \\${par_feather:+--feather \\$par_feather} \\\\ + \\${par_verbose:+--verbose} \\\\ + \\${par_store:+--store} \\\\ + \\${par_raw:+--raw} \\\\ + \\${par_huge:+--huge} \\\\ + \\${par_no_static:+--no_static} \\\\ + \\${par_prefix:+--prefix "\\$par_prefix"} \\\\ + \\${par_tsv_stats:+--tsv_stats} \\\\ + \\${par_only_report:+--only-report} \\\\ + \\${par_info_in_report:+--info_in_report} \\\\ + \\${par_maxlength:+--maxlength "\\$par_maxlength"} \\\\ + \\${par_minlength:+--minlength "\\$par_minlength"} \\\\ + \\${par_drop_outliers:+--drop_outliers} \\\\ + \\${par_downsample:+--downsample "\\$par_downsample"} \\\\ + \\${par_loglength:+--loglength} \\\\ + \\${par_percentqual:+--percentqual} \\\\ + \\${par_alength:+--alength} \\\\ + \\${par_minqual:+--minqual "\\$par_minqual"} \\\\ + \\${par_runtime_until:+--runtime_until "\\$par_runtime_until"} \\\\ + \\${par_readtype:+--readtype "\\$par_readtype"} \\\\ + \\${par_barcoded:+--barcoded} \\\\ + \\${par_no_supplementary:+--no_supplementary} \\\\ + \\${par_color:+--color "\\$par_color"} \\\\ + \\${par_colormap:+--colormap "\\$par_colormap"} \\\\ + \\${par_format:+--format "\\$par_format"} \\\\ + \\${par_plots:+--plots "\\$par_plots"} \\\\ + \\${par_legacy:+--legacy "\\$par_legacy"} \\\\ + \\${par_listcolors:+--listcolors} \\\\ + \\${par_listcolormaps:+--listcolormaps} \\\\ + \\${par_no_N50:+--no-N50} \\\\ + \\${par_N50:+--N50} \\\\ + \\${par_title:+--title "\\$par_title"} \\\\ + \\${par_font_scale:+--font_scale "\\$par_font_scale"} \\\\ + \\${par_dpi:+--dpi "\\$par_dpi"} \\\\ + \\${par_hide_stats:+--hide_stats} \\\\ + \\${meta_cpus:+--threads "\\$meta_cpus"} \\\\ + --outdir "\\$par_outdir" + +exit 0 +VIASHMAIN +bash "$tempscript" +''' + + return vdsl3WorkflowFactory(args, meta, rawScript) +} + + + +/** + * Generate a workflow for VDSL3 modules. + * + * This function is called by the workflowFactory() function. + * + * Input channel: [id, input_map] + * Output channel: [id, output_map] + * + * Internally, this workflow will convert the input channel + * to a format which the Nextflow module will be able to handle. + */ +def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) { + def key = args["key"] + def processObj = null + + workflow processWf { + take: input_ + main: + + if (processObj == null) { + processObj = _vdsl3ProcessFactory(args, meta, rawScript) + } + + output_ = input_ + | map { tuple -> + def id = tuple[0] + def data_ = tuple[1] + + if (workflow.stubRun) { + // add id if missing + data_ = [id: 'stub'] + data_ + } + + // process input files separately + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { par -> + def val = data_.containsKey(par.plainName) ? data_[par.plainName] : [] + def inputFiles = [] + if (val == null) { + inputFiles = [] + } else if (val instanceof List) { + inputFiles = val + } else if (val instanceof Path) { + inputFiles = [ val ] + } else { + inputFiles = [] + } + if (!workflow.stubRun) { + // throw error when an input file doesn't exist + inputFiles.each{ file -> + assert file.exists() : + "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" + + " Required input file does not exist.\n" + + " Path: '$file'.\n" + + " Expected input file to exist" + } + } + inputFiles + } + + // remove input files + def argsExclInputFiles = meta.config.allArguments + .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) } + .collectEntries { par -> + def parName = par.plainName + def val = data_[parName] + if (par.multiple && val instanceof Collection) { + val = val.join(par.multiple_sep) + } + if (par.direction == "output" && par.type == "file") { + val = val + .replaceAll('\\$id', id) + .replaceAll('\\$\\{id\\}', id) + .replaceAll('\\$key', key) + .replaceAll('\\$\\{key\\}', key) + } + [parName, val] + } + + [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ] + } + | processObj + | map { output -> + def outputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .indexed() + .collectEntries{ index, par -> + def out = output[index + 1] + // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678) + if (!out instanceof List || out.size() <= 1) { + if (par.multiple) { + out = [] + } else { + assert !par.required : + "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" + + " Required output file is missing" + out = null + } + } else if (out.size() == 2 && !par.multiple) { + out = out[1] + } else { + out = out.drop(1) + } + [ par.plainName, out ] + } + + // drop null outputs + outputFiles.removeAll{it.value == null} + + [ output[0], outputFiles ] + } + emit: output_ + } + + return processWf +} + +// depends on: session? +def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) { + // autodetect process key + def wfKey = workflowArgs["key"] + def procKeyPrefix = "${wfKey}_process" + def scriptMeta = nextflow.script.ScriptMeta.current() + def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)} + def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()} + def newNumber = (numbers + [-1]).max() + 1 + + def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber" + + if (newNumber > 0) { + log.warn "Key for module '${wfKey}' is duplicated.\n", + "If you run a component multiple times in the same workflow,\n" + + "it's recommended you set a unique key for every call,\n" + + "for example: ${wfKey}.run(key: \"foo\")." + } + + // subset directives and convert to list of tuples + def drctv = workflowArgs.directives + + // TODO: unit test the two commands below + // convert publish array into tags + def valueToStr = { val -> + // ignore closures + if (val instanceof CharSequence) { + if (!val.matches('^[{].*[}]$')) { + '"' + val + '"' + } else { + val + } + } else if (val instanceof List) { + "[" + val.collect{valueToStr(it)}.join(", ") + "]" + } else if (val instanceof Map) { + "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]" + } else { + val.inspect() + } + } + + // multiple entries allowed: label, publishdir + def drctvStrs = drctv.collect { key, value -> + if (key in ["label", "publishDir"]) { + value.collect{ val -> + if (val instanceof Map) { + "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else if (val == null) { + "" + } else { + "\n$key " + valueToStr(val) + } + }.join() + } else if (value instanceof Map) { + "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else { + "\n$key " + valueToStr(value) + } + }.join() + + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' } + .join() + + def outputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + // insert dummy into every output (see nextflow-io/nextflow#2678) + if (!par.multiple) { + ', path{[".exitcode", args.' + par.plainName + ']}' + } else { + ', path{[".exitcode"] + args.' + par.plainName + '}' + } + } + .join() + + // TODO: move this functionality somewhere else? + if (workflowArgs.auto.transcript) { + outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}' + } else { + outputPaths = outputPaths + ', path{[".exitcode"]}' + } + + // create dirs for output files (based on BashWrapper.createParentFiles) + def createParentStr = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" && it.create_parent } + .collect { par -> + def contents = "args[\"${par.plainName}\"] instanceof List ? args[\"${par.plainName}\"].join('\" \"') : args[\"${par.plainName}\"]" + "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent '\" + escapeText(${contents}) + \"'\" : \"\" }" + } + .join("\n") + + // construct inputFileExports + def inputFileExports = meta.config.allArguments + .findAll { it.type == "file" && it.direction.toLowerCase() == "input" } + .collect { par -> + def contents = "viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName}" + "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}='\" + escapeText(${contents}) + \"'\"}" + } + + // NOTE: if using docker, use /tmp instead of tmpDir! + def tmpDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('VIASH_TMPDIR') ?: + System.getenv('VIASH_TEMPDIR') ?: + System.getenv('VIASH_TMP') ?: + System.getenv('TEMP') ?: + System.getenv('TMPDIR') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMP') ?: + '/tmp' + ).toAbsolutePath() + + // construct stub + def stub = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // escape script + def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"') + + // publishdir assert + def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? + """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n Example: --publish_dir './output/'" """ : + "" + + // generate process string + def procStr = + """nextflow.enable.dsl=2 + | + |def escapeText = { s -> s.toString().replaceAll("'", "'\\\"'\\\"'") } + |process $procKey {$drctvStrs + |input: + | tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources") + |output: + | tuple val("\$id")$outputPaths, optional: true + |stub: + |\"\"\" + |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; } + |$stub + |\"\"\" + |script:$assertStr + |def parInject = args + | .findAll{key, value -> value != null} + | .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}='\${escapeText(value)}'"} + | .join("\\n") + |\"\"\" + |# meta exports + |export VIASH_META_RESOURCES_DIR="\${resourcesDir}" + |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}" + |export VIASH_META_NAME="${meta.config.name}" + |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME" + |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml" + |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" } + |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" } + |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then + | export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 )) + | export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 )) + | export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 )) + | export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 )) + | export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 )) + | export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 )) + | export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 )) + | export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 )) + | export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 )) + | export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 )) + |fi + | + |# meta synonyms + |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR" + |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR" + | + |# create output dirs if need be + |function mkdir_parent { + | for file in "\\\$@"; do + | mkdir -p "\\\$(dirname "\\\$file")" + | done + |} + |$createParentStr + | + |# argument exports${inputFileExports.join()} + |\$parInject + | + |# process script + |${escapedScript} + |\"\"\" + |} + |""".stripMargin() + + // TODO: print on debug + // if (workflowArgs.debug == true) { + // println("######################\n$procStr\n######################") + // } + + // write process to temp file + def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf") + addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) } + tempFile.text = procStr + + // create process from temp file + def binding = new nextflow.script.ScriptBinding([:]) + def session = nextflow.Nextflow.getSession() + def parser = new nextflow.script.ScriptParser(session) + .setModule(true) + .setBinding(binding) + def moduleScript = parser.runScript(tempFile) + .getScript() + + // register module in meta + def module = new nextflow.script.IncludeDef.Module(name: procKey) + scriptMeta.addModule(moduleScript, module.name, module.alias) + + // retrieve and return process from meta + return scriptMeta.getProcess(procKey) +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "container" : { + "registry" : "images.viash-hub.com", + "image" : "vsh/biobox/nanoplot", + "tag" : "main" + }, + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/nextflow/nanoplot/nextflow.config b/target/nextflow/nanoplot/nextflow.config new file mode 100644 index 00000000..990c988f --- /dev/null +++ b/target/nextflow/nanoplot/nextflow.config @@ -0,0 +1,125 @@ +manifest { + name = 'nanoplot' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'main' + description = 'Run NanoPlot on nanopore-sequenced reads.\nNanoPlot is a plotting tool for long read sequencing data and alignments.\n' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/nextflow/nanoplot/nextflow_schema.json b/target/nextflow/nanoplot/nextflow_schema.json new file mode 100644 index 00000000..d778e7a0 --- /dev/null +++ b/target/nextflow/nanoplot/nextflow_schema.json @@ -0,0 +1,587 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "nanoplot", +"description": "Run NanoPlot on nanopore-sequenced reads.\nNanoPlot is a plotting tool for long read sequencing data and alignments.\n", +"type": "object", +"definitions": { + + + + "inputs" : { + "title": "Inputs", + "type": "object", + "description": "No description", + "properties": { + + + "fastq": { + "type": + "string", + "description": "Type: List of `file`, example: `read.fq`, multiple_sep: `\";\"`. Input fastq file(s), separated by \";\"", + "help_text": "Type: List of `file`, example: `read.fq`, multiple_sep: `\";\"`. Input fastq file(s), separated by \";\"." + + } + + + , + "fasta": { + "type": + "string", + "description": "Type: List of `file`, example: `read.fa`, multiple_sep: `\";\"`. Input fasta file(s), separated by \";\"", + "help_text": "Type: List of `file`, example: `read.fa`, multiple_sep: `\";\"`. Input fasta file(s), separated by \";\"." + + } + + + , + "fastq_rich": { + "type": + "string", + "description": "Type: List of `file`, example: `read.fq`, multiple_sep: `\";\"`. Input fastq file(s) generated by albacore or \nMinKNOW with additional information concerning channel and time, separated by \";\"", + "help_text": "Type: List of `file`, example: `read.fq`, multiple_sep: `\";\"`. Input fastq file(s) generated by albacore or \nMinKNOW with additional information concerning channel and time, separated by \";\".\n" + + } + + + , + "fastq_minimal": { + "type": + "string", + "description": "Type: List of `file`, example: `read.fq`, multiple_sep: `\";\"`. Input fastq file(s) generated by albacore or MinKNOW with\nadditional information concerning channel and time", + "help_text": "Type: List of `file`, example: `read.fq`, multiple_sep: `\";\"`. Input fastq file(s) generated by albacore or MinKNOW with\nadditional information concerning channel and time. Minimal data is extracted\nswiftly without elaborate checks. Separated by \";\".\n" + + } + + + , + "summary": { + "type": + "string", + "description": "Type: List of `file`, example: `read.txt`, multiple_sep: `\";\"`. Input summary file(s) generated by albacore or guppy, separated by \";\"", + "help_text": "Type: List of `file`, example: `read.txt`, multiple_sep: `\";\"`. Input summary file(s) generated by albacore or guppy, separated by \";\".\n" + + } + + + , + "bam": { + "type": + "string", + "description": "Type: List of `file`, example: `read.bam`, multiple_sep: `\";\"`. Input sorted bam file(s), separated by \";\"", + "help_text": "Type: List of `file`, example: `read.bam`, multiple_sep: `\";\"`. Input sorted bam file(s), separated by \";\"." + + } + + + , + "ubam": { + "type": + "string", + "description": "Type: List of `file`, example: `read.ubam`, multiple_sep: `\";\"`. Input unmapped bam file(s), separated by \";\"", + "help_text": "Type: List of `file`, example: `read.ubam`, multiple_sep: `\";\"`. Input unmapped bam file(s), separated by \";\"." + + } + + + , + "cram": { + "type": + "string", + "description": "Type: List of `file`, example: `read.cram`, multiple_sep: `\";\"`. Input sorted cram file(s), separated by \";\"", + "help_text": "Type: List of `file`, example: `read.cram`, multiple_sep: `\";\"`. Input sorted cram file(s), separated by \";\"." + + } + + + , + "pickle": { + "type": + "string", + "description": "Type: List of `file`, example: `read.pkl`, multiple_sep: `\";\"`. Input pickle file stored earlier, separated by \";\"", + "help_text": "Type: List of `file`, example: `read.pkl`, multiple_sep: `\";\"`. Input pickle file stored earlier, separated by \";\"." + + } + + + , + "feather": { + "type": + "string", + "description": "Type: List of `file`, example: `read.arrow`, multiple_sep: `\";\"`. Input feather file(s), separated by \";\"", + "help_text": "Type: List of `file`, example: `read.arrow`, multiple_sep: `\";\"`. Input feather file(s), separated by \";\"." + + } + + +} +}, + + + "outputs" : { + "title": "Outputs", + "type": "object", + "description": "No description", + "properties": { + + + "outdir": { + "type": + "string", + "description": "Type: `file`, required, default: `$id.$key.outdir.outdir`. Specify directory in which output has to be created", + "help_text": "Type: `file`, required, default: `$id.$key.outdir.outdir`. Specify directory in which output has to be created." + , + "default": "$id.$key.outdir.outdir" + } + + +} +}, + + + "options" : { + "title": "Options", + "type": "object", + "description": "No description", + "properties": { + + + "verbose": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Write log messages also to terminal", + "help_text": "Type: `boolean_true`, default: `false`. Write log messages also to terminal" + , + "default": "False" + } + + + , + "store": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Store the extracted data in a pickle file for future plotting", + "help_text": "Type: `boolean_true`, default: `false`. Store the extracted data in a pickle file for future plotting." + , + "default": "False" + } + + + , + "raw": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Store the extracted data in tab separated file", + "help_text": "Type: `boolean_true`, default: `false`. Store the extracted data in tab separated file." + , + "default": "False" + } + + + , + "huge": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Input data is one very large file", + "help_text": "Type: `boolean_true`, default: `false`. Input data is one very large file." + , + "default": "False" + } + + + , + "no_static": { + "type": + "boolean", + "description": "Type: `boolean_false`, default: `true`. Do not make static (png) plots", + "help_text": "Type: `boolean_false`, default: `true`. Do not make static (png) plots." + , + "default": "True" + } + + + , + "prefix": { + "type": + "string", + "description": "Type: `string`. Specify an optional prefix to be used for the output files", + "help_text": "Type: `string`. Specify an optional prefix to be used for the output files." + + } + + + , + "tsv_stats": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Output the stats file as a properly formatted TSV", + "help_text": "Type: `boolean_true`, default: `false`. Output the stats file as a properly formatted TSV." + , + "default": "False" + } + + + , + "only_report": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Output only the report", + "help_text": "Type: `boolean_true`, default: `false`. Output only the report." + , + "default": "False" + } + + + , + "info_in_report": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Add NanoPlot run info in the report", + "help_text": "Type: `boolean_true`, default: `false`. Add NanoPlot run info in the report." + , + "default": "False" + } + + +} +}, + + + "filtering or transforming input" : { + "title": "Filtering or transforming input", + "type": "object", + "description": "No description", + "properties": { + + + "maxlength": { + "type": + "integer", + "description": "Type: `integer`. Drop reads longer than length specified", + "help_text": "Type: `integer`. Drop reads longer than length specified." + + } + + + , + "minlength": { + "type": + "integer", + "description": "Type: `integer`. Drop reads shorter than length specified", + "help_text": "Type: `integer`. Drop reads shorter than length specified." + + } + + + , + "drop_outliers": { + "type": + "boolean", + "description": "Type: `boolean_false`, default: `true`. Drop outlier reads with extreme long length", + "help_text": "Type: `boolean_false`, default: `true`. Drop outlier reads with extreme long length." + , + "default": "True" + } + + + , + "downsample": { + "type": + "integer", + "description": "Type: `integer`. Reduce dataset to N reads by random sampling", + "help_text": "Type: `integer`. Reduce dataset to N reads by random sampling." + + } + + + , + "loglength": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Logarithmic scaling of lengths in plots", + "help_text": "Type: `boolean_true`, default: `false`. Logarithmic scaling of lengths in plots." + , + "default": "False" + } + + + , + "percentqual": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Use qualities as theoretical percent identities", + "help_text": "Type: `boolean_true`, default: `false`. Use qualities as theoretical percent identities." + , + "default": "False" + } + + + , + "alength": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Use aligned read lengths rather than sequenced length (bam mode)", + "help_text": "Type: `boolean_true`, default: `false`. Use aligned read lengths rather than sequenced length (bam mode)." + , + "default": "False" + } + + + , + "minqual": { + "type": + "integer", + "description": "Type: `integer`. Drop reads with an average quality lower than specified", + "help_text": "Type: `integer`. Drop reads with an average quality lower than specified." + + } + + + , + "runtime_until": { + "type": + "integer", + "description": "Type: `integer`. Only take the N first hours of a run", + "help_text": "Type: `integer`. Only take the N first hours of a run." + + } + + + , + "readtype": { + "type": + "string", + "description": "Type: `string`. Which read type to extract information about from summary", + "help_text": "Type: `string`. Which read type to extract information about from summary.\nOptions are 1D, 2D, 1D2\n" + + } + + + , + "barcoded": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Use if you want to split the summary file by barcode", + "help_text": "Type: `boolean_true`, default: `false`. Use if you want to split the summary file by barcode." + , + "default": "False" + } + + + , + "no_supplementary": { + "type": + "boolean", + "description": "Type: `boolean_false`, default: `true`. Use if you want to remove supplementary alignments", + "help_text": "Type: `boolean_false`, default: `true`. Use if you want to remove supplementary alignments." + , + "default": "True" + } + + +} +}, + + + "customizing plots" : { + "title": "Customizing plots", + "type": "object", + "description": "No description", + "properties": { + + + "color": { + "type": + "string", + "description": "Type: `string`. Specify a color for the plots, must be a valid matplotlib color", + "help_text": "Type: `string`. Specify a color for the plots, must be a valid matplotlib color." + + } + + + , + "colormap": { + "type": + "string", + "description": "Type: `string`. Specify a valid matplotlib colormap for the heatmap", + "help_text": "Type: `string`. Specify a valid matplotlib colormap for the heatmap." + + } + + + , + "format": { + "type": + "string", + "description": "Type: `string`, default: `png`. Specify the output format of the plots", + "help_text": "Type: `string`, default: `png`. Specify the output format of the plots.\n{eps,jpeg,jpg,pdf,pgf,png,ps,raw,rgba,svg,svgz,tif,tiff}\n" + , + "default": "png" + } + + + , + "plots": { + "type": + "string", + "description": "Type: `string`. Specify which bivariate plots have to be made", + "help_text": "Type: `string`. Specify which bivariate plots have to be made.\n[{kde,hex,dot} ...]\n" + + } + + + , + "legacy": { + "type": + "string", + "description": "Type: `string`. Specify which bivariate plots have to be made (legacy mode)", + "help_text": "Type: `string`. Specify which bivariate plots have to be made (legacy mode).\n[{kde,dot,hex} ...]\n" + + } + + + , + "listcolors": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. List the colors which are available for plotting and exit", + "help_text": "Type: `boolean_true`, default: `false`. List the colors which are available for plotting and exit." + , + "default": "False" + } + + + , + "listcolormaps": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. List the colormaps which are available for plotting and exit", + "help_text": "Type: `boolean_true`, default: `false`. List the colormaps which are available for plotting and exit." + , + "default": "False" + } + + + , + "no_N50": { + "type": + "boolean", + "description": "Type: `boolean_false`, default: `true`. Hide the N50 mark in the read length histogram", + "help_text": "Type: `boolean_false`, default: `true`. Hide the N50 mark in the read length histogram." + , + "default": "True" + } + + + , + "N50": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Show the N50 mark in the read length histogram", + "help_text": "Type: `boolean_true`, default: `false`. Show the N50 mark in the read length histogram." + , + "default": "False" + } + + + , + "title": { + "type": + "string", + "description": "Type: `string`. Add a title to all plots, requires quoting if using spaces", + "help_text": "Type: `string`. Add a title to all plots, requires quoting if using spaces." + + } + + + , + "font_scale": { + "type": + "number", + "description": "Type: `double`. Scale the font of the plots by a factor", + "help_text": "Type: `double`. Scale the font of the plots by a factor." + + } + + + , + "dpi": { + "type": + "integer", + "description": "Type: `integer`. Set the dpi for saving images", + "help_text": "Type: `integer`. Set the dpi for saving images." + + } + + + , + "hide_stats": { + "type": + "boolean", + "description": "Type: `boolean_false`, default: `true`. Not adding Pearson R stats in some bivariate plots", + "help_text": "Type: `boolean_false`, default: `true`. Not adding Pearson R stats in some bivariate plots." + , + "default": "True" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/inputs" + }, + + { + "$ref": "#/definitions/outputs" + }, + + { + "$ref": "#/definitions/options" + }, + + { + "$ref": "#/definitions/filtering or transforming input" + }, + + { + "$ref": "#/definitions/customizing plots" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/nextflow/pear/.config.vsh.yaml b/target/nextflow/pear/.config.vsh.yaml index 8b8903d6..cf63801f 100644 --- a/target/nextflow/pear/.config.vsh.yaml +++ b/target/nextflow/pear/.config.vsh.yaml @@ -398,9 +398,9 @@ build_info: output: "target/nextflow/pear" executable: "target/nextflow/pear/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/pear/main.nf b/target/nextflow/pear/main.nf index 7448ed85..21d4bcd2 100644 --- a/target/nextflow/pear/main.nf +++ b/target/nextflow/pear/main.nf @@ -3259,9 +3259,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/pear", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml b/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml index b387ad01..8be61998 100644 --- a/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml +++ b/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml @@ -264,9 +264,9 @@ build_info: output: "target/nextflow/qualimap/qualimap_rnaseq" executable: "target/nextflow/qualimap/qualimap_rnaseq/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/qualimap/qualimap_rnaseq/main.nf b/target/nextflow/qualimap/qualimap_rnaseq/main.nf index 5821f0f4..4c61721f 100644 --- a/target/nextflow/qualimap/qualimap_rnaseq/main.nf +++ b/target/nextflow/qualimap/qualimap_rnaseq/main.nf @@ -3129,9 +3129,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/qualimap/qualimap_rnaseq", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml b/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml index 7ad9c97d..30105b2c 100644 --- a/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml +++ b/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml @@ -852,9 +852,9 @@ build_info: output: "target/nextflow/rsem/rsem_calculate_expression" executable: "target/nextflow/rsem/rsem_calculate_expression/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/rsem/rsem_calculate_expression/main.nf b/target/nextflow/rsem/rsem_calculate_expression/main.nf index 6483607d..da9a2855 100644 --- a/target/nextflow/rsem/rsem_calculate_expression/main.nf +++ b/target/nextflow/rsem/rsem_calculate_expression/main.nf @@ -3661,9 +3661,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/rsem/rsem_calculate_expression", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml b/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml index 69add8ad..493bc335 100644 --- a/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml +++ b/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml @@ -416,9 +416,9 @@ build_info: output: "target/nextflow/rsem/rsem_prepare_reference" executable: "target/nextflow/rsem/rsem_prepare_reference/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/rsem/rsem_prepare_reference/main.nf b/target/nextflow/rsem/rsem_prepare_reference/main.nf index 6ff7f8e8..4222c86b 100644 --- a/target/nextflow/rsem/rsem_prepare_reference/main.nf +++ b/target/nextflow/rsem/rsem_prepare_reference/main.nf @@ -3245,9 +3245,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/rsem/rsem_prepare_reference", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/salmon/salmon_index/.config.vsh.yaml b/target/nextflow/salmon/salmon_index/.config.vsh.yaml index d1ae7541..6f577df7 100644 --- a/target/nextflow/salmon/salmon_index/.config.vsh.yaml +++ b/target/nextflow/salmon/salmon_index/.config.vsh.yaml @@ -277,9 +277,9 @@ build_info: output: "target/nextflow/salmon/salmon_index" executable: "target/nextflow/salmon/salmon_index/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/salmon/salmon_index/main.nf b/target/nextflow/salmon/salmon_index/main.nf index c7ba9c96..448c2a5a 100644 --- a/target/nextflow/salmon/salmon_index/main.nf +++ b/target/nextflow/salmon/salmon_index/main.nf @@ -3129,9 +3129,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/salmon/salmon_index", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/salmon/salmon_quant/.config.vsh.yaml b/target/nextflow/salmon/salmon_quant/.config.vsh.yaml index 3058d9db..42a47d3f 100644 --- a/target/nextflow/salmon/salmon_quant/.config.vsh.yaml +++ b/target/nextflow/salmon/salmon_quant/.config.vsh.yaml @@ -1173,9 +1173,9 @@ build_info: output: "target/nextflow/salmon/salmon_quant" executable: "target/nextflow/salmon/salmon_quant/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/salmon/salmon_quant/main.nf b/target/nextflow/salmon/salmon_quant/main.nf index a4770222..b98c90cf 100644 --- a/target/nextflow/salmon/salmon_quant/main.nf +++ b/target/nextflow/salmon/salmon_quant/main.nf @@ -3964,9 +3964,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/salmon/salmon_quant", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_collate/.config.vsh.yaml b/target/nextflow/samtools/samtools_collate/.config.vsh.yaml index a08c0d60..fc6377aa 100644 --- a/target/nextflow/samtools/samtools_collate/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_collate/.config.vsh.yaml @@ -264,9 +264,9 @@ build_info: output: "target/nextflow/samtools/samtools_collate" executable: "target/nextflow/samtools/samtools_collate/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_collate/main.nf b/target/nextflow/samtools/samtools_collate/main.nf index 0395fca8..cfef0132 100644 --- a/target/nextflow/samtools/samtools_collate/main.nf +++ b/target/nextflow/samtools/samtools_collate/main.nf @@ -3140,9 +3140,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_collate", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml b/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml index 255a9cb3..2fb05ad8 100644 --- a/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml @@ -243,9 +243,9 @@ build_info: output: "target/nextflow/samtools/samtools_faidx" executable: "target/nextflow/samtools/samtools_faidx/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_faidx/main.nf b/target/nextflow/samtools/samtools_faidx/main.nf index 65104b00..94730b5a 100644 --- a/target/nextflow/samtools/samtools_faidx/main.nf +++ b/target/nextflow/samtools/samtools_faidx/main.nf @@ -3112,9 +3112,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_faidx", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml b/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml index 7fc79d34..c7b32ffb 100644 --- a/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml @@ -433,9 +433,9 @@ build_info: output: "target/nextflow/samtools/samtools_fasta" executable: "target/nextflow/samtools/samtools_fasta/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_fasta/main.nf b/target/nextflow/samtools/samtools_fasta/main.nf index a6c0c293..cd376663 100644 --- a/target/nextflow/samtools/samtools_fasta/main.nf +++ b/target/nextflow/samtools/samtools_fasta/main.nf @@ -3304,9 +3304,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_fasta", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml b/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml index 75a7061f..3802e408 100644 --- a/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml @@ -433,9 +433,9 @@ build_info: output: "target/nextflow/samtools/samtools_fastq" executable: "target/nextflow/samtools/samtools_fastq/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_fastq/main.nf b/target/nextflow/samtools/samtools_fastq/main.nf index 96eef9b7..b8280900 100644 --- a/target/nextflow/samtools/samtools_fastq/main.nf +++ b/target/nextflow/samtools/samtools_fastq/main.nf @@ -3304,9 +3304,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_fastq", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml b/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml index 0bd3ec4e..0f953f4f 100644 --- a/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml @@ -173,9 +173,9 @@ build_info: output: "target/nextflow/samtools/samtools_flagstat" executable: "target/nextflow/samtools/samtools_flagstat/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_flagstat/main.nf b/target/nextflow/samtools/samtools_flagstat/main.nf index a16f5f52..f0269761 100644 --- a/target/nextflow/samtools/samtools_flagstat/main.nf +++ b/target/nextflow/samtools/samtools_flagstat/main.nf @@ -3028,9 +3028,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_flagstat", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml b/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml index ea9b52fd..a368fe88 100644 --- a/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml @@ -183,9 +183,9 @@ build_info: output: "target/nextflow/samtools/samtools_idxstats" executable: "target/nextflow/samtools/samtools_idxstats/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_idxstats/main.nf b/target/nextflow/samtools/samtools_idxstats/main.nf index 7d4ff1d1..aff1d8ff 100644 --- a/target/nextflow/samtools/samtools_idxstats/main.nf +++ b/target/nextflow/samtools/samtools_idxstats/main.nf @@ -3040,9 +3040,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_idxstats", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_index/.config.vsh.yaml b/target/nextflow/samtools/samtools_index/.config.vsh.yaml index 35952019..0edcad68 100644 --- a/target/nextflow/samtools/samtools_index/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_index/.config.vsh.yaml @@ -189,9 +189,9 @@ build_info: output: "target/nextflow/samtools/samtools_index" executable: "target/nextflow/samtools/samtools_index/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_index/main.nf b/target/nextflow/samtools/samtools_index/main.nf index 9a1210d9..39488a44 100644 --- a/target/nextflow/samtools/samtools_index/main.nf +++ b/target/nextflow/samtools/samtools_index/main.nf @@ -3053,9 +3053,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_index", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_sort/.config.vsh.yaml b/target/nextflow/samtools/samtools_sort/.config.vsh.yaml index 2c6bfe2c..09b378fd 100644 --- a/target/nextflow/samtools/samtools_sort/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_sort/.config.vsh.yaml @@ -332,9 +332,9 @@ build_info: output: "target/nextflow/samtools/samtools_sort" executable: "target/nextflow/samtools/samtools_sort/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_sort/main.nf b/target/nextflow/samtools/samtools_sort/main.nf index 5355dd3a..d9ac81a7 100644 --- a/target/nextflow/samtools/samtools_sort/main.nf +++ b/target/nextflow/samtools/samtools_sort/main.nf @@ -3225,9 +3225,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_sort", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_stats/.config.vsh.yaml b/target/nextflow/samtools/samtools_stats/.config.vsh.yaml index 43ff922c..610e8266 100644 --- a/target/nextflow/samtools/samtools_stats/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_stats/.config.vsh.yaml @@ -401,9 +401,9 @@ build_info: output: "target/nextflow/samtools/samtools_stats" executable: "target/nextflow/samtools/samtools_stats/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_stats/main.nf b/target/nextflow/samtools/samtools_stats/main.nf index b8fa1065..6d1bbfca 100644 --- a/target/nextflow/samtools/samtools_stats/main.nf +++ b/target/nextflow/samtools/samtools_stats/main.nf @@ -3295,9 +3295,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_stats", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_view/.config.vsh.yaml b/target/nextflow/samtools/samtools_view/.config.vsh.yaml index 73bf77ca..22946e1f 100644 --- a/target/nextflow/samtools/samtools_view/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_view/.config.vsh.yaml @@ -665,9 +665,9 @@ build_info: output: "target/nextflow/samtools/samtools_view" executable: "target/nextflow/samtools/samtools_view/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_view/main.nf b/target/nextflow/samtools/samtools_view/main.nf index 8224a44c..8db0d9df 100644 --- a/target/nextflow/samtools/samtools_view/main.nf +++ b/target/nextflow/samtools/samtools_view/main.nf @@ -3476,9 +3476,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_view", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml b/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml index fb6a77ea..3f3016b6 100644 --- a/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml +++ b/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml @@ -173,9 +173,9 @@ build_info: output: "target/nextflow/seqtk/seqtk_sample" executable: "target/nextflow/seqtk/seqtk_sample/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/seqtk/seqtk_sample/main.nf b/target/nextflow/seqtk/seqtk_sample/main.nf index 01b0c2dc..5526071f 100644 --- a/target/nextflow/seqtk/seqtk_sample/main.nf +++ b/target/nextflow/seqtk/seqtk_sample/main.nf @@ -3030,9 +3030,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/seqtk/seqtk_sample", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml b/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml index 5b6cac3c..e160cac3 100644 --- a/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml +++ b/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml @@ -196,9 +196,9 @@ build_info: output: "target/nextflow/seqtk/seqtk_subseq" executable: "target/nextflow/seqtk/seqtk_subseq/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/seqtk/seqtk_subseq/main.nf b/target/nextflow/seqtk/seqtk_subseq/main.nf index 9b903621..5a28c1f6 100644 --- a/target/nextflow/seqtk/seqtk_subseq/main.nf +++ b/target/nextflow/seqtk/seqtk_subseq/main.nf @@ -3060,9 +3060,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/seqtk/seqtk_subseq", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/snpeff/.config.vsh.yaml b/target/nextflow/snpeff/.config.vsh.yaml index 7cc29048..ab716ca9 100644 --- a/target/nextflow/snpeff/.config.vsh.yaml +++ b/target/nextflow/snpeff/.config.vsh.yaml @@ -628,9 +628,9 @@ build_info: output: "target/nextflow/snpeff" executable: "target/nextflow/snpeff/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/snpeff/main.nf b/target/nextflow/snpeff/main.nf index 3a78177a..eeafca19 100644 --- a/target/nextflow/snpeff/main.nf +++ b/target/nextflow/snpeff/main.nf @@ -3555,9 +3555,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/snpeff", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/sortmerna/.config.vsh.yaml b/target/nextflow/sortmerna/.config.vsh.yaml index 89a75786..4e9e7d98 100644 --- a/target/nextflow/sortmerna/.config.vsh.yaml +++ b/target/nextflow/sortmerna/.config.vsh.yaml @@ -591,9 +591,9 @@ build_info: output: "target/nextflow/sortmerna" executable: "target/nextflow/sortmerna/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/sortmerna/main.nf b/target/nextflow/sortmerna/main.nf index af095f24..f967191b 100644 --- a/target/nextflow/sortmerna/main.nf +++ b/target/nextflow/sortmerna/main.nf @@ -3456,9 +3456,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/sortmerna", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/star/star_align_reads/.config.vsh.yaml b/target/nextflow/star/star_align_reads/.config.vsh.yaml index 5dac6c12..3e5fb4da 100644 --- a/target/nextflow/star/star_align_reads/.config.vsh.yaml +++ b/target/nextflow/star/star_align_reads/.config.vsh.yaml @@ -2663,9 +2663,9 @@ build_info: output: "target/nextflow/star/star_align_reads" executable: "target/nextflow/star/star_align_reads/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/star/star_align_reads/main.nf b/target/nextflow/star/star_align_reads/main.nf index bfda8f22..e452b1cc 100644 --- a/target/nextflow/star/star_align_reads/main.nf +++ b/target/nextflow/star/star_align_reads/main.nf @@ -5943,9 +5943,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/star/star_align_reads", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/star/star_genome_generate/.config.vsh.yaml b/target/nextflow/star/star_genome_generate/.config.vsh.yaml index 47b25204..4b700892 100644 --- a/target/nextflow/star/star_genome_generate/.config.vsh.yaml +++ b/target/nextflow/star/star_genome_generate/.config.vsh.yaml @@ -333,9 +333,9 @@ build_info: output: "target/nextflow/star/star_genome_generate" executable: "target/nextflow/star/star_genome_generate/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/star/star_genome_generate/main.nf b/target/nextflow/star/star_genome_generate/main.nf index 07933cda..28b9805e 100644 --- a/target/nextflow/star/star_genome_generate/main.nf +++ b/target/nextflow/star/star_genome_generate/main.nf @@ -3195,9 +3195,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/star/star_genome_generate", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/trimgalore/.config.vsh.yaml b/target/nextflow/trimgalore/.config.vsh.yaml index e58a4070..861f94fb 100644 --- a/target/nextflow/trimgalore/.config.vsh.yaml +++ b/target/nextflow/trimgalore/.config.vsh.yaml @@ -770,9 +770,9 @@ build_info: output: "target/nextflow/trimgalore" executable: "target/nextflow/trimgalore/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/trimgalore/main.nf b/target/nextflow/trimgalore/main.nf index 69d67589..ff9d7e58 100644 --- a/target/nextflow/trimgalore/main.nf +++ b/target/nextflow/trimgalore/main.nf @@ -3560,9 +3560,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/trimgalore", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml b/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml index f421b88b..53705034 100644 --- a/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml +++ b/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml @@ -611,9 +611,9 @@ build_info: output: "target/nextflow/umi_tools/umi_tools_dedup" executable: "target/nextflow/umi_tools/umi_tools_dedup/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/umi_tools/umi_tools_dedup/main.nf b/target/nextflow/umi_tools/umi_tools_dedup/main.nf index fce3cbc9..ce223d29 100644 --- a/target/nextflow/umi_tools/umi_tools_dedup/main.nf +++ b/target/nextflow/umi_tools/umi_tools_dedup/main.nf @@ -3487,9 +3487,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/umi_tools/umi_tools_dedup", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml b/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml index 6b26b479..dfe9c985 100644 --- a/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml +++ b/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml @@ -449,9 +449,9 @@ build_info: output: "target/nextflow/umi_tools/umi_tools_extract" executable: "target/nextflow/umi_tools/umi_tools_extract/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/umi_tools/umi_tools_extract/main.nf b/target/nextflow/umi_tools/umi_tools_extract/main.nf index 48f436f3..90c2bd17 100644 --- a/target/nextflow/umi_tools/umi_tools_extract/main.nf +++ b/target/nextflow/umi_tools/umi_tools_extract/main.nf @@ -3316,9 +3316,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/umi_tools/umi_tools_extract", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml b/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml index 7674b2c6..cca3c5ff 100644 --- a/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml +++ b/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml @@ -256,9 +256,9 @@ build_info: output: "target/nextflow/umi_tools/umi_tools_prepareforrsem" executable: "target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf" viash_version: "0.9.0" - git_commit: "7fb67a98539868b9af788338fb5f46d34ab742f7" - git_remote: "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox" - git_tag: "v0.2.0-11-g7fb67a9" + git_commit: "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29" + git_remote: "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox" + git_tag: "v0.2.0-12-g6e6b139" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf b/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf index 0937572e..487b904b 100644 --- a/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf +++ b/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf @@ -3121,9 +3121,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/umi_tools/umi_tools_prepareforrsem", "viash_version" : "0.9.0", - "git_commit" : "7fb67a98539868b9af788338fb5f46d34ab742f7", - "git_remote" : "https://x-access-token:ghs_lv5GvifOUhTQDSxrDFIWt5FoCBy00e2Tt6iO@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-11-g7fb67a9" + "git_commit" : "6e6b13939c9d719f1cd7ff5a91a6562e0a6e2e29", + "git_remote" : "https://x-access-token:ghs_yMJ96XEhcHROF2pqaopOfHbmZnWq3J2wWhaj@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-12-g6e6b139" }, "package_config" : { "name" : "biobox",