diff --git a/CHANGELOG.md b/CHANGELOG.md index 8cbc52f0..4c71bb4b 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -27,6 +27,8 @@ * `nanoplot`: Plotting tool for long read sequencing data and alignments (PR #95). +* `sgedemux`: demultiplexing sequencing data generated on Singular Genomics' sequencing instruments (PR #166). + ## BUG FIXES * `falco`: Fix a typo in the `--reverse_complement` argument (PR #157). diff --git a/src/sgdemux/config.vsh.yaml b/src/sgdemux/config.vsh.yaml new file mode 100644 index 00000000..bb21a7a0 --- /dev/null +++ b/src/sgdemux/config.vsh.yaml @@ -0,0 +1,212 @@ +name: sgdemux +description: | + Demultiplex sequence data generated on Singular Genomics' sequencing instruments. +keywords: ["demultiplex", "fastq"] +links: + repository: https://github.com/Singular-Genomics/singular-demux +license: Proprietairy +requirements: + commands: [sgdemux] +authors: + - __merge__: /src/_authors/dries_schaumont.yaml + roles: [ author, maintainer ] + +argument_groups: + - name: Input + arguments: + - name: "--fastqs" + alternatives: [-f] + type: file + description: Path to the input FASTQs, or path prefix if not a file + required: true + multiple: true + example: sample1_r1.fq;sample1_r2.fq;sample2_r1.fq;sample2_r2.fq + - name: --sample_metadata + alternatives: ["-s"] + type: file + description: Path to the sample metadata CSV file including sample names and barcode sequences + required: true + + - name: Output + arguments: + - name: "--sample_fastq" + direction: "output" + type: file + description: The directory containing demultiplexed sample FASTQ files. + required: true + example: "output/" + - name: "--metrics" + direction: "output" + type: file + required: false + description: | + Demultiplexing summary statisitcs: + - control_reads_omitted: The number of reads that were omitted for being control reads. + - failing_reads_omitted: The number of reads that were omitted for having failed QC. + - total_templates: The total number of template reads that were output. + example: metrics.tsv + - name: "--most_frequent_unmatched" + direction: output + type: file + required: false + description: | + It contains the (approximate) counts of the most prevelant observed barcode sequences + that did not match to one of the expected barcodes. Can only be created when 'most_unmatched_to_output' + is not set to 0. + example: most_frequent_unmatched.tsv + - name: "--sample_barcode_hop_metrics" + direction: output + type: file + required: false + description: | + File containing the frequently observed barcodes that are unexpected + combinations of expected barcodes in a dual-indexed run. + example: sample_barcode_hop_metrics.tsv + - name: --per_project_metrics + type: file + required: false + direction: output + description: | + Aggregates the metrics by project (aggregates the metrics across samples with the same project) and + has the same columns as `--metrics`. In this case, sample_ID will contain the project name (or None if no project is given). + THe barcode will contain all Ns. The undetermined sample will not be aggregated with any other sample. + example: per_project_metrics.tsv + - name: --per_sample_metrics + direction: output + type: file + required: false + description: | + Tab-separated file containing statistics per sample. + example: per_sample_metrics.tsv + - name: Arguments + arguments: + - name: --read_structures + alternatives: ["-r"] + type: string + description: Read structures, one per input FASTQ. Do not provide when using a path prefix for FASTQs + required: false + multiple: true + - name: --allowed_mismatches + alternatives: ["-m"] + type: integer + description: Number of allowed mismatches between the observed barcode and the expected barcode + example: 1 + - name: --min_delta + alternatives: ["-d"] + type: integer + description: The minimum allowed difference between an observed barcode and the second closest expected barcode + example: 2 + - name: --free_ns + alternatives: ["-F"] + type: integer + description: Number of N's to allow in a barcode without counting against the allowed_mismatches + example: 1 + - name: --max_no_calls + alternatives: ["-N"] + type: integer + description: | + Max no-calls (N's) in a barcode before it is considered unmatchable. + A barcode with total N's greater than 'max_no_call' will be considered unmatchable. + required: false + - name: --quality_mask_threshold + type: integer + multiple: true + alternatives: [-M] + description: | + Mask template bases with quality scores less than specified value(s). + Sample barcode/index and UMI bases are never masked. If provided either a single value, + or one value per FASTQ must be provided. + required: false + - name: --filter_control_reads + alternatives: [-C] + type: boolean_true + description: Filter out control reads + - name: "--filter_failing_quality" + alternatives: [-Q] + type: boolean_true + description: | + Filter reads failing quality filter + - name: "--output_types" + alternatives: [-T] + multiple: true + type: string + description: | + The types of output FASTQs to write. + For each read structure, all segment types listed will be output to a FASTQ file. + + These may be any of the following: + - `T` - Template bases + - `B` - Sample barcode bases + - `M` - Molecular barcode bases + - `S` - Skip bases + choices: ["T", "B", "S", "M"] + example: T + - name: --undetermined_sample_name + alternatives: ["-u"] + type: string + example: Undetermined + description: | + The sample name for undetermined reads (reads that do not match an expected barcode) + - name: --most_unmatched_to_output + alternatives: ["-U"] + type: integer + description: | + Output the most frequent "unmatched" barcodes up to this number. + If set to 0 unmatched barcodes will not be collected, improving overall performance. + example: 1000 + - name: "--override_matcher" + type: string + description: | + If the sample barcodes are > 12 bp long, a cached hamming distance matcher is used. + If the barcodes are less than or equal to 12 bp long, all possible matches are precomputed. + This option allows for overriding that heuristic. + choices: [cached-hamming-distance, pre-compute] + - name: --skip_read_name_check + type: boolean_true + description: | + If this is true, then all the read names across FASTQs will not be enforced to be the same. + This may be useful when the read names are known to be the same and performance matters. + Regardless, the first read name in each FASTQ will always be checked. + - name: "--sample_barcode_in_fastq_header" + type: boolean_true + description: | + If this is true, then the sample barcode is expected to be in the FASTQ read header. + For dual indexed data, the barcodes must be `+` (plus) delimited. Additionally, if true, + then neither index FASTQ files nor sample barcode segments in the read structure may be specified. + - name: "--metric_prefix" + type: string + description: | + Prepend this prefix to all output metric file names + - name: "--lane" + type: integer + multiple: true + alternatives: ["-l"] + description: | + Select a subset of lanes to demultiplex. Will cause only samples and input FASTQs with + the given `Lane`(s) to be demultiplexed. Samples without a lane will be ignored, and + FASTQs without lane information will be ignored + +resources: + - type: bash_script + path: script.sh + +test_resources: + - type: bash_script + path: test.sh + - path: test_data + +engines: +- type: docker + image: continuumio/miniconda3:latest + setup: + - type: apt + packages: + - procps + - type: docker + run: | + conda install -c conda-forge -c bioconda sgdemux && \ + echo "sgdemux: $(sgdemux --version | cut -d' ' -f2)" > /var/software_versions.txt + +runners: + - type: executable + - type: nextflow diff --git a/src/sgdemux/help.txt b/src/sgdemux/help.txt new file mode 100644 index 00000000..4782eb02 --- /dev/null +++ b/src/sgdemux/help.txt @@ -0,0 +1,166 @@ +███████╗██╗███╗ ██╗ ██████╗ ██╗ ██╗██╗ █████╗ ██████╗ +██╔════╝██║████╗ ██║██╔════╝ ██║ ██║██║ ██╔══██╗██╔══██╗ +███████╗██║██╔██╗ ██║██║ ███╗██║ ██║██║ ███████║██████╔╝ +╚════██║██║██║╚██╗██║██║ ██║██║ ██║██║ ██╔══██║██╔══██╗ +███████║██║██║ ╚████║╚██████╔╝╚██████╔╝███████╗██║ ██║██║ ██║ +╚══════╝╚═╝╚═╝ ╚═══╝ ╚═════╝ ╚═════╝ ╚══════╝╚═╝ ╚═╝╚═╝ ╚═╝ + + ██████╗ ███████╗███╗ ██╗ ██████╗ ███╗ ███╗██╗ ██████╗███████╗ +██╔════╝ ██╔════╝████╗ ██║██╔═══██╗████╗ ████║██║██╔════╝██╔════╝ +██║ ███╗█████╗ ██╔██╗ ██║██║ ██║██╔████╔██║██║██║ ███████╗ +██║ ██║██╔══╝ ██║╚██╗██║██║ ██║██║╚██╔╝██║██║██║ ╚════██║ +╚██████╔╝███████╗██║ ╚████║╚██████╔╝██║ ╚═╝ ██║██║╚██████╗███████║ + ╚═════╝ ╚══════╝╚═╝ ╚═══╝ ╚═════╝ ╚═╝ ╚═╝╚═╝ ╚═════╝╚══════╝ + +Performs sample demultiplexing on block-compressed (BGZF) FASTQs. + +Input FASTQs must be block compressed (e.g. with `bgzip`). A single bgzipped FASTQ file +should be provided per instrument read. One read structure should be provided per input FASTQ. + +Per-sample files with suffixes like _R1.fastq.gz will be written to the output directory specified with --output. + +The sample metadata file may be a Sample Sheet or a simple two-column CSV file with headers. +The Sample Sheet may haave a `[Demux]` section for command line options, and must have a `[Data]` +section for sample information. The `Sample_ID` column must contain a unique, non-empty identifier +for each sample. Both `Index1_Sequence` and `Index2_Sequence` must be present with values for +indexed runs. For non-indexed runs, a single sample must be given with an empty value for the +`Index1_Sequence` and `Index2_Sequence` columns. For the simple two-column CSV, the +`Sample_Barcode` column must contain the unique set of sample barcode bases for the sample(s). + +Example invocation: + +sgdemux \ + --fastqs R1.fq.gz R2.fq.gz I1.fq.gz \ + --read-structures +T +T 8B \ + --sample-metadata samples.csv \ + --output demuxed-fastqs/ + +For complete documentation see: https://github.com/Singular-Genomics/singular-demux +For support please contact: care@singulargenomics.com + +USAGE: + sgdemux [OPTIONS] --sample-metadata --output-dir + +OPTIONS: + -f, --fastqs ... + Path to the input FASTQs, or path prefix if not a file + + -s, --sample-metadata + Path to the sample metadata + + -r, --read-structures ... + Read structures, one per input FASTQ. Do not provide when using a path prefix for FASTQs + + -o, --output-dir + The directory to write outputs to. + + This tool will overwrite existing files. + + -m, --allowed-mismatches + Number of allowed mismatches between the observed barcode and the expected barcode + + [default: 1] + + -d, --min-delta + The minimum allowed difference between an observed barcode and the second closest expected barcode + + [default: 2] + + -F, --free-ns + Number of N's to allow in a barcode without counting against the allowed_mismatches + + [default: 1] + + -N, --max-no-calls + Max no-calls (N's) in a barcode before it is considered unmatchable. + + A barcode with total N's greater than `max_no_call` will be considered unmatchable. + + [default: None] + + -M, --quality-mask-threshold ... + Mask template bases with quality scores less than specified value(s). + + Sample barcode/index and UMI bases are never masked. If provided either a single value, or one value per FASTQ must be provided. + + -C, --filter-control-reads + Filter out control reads + + -Q, --filter-failing-quality + Filter reads failing quality filter + + -T, --output-types + The types of output FASTQs to write. + + These may be any of the following: + - `T` - Template bases + - `B` - Sample barcode bases + - `M` - Molecular barcode bases + - `S` - Skip bases + + For each read structure, all segment types listed by `--output-types` will be output to a + FASTQ file. + + [default: T] + + -u, --undetermined-sample-name + The sample name for undetermined reads (reads that do not match an expected barcode) + + [default: Undetermined] + + -U, --most-unmatched-to-output + Output the most frequent "unmatched" barcodes up to this number. + + If set to 0 unmatched barcodes will not be collected, improving overall performance. + + [default: 1000] + + -t, --demux-threads + Number of threads for demultiplexing. + + The number of threads to use for the process of determining which input reads should be assigned to which sample. + + [default: 4] + + --compressor-threads + Number of threads for compression the output reads. + + The number of threads to use for compressing reads that are queued for writing. + + [default: 12] + + --writer-threads + Number of threads for writing compressed reads to output. + + The number of threads to have writing reads to their individual output files. + + [default: 5] + + --override-matcher + Override the matcher heuristic. + + If the sample barcodes are > 12 bp long, a cached hamming distance matcher is used. If the barcodes are less than or equal to 12 bp long, all possible matches are precomputed. + + This option allows for overriding that heuristic. + + [default: None] + + [possible values: cached-hamming-distance, pre-compute] + + --skip-read-name-check + If this is true, then all the read names across FASTQs will not be enforced to be the same. This may be useful when the read names are known to be the same and performance matters. Regardless, the first read name in each FASTQ will always be checked + + --sample-barcode-in-fastq-header + If this is true, then the sample barcode is expected to be in the FASTQ read header. For dual indexed data, the barcodes must be `+` (plus) delimited. Additionally, if true, then neither index FASTQ files nor sample barcode segments in the read structure may be specified + + --metric-prefix + Prepend this prefix to all output metric file names + + -l, --lane ... + Select a subset of lanes to demultiplex. Will cause only samples and input FASTQs with the given `Lane`(s) to be demultiplexed. Samples without a lane will be ignored, and FASTQs without lane information will be ignored + + -h, --help + Print help information + + -V, --version + Print version information \ No newline at end of file diff --git a/src/sgdemux/script.sh b/src/sgdemux/script.sh new file mode 100644 index 00000000..356289fe --- /dev/null +++ b/src/sgdemux/script.sh @@ -0,0 +1,113 @@ +#!/bin/bash + +set -eo pipefail + +## VIASH START +## VIASH END + +unset_if_false=( + par_filter_control_reads + par_filter_failing_quality + par_skip_read_name_check + par_sample_barcode_in_fastq_header +) + +for par in ${unset_if_false[@]}; do + test_val="${!par}" + [[ "$test_val" == "false" ]] && unset $par +done + +# Create arrays for inputs that contain multiple arguments +IFS=";" read -ra fastqs <<< "$par_fastqs" +IFS=";" read -ra read_structures <<< "$par_read_structures" +IFS=";" read -ra lane <<< "$par_lane" +IFS=";" read -ra quality_mask_threashold <<< "$par_quality_mask_threshold" +IFS=";" read -ra output_types <<< "$par_output_types" + +echo "> Creating temporary directory" +# create temporary directory and clean up on exit +TMPDIR=$(mktemp -d "$meta_temp_dir/$meta_name-XXXXXX") +function clean_up { + [[ -d "$TMPDIR" ]] && rm -rf "$TMPDIR" +} +trap clean_up EXIT +echo "> Temporary directory '$TMPDIR' created" + +if [ "$par_most_unmatched_to_output" -eq "0" ] && [ ! -z "$par_most_frequent_unmatched" ]; then + echo "Requested to output 'most_frequent_unmatched' file, but 'most_unmatched_to_output' is set to 0." + exit 1 +fi + +# The sgdemux documentation recommends the following settings: +# 1/3 of available threads for compression +# 1/6 of available threads for writing +# 1/6-1/3 of available threads for demultiplexing +declare -A thread_settings=(["compression_threads"]="3" + ["writing_threads"]="6" + ["demultiplexing_threads"]="3" + ) +if [ ! -z "$meta_cpus" ]; then + for setting_var in "${!thread_settings[@]}"; do + denominator=${thread_settings[$setting_var]} + result=$(( $meta_cpus / $denominator )) + if (( $result == 0 )); then + result=1 + fi + declare $setting_var=$result + done +fi + +args=( + --fastqs ${fastqs[@]} + --sample-metadata "$par_sample_metadata" + --output-dir "$TMPDIR" + ${demultiplexing_threads:+--demux-threads $demultiplexing_threads} + ${writing_threads:+--writer-threads $writing_threads} + ${compression_threads:+--compressor-threads $compression_threads} + ${par_allowed_mismatches:+--allowed-mismatches $par_allowed_mismatches} + ${par_min_delta:+--min-delta $par_min_delta} + ${par_free_ns:+--free-ns $par_free_ns} + ${par_max_no_calls:+--max-no-calls $par_max_no_calls} + ${quality_mask_threashold:+--quality-mask-threshold "${quality_mask_threashold[*]}" } + ${output_types:+--output-types "${output_types[*]}"} + ${par_undetermined_sample_name:+--undetermined-sample-name ${par_undetermined_sample_name}} + ${par_most_unmatched_to_output:+--par-most-unmatched-to-output ${par_most_unmatched_to_output}} + ${par_override_matcher:+--override-matcher $par_override_matcher} + ${par_metric_prefix:+--metric-prefix $par_metric_prefix} + ${lane:+--lane "${lane[*]}"} + ${read_structures:+--read-structures ${read_structures[*]}} + ${par_filter_control_reads:+--filter-control-reads} + ${par_filter_failing_quality:+--filter-failing-quality} + ${par_skip_read_name_check:+--skip-read-name-check} + ${par_sample_barcode_in_fastq_header:+--sample-barcode-in-fastq-header} +) + +echo "> Running sgdemux with arguments: ${args[@]}" +sgdemux ${args[@]} +echo "> Done running sgdemux" + +echo "> Copying FASTQ files to $par_sample_fastq" +find "$TMPDIR" -type f -name "*.fastq.gz" -exec mv '{}' "$par_sample_fastq" \; + +declare -A output_files=(["metrics.tsv"]="par_metrics" + ["most_frequent_unmatched.tsv"]="par_most_frequent_unmatched" + ["sample_barcode_hop_metrics.tsv"]="par_sample_barcode_hop_metrics" + ["per_project_metrics.tsv"]="par_per_project_metrics" + ["per_sample_metrics.tsv"]="par_per_sample_metrics" + ) + +for output_file_name in "${!output_files[@]}"; do + output_arg_variable_name=${output_files[$output_file_name]} + destination="${!output_arg_variable_name}" + if [ ! -z "$destination" ]; then + echo "> Copying $output_file file to $destination" + output_file="$TMPDIR/$output_file_name" + if [ ! -f "$output_file" ]; then + echo "Expected a '$output_file_name' to have been created! Exiting..." + exit 1 + fi + cp "$output_file" "$destination" + fi +done + +echo "> Finished!" \ No newline at end of file diff --git a/src/sgdemux/test.sh b/src/sgdemux/test.sh new file mode 100644 index 00000000..f3eea062 --- /dev/null +++ b/src/sgdemux/test.sh @@ -0,0 +1,67 @@ +#!/bin/bash + +set -eou pipefail + +# Helper functions +assert_file_exists() { + [ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; } +} +assert_file_not_empty() { + [ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; } +} +assert_file_contains() { + grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; } +} + + +# create temporary directory and clean up on exit +TMPDIR=$(mktemp -d "$meta_temp_dir/$meta_name-XXXXXX") +function clean_up { + [[ -d "$TMPDIR" ]] && rm -rf "$TMPDIR" +} +trap clean_up EXIT + +output_test1="$TMPDIR/output1" +mkdir "$output_test1" +sample_dir_test_1="$output_test1/fastq" +mkdir "$sample_dir_test_1" + +"$meta_executable" \ + --fastqs "$meta_resources_dir/test_data/fastq" \ + --sample_metadata "$meta_resources_dir/test_data/samplesheet.csv" \ + --sample_fastq "$sample_dir_test_1" \ + --metrics "$output_test1/metrics.tsv" \ + --most_frequent_unmatched "$output_test1/most_frequent_unmatched.tsv" \ + --sample_barcode_hop_metrics "$output_test1/sample_barcode_hop_metrics.tsv" \ + --per_sample_metrics "$output_test1/per_sample_metrics.tsv" \ + --per_project_metrics "$output_test1/per_project_metrics.tsv" \ + ---cpus 1 + +# Check for correct number of output FASTQ files +readarray -d '' output_fastq < <(find "$sample_dir_test_1" -name "*.fastq.gz" -print0) +if (( ${#output_fastq[@]} != "196" )); then + echo "Wrong number of output fastq files found." + exit 1 +fi + +# Check if fastq files are not empty +for fastq in ${output_fastq[@]}; do + assert_file_not_empty "$fastq" +done + +# Checking if requested output files exist +assert_file_exists "$output_test1/metrics.tsv" +assert_file_exists "$output_test1/most_frequent_unmatched.tsv" +assert_file_exists "$output_test1/sample_barcode_hop_metrics.tsv" +assert_file_exists "$output_test1/per_sample_metrics.tsv" +assert_file_exists "$output_test1/per_project_metrics.tsv" + +# Checking output file contents +diff -q "$meta_resources_dir/test_data/expected/metrics.tsv" "$output_test1/metrics.tsv" || \ + (echo "Incorrect metrics.tsv output!" && exit 1) + +diff -q "$meta_resources_dir/test_data/expected/per_project_metrics.tsv" "$output_test1/per_project_metrics.tsv" || \ + (echo "Incorrect per_project_metrics.tsv output!" && diff exit 1) + +diff -q "$meta_resources_dir/test_data/expected/per_sample_metrics.tsv" "$output_test1/per_sample_metrics.tsv" || \ + (echo "Incorrect per_sample_metrics.tsv output!" && exit 1) \ No newline at end of file diff --git a/src/sgdemux/test_data/.gitignore b/src/sgdemux/test_data/.gitignore new file mode 100644 index 00000000..5fc9cc14 --- /dev/null +++ b/src/sgdemux/test_data/.gitignore @@ -0,0 +1,2 @@ +unfiltered_fastq +unfiltered_fastq.tar \ No newline at end of file diff --git a/src/sgdemux/test_data/expected/metrics.tsv b/src/sgdemux/test_data/expected/metrics.tsv new file mode 100644 index 00000000..f8743410 --- /dev/null +++ b/src/sgdemux/test_data/expected/metrics.tsv @@ -0,0 +1,2 @@ +control_reads_omitted failing_reads_omitted total_templates +0 0 40000 diff --git a/src/sgdemux/test_data/expected/per_project_metrics.tsv b/src/sgdemux/test_data/expected/per_project_metrics.tsv new file mode 100644 index 00000000..c5956b3d --- /dev/null +++ b/src/sgdemux/test_data/expected/per_project_metrics.tsv @@ -0,0 +1,3 @@ +barcode_name library_name barcode templates perfect_matches one_mismatch_matches q20_bases q30_bases total_number_of_bases fraction_matches ratio_this_barcode_to_best_barcode frac_q20_bases frac_q30_bases mean_index_base_quality +None None NNNNNNNNNNNNNNNNNNNNNNNN 39120 38085 1035 11379704 10715554 11736000 0.978 1.0 0.9696407634628493 0.9130499318336741 34.25803723585549 +Undetermined Undetermined NNNNNNNNNNNNNNNNNNNNNNNN 880 0 0 248629 228186 264000 0.022 0.022494887525562373 0.9417765151515152 0.8643409090909091 32.029592803030305 diff --git a/src/sgdemux/test_data/expected/per_sample_metrics.tsv b/src/sgdemux/test_data/expected/per_sample_metrics.tsv new file mode 100644 index 00000000..55a3f930 --- /dev/null +++ b/src/sgdemux/test_data/expected/per_sample_metrics.tsv @@ -0,0 +1,99 @@ +barcode_name library_name barcode templates perfect_matches one_mismatch_matches q20_bases q30_bases total_number_of_bases fraction_matches ratio_this_barcode_to_best_barcode frac_q20_bases frac_q30_bases mean_index_base_quality +Index1 Index1 TAAGACCCTACTGGGACATATTGA 407 398 9 118274 111544 122100 0.010175 0.2840195394277739 0.9686650286650287 0.9135462735462736 34.96007371007371 +Index2 Index2 CGAAGTACATCCTAGGACGTAACG 411 403 8 119540 112432 123300 0.010275 0.2868108862526169 0.9695052716950527 0.9118572587185726 33.54622871046229 +Index3 Index3 TAGCCTTCCAAAAGTATGGCAAGA 411 391 20 119407 112307 123300 0.010275 0.2868108862526169 0.968426601784266 0.9108434712084347 35.30869829683698 +Index4 Index4 GCCTTTCAAGTCTAGAGTCGTCGT 393 380 13 114900 108296 117900 0.009825 0.27424982554082344 0.9745547073791349 0.9185411365564037 33.596692111959285 +Index5 Index5 CAACGGTTCCGGACGTTTCGCTCG 333 326 7 96836 91049 99900 0.008325 0.23237962316817865 0.9693293293293294 0.9114014014014014 33.295670670670674 +Index6 Index6 GTTGCATGGCCCTAGGGAACGATG 358 348 10 104555 98438 107400 0.00895 0.24982554082344732 0.9735102420856611 0.9165549348230912 33.8824487895717 +Index7 Index7 ATCGTTGCTATCATGACTCCGCAT 405 398 7 117691 110628 121500 0.010125 0.2826238660153524 0.9686502057613169 0.9105185185185185 33.678909465020574 +Index8 Index8 CCTCGAATTCATGGTTGCTACCGG 349 339 10 101314 95441 104700 0.008725 0.2435450104675506 0.9676599808978033 0.9115663801337154 34.25059694364852 +Index9 Index9 TGAACGTCCGCCTCCTCGATTGAA 488 477 11 142525 134668 146400 0.0122 0.3405443126308444 0.9735314207650273 0.919863387978142 34.09366461748634 +Index10 Index10 CATCTAGCAAGCATGTAGCGTCTC 470 457 13 136840 129261 141000 0.01175 0.3279832519190509 0.9704964539007093 0.9167446808510639 34.048758865248224 +Index11 Index11 TATCGAGGCAACCATCATGCGTAC 443 429 14 127995 120114 132900 0.011075 0.3091416608513608 0.9630925507900677 0.9037923250564334 34.151523702031604 +Index12 Index12 GAGACGTAGCAAACCTTGACCGGG 305 301 4 88991 83801 91500 0.007625 0.21284019539427773 0.9725792349726776 0.9158579234972678 34.09685792349727 +Index13 Index13 ATCATGCGCCCGTTGACGAGATCT 433 428 5 126373 119226 129900 0.010825 0.30216329378925333 0.9728483448806774 0.9178290993071594 33.628752886836025 +Index14 Index14 AGGAGCTAGGGAGGGCTAATGTCA 423 413 10 123319 116323 126900 0.010575 0.29518492672714586 0.9717809298660363 0.9166509062253743 35.20439322301024 +Index15 Index15 ATCGACCATGCTTTAGGAGCGAAC 509 495 14 148123 139913 152700 0.012725 0.35519888346127004 0.9700261951538965 0.9162606417812704 33.92788146692862 +Index16 Index16 TGCGAATCGACAGTACATCGAGTA 385 379 6 112208 106006 115500 0.009625 0.2686671318911375 0.9714978354978355 0.9178008658008658 34.0754329004329 +Index17 Index17 ATGTTCCCCTCTAGGCTTTGTCAT 408 398 10 118038 110515 122400 0.0102 0.2847173761339846 0.9643627450980392 0.9029003267973856 34.84089052287582 +Index18 Index18 TCGCTCATCTAGCGACGATATTTG 339 325 14 98862 93167 101700 0.008475 0.23656664340544312 0.972094395280236 0.9160963618485742 33.497173058013765 +Index19 Index19 CCTAAGGTAAACAAACTCCGTTGT 369 346 23 107000 100347 110700 0.009225 0.2575017445917655 0.966576332429991 0.9064769647696477 34.50621047877146 +Index20 Index20 GAATAGCGCTTAACGTACCAAGAC 373 361 12 109064 103043 111900 0.009325 0.2602930914166085 0.9746559428060768 0.9208489722966935 34.24474977658624 +Index21 Index21 CGATGTACATCCTCCGATGTCGGC 358 350 8 103582 97059 107400 0.00895 0.24982554082344732 0.9644506517690875 0.9037150837988827 33.41980912476723 +Index22 Index22 CAAGTCGAAACCAGGTTACCGCGT 353 339 14 102683 96579 105900 0.008825 0.2463363572923936 0.9696222851746931 0.9119830028328612 33.82872993389991 +Index23 Index23 GTAACGGATAGCATGCCGAAACGT 359 346 13 103868 97314 107700 0.008975 0.2505233775296581 0.9644196843082637 0.9035654596100279 33.227251624883934 +Index24 Index24 GAAGCTTGGTCAACATACGCGGGG 294 288 6 85741 80490 88200 0.00735 0.20516399162595952 0.9721201814058957 0.9125850340136055 33.92743764172336 +Index25 Index25 AACCCGTAACCAGGATCTAGGACG 377 352 25 109783 103195 113100 0.009425 0.2630844382414515 0.9706719717064545 0.9124226348364279 33.73596374889478 +Index26 Index26 AATGCTCCCCTATCGACTCTCCGT 402 394 8 117878 111620 120600 0.01005 0.28053035589672015 0.9774295190713101 0.9255389718076286 33.359038142620236 +Index27 Index27 GTATGACGGATGTACGCTAGACAA 345 335 10 99083 92197 103500 0.008625 0.24075366364270762 0.9573236714975846 0.890792270531401 33.13345410628019 +Index28 Index28 GCAAAGCTTGGAATTTCGGGTAAG 354 344 10 102631 96324 106200 0.00885 0.24703419399860432 0.9663935969868174 0.9070056497175141 34.30426082862524 +Index29 Index29 TCTAACCGGCTACTAGCCAACGCC 332 320 12 95787 89529 99600 0.0083 0.2316817864619679 0.9617168674698795 0.8988855421686747 34.03752510040161 +Index30 Index30 ATTGGAGCCCGCTGATAGCCGGTT 327 323 4 94891 88955 98100 0.008175 0.22819260293091417 0.9672884811416922 0.9067787971457696 33.80338939857288 +Index31 Index31 TGTCCGATCTATGCATGGTTCCTA 376 366 10 108952 102197 112800 0.0094 0.26238660153524074 0.965886524822695 0.9060017730496454 33.57890070921986 +Index32 Index32 ACATCGCATGTTGACGGTAATGAG 391 381 10 114169 107781 117300 0.009775 0.27285415212840197 0.973307757885763 0.918849104859335 33.2770673486786 +Index33 Index33 ACTTCCGACAATCGAAGTCATCAA 455 437 18 131991 123910 136500 0.011375 0.31751570132588974 0.966967032967033 0.9077655677655677 34.097802197802196 +Index34 Index34 GCTCCTATGCCTTGGACTACAAAC 405 392 13 118042 111426 121500 0.010125 0.2826238660153524 0.9715390946502057 0.9170864197530865 34.9059670781893 +Index35 Index35 CATAACGCGAATATACGCGACATT 379 368 11 110301 104021 113700 0.009475 0.264480111653873 0.9701055408970977 0.914872471416007 33.94426121372032 +Index36 Index36 CGGACAATGATTTCCCTATGATAC 489 477 12 141195 132440 146700 0.012225 0.34124214933705516 0.9624744376278118 0.9027948193592366 34.75587934560327 +Index37 Index37 GCTACTTGGAAAGAGCTCTACGCA 342 330 12 99495 93814 102600 0.00855 0.23866015352407538 0.9697368421052631 0.9143664717348928 35.11464424951267 +Index38 Index38 TAAGCGAGTAGTCTAGAGGTTACC 443 436 7 128507 120437 132900 0.011075 0.3091416608513608 0.9669450714823176 0.9062227238525207 34.315744920993225 +Index39 Index39 TGCTTGACTCCGAACCCTTGTTCG 376 360 16 109593 103162 112800 0.0094 0.26238660153524074 0.9715691489361702 0.9145567375886525 33.58577127659574 +Index40 Index40 GACATCGTCGGGGTCGTAAGGGGT 346 334 12 100588 94635 103800 0.00865 0.24145150034891835 0.9690558766859345 0.9117052023121387 33.464715799614645 +Index41 Index41 AGCTATGGGACGTATACCCGGCCC 369 361 8 106939 100204 110700 0.009225 0.2575017445917655 0.9660252935862692 0.9051851851851852 34.12782294489612 +Index42 Index42 ACGACTAGGCTCTGCTAAGCGAGC 445 428 17 129387 121303 133500 0.011125 0.31053733426378227 0.9691910112359551 0.9086367041198502 33.87059925093633 +Index43 Index43 TACCGTACGATACGTCCTAAAACT 410 399 11 119141 112060 123000 0.01025 0.28611304954640615 0.9686260162601626 0.9110569105691056 34.009959349593494 +Index44 Index44 TAGAAGGCGCGTATATCGGGTAAG 337 329 8 97825 91982 101100 0.008425 0.23517096999302164 0.9676063303659743 0.9098120672601385 33.83469337289812 +Index45 Index45 CGTCATCAAGGAGAGACGTTCTTA 353 345 8 102459 96200 105900 0.008825 0.2463363572923936 0.9675070821529745 0.9084041548630784 34.14199716713881 +Index46 Index46 CCGTAAGATAGAGCTTAACGATCA 393 385 8 114883 108408 117900 0.009825 0.27424982554082344 0.9744105173876166 0.9194910941475827 34.751166242578456 +Index47 Index47 TAGACTCGTTTCCGCTAGTACTAT 335 326 9 97703 92042 100500 0.008375 0.23377529658060014 0.9721691542288557 0.9158407960199005 33.91417910447761 +Index48 Index48 TATCGGCTTGGTACGGGTTATTAG 340 332 8 98879 93215 102000 0.0085 0.23726448011165388 0.9694019607843137 0.9138725490196078 33.5484068627451 +Index49 Index49 TCAAGAGCGGAGCGGACTTTTGTA 286 279 7 83104 78361 85800 0.00715 0.19958129797627355 0.9685780885780886 0.9132983682983683 34.25728438228438 +Index50 Index50 TTACCCGTAGAATCCATTGCTTCT 430 421 9 125125 117868 129000 0.01075 0.3000697836706211 0.9699612403100775 0.9137054263565891 34.980135658914726 +Index51 Index51 GCTCTCAATCGGGTCTCATGGCGG 362 356 6 105671 99926 108600 0.00905 0.2526168876482903 0.9730294659300184 0.9201289134438305 33.95683701657459 +Index52 Index52 GTCTACGTTTACTGACTTGGAGAA 424 414 10 123910 116846 127200 0.0106 0.2958827634333566 0.9741352201257861 0.9186006289308176 35.046776729559745 +Index53 Index53 TCCGTATGAGACACCGTATCCGAT 388 377 11 113079 106509 116400 0.0097 0.27076064200976974 0.9714690721649485 0.9150257731958763 33.57796391752577 +Index54 Index54 CGCCAATACGTCCTATGGGACGGT 376 367 9 110118 104393 112800 0.0094 0.26238660153524074 0.9762234042553192 0.9254698581560283 34.23282358156028 +Index55 Index55 GATGGTCTAGCATAGTTCCCATTC 424 415 9 123407 116497 127200 0.0106 0.2958827634333566 0.9701808176100629 0.9158569182389937 34.653793238993714 +Index56 Index56 CTCGCTTAAGGCCTCCAAGACATC 378 367 11 109899 103233 113400 0.00945 0.26378227494766227 0.9691269841269842 0.9103439153439153 34.77436067019401 +Index57 Index57 GGCAACATGGGTATTACCGCGGTA 391 384 7 113735 107024 117300 0.009775 0.27285415212840197 0.9696078431372549 0.9123955669224212 34.57107843137255 +Index58 Index58 AGACTCTCATCACTAAGCTCCTAA 453 441 12 132414 124981 135900 0.011325 0.31612002791346827 0.9743487858719647 0.919654157468727 35.748804267844 +Index59 Index59 TGACAAGGTCAATGAACGTCCTTC 418 408 10 121688 114809 125400 0.01045 0.2916957431960921 0.9703987240829346 0.9155422647527911 34.78807814992025 +Index60 Index60 CGGTATGTCATCCCATGCAATCTA 380 373 7 110218 103476 114000 0.0095 0.26517794836008374 0.9668245614035088 0.9076842105263158 34.43344298245614 +Index61 Index61 GACTCATGAATGTAGCGTTCATTG 472 462 10 137703 130082 141600 0.0118 0.32937892533147245 0.9724788135593221 0.9186581920903955 34.63162076271186 +Index62 Index62 CGTAGACATTGAAGCATTCGAGCC 376 366 10 108875 101826 112800 0.0094 0.26238660153524074 0.9652039007092199 0.9027127659574468 34.237477836879435 +Index63 Index63 CATTCGCTCCCTAACCTCGAACAT 432 410 22 126027 119036 129600 0.0108 0.30146545708304257 0.9724305555555556 0.9184876543209877 33.62287808641975 +Index64 Index64 ACAATCGGGGACCAAATCGCGGAA 392 378 14 113976 107226 117600 0.0098 0.2735519888346127 0.9691836734693877 0.9117857142857143 34.69834183673469 +Index65 Index65 GGACTTAGAGCGGTCAAGAGGTTA 383 372 11 112077 105968 114900 0.009575 0.267271458478716 0.9754308093994778 0.9222628372497824 35.06647084421236 +Index66 Index66 GACCGATTCTCGTTAAGGCCGGGA 413 404 9 120172 113111 123900 0.010325 0.2882065596650384 0.969911218724778 0.9129217110573042 34.24606537530266 +Index67 Index67 TGGAAACCCGAGTCGAAAGGGAAA 384 371 13 111892 105331 115200 0.0096 0.26796929518492674 0.9712847222222222 0.9143315972222222 34.3740234375 +Index68 Index68 GGCCTAATGGAAGGAGTCAAATAG 412 405 7 119626 112676 123600 0.0103 0.2875087229588276 0.9678478964401295 0.9116181229773462 35.35507686084142 +Index69 Index69 TTGTACGCGTACCCGTTCTATACA 375 364 11 108748 102143 112500 0.009375 0.26168876482903003 0.9666488888888889 0.9079377777777777 33.481 +Index70 Index70 ATGTCGAGTTGCTGCGAATGCGAA 368 363 5 106772 100222 110400 0.0092 0.2568039078855548 0.9671376811594203 0.9078079710144927 34.03238224637681 +Index71 Index71 CTTCGTACCTCCGCGATCATGACT 370 354 16 106512 99008 111000 0.00925 0.25819958129797627 0.9595675675675676 0.8919639639639639 33.420495495495494 +Index72 Index72 TTAGGTCCGAGACCGAAATCCAAC 376 370 6 109689 103402 112800 0.0094 0.26238660153524074 0.9724202127659575 0.9166843971631206 34.535904255319146 +Index73 Index73 CTAGCTCTTCGTTCGGAGTTTTAC 408 401 7 117925 110354 122400 0.0102 0.2847173761339846 0.9634395424836601 0.9015849673202614 34.30514705882353 +Index74 Index74 CTTGTCCAACTTCTATCCGTCCCG 484 473 11 140913 132578 145200 0.0121 0.3377529658060014 0.9704752066115703 0.9130716253443526 34.36923209366391 +Index75 Index75 CTTAGCGACCCATAACGCGTACCC 380 367 13 109975 103107 114000 0.0095 0.26517794836008374 0.9646929824561403 0.9044473684210527 33.75416666666667 +Index76 Index76 CGTAGGTTAACACTCGTACTTAGC 435 434 1 127211 120150 130500 0.010875 0.3035589672016748 0.9747969348659004 0.9206896551724137 34.482183908045975 +Index77 Index77 AGCATTCCATGTGACTCGAAATGA 407 396 11 117815 110721 122100 0.010175 0.2840195394277739 0.964905814905815 0.9068058968058968 34.646191646191646 +Index78 Index78 TCGTTACCAACGTTAACCGGCCGA 429 417 12 124538 116764 128700 0.010725 0.29937194696441033 0.9676612276612276 0.9072571872571873 34.04127816627817 +Index79 Index79 TTGCTAGGACATTTCCTAGCAACC 413 401 12 119819 112447 123900 0.010325 0.2882065596650384 0.9670621468926553 0.9075625504439063 34.92070217917676 +Index80 Index80 CGAGACTTCTACGAATAGCGTCCC 342 336 6 99060 92765 102600 0.00855 0.23866015352407538 0.9654970760233919 0.9041423001949318 34.132797270955166 +Index81 Index81 GGTCTATGTTTGAATGACGGATGT 392 380 12 113778 106959 117600 0.0098 0.2735519888346127 0.9675 0.909515306122449 33.21226615646258 +Index82 Index82 GATGCCATAGTAAGTAGCTCGTCC 375 366 9 108822 102411 112500 0.009375 0.26168876482903003 0.9673066666666666 0.91032 34.473555555555556 +Index83 Index83 GTACGAGTTCCTTGGCCATTCTCC 420 404 16 121987 114521 126000 0.0105 0.2930914166085136 0.9681507936507937 0.9088968253968254 34.47152777777778 +Index84 Index84 TTCCATCGGTAGACGCCATAACCG 404 396 8 117727 110971 121200 0.0101 0.2819260293091417 0.9713448844884488 0.9156023102310231 34.18492161716171 +Index85 Index85 ACGCTATCATCTCGTTAACCCGCT 350 344 6 101640 95665 105000 0.00875 0.24424284717376135 0.968 0.9110952380952381 34.33047619047619 +Index86 Index86 GTCCAAGAGTTCTTGAGCCTTGCT 463 457 6 134610 126653 138900 0.011575 0.32309839497557574 0.9691144708423326 0.9118286537077034 35.270608351331894 +Index87 Index87 CGAATGGTAAGAACCCGTAACAAG 390 376 14 114157 107708 117000 0.00975 0.2721563154221912 0.9757008547008547 0.9205811965811965 34.15737179487179 +Index88 Index88 AGGTTTCGGTATAAAGGTCGCCCC 430 419 11 124474 116755 129000 0.01075 0.3000697836706211 0.9649147286821705 0.9050775193798449 33.74437984496124 +Index89 Index89 GGTTCAAGATACTACGAGCTCCTC 383 373 10 111039 104146 114900 0.009575 0.267271458478716 0.9663968668407311 0.9064055700609226 34.52708877284595 +Index90 Index90 GTTAAGCGGGCGGGCATAGAGCGA 400 395 5 116794 110269 120000 0.01 0.2791346824842987 0.9732833333333333 0.9189083333333333 35.131145833333335 +Index91 Index91 AAGCTACGCGAAGGTAGCATTCGG 421 410 11 121916 114493 126300 0.010525 0.29378925331472433 0.9652889944576405 0.9065162311955661 34.24851543942993 +Index92 Index92 TTGAGCGTCCGACGACAAGTTCGA 406 398 8 117940 111084 121800 0.01015 0.28332170272156315 0.9683087027914614 0.9120197044334976 33.79176929392447 +Index93 Index93 CCTATGCAATTGGGCAATGTACTT 464 457 7 134945 126964 139200 0.0116 0.32379623168178645 0.9694324712643678 0.9120977011494252 35.02846623563219 +Index94 Index94 CTATTGCCTACGCCGGTAAACCCA 421 412 9 122369 115190 126300 0.010525 0.29378925331472433 0.9688756927949327 0.9120348376880444 35.04127078384798 +Index95 Index95 CCTCTTGAAGAGGCCCATTAGATT 383 374 9 111657 105311 114900 0.009575 0.267271458478716 0.9717754569190601 0.9165448215839861 35.01142297650131 +Index96 Index96 TGGGTTACGGGCCAAGGTTCTCTT 327 323 4 94702 88727 98100 0.008175 0.22819260293091417 0.965361875637105 0.9044546381243629 34.88200815494393 +PhiX PhiX AAGGTAGCTACAGACAACCTACCT 1433 1386 47 421623 405869 429900 0.035825 1.0 0.9807466852756455 0.9441009537101651 34.565422191207254 +Undetermined Undetermined NNNNNNNNNNNNNNNNNNNNNNNN 880 0 0 248629 228186 264000 0.022 0.6140963014654571 0.9417765151515152 0.8643409090909091 32.029592803030305 diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L001_I1_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L001_I1_001.fastq.gz new file mode 100644 index 00000000..d3d7e8ab Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L001_I1_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L001_I2_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L001_I2_001.fastq.gz new file mode 100644 index 00000000..6c4a0688 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L001_I2_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L001_R1_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L001_R1_001.fastq.gz new file mode 100644 index 00000000..63ccec3f Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L001_R1_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L001_R2_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L001_R2_001.fastq.gz new file mode 100644 index 00000000..b2641039 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L001_R2_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L002_I1_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L002_I1_001.fastq.gz new file mode 100644 index 00000000..ae9efffd Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L002_I1_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L002_I2_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L002_I2_001.fastq.gz new file mode 100644 index 00000000..375cb160 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L002_I2_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L002_R1_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L002_R1_001.fastq.gz new file mode 100644 index 00000000..cdbd4cdd Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L002_R1_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L002_R2_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L002_R2_001.fastq.gz new file mode 100644 index 00000000..367cde43 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L002_R2_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L003_I1_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L003_I1_001.fastq.gz new file mode 100644 index 00000000..25260a79 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L003_I1_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L003_I2_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L003_I2_001.fastq.gz new file mode 100644 index 00000000..941deb06 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L003_I2_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L003_R1_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L003_R1_001.fastq.gz new file mode 100644 index 00000000..80d6d8b1 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L003_R1_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L003_R2_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L003_R2_001.fastq.gz new file mode 100644 index 00000000..6d7c77fc Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L003_R2_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L004_I1_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L004_I1_001.fastq.gz new file mode 100644 index 00000000..e6b68227 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L004_I1_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L004_I2_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L004_I2_001.fastq.gz new file mode 100644 index 00000000..8be1acd5 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L004_I2_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L004_R1_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L004_R1_001.fastq.gz new file mode 100644 index 00000000..5c9e4b13 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L004_R1_001.fastq.gz differ diff --git a/src/sgdemux/test_data/fastq/Undetermined_S0_L004_R2_001.fastq.gz b/src/sgdemux/test_data/fastq/Undetermined_S0_L004_R2_001.fastq.gz new file mode 100644 index 00000000..9bda11c2 Binary files /dev/null and b/src/sgdemux/test_data/fastq/Undetermined_S0_L004_R2_001.fastq.gz differ diff --git a/src/sgdemux/test_data/samplesheet.csv b/src/sgdemux/test_data/samplesheet.csv new file mode 100644 index 00000000..9cbf1cdc --- /dev/null +++ b/src/sgdemux/test_data/samplesheet.csv @@ -0,0 +1,409 @@ +[Header],,,,,,,,,,, +Date,2023-01-30,,,,,,,,,, +Run Name,G15_020,,,,,,,,,, +User Name,,,,#Optional,,,,,,, +User Email,,,,#Optional,,,,,,, +Workflow,PE with Dual Indices,,,#Optional,,,,,,, +Assay,Functional Testing Pool of 96,,,#Optional,,,,,,, +Run Notes,12x150x12x150,,,#Optional,,,,,,, +,,,,,,,,,,, +[Settings],,,,,,,,,,, +Read1,150,,,#Enter the number of basepairs per read ,,,,,,, +Read2,150,,,,,,,,,, +,,,,,,,,,,, +Index1,12,,,#Enter the number of basepairs per index from 8-20 bp if using indices,,,,,,, +Index2,12,,,,,,,,,, +,,,,,,,,,,, +Custom Primer Read1 (Y),,,,"#If a custom primer is needed for the run mark Y. Otherwise, leave blank.",,,,,,, +Custom Primer Read2 (Y),,,,,,,,,,, +,,,,,,,,,,, +[Data],,#Required for demux,,#Required for demux,"#Indicate 1,2,3 or 4",#Optional,#Optional,#Optional,#Optional,#Optional,#Optional +Sample_ID,Index1_Name,Index1_Sequence,Index2_Name,Index2_Sequence,Lane,Lane_Name,Project,Loading_Concentration,Application,Notes,Reference +Index1,S1_Index1,TAAGACCCTACT,S2_Index1,GGGACATATTGA,1,,,,,, +Index1,S1_Index1,TAAGACCCTACT,S2_Index1,GGGACATATTGA,2,,,,,, +Index1,S1_Index1,TAAGACCCTACT,S2_Index1,GGGACATATTGA,3,,,,,, +Index1,S1_Index1,TAAGACCCTACT,S2_Index1,GGGACATATTGA,4,,,,,, +Index2,S1_Index2,CGAAGTACATCC,S2_Index2,TAGGACGTAACG,1,,,,,, +Index2,S1_Index2,CGAAGTACATCC,S2_Index2,TAGGACGTAACG,2,,,,,, +Index2,S1_Index2,CGAAGTACATCC,S2_Index2,TAGGACGTAACG,3,,,,,, +Index2,S1_Index2,CGAAGTACATCC,S2_Index2,TAGGACGTAACG,4,,,,,, +Index3,S1_Index3,TAGCCTTCCAAA,S2_Index3,AGTATGGCAAGA,1,,,,,, +Index3,S1_Index3,TAGCCTTCCAAA,S2_Index3,AGTATGGCAAGA,2,,,,,, +Index3,S1_Index3,TAGCCTTCCAAA,S2_Index3,AGTATGGCAAGA,3,,,,,, +Index3,S1_Index3,TAGCCTTCCAAA,S2_Index3,AGTATGGCAAGA,4,,,,,, +Index4,S1_Index4,GCCTTTCAAGTC,S2_Index4,TAGAGTCGTCGT,1,,,,,, +Index4,S1_Index4,GCCTTTCAAGTC,S2_Index4,TAGAGTCGTCGT,2,,,,,, +Index4,S1_Index4,GCCTTTCAAGTC,S2_Index4,TAGAGTCGTCGT,3,,,,,, +Index4,S1_Index4,GCCTTTCAAGTC,S2_Index4,TAGAGTCGTCGT,4,,,,,, +Index5,S1_Index5,CAACGGTTCCGG,S2_Index5,ACGTTTCGCTCG,1,,,,,, +Index5,S1_Index5,CAACGGTTCCGG,S2_Index5,ACGTTTCGCTCG,2,,,,,, +Index5,S1_Index5,CAACGGTTCCGG,S2_Index5,ACGTTTCGCTCG,3,,,,,, +Index5,S1_Index5,CAACGGTTCCGG,S2_Index5,ACGTTTCGCTCG,4,,,,,, +Index6,S1_Index6,GTTGCATGGCCC,S2_Index6,TAGGGAACGATG,1,,,,,, +Index6,S1_Index6,GTTGCATGGCCC,S2_Index6,TAGGGAACGATG,2,,,,,, +Index6,S1_Index6,GTTGCATGGCCC,S2_Index6,TAGGGAACGATG,3,,,,,, +Index6,S1_Index6,GTTGCATGGCCC,S2_Index6,TAGGGAACGATG,4,,,,,, +Index7,S1_Index7,ATCGTTGCTATC,S2_Index7,ATGACTCCGCAT,1,,,,,, +Index7,S1_Index7,ATCGTTGCTATC,S2_Index7,ATGACTCCGCAT,2,,,,,, +Index7,S1_Index7,ATCGTTGCTATC,S2_Index7,ATGACTCCGCAT,3,,,,,, +Index7,S1_Index7,ATCGTTGCTATC,S2_Index7,ATGACTCCGCAT,4,,,,,, +Index8,S1_Index8,CCTCGAATTCAT,S2_Index8,GGTTGCTACCGG,1,,,,,, +Index8,S1_Index8,CCTCGAATTCAT,S2_Index8,GGTTGCTACCGG,2,,,,,, +Index8,S1_Index8,CCTCGAATTCAT,S2_Index8,GGTTGCTACCGG,3,,,,,, +Index8,S1_Index8,CCTCGAATTCAT,S2_Index8,GGTTGCTACCGG,4,,,,,, +Index9,S1_Index9,TGAACGTCCGCC,S2_Index9,TCCTCGATTGAA,1,,,,,, +Index9,S1_Index9,TGAACGTCCGCC,S2_Index9,TCCTCGATTGAA,2,,,,,, +Index9,S1_Index9,TGAACGTCCGCC,S2_Index9,TCCTCGATTGAA,3,,,,,, +Index9,S1_Index9,TGAACGTCCGCC,S2_Index9,TCCTCGATTGAA,4,,,,,, +Index10,S1_Index10,CATCTAGCAAGC,S2_Index10,ATGTAGCGTCTC,1,,,,,, +Index10,S1_Index10,CATCTAGCAAGC,S2_Index10,ATGTAGCGTCTC,2,,,,,, +Index10,S1_Index10,CATCTAGCAAGC,S2_Index10,ATGTAGCGTCTC,3,,,,,, +Index10,S1_Index10,CATCTAGCAAGC,S2_Index10,ATGTAGCGTCTC,4,,,,,, +Index11,S1_Index11,TATCGAGGCAAC,S2_Index11,CATCATGCGTAC,1,,,,,, +Index11,S1_Index11,TATCGAGGCAAC,S2_Index11,CATCATGCGTAC,2,,,,,, +Index11,S1_Index11,TATCGAGGCAAC,S2_Index11,CATCATGCGTAC,3,,,,,, +Index11,S1_Index11,TATCGAGGCAAC,S2_Index11,CATCATGCGTAC,4,,,,,, +Index12,S1_Index12,GAGACGTAGCAA,S2_Index12,ACCTTGACCGGG,1,,,,,, +Index12,S1_Index12,GAGACGTAGCAA,S2_Index12,ACCTTGACCGGG,2,,,,,, +Index12,S1_Index12,GAGACGTAGCAA,S2_Index12,ACCTTGACCGGG,3,,,,,, +Index12,S1_Index12,GAGACGTAGCAA,S2_Index12,ACCTTGACCGGG,4,,,,,, +Index13,S1_Index13,ATCATGCGCCCG,S2_Index13,TTGACGAGATCT,1,,,,,, +Index13,S1_Index13,ATCATGCGCCCG,S2_Index13,TTGACGAGATCT,2,,,,,, +Index13,S1_Index13,ATCATGCGCCCG,S2_Index13,TTGACGAGATCT,3,,,,,, +Index13,S1_Index13,ATCATGCGCCCG,S2_Index13,TTGACGAGATCT,4,,,,,, +Index14,S1_Index14,AGGAGCTAGGGA,S2_Index14,GGGCTAATGTCA,1,,,,,, +Index14,S1_Index14,AGGAGCTAGGGA,S2_Index14,GGGCTAATGTCA,2,,,,,, +Index14,S1_Index14,AGGAGCTAGGGA,S2_Index14,GGGCTAATGTCA,3,,,,,, +Index14,S1_Index14,AGGAGCTAGGGA,S2_Index14,GGGCTAATGTCA,4,,,,,, +Index15,S1_Index15,ATCGACCATGCT,S2_Index15,TTAGGAGCGAAC,1,,,,,, +Index15,S1_Index15,ATCGACCATGCT,S2_Index15,TTAGGAGCGAAC,2,,,,,, +Index15,S1_Index15,ATCGACCATGCT,S2_Index15,TTAGGAGCGAAC,3,,,,,, +Index15,S1_Index15,ATCGACCATGCT,S2_Index15,TTAGGAGCGAAC,4,,,,,, +Index16,S1_Index16,TGCGAATCGACA,S2_Index16,GTACATCGAGTA,1,,,,,, +Index16,S1_Index16,TGCGAATCGACA,S2_Index16,GTACATCGAGTA,2,,,,,, +Index16,S1_Index16,TGCGAATCGACA,S2_Index16,GTACATCGAGTA,3,,,,,, +Index16,S1_Index16,TGCGAATCGACA,S2_Index16,GTACATCGAGTA,4,,,,,, +Index17,S1_Index17,ATGTTCCCCTCT,S2_Index17,AGGCTTTGTCAT,1,,,,,, +Index17,S1_Index17,ATGTTCCCCTCT,S2_Index17,AGGCTTTGTCAT,2,,,,,, +Index17,S1_Index17,ATGTTCCCCTCT,S2_Index17,AGGCTTTGTCAT,3,,,,,, +Index17,S1_Index17,ATGTTCCCCTCT,S2_Index17,AGGCTTTGTCAT,4,,,,,, +Index18,S1_Index18,TCGCTCATCTAG,S2_Index18,CGACGATATTTG,1,,,,,, +Index18,S1_Index18,TCGCTCATCTAG,S2_Index18,CGACGATATTTG,2,,,,,, +Index18,S1_Index18,TCGCTCATCTAG,S2_Index18,CGACGATATTTG,3,,,,,, +Index18,S1_Index18,TCGCTCATCTAG,S2_Index18,CGACGATATTTG,4,,,,,, +Index19,S1_Index19,CCTAAGGTAAAC,S2_Index19,AAACTCCGTTGT,1,,,,,, +Index19,S1_Index19,CCTAAGGTAAAC,S2_Index19,AAACTCCGTTGT,2,,,,,, +Index19,S1_Index19,CCTAAGGTAAAC,S2_Index19,AAACTCCGTTGT,3,,,,,, +Index19,S1_Index19,CCTAAGGTAAAC,S2_Index19,AAACTCCGTTGT,4,,,,,, +Index20,S1_Index20,GAATAGCGCTTA,S2_Index20,ACGTACCAAGAC,1,,,,,, +Index20,S1_Index20,GAATAGCGCTTA,S2_Index20,ACGTACCAAGAC,2,,,,,, +Index20,S1_Index20,GAATAGCGCTTA,S2_Index20,ACGTACCAAGAC,3,,,,,, +Index20,S1_Index20,GAATAGCGCTTA,S2_Index20,ACGTACCAAGAC,4,,,,,, +Index21,S1_Index21,CGATGTACATCC,S2_Index21,TCCGATGTCGGC,1,,,,,, +Index21,S1_Index21,CGATGTACATCC,S2_Index21,TCCGATGTCGGC,2,,,,,, +Index21,S1_Index21,CGATGTACATCC,S2_Index21,TCCGATGTCGGC,3,,,,,, +Index21,S1_Index21,CGATGTACATCC,S2_Index21,TCCGATGTCGGC,4,,,,,, +Index22,S1_Index22,CAAGTCGAAACC,S2_Index22,AGGTTACCGCGT,1,,,,,, +Index22,S1_Index22,CAAGTCGAAACC,S2_Index22,AGGTTACCGCGT,2,,,,,, +Index22,S1_Index22,CAAGTCGAAACC,S2_Index22,AGGTTACCGCGT,3,,,,,, +Index22,S1_Index22,CAAGTCGAAACC,S2_Index22,AGGTTACCGCGT,4,,,,,, +Index23,S1_Index23,GTAACGGATAGC,S2_Index23,ATGCCGAAACGT,1,,,,,, +Index23,S1_Index23,GTAACGGATAGC,S2_Index23,ATGCCGAAACGT,2,,,,,, +Index23,S1_Index23,GTAACGGATAGC,S2_Index23,ATGCCGAAACGT,3,,,,,, +Index23,S1_Index23,GTAACGGATAGC,S2_Index23,ATGCCGAAACGT,4,,,,,, +Index24,S1_Index24,GAAGCTTGGTCA,S2_Index24,ACATACGCGGGG,1,,,,,, +Index24,S1_Index24,GAAGCTTGGTCA,S2_Index24,ACATACGCGGGG,2,,,,,, +Index24,S1_Index24,GAAGCTTGGTCA,S2_Index24,ACATACGCGGGG,3,,,,,, +Index24,S1_Index24,GAAGCTTGGTCA,S2_Index24,ACATACGCGGGG,4,,,,,, +Index25,S1_Index25,AACCCGTAACCA,S2_Index25,GGATCTAGGACG,1,,,,,, +Index25,S1_Index25,AACCCGTAACCA,S2_Index25,GGATCTAGGACG,2,,,,,, +Index25,S1_Index25,AACCCGTAACCA,S2_Index25,GGATCTAGGACG,3,,,,,, +Index25,S1_Index25,AACCCGTAACCA,S2_Index25,GGATCTAGGACG,4,,,,,, +Index26,S1_Index26,AATGCTCCCCTA,S2_Index26,TCGACTCTCCGT,1,,,,,, +Index26,S1_Index26,AATGCTCCCCTA,S2_Index26,TCGACTCTCCGT,2,,,,,, +Index26,S1_Index26,AATGCTCCCCTA,S2_Index26,TCGACTCTCCGT,3,,,,,, +Index26,S1_Index26,AATGCTCCCCTA,S2_Index26,TCGACTCTCCGT,4,,,,,, +Index27,S1_Index27,GTATGACGGATG,S2_Index27,TACGCTAGACAA,1,,,,,, +Index27,S1_Index27,GTATGACGGATG,S2_Index27,TACGCTAGACAA,2,,,,,, +Index27,S1_Index27,GTATGACGGATG,S2_Index27,TACGCTAGACAA,3,,,,,, +Index27,S1_Index27,GTATGACGGATG,S2_Index27,TACGCTAGACAA,4,,,,,, +Index28,S1_Index28,GCAAAGCTTGGA,S2_Index28,ATTTCGGGTAAG,1,,,,,, +Index28,S1_Index28,GCAAAGCTTGGA,S2_Index28,ATTTCGGGTAAG,2,,,,,, +Index28,S1_Index28,GCAAAGCTTGGA,S2_Index28,ATTTCGGGTAAG,3,,,,,, +Index28,S1_Index28,GCAAAGCTTGGA,S2_Index28,ATTTCGGGTAAG,4,,,,,, +Index29,S1_Index29,TCTAACCGGCTA,S2_Index29,CTAGCCAACGCC,1,,,,,, +Index29,S1_Index29,TCTAACCGGCTA,S2_Index29,CTAGCCAACGCC,2,,,,,, +Index29,S1_Index29,TCTAACCGGCTA,S2_Index29,CTAGCCAACGCC,3,,,,,, +Index29,S1_Index29,TCTAACCGGCTA,S2_Index29,CTAGCCAACGCC,4,,,,,, +Index30,S1_Index30,ATTGGAGCCCGC,S2_Index30,TGATAGCCGGTT,1,,,,,, +Index30,S1_Index30,ATTGGAGCCCGC,S2_Index30,TGATAGCCGGTT,2,,,,,, +Index30,S1_Index30,ATTGGAGCCCGC,S2_Index30,TGATAGCCGGTT,3,,,,,, +Index30,S1_Index30,ATTGGAGCCCGC,S2_Index30,TGATAGCCGGTT,4,,,,,, +Index31,S1_Index31,TGTCCGATCTAT,S2_Index31,GCATGGTTCCTA,1,,,,,, +Index31,S1_Index31,TGTCCGATCTAT,S2_Index31,GCATGGTTCCTA,2,,,,,, +Index31,S1_Index31,TGTCCGATCTAT,S2_Index31,GCATGGTTCCTA,3,,,,,, +Index31,S1_Index31,TGTCCGATCTAT,S2_Index31,GCATGGTTCCTA,4,,,,,, +Index32,S1_Index32,ACATCGCATGTT,S2_Index32,GACGGTAATGAG,1,,,,,, +Index32,S1_Index32,ACATCGCATGTT,S2_Index32,GACGGTAATGAG,2,,,,,, +Index32,S1_Index32,ACATCGCATGTT,S2_Index32,GACGGTAATGAG,3,,,,,, +Index32,S1_Index32,ACATCGCATGTT,S2_Index32,GACGGTAATGAG,4,,,,,, +Index33,S1_Index33,ACTTCCGACAAT,S2_Index33,CGAAGTCATCAA,1,,,,,, +Index33,S1_Index33,ACTTCCGACAAT,S2_Index33,CGAAGTCATCAA,2,,,,,, +Index33,S1_Index33,ACTTCCGACAAT,S2_Index33,CGAAGTCATCAA,3,,,,,, +Index33,S1_Index33,ACTTCCGACAAT,S2_Index33,CGAAGTCATCAA,4,,,,,, +Index34,S1_Index34,GCTCCTATGCCT,S2_Index34,TGGACTACAAAC,1,,,,,, +Index34,S1_Index34,GCTCCTATGCCT,S2_Index34,TGGACTACAAAC,2,,,,,, +Index34,S1_Index34,GCTCCTATGCCT,S2_Index34,TGGACTACAAAC,3,,,,,, +Index34,S1_Index34,GCTCCTATGCCT,S2_Index34,TGGACTACAAAC,4,,,,,, +Index35,S1_Index35,CATAACGCGAAT,S2_Index35,ATACGCGACATT,1,,,,,, +Index35,S1_Index35,CATAACGCGAAT,S2_Index35,ATACGCGACATT,2,,,,,, +Index35,S1_Index35,CATAACGCGAAT,S2_Index35,ATACGCGACATT,3,,,,,, +Index35,S1_Index35,CATAACGCGAAT,S2_Index35,ATACGCGACATT,4,,,,,, +Index36,S1_Index36,CGGACAATGATT,S2_Index36,TCCCTATGATAC,1,,,,,, +Index36,S1_Index36,CGGACAATGATT,S2_Index36,TCCCTATGATAC,2,,,,,, +Index36,S1_Index36,CGGACAATGATT,S2_Index36,TCCCTATGATAC,3,,,,,, +Index36,S1_Index36,CGGACAATGATT,S2_Index36,TCCCTATGATAC,4,,,,,, +Index37,S1_Index37,GCTACTTGGAAA,S2_Index37,GAGCTCTACGCA,1,,,,,, +Index37,S1_Index37,GCTACTTGGAAA,S2_Index37,GAGCTCTACGCA,2,,,,,, +Index37,S1_Index37,GCTACTTGGAAA,S2_Index37,GAGCTCTACGCA,3,,,,,, +Index37,S1_Index37,GCTACTTGGAAA,S2_Index37,GAGCTCTACGCA,4,,,,,, +Index38,S1_Index38,TAAGCGAGTAGT,S2_Index38,CTAGAGGTTACC,1,,,,,, +Index38,S1_Index38,TAAGCGAGTAGT,S2_Index38,CTAGAGGTTACC,2,,,,,, +Index38,S1_Index38,TAAGCGAGTAGT,S2_Index38,CTAGAGGTTACC,3,,,,,, +Index38,S1_Index38,TAAGCGAGTAGT,S2_Index38,CTAGAGGTTACC,4,,,,,, +Index39,S1_Index39,TGCTTGACTCCG,S2_Index39,AACCCTTGTTCG,1,,,,,, +Index39,S1_Index39,TGCTTGACTCCG,S2_Index39,AACCCTTGTTCG,2,,,,,, +Index39,S1_Index39,TGCTTGACTCCG,S2_Index39,AACCCTTGTTCG,3,,,,,, +Index39,S1_Index39,TGCTTGACTCCG,S2_Index39,AACCCTTGTTCG,4,,,,,, +Index40,S1_Index40,GACATCGTCGGG,S2_Index40,GTCGTAAGGGGT,1,,,,,, +Index40,S1_Index40,GACATCGTCGGG,S2_Index40,GTCGTAAGGGGT,2,,,,,, +Index40,S1_Index40,GACATCGTCGGG,S2_Index40,GTCGTAAGGGGT,3,,,,,, +Index40,S1_Index40,GACATCGTCGGG,S2_Index40,GTCGTAAGGGGT,4,,,,,, +Index41,S1_Index41,AGCTATGGGACG,S2_Index41,TATACCCGGCCC,1,,,,,, +Index41,S1_Index41,AGCTATGGGACG,S2_Index41,TATACCCGGCCC,2,,,,,, +Index41,S1_Index41,AGCTATGGGACG,S2_Index41,TATACCCGGCCC,3,,,,,, +Index41,S1_Index41,AGCTATGGGACG,S2_Index41,TATACCCGGCCC,4,,,,,, +Index42,S1_Index42,ACGACTAGGCTC,S2_Index42,TGCTAAGCGAGC,1,,,,,, +Index42,S1_Index42,ACGACTAGGCTC,S2_Index42,TGCTAAGCGAGC,2,,,,,, +Index42,S1_Index42,ACGACTAGGCTC,S2_Index42,TGCTAAGCGAGC,3,,,,,, +Index42,S1_Index42,ACGACTAGGCTC,S2_Index42,TGCTAAGCGAGC,4,,,,,, +Index43,S1_Index43,TACCGTACGATA,S2_Index43,CGTCCTAAAACT,1,,,,,, +Index43,S1_Index43,TACCGTACGATA,S2_Index43,CGTCCTAAAACT,2,,,,,, +Index43,S1_Index43,TACCGTACGATA,S2_Index43,CGTCCTAAAACT,3,,,,,, +Index43,S1_Index43,TACCGTACGATA,S2_Index43,CGTCCTAAAACT,4,,,,,, +Index44,S1_Index44,TAGAAGGCGCGT,S2_Index44,ATATCGGGTAAG,1,,,,,, +Index44,S1_Index44,TAGAAGGCGCGT,S2_Index44,ATATCGGGTAAG,2,,,,,, +Index44,S1_Index44,TAGAAGGCGCGT,S2_Index44,ATATCGGGTAAG,3,,,,,, +Index44,S1_Index44,TAGAAGGCGCGT,S2_Index44,ATATCGGGTAAG,4,,,,,, +Index45,S1_Index45,CGTCATCAAGGA,S2_Index45,GAGACGTTCTTA,1,,,,,, +Index45,S1_Index45,CGTCATCAAGGA,S2_Index45,GAGACGTTCTTA,2,,,,,, +Index45,S1_Index45,CGTCATCAAGGA,S2_Index45,GAGACGTTCTTA,3,,,,,, +Index45,S1_Index45,CGTCATCAAGGA,S2_Index45,GAGACGTTCTTA,4,,,,,, +Index46,S1_Index46,CCGTAAGATAGA,S2_Index46,GCTTAACGATCA,1,,,,,, +Index46,S1_Index46,CCGTAAGATAGA,S2_Index46,GCTTAACGATCA,2,,,,,, +Index46,S1_Index46,CCGTAAGATAGA,S2_Index46,GCTTAACGATCA,3,,,,,, +Index46,S1_Index46,CCGTAAGATAGA,S2_Index46,GCTTAACGATCA,4,,,,,, +Index47,S1_Index47,TAGACTCGTTTC,S2_Index47,CGCTAGTACTAT,1,,,,,, +Index47,S1_Index47,TAGACTCGTTTC,S2_Index47,CGCTAGTACTAT,2,,,,,, +Index47,S1_Index47,TAGACTCGTTTC,S2_Index47,CGCTAGTACTAT,3,,,,,, +Index47,S1_Index47,TAGACTCGTTTC,S2_Index47,CGCTAGTACTAT,4,,,,,, +Index48,S1_Index48,TATCGGCTTGGT,S2_Index48,ACGGGTTATTAG,1,,,,,, +Index48,S1_Index48,TATCGGCTTGGT,S2_Index48,ACGGGTTATTAG,2,,,,,, +Index48,S1_Index48,TATCGGCTTGGT,S2_Index48,ACGGGTTATTAG,3,,,,,, +Index48,S1_Index48,TATCGGCTTGGT,S2_Index48,ACGGGTTATTAG,4,,,,,, +Index49,S1_Index49,TCAAGAGCGGAG,S2_Index49,CGGACTTTTGTA,1,,,,,, +Index49,S1_Index49,TCAAGAGCGGAG,S2_Index49,CGGACTTTTGTA,2,,,,,, +Index49,S1_Index49,TCAAGAGCGGAG,S2_Index49,CGGACTTTTGTA,3,,,,,, +Index49,S1_Index49,TCAAGAGCGGAG,S2_Index49,CGGACTTTTGTA,4,,,,,, +Index50,S1_Index50,TTACCCGTAGAA,S2_Index50,TCCATTGCTTCT,1,,,,,, +Index50,S1_Index50,TTACCCGTAGAA,S2_Index50,TCCATTGCTTCT,2,,,,,, +Index50,S1_Index50,TTACCCGTAGAA,S2_Index50,TCCATTGCTTCT,3,,,,,, +Index50,S1_Index50,TTACCCGTAGAA,S2_Index50,TCCATTGCTTCT,4,,,,,, +Index51,S1_Index51,GCTCTCAATCGG,S2_Index51,GTCTCATGGCGG,1,,,,,, +Index51,S1_Index51,GCTCTCAATCGG,S2_Index51,GTCTCATGGCGG,2,,,,,, +Index51,S1_Index51,GCTCTCAATCGG,S2_Index51,GTCTCATGGCGG,3,,,,,, +Index51,S1_Index51,GCTCTCAATCGG,S2_Index51,GTCTCATGGCGG,4,,,,,, +Index52,S1_Index52,GTCTACGTTTAC,S2_Index52,TGACTTGGAGAA,1,,,,,, +Index52,S1_Index52,GTCTACGTTTAC,S2_Index52,TGACTTGGAGAA,2,,,,,, +Index52,S1_Index52,GTCTACGTTTAC,S2_Index52,TGACTTGGAGAA,3,,,,,, +Index52,S1_Index52,GTCTACGTTTAC,S2_Index52,TGACTTGGAGAA,4,,,,,, +Index53,S1_Index53,TCCGTATGAGAC,S2_Index53,ACCGTATCCGAT,1,,,,,, +Index53,S1_Index53,TCCGTATGAGAC,S2_Index53,ACCGTATCCGAT,2,,,,,, +Index53,S1_Index53,TCCGTATGAGAC,S2_Index53,ACCGTATCCGAT,3,,,,,, +Index53,S1_Index53,TCCGTATGAGAC,S2_Index53,ACCGTATCCGAT,4,,,,,, +Index54,S1_Index54,CGCCAATACGTC,S2_Index54,CTATGGGACGGT,1,,,,,, +Index54,S1_Index54,CGCCAATACGTC,S2_Index54,CTATGGGACGGT,2,,,,,, +Index54,S1_Index54,CGCCAATACGTC,S2_Index54,CTATGGGACGGT,3,,,,,, +Index54,S1_Index54,CGCCAATACGTC,S2_Index54,CTATGGGACGGT,4,,,,,, +Index55,S1_Index55,GATGGTCTAGCA,S2_Index55,TAGTTCCCATTC,1,,,,,, +Index55,S1_Index55,GATGGTCTAGCA,S2_Index55,TAGTTCCCATTC,2,,,,,, +Index55,S1_Index55,GATGGTCTAGCA,S2_Index55,TAGTTCCCATTC,3,,,,,, +Index55,S1_Index55,GATGGTCTAGCA,S2_Index55,TAGTTCCCATTC,4,,,,,, +Index56,S1_Index56,CTCGCTTAAGGC,S2_Index56,CTCCAAGACATC,1,,,,,, +Index56,S1_Index56,CTCGCTTAAGGC,S2_Index56,CTCCAAGACATC,2,,,,,, +Index56,S1_Index56,CTCGCTTAAGGC,S2_Index56,CTCCAAGACATC,3,,,,,, +Index56,S1_Index56,CTCGCTTAAGGC,S2_Index56,CTCCAAGACATC,4,,,,,, +Index57,S1_Index57,GGCAACATGGGT,S2_Index57,ATTACCGCGGTA,1,,,,,, +Index57,S1_Index57,GGCAACATGGGT,S2_Index57,ATTACCGCGGTA,2,,,,,, +Index57,S1_Index57,GGCAACATGGGT,S2_Index57,ATTACCGCGGTA,3,,,,,, +Index57,S1_Index57,GGCAACATGGGT,S2_Index57,ATTACCGCGGTA,4,,,,,, +Index58,S1_Index58,AGACTCTCATCA,S2_Index58,CTAAGCTCCTAA,1,,,,,, +Index58,S1_Index58,AGACTCTCATCA,S2_Index58,CTAAGCTCCTAA,2,,,,,, +Index58,S1_Index58,AGACTCTCATCA,S2_Index58,CTAAGCTCCTAA,3,,,,,, +Index58,S1_Index58,AGACTCTCATCA,S2_Index58,CTAAGCTCCTAA,4,,,,,, +Index59,S1_Index59,TGACAAGGTCAA,S2_Index59,TGAACGTCCTTC,1,,,,,, +Index59,S1_Index59,TGACAAGGTCAA,S2_Index59,TGAACGTCCTTC,2,,,,,, +Index59,S1_Index59,TGACAAGGTCAA,S2_Index59,TGAACGTCCTTC,3,,,,,, +Index59,S1_Index59,TGACAAGGTCAA,S2_Index59,TGAACGTCCTTC,4,,,,,, +Index60,S1_Index60,CGGTATGTCATC,S2_Index60,CCATGCAATCTA,1,,,,,, +Index60,S1_Index60,CGGTATGTCATC,S2_Index60,CCATGCAATCTA,2,,,,,, +Index60,S1_Index60,CGGTATGTCATC,S2_Index60,CCATGCAATCTA,3,,,,,, +Index60,S1_Index60,CGGTATGTCATC,S2_Index60,CCATGCAATCTA,4,,,,,, +Index61,S1_Index61,GACTCATGAATG,S2_Index61,TAGCGTTCATTG,1,,,,,, +Index61,S1_Index61,GACTCATGAATG,S2_Index61,TAGCGTTCATTG,2,,,,,, +Index61,S1_Index61,GACTCATGAATG,S2_Index61,TAGCGTTCATTG,3,,,,,, +Index61,S1_Index61,GACTCATGAATG,S2_Index61,TAGCGTTCATTG,4,,,,,, +Index62,S1_Index62,CGTAGACATTGA,S2_Index62,AGCATTCGAGCC,1,,,,,, +Index62,S1_Index62,CGTAGACATTGA,S2_Index62,AGCATTCGAGCC,2,,,,,, +Index62,S1_Index62,CGTAGACATTGA,S2_Index62,AGCATTCGAGCC,3,,,,,, +Index62,S1_Index62,CGTAGACATTGA,S2_Index62,AGCATTCGAGCC,4,,,,,, +Index63,S1_Index63,CATTCGCTCCCT,S2_Index63,AACCTCGAACAT,1,,,,,, +Index63,S1_Index63,CATTCGCTCCCT,S2_Index63,AACCTCGAACAT,2,,,,,, +Index63,S1_Index63,CATTCGCTCCCT,S2_Index63,AACCTCGAACAT,3,,,,,, +Index63,S1_Index63,CATTCGCTCCCT,S2_Index63,AACCTCGAACAT,4,,,,,, +Index64,S1_Index64,ACAATCGGGGAC,S2_Index64,CAAATCGCGGAA,1,,,,,, +Index64,S1_Index64,ACAATCGGGGAC,S2_Index64,CAAATCGCGGAA,2,,,,,, +Index64,S1_Index64,ACAATCGGGGAC,S2_Index64,CAAATCGCGGAA,3,,,,,, +Index64,S1_Index64,ACAATCGGGGAC,S2_Index64,CAAATCGCGGAA,4,,,,,, +Index65,S1_Index65,GGACTTAGAGCG,S2_Index65,GTCAAGAGGTTA,1,,,,,, +Index65,S1_Index65,GGACTTAGAGCG,S2_Index65,GTCAAGAGGTTA,2,,,,,, +Index65,S1_Index65,GGACTTAGAGCG,S2_Index65,GTCAAGAGGTTA,3,,,,,, +Index65,S1_Index65,GGACTTAGAGCG,S2_Index65,GTCAAGAGGTTA,4,,,,,, +Index66,S1_Index66,GACCGATTCTCG,S2_Index66,TTAAGGCCGGGA,1,,,,,, +Index66,S1_Index66,GACCGATTCTCG,S2_Index66,TTAAGGCCGGGA,2,,,,,, +Index66,S1_Index66,GACCGATTCTCG,S2_Index66,TTAAGGCCGGGA,3,,,,,, +Index66,S1_Index66,GACCGATTCTCG,S2_Index66,TTAAGGCCGGGA,4,,,,,, +Index67,S1_Index67,TGGAAACCCGAG,S2_Index67,TCGAAAGGGAAA,1,,,,,, +Index67,S1_Index67,TGGAAACCCGAG,S2_Index67,TCGAAAGGGAAA,2,,,,,, +Index67,S1_Index67,TGGAAACCCGAG,S2_Index67,TCGAAAGGGAAA,3,,,,,, +Index67,S1_Index67,TGGAAACCCGAG,S2_Index67,TCGAAAGGGAAA,4,,,,,, +Index68,S1_Index68,GGCCTAATGGAA,S2_Index68,GGAGTCAAATAG,1,,,,,, +Index68,S1_Index68,GGCCTAATGGAA,S2_Index68,GGAGTCAAATAG,2,,,,,, +Index68,S1_Index68,GGCCTAATGGAA,S2_Index68,GGAGTCAAATAG,3,,,,,, +Index68,S1_Index68,GGCCTAATGGAA,S2_Index68,GGAGTCAAATAG,4,,,,,, +Index69,S1_Index69,TTGTACGCGTAC,S2_Index69,CCGTTCTATACA,1,,,,,, +Index69,S1_Index69,TTGTACGCGTAC,S2_Index69,CCGTTCTATACA,2,,,,,, +Index69,S1_Index69,TTGTACGCGTAC,S2_Index69,CCGTTCTATACA,3,,,,,, +Index69,S1_Index69,TTGTACGCGTAC,S2_Index69,CCGTTCTATACA,4,,,,,, +Index70,S1_Index70,ATGTCGAGTTGC,S2_Index70,TGCGAATGCGAA,1,,,,,, +Index70,S1_Index70,ATGTCGAGTTGC,S2_Index70,TGCGAATGCGAA,2,,,,,, +Index70,S1_Index70,ATGTCGAGTTGC,S2_Index70,TGCGAATGCGAA,3,,,,,, +Index70,S1_Index70,ATGTCGAGTTGC,S2_Index70,TGCGAATGCGAA,4,,,,,, +Index71,S1_Index71,CTTCGTACCTCC,S2_Index71,GCGATCATGACT,1,,,,,, +Index71,S1_Index71,CTTCGTACCTCC,S2_Index71,GCGATCATGACT,2,,,,,, +Index71,S1_Index71,CTTCGTACCTCC,S2_Index71,GCGATCATGACT,3,,,,,, +Index71,S1_Index71,CTTCGTACCTCC,S2_Index71,GCGATCATGACT,4,,,,,, +Index72,S1_Index72,TTAGGTCCGAGA,S2_Index72,CCGAAATCCAAC,1,,,,,, +Index72,S1_Index72,TTAGGTCCGAGA,S2_Index72,CCGAAATCCAAC,2,,,,,, +Index72,S1_Index72,TTAGGTCCGAGA,S2_Index72,CCGAAATCCAAC,3,,,,,, +Index72,S1_Index72,TTAGGTCCGAGA,S2_Index72,CCGAAATCCAAC,4,,,,,, +Index73,S1_Index73,CTAGCTCTTCGT,S2_Index73,TCGGAGTTTTAC,1,,,,,, +Index73,S1_Index73,CTAGCTCTTCGT,S2_Index73,TCGGAGTTTTAC,2,,,,,, +Index73,S1_Index73,CTAGCTCTTCGT,S2_Index73,TCGGAGTTTTAC,3,,,,,, +Index73,S1_Index73,CTAGCTCTTCGT,S2_Index73,TCGGAGTTTTAC,4,,,,,, +Index74,S1_Index74,CTTGTCCAACTT,S2_Index74,CTATCCGTCCCG,1,,,,,, +Index74,S1_Index74,CTTGTCCAACTT,S2_Index74,CTATCCGTCCCG,2,,,,,, +Index74,S1_Index74,CTTGTCCAACTT,S2_Index74,CTATCCGTCCCG,3,,,,,, +Index74,S1_Index74,CTTGTCCAACTT,S2_Index74,CTATCCGTCCCG,4,,,,,, +Index75,S1_Index75,CTTAGCGACCCA,S2_Index75,TAACGCGTACCC,1,,,,,, +Index75,S1_Index75,CTTAGCGACCCA,S2_Index75,TAACGCGTACCC,2,,,,,, +Index75,S1_Index75,CTTAGCGACCCA,S2_Index75,TAACGCGTACCC,3,,,,,, +Index75,S1_Index75,CTTAGCGACCCA,S2_Index75,TAACGCGTACCC,4,,,,,, +Index76,S1_Index76,CGTAGGTTAACA,S2_Index76,CTCGTACTTAGC,1,,,,,, +Index76,S1_Index76,CGTAGGTTAACA,S2_Index76,CTCGTACTTAGC,2,,,,,, +Index76,S1_Index76,CGTAGGTTAACA,S2_Index76,CTCGTACTTAGC,3,,,,,, +Index76,S1_Index76,CGTAGGTTAACA,S2_Index76,CTCGTACTTAGC,4,,,,,, +Index77,S1_Index77,AGCATTCCATGT,S2_Index77,GACTCGAAATGA,1,,,,,, +Index77,S1_Index77,AGCATTCCATGT,S2_Index77,GACTCGAAATGA,2,,,,,, +Index77,S1_Index77,AGCATTCCATGT,S2_Index77,GACTCGAAATGA,3,,,,,, +Index77,S1_Index77,AGCATTCCATGT,S2_Index77,GACTCGAAATGA,4,,,,,, +Index78,S1_Index78,TCGTTACCAACG,S2_Index78,TTAACCGGCCGA,1,,,,,, +Index78,S1_Index78,TCGTTACCAACG,S2_Index78,TTAACCGGCCGA,2,,,,,, +Index78,S1_Index78,TCGTTACCAACG,S2_Index78,TTAACCGGCCGA,3,,,,,, +Index78,S1_Index78,TCGTTACCAACG,S2_Index78,TTAACCGGCCGA,4,,,,,, +Index79,S1_Index79,TTGCTAGGACAT,S2_Index79,TTCCTAGCAACC,1,,,,,, +Index79,S1_Index79,TTGCTAGGACAT,S2_Index79,TTCCTAGCAACC,2,,,,,, +Index79,S1_Index79,TTGCTAGGACAT,S2_Index79,TTCCTAGCAACC,3,,,,,, +Index79,S1_Index79,TTGCTAGGACAT,S2_Index79,TTCCTAGCAACC,4,,,,,, +Index80,S1_Index80,CGAGACTTCTAC,S2_Index80,GAATAGCGTCCC,1,,,,,, +Index80,S1_Index80,CGAGACTTCTAC,S2_Index80,GAATAGCGTCCC,2,,,,,, +Index80,S1_Index80,CGAGACTTCTAC,S2_Index80,GAATAGCGTCCC,3,,,,,, +Index80,S1_Index80,CGAGACTTCTAC,S2_Index80,GAATAGCGTCCC,4,,,,,, +Index81,S1_Index81,GGTCTATGTTTG,S2_Index81,AATGACGGATGT,1,,,,,, +Index81,S1_Index81,GGTCTATGTTTG,S2_Index81,AATGACGGATGT,2,,,,,, +Index81,S1_Index81,GGTCTATGTTTG,S2_Index81,AATGACGGATGT,3,,,,,, +Index81,S1_Index81,GGTCTATGTTTG,S2_Index81,AATGACGGATGT,4,,,,,, +Index82,S1_Index82,GATGCCATAGTA,S2_Index82,AGTAGCTCGTCC,1,,,,,, +Index82,S1_Index82,GATGCCATAGTA,S2_Index82,AGTAGCTCGTCC,2,,,,,, +Index82,S1_Index82,GATGCCATAGTA,S2_Index82,AGTAGCTCGTCC,3,,,,,, +Index82,S1_Index82,GATGCCATAGTA,S2_Index82,AGTAGCTCGTCC,4,,,,,, +Index83,S1_Index83,GTACGAGTTCCT,S2_Index83,TGGCCATTCTCC,1,,,,,, +Index83,S1_Index83,GTACGAGTTCCT,S2_Index83,TGGCCATTCTCC,2,,,,,, +Index83,S1_Index83,GTACGAGTTCCT,S2_Index83,TGGCCATTCTCC,3,,,,,, +Index83,S1_Index83,GTACGAGTTCCT,S2_Index83,TGGCCATTCTCC,4,,,,,, +Index84,S1_Index84,TTCCATCGGTAG,S2_Index84,ACGCCATAACCG,1,,,,,, +Index84,S1_Index84,TTCCATCGGTAG,S2_Index84,ACGCCATAACCG,2,,,,,, +Index84,S1_Index84,TTCCATCGGTAG,S2_Index84,ACGCCATAACCG,3,,,,,, +Index84,S1_Index84,TTCCATCGGTAG,S2_Index84,ACGCCATAACCG,4,,,,,, +Index85,S1_Index85,ACGCTATCATCT,S2_Index85,CGTTAACCCGCT,1,,,,,, +Index85,S1_Index85,ACGCTATCATCT,S2_Index85,CGTTAACCCGCT,2,,,,,, +Index85,S1_Index85,ACGCTATCATCT,S2_Index85,CGTTAACCCGCT,3,,,,,, +Index85,S1_Index85,ACGCTATCATCT,S2_Index85,CGTTAACCCGCT,4,,,,,, +Index86,S1_Index86,GTCCAAGAGTTC,S2_Index86,TTGAGCCTTGCT,1,,,,,, +Index86,S1_Index86,GTCCAAGAGTTC,S2_Index86,TTGAGCCTTGCT,2,,,,,, +Index86,S1_Index86,GTCCAAGAGTTC,S2_Index86,TTGAGCCTTGCT,3,,,,,, +Index86,S1_Index86,GTCCAAGAGTTC,S2_Index86,TTGAGCCTTGCT,4,,,,,, +Index87,S1_Index87,CGAATGGTAAGA,S2_Index87,ACCCGTAACAAG,1,,,,,, +Index87,S1_Index87,CGAATGGTAAGA,S2_Index87,ACCCGTAACAAG,2,,,,,, +Index87,S1_Index87,CGAATGGTAAGA,S2_Index87,ACCCGTAACAAG,3,,,,,, +Index87,S1_Index87,CGAATGGTAAGA,S2_Index87,ACCCGTAACAAG,4,,,,,, +Index88,S1_Index88,AGGTTTCGGTAT,S2_Index88,AAAGGTCGCCCC,1,,,,,, +Index88,S1_Index88,AGGTTTCGGTAT,S2_Index88,AAAGGTCGCCCC,2,,,,,, +Index88,S1_Index88,AGGTTTCGGTAT,S2_Index88,AAAGGTCGCCCC,3,,,,,, +Index88,S1_Index88,AGGTTTCGGTAT,S2_Index88,AAAGGTCGCCCC,4,,,,,, +Index89,S1_Index89,GGTTCAAGATAC,S2_Index89,TACGAGCTCCTC,1,,,,,, +Index89,S1_Index89,GGTTCAAGATAC,S2_Index89,TACGAGCTCCTC,2,,,,,, +Index89,S1_Index89,GGTTCAAGATAC,S2_Index89,TACGAGCTCCTC,3,,,,,, +Index89,S1_Index89,GGTTCAAGATAC,S2_Index89,TACGAGCTCCTC,4,,,,,, +Index90,S1_Index90,GTTAAGCGGGCG,S2_Index90,GGCATAGAGCGA,1,,,,,, +Index90,S1_Index90,GTTAAGCGGGCG,S2_Index90,GGCATAGAGCGA,2,,,,,, +Index90,S1_Index90,GTTAAGCGGGCG,S2_Index90,GGCATAGAGCGA,3,,,,,, +Index90,S1_Index90,GTTAAGCGGGCG,S2_Index90,GGCATAGAGCGA,4,,,,,, +Index91,S1_Index91,AAGCTACGCGAA,S2_Index91,GGTAGCATTCGG,1,,,,,, +Index91,S1_Index91,AAGCTACGCGAA,S2_Index91,GGTAGCATTCGG,2,,,,,, +Index91,S1_Index91,AAGCTACGCGAA,S2_Index91,GGTAGCATTCGG,3,,,,,, +Index91,S1_Index91,AAGCTACGCGAA,S2_Index91,GGTAGCATTCGG,4,,,,,, +Index92,S1_Index92,TTGAGCGTCCGA,S2_Index92,CGACAAGTTCGA,1,,,,,, +Index92,S1_Index92,TTGAGCGTCCGA,S2_Index92,CGACAAGTTCGA,2,,,,,, +Index92,S1_Index92,TTGAGCGTCCGA,S2_Index92,CGACAAGTTCGA,3,,,,,, +Index92,S1_Index92,TTGAGCGTCCGA,S2_Index92,CGACAAGTTCGA,4,,,,,, +Index93,S1_Index93,CCTATGCAATTG,S2_Index93,GGCAATGTACTT,1,,,,,, +Index93,S1_Index93,CCTATGCAATTG,S2_Index93,GGCAATGTACTT,2,,,,,, +Index93,S1_Index93,CCTATGCAATTG,S2_Index93,GGCAATGTACTT,3,,,,,, +Index93,S1_Index93,CCTATGCAATTG,S2_Index93,GGCAATGTACTT,4,,,,,, +Index94,S1_Index94,CTATTGCCTACG,S2_Index94,CCGGTAAACCCA,1,,,,,, +Index94,S1_Index94,CTATTGCCTACG,S2_Index94,CCGGTAAACCCA,2,,,,,, +Index94,S1_Index94,CTATTGCCTACG,S2_Index94,CCGGTAAACCCA,3,,,,,, +Index94,S1_Index94,CTATTGCCTACG,S2_Index94,CCGGTAAACCCA,4,,,,,, +Index95,S1_Index95,CCTCTTGAAGAG,S2_Index95,GCCCATTAGATT,1,,,,,, +Index95,S1_Index95,CCTCTTGAAGAG,S2_Index95,GCCCATTAGATT,2,,,,,, +Index95,S1_Index95,CCTCTTGAAGAG,S2_Index95,GCCCATTAGATT,3,,,,,, +Index95,S1_Index95,CCTCTTGAAGAG,S2_Index95,GCCCATTAGATT,4,,,,,, +Index96,S1_Index96,TGGGTTACGGGC,S2_Index96,CAAGGTTCTCTT,1,,,,,, +Index96,S1_Index96,TGGGTTACGGGC,S2_Index96,CAAGGTTCTCTT,2,,,,,, +Index96,S1_Index96,TGGGTTACGGGC,S2_Index96,CAAGGTTCTCTT,3,,,,,, +Index96,S1_Index96,TGGGTTACGGGC,S2_Index96,CAAGGTTCTCTT,4,,,,,, +PhiX,S1-PhiX-index,AAGGTAGCTACA,S2-PhiX-index,GACAACCTACCT,1,,,,,, +PhiX,S1-PhiX-index,AAGGTAGCTACA,S2-PhiX-index,GACAACCTACCT,2,,,,,, +PhiX,S1-PhiX-index,AAGGTAGCTACA,S2-PhiX-index,GACAACCTACCT,3,,,,,, +PhiX,S1-PhiX-index,AAGGTAGCTACA,S2-PhiX-index,GACAACCTACCT,4,,,,,, diff --git a/src/sgdemux/test_data/script.sh b/src/sgdemux/test_data/script.sh new file mode 100755 index 00000000..776977b4 --- /dev/null +++ b/src/sgdemux/test_data/script.sh @@ -0,0 +1,49 @@ +#!/bin/bash +set -eo pipefail + +REPO_ROOT=$(git rev-parse --show-toplevel) +cd "$REPO_ROOT" + +OUT=src/sgdemux/test_data/ + + +TAR_LOC="$OUT/unfiltered_fastq.tar" +if [ ! -f "$TAR_LOC" ]; then + wget https://singular-public-repo.s3.us-west-1.amazonaws.com/example_raw_files/unfiltered_fastq.tar.gz -O "$TAR_LOC" +fi + +tar -xvf "$TAR_LOC" -C "$OUT" + +# NOTE: sgdemux requires block compressed gzip files! +function seqkit_head { + input="$1" + output="$2" + if [[ ! -f "$output" ]]; then + echo "> Processing $(basename $input)" + seqkit head -n 10000 "$input" | bgzip --threads 12 > "$output" + fi +} +tar_contents=( + Undetermined_S0_L001_I1_001.fastq.gz + Undetermined_S0_L001_I2_001.fastq.gz + Undetermined_S0_L001_R1_001.fastq.gz + Undetermined_S0_L001_R2_001.fastq.gz + Undetermined_S0_L002_I1_001.fastq.gz + Undetermined_S0_L002_I2_001.fastq.gz + Undetermined_S0_L002_R1_001.fastq.gz + Undetermined_S0_L002_R2_001.fastq.gz + Undetermined_S0_L003_I1_001.fastq.gz + Undetermined_S0_L003_I2_001.fastq.gz + Undetermined_S0_L003_R1_001.fastq.gz + Undetermined_S0_L003_R2_001.fastq.gz + Undetermined_S0_L004_I1_001.fastq.gz + Undetermined_S0_L004_I2_001.fastq.gz + Undetermined_S0_L004_R1_001.fastq.gz + Undetermined_S0_L004_R2_001.fastq.gz +) + +mkdir -p "$OUT/fastq" +for fastq in ${tar_contents[@]}; do + seqkit_head "$OUT/unfiltered_fastq/$fastq" "$OUT/fastq/$fastq" +done +cp "$OUT/unfiltered_fastq/samplesheet.csv" "$OUT/samplesheet.csv" \ No newline at end of file diff --git a/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml index 2830489d..9522be6f 100644 --- a/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml @@ -235,9 +235,9 @@ build_info: output: "target/executable/agat/agat_convert_bed2gff" executable: "target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff b/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff index 3be2055b..9281225e 100755 --- a/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff +++ b/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff @@ -515,9 +515,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_bed2gff" -LABEL org.opencontainers.image.created="2024-11-08T09:44:57Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:47Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml index ca2ff54f..5a5b0a35 100644 --- a/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml @@ -225,9 +225,9 @@ build_info: output: "target/executable/agat/agat_convert_embl2gff" executable: "target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff b/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff index b735bbac..e6458841 100755 --- a/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff +++ b/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff @@ -505,9 +505,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_embl2gff" -LABEL org.opencontainers.image.created="2024-11-08T09:44:59Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:49Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml index 188b00dd..341102b1 100644 --- a/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml @@ -230,9 +230,9 @@ build_info: output: "target/executable/agat/agat_convert_genscan2gff" executable: "target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff b/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff index 94274d65..6442b334 100755 --- a/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff +++ b/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff @@ -514,9 +514,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_genscan2gff" -LABEL org.opencontainers.image.created="2024-11-08T09:44:59Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:50Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_mfannot2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_mfannot2gff/.config.vsh.yaml index 31fcec3f..896ec6fb 100644 --- a/target/executable/agat/agat_convert_mfannot2gff/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_mfannot2gff/.config.vsh.yaml @@ -186,9 +186,9 @@ build_info: output: "target/executable/agat/agat_convert_mfannot2gff" executable: "target/executable/agat/agat_convert_mfannot2gff/agat_convert_mfannot2gff" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_mfannot2gff/agat_convert_mfannot2gff b/target/executable/agat/agat_convert_mfannot2gff/agat_convert_mfannot2gff index 95b3cfc5..ea4de1cc 100755 --- a/target/executable/agat/agat_convert_mfannot2gff/agat_convert_mfannot2gff +++ b/target/executable/agat/agat_convert_mfannot2gff/agat_convert_mfannot2gff @@ -480,9 +480,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_mfannot2gff" -LABEL org.opencontainers.image.created="2024-11-08T09:45:10Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:02Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml b/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml index c80b7dec..636c70b7 100644 --- a/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml @@ -228,9 +228,9 @@ build_info: output: "target/executable/agat/agat_convert_sp_gff2gtf" executable: "target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf b/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf index f1b69d0a..24b543cf 100755 --- a/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf +++ b/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf @@ -519,9 +519,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2gtf" -LABEL org.opencontainers.image.created="2024-11-08T09:44:57Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:47Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml b/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml index e8dd5a9b..863c9691 100644 --- a/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml @@ -188,9 +188,9 @@ build_info: output: "target/executable/agat/agat_convert_sp_gff2tsv" executable: "target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv b/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv index 63f8fd20..bf3ae1c8 100755 --- a/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv +++ b/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv @@ -484,9 +484,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2tsv" -LABEL org.opencontainers.image.created="2024-11-08T09:44:58Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:48Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml b/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml index 9da9ae0d..517359be 100644 --- a/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml +++ b/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml @@ -195,9 +195,9 @@ build_info: output: "target/executable/agat/agat_convert_sp_gxf2gxf" executable: "target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf b/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf index 9faad85b..9c22ba7c 100755 --- a/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf +++ b/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf @@ -493,9 +493,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gxf2gxf" -LABEL org.opencontainers.image.created="2024-11-08T09:45:10Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:46Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml b/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml index f0bc9aff..e1c6570e 100644 --- a/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml +++ b/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml @@ -186,9 +186,9 @@ build_info: output: "target/executable/agat/agat_sp_add_introns" executable: "target/executable/agat/agat_sp_add_introns/agat_sp_add_introns" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns b/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns index 89117834..ad4c9053 100755 --- a/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns +++ b/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns @@ -479,9 +479,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_add_introns" -LABEL org.opencontainers.image.created="2024-11-08T09:44:57Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:48Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml b/target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml index ef36065a..4536b0f1 100644 --- a/target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml +++ b/target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml @@ -236,9 +236,9 @@ build_info: output: "target/executable/agat/agat_sp_filter_feature_from_kill_list" executable: "target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list b/target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list index 857de2dd..3642ee13 100755 --- a/target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list +++ b/target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list @@ -517,9 +517,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_filter_feature_from_kill_list" -LABEL org.opencontainers.image.created="2024-11-08T09:44:59Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:49Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml b/target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml index 6923cc12..d325b1bd 100644 --- a/target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml +++ b/target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml @@ -184,9 +184,9 @@ build_info: output: "target/executable/agat/agat_sp_merge_annotations" executable: "target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations b/target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations index 66e893c8..243fcbef 100755 --- a/target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations +++ b/target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations @@ -482,9 +482,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_merge_annotations" -LABEL org.opencontainers.image.created="2024-11-08T09:44:58Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:49Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_sp_statistics/.config.vsh.yaml b/target/executable/agat/agat_sp_statistics/.config.vsh.yaml index eaa3391a..2ff77237 100644 --- a/target/executable/agat/agat_sp_statistics/.config.vsh.yaml +++ b/target/executable/agat/agat_sp_statistics/.config.vsh.yaml @@ -231,9 +231,9 @@ build_info: output: "target/executable/agat/agat_sp_statistics" executable: "target/executable/agat/agat_sp_statistics/agat_sp_statistics" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_sp_statistics/agat_sp_statistics b/target/executable/agat/agat_sp_statistics/agat_sp_statistics index e1967c45..a41cc3e8 100755 --- a/target/executable/agat/agat_sp_statistics/agat_sp_statistics +++ b/target/executable/agat/agat_sp_statistics/agat_sp_statistics @@ -507,9 +507,9 @@ RUN agat --version | sed 's/.*v\.//; s/\s.*//' | sed 's/^/AGAT: /' > /var/softwa LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_statistics" -LABEL org.opencontainers.image.created="2024-11-08T09:44:58Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:48Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/agat/agat_sq_stat_basic/.config.vsh.yaml b/target/executable/agat/agat_sq_stat_basic/.config.vsh.yaml index 31041568..b8276cd0 100644 --- a/target/executable/agat/agat_sq_stat_basic/.config.vsh.yaml +++ b/target/executable/agat/agat_sq_stat_basic/.config.vsh.yaml @@ -227,9 +227,9 @@ build_info: output: "target/executable/agat/agat_sq_stat_basic" executable: "target/executable/agat/agat_sq_stat_basic/agat_sq_stat_basic" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/agat/agat_sq_stat_basic/agat_sq_stat_basic b/target/executable/agat/agat_sq_stat_basic/agat_sq_stat_basic index c0919478..8efd573a 100755 --- a/target/executable/agat/agat_sq_stat_basic/agat_sq_stat_basic +++ b/target/executable/agat/agat_sq_stat_basic/agat_sq_stat_basic @@ -507,9 +507,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t LABEL org.opencontainers.image.authors="Leïla Paquay" LABEL org.opencontainers.image.description="Companion container for running component agat agat_sq_stat_basic" -LABEL org.opencontainers.image.created="2024-11-08T09:45:10Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:02Z" LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/arriba/.config.vsh.yaml b/target/executable/arriba/.config.vsh.yaml index 34a72d99..f210ecd0 100644 --- a/target/executable/arriba/.config.vsh.yaml +++ b/target/executable/arriba/.config.vsh.yaml @@ -706,9 +706,9 @@ build_info: output: "target/executable/arriba" executable: "target/executable/arriba/arriba" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/arriba/arriba b/target/executable/arriba/arriba index 2f8c34fa..c80ada30 100755 --- a/target/executable/arriba/arriba +++ b/target/executable/arriba/arriba @@ -754,9 +754,9 @@ RUN arriba -h | grep 'Version:' 2>&1 | sed 's/Version:\s\(.*\)/arriba: "\1"/' > LABEL org.opencontainers.image.authors="Robrecht Cannoodt" LABEL org.opencontainers.image.description="Companion container for running component arriba" -LABEL org.opencontainers.image.created="2024-11-08T09:45:00Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:51Z" LABEL org.opencontainers.image.source="https://github.com/suhrig/arriba" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml b/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml index f88459a9..a19bd79c 100644 --- a/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml +++ b/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml @@ -368,9 +368,9 @@ build_info: output: "target/executable/bbmap/bbmap_bbsplit" executable: "target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit b/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit index c9b351a4..c19b2141 100755 --- a/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit +++ b/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit @@ -600,9 +600,9 @@ cp -r bbmap/* /usr/local/bin RUN bbsplit.sh --version 2>&1 | awk '/BBMap version/{print "BBMAP:", $NF}' > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component bbmap bbmap_bbsplit" -LABEL org.opencontainers.image.created="2024-11-08T09:45:00Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:51Z" LABEL org.opencontainers.image.source="https://github.com/BioInfoTools/BBMap/blob/master/sh/bbsplit.sh" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml b/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml index c163b7cf..0d4b08c3 100644 --- a/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml @@ -469,9 +469,9 @@ build_info: output: "target/executable/bcftools/bcftools_annotate" executable: "target/executable/bcftools/bcftools_annotate/bcftools_annotate" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_annotate/bcftools_annotate b/target/executable/bcftools/bcftools_annotate/bcftools_annotate index 7e914da0..15f7e002 100755 --- a/target/executable/bcftools/bcftools_annotate/bcftools_annotate +++ b/target/executable/bcftools/bcftools_annotate/bcftools_annotate @@ -650,9 +650,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_annotate" -LABEL org.opencontainers.image.created="2024-11-08T09:45:08Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:00Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_concat/.config.vsh.yaml b/target/executable/bcftools/bcftools_concat/.config.vsh.yaml index ae6f3aa7..c1c426ac 100644 --- a/target/executable/bcftools/bcftools_concat/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_concat/.config.vsh.yaml @@ -335,9 +335,9 @@ build_info: output: "target/executable/bcftools/bcftools_concat" executable: "target/executable/bcftools/bcftools_concat/bcftools_concat" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_concat/bcftools_concat b/target/executable/bcftools/bcftools_concat/bcftools_concat index 846beff5..8f9bb952 100755 --- a/target/executable/bcftools/bcftools_concat/bcftools_concat +++ b/target/executable/bcftools/bcftools_concat/bcftools_concat @@ -566,9 +566,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_concat" -LABEL org.opencontainers.image.created="2024-11-08T09:45:07Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:59Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_norm/.config.vsh.yaml b/target/executable/bcftools/bcftools_norm/.config.vsh.yaml index 390a386f..b9926e1b 100644 --- a/target/executable/bcftools/bcftools_norm/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_norm/.config.vsh.yaml @@ -416,9 +416,9 @@ build_info: output: "target/executable/bcftools/bcftools_norm" executable: "target/executable/bcftools/bcftools_norm/bcftools_norm" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_norm/bcftools_norm b/target/executable/bcftools/bcftools_norm/bcftools_norm index 400c92b1..8030bc62 100755 --- a/target/executable/bcftools/bcftools_norm/bcftools_norm +++ b/target/executable/bcftools/bcftools_norm/bcftools_norm @@ -589,9 +589,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_norm" -LABEL org.opencontainers.image.created="2024-11-08T09:45:08Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:00Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_sort/.config.vsh.yaml b/target/executable/bcftools/bcftools_sort/.config.vsh.yaml index fa48071d..59bf3485 100644 --- a/target/executable/bcftools/bcftools_sort/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_sort/.config.vsh.yaml @@ -185,9 +185,9 @@ build_info: output: "target/executable/bcftools/bcftools_sort" executable: "target/executable/bcftools/bcftools_sort/bcftools_sort" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_sort/bcftools_sort b/target/executable/bcftools/bcftools_sort/bcftools_sort index b9d36e0f..6aa7d290 100755 --- a/target/executable/bcftools/bcftools_sort/bcftools_sort +++ b/target/executable/bcftools/bcftools_sort/bcftools_sort @@ -483,9 +483,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_sort" -LABEL org.opencontainers.image.created="2024-11-08T09:45:07Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:59Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcftools/bcftools_stats/.config.vsh.yaml b/target/executable/bcftools/bcftools_stats/.config.vsh.yaml index 08e55d34..8b9d2747 100644 --- a/target/executable/bcftools/bcftools_stats/.config.vsh.yaml +++ b/target/executable/bcftools/bcftools_stats/.config.vsh.yaml @@ -458,9 +458,9 @@ build_info: output: "target/executable/bcftools/bcftools_stats" executable: "target/executable/bcftools/bcftools_stats/bcftools_stats" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcftools/bcftools_stats/bcftools_stats b/target/executable/bcftools/bcftools_stats/bcftools_stats index 2c1be8f8..ea7b28ed 100755 --- a/target/executable/bcftools/bcftools_stats/bcftools_stats +++ b/target/executable/bcftools/bcftools_stats/bcftools_stats @@ -626,9 +626,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_stats" -LABEL org.opencontainers.image.created="2024-11-08T09:45:08Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:59Z" LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bcl_convert/.config.vsh.yaml b/target/executable/bcl_convert/.config.vsh.yaml index a8cd1ced..5ec90f7a 100644 --- a/target/executable/bcl_convert/.config.vsh.yaml +++ b/target/executable/bcl_convert/.config.vsh.yaml @@ -418,9 +418,9 @@ build_info: output: "target/executable/bcl_convert" executable: "target/executable/bcl_convert/bcl_convert" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bcl_convert/bcl_convert b/target/executable/bcl_convert/bcl_convert index 07d35967..7b02891a 100755 --- a/target/executable/bcl_convert/bcl_convert +++ b/target/executable/bcl_convert/bcl_convert @@ -599,9 +599,9 @@ RUN echo "bcl-convert: \"$(bcl-convert -V 2>&1 >/dev/null | sed -n '/Version/ s/ LABEL org.opencontainers.image.authors="Toni Verbeiren, Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component bcl_convert" -LABEL org.opencontainers.image.created="2024-11-08T09:45:06Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:57Z" LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml index 488bbca3..4d6d27fd 100644 --- a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml +++ b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml @@ -274,9 +274,9 @@ build_info: output: "target/executable/bd_rhapsody/bd_rhapsody_make_reference" executable: "target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference index 1560c922..f9c6dce3 100755 --- a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference +++ b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference @@ -554,9 +554,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1) RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz" LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_make_reference" -LABEL org.opencontainers.image.created="2024-11-08T09:45:09Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:01Z" LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1/Extra_Utilities/" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml index 49c9d667..f068cf99 100644 --- a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml +++ b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml @@ -1115,9 +1115,9 @@ build_info: output: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis" executable: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis index 99cbff52..4dfc22b1 100755 --- a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis +++ b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis @@ -954,9 +954,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1) RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz" LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_sequence_analysis" -LABEL org.opencontainers.image.created="2024-11-08T09:45:09Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:01Z" LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml b/target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml index f0b561d6..c74ee645 100644 --- a/target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml @@ -235,9 +235,9 @@ build_info: output: "target/executable/bedtools/bedtools_bamtobed" executable: "target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed b/target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed index 47f08d24..623c9a0d 100755 --- a/target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed +++ b/target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed @@ -522,9 +522,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bamtobed" -LABEL org.opencontainers.image.created="2024-11-08T09:45:06Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:58Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml b/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml index 5903fca6..7d15aeff 100644 --- a/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml @@ -187,9 +187,9 @@ build_info: output: "target/executable/bedtools/bedtools_bamtofastq" executable: "target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq b/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq index b63e1cab..251b099c 100755 --- a/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq +++ b/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq @@ -483,9 +483,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bamtofastq" -LABEL org.opencontainers.image.created="2024-11-08T09:45:07Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:59Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml b/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml index 4b797aff..8507ba88 100644 --- a/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml @@ -176,9 +176,9 @@ build_info: output: "target/executable/bedtools/bedtools_bed12tobed6" executable: "target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6 b/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6 index 4b0aef70..8c7783eb 100755 --- a/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6 +++ b/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6 @@ -480,9 +480,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bed12tobed6" -LABEL org.opencontainers.image.created="2024-11-08T09:45:08Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:00Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml b/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml index 9ee595dd..19cbe098 100644 --- a/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml @@ -214,9 +214,9 @@ build_info: output: "target/executable/bedtools/bedtools_bedtobam" executable: "target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam b/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam index b250a830..3986eded 100755 --- a/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam +++ b/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam @@ -496,9 +496,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bedtobam" -LABEL org.opencontainers.image.created="2024-11-08T09:45:09Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:01Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml b/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml index dc635c2f..99a3ef2b 100644 --- a/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml @@ -337,9 +337,9 @@ build_info: output: "target/executable/bedtools/bedtools_genomecov" executable: "target/executable/bedtools/bedtools_genomecov/bedtools_genomecov" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov b/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov index ea180175..9a52272b 100755 --- a/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov +++ b/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov @@ -591,9 +591,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_genomecov" -LABEL org.opencontainers.image.created="2024-11-08T09:45:09Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:01Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml b/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml index 245c6ac7..c844a611 100644 --- a/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml @@ -232,9 +232,9 @@ build_info: output: "target/executable/bedtools/bedtools_getfasta" executable: "target/executable/bedtools/bedtools_getfasta/bedtools_getfasta" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta b/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta index 599e1654..3753ddce 100755 --- a/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta +++ b/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta @@ -526,9 +526,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Dries Schaumont" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_getfasta" -LABEL org.opencontainers.image.created="2024-11-08T09:45:07Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:59Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml b/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml index 071a8982..b10207f5 100644 --- a/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml @@ -273,9 +273,9 @@ build_info: output: "target/executable/bedtools/bedtools_groupby" executable: "target/executable/bedtools/bedtools_groupby/bedtools_groupby" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_groupby/bedtools_groupby b/target/executable/bedtools/bedtools_groupby/bedtools_groupby index 3f8d6410..adb1ab63 100755 --- a/target/executable/bedtools/bedtools_groupby/bedtools_groupby +++ b/target/executable/bedtools/bedtools_groupby/bedtools_groupby @@ -552,9 +552,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_groupby" -LABEL org.opencontainers.image.created="2024-11-08T09:45:06Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:58Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml b/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml index 4f84d910..88027b5e 100644 --- a/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml @@ -410,9 +410,9 @@ build_info: output: "target/executable/bedtools/bedtools_intersect" executable: "target/executable/bedtools/bedtools_intersect/bedtools_intersect" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_intersect/bedtools_intersect b/target/executable/bedtools/bedtools_intersect/bedtools_intersect index 2d963f66..e7e01cd3 100755 --- a/target/executable/bedtools/bedtools_intersect/bedtools_intersect +++ b/target/executable/bedtools/bedtools_intersect/bedtools_intersect @@ -633,9 +633,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_intersect" -LABEL org.opencontainers.image.created="2024-11-08T09:45:08Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:59Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_links/.config.vsh.yaml b/target/executable/bedtools/bedtools_links/.config.vsh.yaml index e414e43d..0becd9a5 100644 --- a/target/executable/bedtools/bedtools_links/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_links/.config.vsh.yaml @@ -210,9 +210,9 @@ build_info: output: "target/executable/bedtools/bedtools_links" executable: "target/executable/bedtools/bedtools_links/bedtools_links" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_links/bedtools_links b/target/executable/bedtools/bedtools_links/bedtools_links index 70db38c3..0b57db62 100755 --- a/target/executable/bedtools/bedtools_links/bedtools_links +++ b/target/executable/bedtools/bedtools_links/bedtools_links @@ -500,9 +500,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_links" -LABEL org.opencontainers.image.created="2024-11-08T09:45:08Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:00Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_merge/.config.vsh.yaml b/target/executable/bedtools/bedtools_merge/.config.vsh.yaml index 96618b23..07894909 100644 --- a/target/executable/bedtools/bedtools_merge/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_merge/.config.vsh.yaml @@ -279,9 +279,9 @@ build_info: output: "target/executable/bedtools/bedtools_merge" executable: "target/executable/bedtools/bedtools_merge/bedtools_merge" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_merge/bedtools_merge b/target/executable/bedtools/bedtools_merge/bedtools_merge index 62037c7a..82c61b24 100755 --- a/target/executable/bedtools/bedtools_merge/bedtools_merge +++ b/target/executable/bedtools/bedtools_merge/bedtools_merge @@ -558,9 +558,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_merge" -LABEL org.opencontainers.image.created="2024-11-08T09:45:09Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:01Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/bedtools/bedtools_sort/.config.vsh.yaml b/target/executable/bedtools/bedtools_sort/.config.vsh.yaml index c8a1107a..770d63b5 100644 --- a/target/executable/bedtools/bedtools_sort/.config.vsh.yaml +++ b/target/executable/bedtools/bedtools_sort/.config.vsh.yaml @@ -222,9 +222,9 @@ build_info: output: "target/executable/bedtools/bedtools_sort" executable: "target/executable/bedtools/bedtools_sort/bedtools_sort" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/bedtools/bedtools_sort/bedtools_sort b/target/executable/bedtools/bedtools_sort/bedtools_sort index 9a67d328..41569ebd 100755 --- a/target/executable/bedtools/bedtools_sort/bedtools_sort +++ b/target/executable/bedtools/bedtools_sort/bedtools_sort @@ -509,9 +509,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_sort" -LABEL org.opencontainers.image.created="2024-11-08T09:45:07Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:59Z" LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/busco/busco_download_datasets/.config.vsh.yaml b/target/executable/busco/busco_download_datasets/.config.vsh.yaml index 9d5247c9..d868ffc6 100644 --- a/target/executable/busco/busco_download_datasets/.config.vsh.yaml +++ b/target/executable/busco/busco_download_datasets/.config.vsh.yaml @@ -158,9 +158,9 @@ build_info: output: "target/executable/busco/busco_download_datasets" executable: "target/executable/busco/busco_download_datasets/busco_download_datasets" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/busco/busco_download_datasets/busco_download_datasets b/target/executable/busco/busco_download_datasets/busco_download_datasets index 94cdca6c..b3fef5de 100755 --- a/target/executable/busco/busco_download_datasets/busco_download_datasets +++ b/target/executable/busco/busco_download_datasets/busco_download_datasets @@ -475,9 +475,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component busco busco_download_datasets" -LABEL org.opencontainers.image.created="2024-11-08T09:45:06Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:57Z" LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/busco/busco_list_datasets/.config.vsh.yaml b/target/executable/busco/busco_list_datasets/.config.vsh.yaml index eccecc36..91415474 100644 --- a/target/executable/busco/busco_list_datasets/.config.vsh.yaml +++ b/target/executable/busco/busco_list_datasets/.config.vsh.yaml @@ -145,9 +145,9 @@ build_info: output: "target/executable/busco/busco_list_datasets" executable: "target/executable/busco/busco_list_datasets/busco_list_datasets" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/busco/busco_list_datasets/busco_list_datasets b/target/executable/busco/busco_list_datasets/busco_list_datasets index f1994d7d..dfdec867 100755 --- a/target/executable/busco/busco_list_datasets/busco_list_datasets +++ b/target/executable/busco/busco_list_datasets/busco_list_datasets @@ -465,9 +465,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component busco busco_list_datasets" -LABEL org.opencontainers.image.created="2024-11-08T09:45:05Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:57Z" LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/busco/busco_run/.config.vsh.yaml b/target/executable/busco/busco_run/.config.vsh.yaml index 3d4de398..1975e295 100644 --- a/target/executable/busco/busco_run/.config.vsh.yaml +++ b/target/executable/busco/busco_run/.config.vsh.yaml @@ -423,9 +423,9 @@ build_info: output: "target/executable/busco/busco_run" executable: "target/executable/busco/busco_run/busco_run" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/busco/busco_run/busco_run b/target/executable/busco/busco_run/busco_run index cebb2d1a..61d535c1 100755 --- a/target/executable/busco/busco_run/busco_run +++ b/target/executable/busco/busco_run/busco_run @@ -632,9 +632,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component busco busco_run" -LABEL org.opencontainers.image.created="2024-11-08T09:45:05Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:57Z" LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/cellranger/cellranger_mkref/.config.vsh.yaml b/target/executable/cellranger/cellranger_mkref/.config.vsh.yaml index f18a5b68..d5921dc4 100644 --- a/target/executable/cellranger/cellranger_mkref/.config.vsh.yaml +++ b/target/executable/cellranger/cellranger_mkref/.config.vsh.yaml @@ -195,9 +195,9 @@ build_info: output: "target/executable/cellranger/cellranger_mkref" executable: "target/executable/cellranger/cellranger_mkref/cellranger_mkref" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/cellranger/cellranger_mkref/cellranger_mkref b/target/executable/cellranger/cellranger_mkref/cellranger_mkref index 6cc08e12..7931e08d 100755 --- a/target/executable/cellranger/cellranger_mkref/cellranger_mkref +++ b/target/executable/cellranger/cellranger_mkref/cellranger_mkref @@ -481,9 +481,9 @@ RUN apt-get update && \ LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component cellranger cellranger_mkref" -LABEL org.opencontainers.image.created="2024-11-08T09:45:06Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:57Z" LABEL org.opencontainers.image.source="https://github.com/10XGenomics/cellranger/blob/main/lib/python/cellranger/reference_builder.py" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/cutadapt/.config.vsh.yaml b/target/executable/cutadapt/.config.vsh.yaml index 365ed0a7..ca6f8a74 100644 --- a/target/executable/cutadapt/.config.vsh.yaml +++ b/target/executable/cutadapt/.config.vsh.yaml @@ -740,9 +740,9 @@ build_info: output: "target/executable/cutadapt" executable: "target/executable/cutadapt/cutadapt" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/cutadapt/cutadapt b/target/executable/cutadapt/cutadapt index ab1fd58b..4479be1c 100755 --- a/target/executable/cutadapt/cutadapt +++ b/target/executable/cutadapt/cutadapt @@ -831,9 +831,9 @@ RUN cutadapt --version | sed 's/\(.*\)/cutadapt: "\1"/' > /var/software_versions LABEL org.opencontainers.image.authors="Toni Verbeiren" LABEL org.opencontainers.image.description="Companion container for running component cutadapt" -LABEL org.opencontainers.image.created="2024-11-08T09:45:01Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:52Z" LABEL org.opencontainers.image.source="https://github.com/marcelm/cutadapt" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/falco/.config.vsh.yaml b/target/executable/falco/.config.vsh.yaml index 1b455604..4e51e478 100644 --- a/target/executable/falco/.config.vsh.yaml +++ b/target/executable/falco/.config.vsh.yaml @@ -317,9 +317,9 @@ build_info: output: "target/executable/falco" executable: "target/executable/falco/falco" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/falco/falco b/target/executable/falco/falco index da557a40..d70d4422 100755 --- a/target/executable/falco/falco +++ b/target/executable/falco/falco @@ -589,9 +589,9 @@ RUN echo "falco: \"$(falco -v | sed -n 's/^falco //p')\"" > /var/software_versio LABEL org.opencontainers.image.authors="Toni Verbeiren" LABEL org.opencontainers.image.description="Companion container for running component falco" -LABEL org.opencontainers.image.created="2024-11-08T09:44:58Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:48Z" LABEL org.opencontainers.image.source="https://github.com/smithlabcode/falco" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/fastp/.config.vsh.yaml b/target/executable/fastp/.config.vsh.yaml index 0514b05a..f4fff564 100644 --- a/target/executable/fastp/.config.vsh.yaml +++ b/target/executable/fastp/.config.vsh.yaml @@ -1083,9 +1083,9 @@ build_info: output: "target/executable/fastp" executable: "target/executable/fastp/fastp" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/fastp/fastp b/target/executable/fastp/fastp index c21d7565..fa461ae5 100755 --- a/target/executable/fastp/fastp +++ b/target/executable/fastp/fastp @@ -1028,9 +1028,9 @@ RUN fastp --version 2>&1 | sed 's# #: "#;s#$#"#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Robrecht Cannoodt" LABEL org.opencontainers.image.description="Companion container for running component fastp" -LABEL org.opencontainers.image.created="2024-11-08T09:45:10Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:02Z" LABEL org.opencontainers.image.source="https://github.com/OpenGene/fastp" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/fastqc/.config.vsh.yaml b/target/executable/fastqc/.config.vsh.yaml index 4a8819fc..fb08791d 100644 --- a/target/executable/fastqc/.config.vsh.yaml +++ b/target/executable/fastqc/.config.vsh.yaml @@ -340,9 +340,9 @@ build_info: output: "target/executable/fastqc" executable: "target/executable/fastqc/fastqc" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/fastqc/fastqc b/target/executable/fastqc/fastqc index 7692a571..4737446e 100755 --- a/target/executable/fastqc/fastqc +++ b/target/executable/fastqc/fastqc @@ -601,9 +601,9 @@ RUN echo "fastqc: $(fastqc --version | sed -n 's/^FastQC //p')" > /var/software_ LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component fastqc" -LABEL org.opencontainers.image.created="2024-11-08T09:45:11Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:03Z" LABEL org.opencontainers.image.source="https://github.com/s-andrews/FastQC" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/featurecounts/.config.vsh.yaml b/target/executable/featurecounts/.config.vsh.yaml index ff03fc45..ff096fb3 100644 --- a/target/executable/featurecounts/.config.vsh.yaml +++ b/target/executable/featurecounts/.config.vsh.yaml @@ -645,9 +645,9 @@ build_info: output: "target/executable/featurecounts" executable: "target/executable/featurecounts/featurecounts" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/featurecounts/featurecounts b/target/executable/featurecounts/featurecounts index 0c6b5ad1..720cb129 100755 --- a/target/executable/featurecounts/featurecounts +++ b/target/executable/featurecounts/featurecounts @@ -754,9 +754,9 @@ RUN featureCounts -v 2>&1 | sed 's/featureCounts v\([0-9.]*\)/featureCounts: \1/ LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component featurecounts" -LABEL org.opencontainers.image.created="2024-11-08T09:44:56Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:46Z" LABEL org.opencontainers.image.source="https://github.com/ShiLab-Bioinformatics/subread" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/fq_subsample/.config.vsh.yaml b/target/executable/fq_subsample/.config.vsh.yaml index 0e063bbd..d3804bcd 100644 --- a/target/executable/fq_subsample/.config.vsh.yaml +++ b/target/executable/fq_subsample/.config.vsh.yaml @@ -190,9 +190,9 @@ build_info: output: "target/executable/fq_subsample" executable: "target/executable/fq_subsample/fq_subsample" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/fq_subsample/fq_subsample b/target/executable/fq_subsample/fq_subsample index 1e772c7d..822e16e7 100755 --- a/target/executable/fq_subsample/fq_subsample +++ b/target/executable/fq_subsample/fq_subsample @@ -493,9 +493,9 @@ mv target/release/fq /usr/local/bin/ && \ cd / && rm -rf /fq LABEL org.opencontainers.image.description="Companion container for running component fq_subsample" -LABEL org.opencontainers.image.created="2024-11-08T09:45:04Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:55Z" LABEL org.opencontainers.image.source="https://github.com/stjude-rust-labs/fq" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/gffread/.config.vsh.yaml b/target/executable/gffread/.config.vsh.yaml index 2befecb9..c4d7befa 100644 --- a/target/executable/gffread/.config.vsh.yaml +++ b/target/executable/gffread/.config.vsh.yaml @@ -685,9 +685,9 @@ build_info: output: "target/executable/gffread" executable: "target/executable/gffread/gffread" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/gffread/gffread b/target/executable/gffread/gffread index 2e5cb686..b61727fc 100755 --- a/target/executable/gffread/gffread +++ b/target/executable/gffread/gffread @@ -807,9 +807,9 @@ RUN echo "gffread: \"$(gffread --version 2>&1)\"" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component gffread" -LABEL org.opencontainers.image.created="2024-11-08T09:44:59Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:50Z" LABEL org.opencontainers.image.source="https://github.com/gpertea/gffread" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/kallisto/kallisto_index/.config.vsh.yaml b/target/executable/kallisto/kallisto_index/.config.vsh.yaml index 76c13e3b..678a3f8f 100644 --- a/target/executable/kallisto/kallisto_index/.config.vsh.yaml +++ b/target/executable/kallisto/kallisto_index/.config.vsh.yaml @@ -218,9 +218,9 @@ build_info: output: "target/executable/kallisto/kallisto_index" executable: "target/executable/kallisto/kallisto_index/kallisto_index" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/kallisto/kallisto_index/kallisto_index b/target/executable/kallisto/kallisto_index/kallisto_index index bfb8dfed..49525a36 100755 --- a/target/executable/kallisto/kallisto_index/kallisto_index +++ b/target/executable/kallisto/kallisto_index/kallisto_index @@ -506,9 +506,9 @@ tar -xzf kallisto_linux-v0.50.1.tar.gz && \ mv kallisto/kallisto /usr/local/bin/ LABEL org.opencontainers.image.description="Companion container for running component kallisto kallisto_index" -LABEL org.opencontainers.image.created="2024-11-08T09:44:59Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:49Z" LABEL org.opencontainers.image.source="https://github.com/pachterlab/kallisto" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/kallisto/kallisto_quant/.config.vsh.yaml b/target/executable/kallisto/kallisto_quant/.config.vsh.yaml index 966a1006..e63b31de 100644 --- a/target/executable/kallisto/kallisto_quant/.config.vsh.yaml +++ b/target/executable/kallisto/kallisto_quant/.config.vsh.yaml @@ -246,9 +246,9 @@ build_info: output: "target/executable/kallisto/kallisto_quant" executable: "target/executable/kallisto/kallisto_quant/kallisto_quant" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/kallisto/kallisto_quant/kallisto_quant b/target/executable/kallisto/kallisto_quant/kallisto_quant index b8c57fd3..066a3695 100755 --- a/target/executable/kallisto/kallisto_quant/kallisto_quant +++ b/target/executable/kallisto/kallisto_quant/kallisto_quant @@ -522,9 +522,9 @@ mv kallisto/kallisto /usr/local/bin/ RUN echo "kallisto: $(kallisto version | sed 's/kallisto, version //')" > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component kallisto kallisto_quant" -LABEL org.opencontainers.image.created="2024-11-08T09:44:59Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:49Z" LABEL org.opencontainers.image.source="https://github.com/pachterlab/kallisto" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/lofreq/lofreq_call/.config.vsh.yaml b/target/executable/lofreq/lofreq_call/.config.vsh.yaml index cd727bc1..be575369 100644 --- a/target/executable/lofreq/lofreq_call/.config.vsh.yaml +++ b/target/executable/lofreq/lofreq_call/.config.vsh.yaml @@ -507,9 +507,9 @@ build_info: output: "target/executable/lofreq/lofreq_call" executable: "target/executable/lofreq/lofreq_call/lofreq_call" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/lofreq/lofreq_call/lofreq_call b/target/executable/lofreq/lofreq_call/lofreq_call index b5dd1422..c0009ea1 100755 --- a/target/executable/lofreq/lofreq_call/lofreq_call +++ b/target/executable/lofreq/lofreq_call/lofreq_call @@ -656,9 +656,9 @@ echo "lofreq: $version" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Kai Waldrant" LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_call" -LABEL org.opencontainers.image.created="2024-11-08T09:45:10Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:02Z" LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml b/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml index 124e7994..4ac94d52 100644 --- a/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml +++ b/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml @@ -215,9 +215,9 @@ build_info: output: "target/executable/lofreq/lofreq_indelqual" executable: "target/executable/lofreq/lofreq_indelqual/lofreq_indelqual" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual b/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual index f5be0c3d..b37f38fb 100755 --- a/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual +++ b/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual @@ -501,9 +501,9 @@ echo "lofreq: $version" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Kai Waldrant" LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_indelqual" -LABEL org.opencontainers.image.created="2024-11-08T09:45:11Z" +LABEL org.opencontainers.image.created="2024-11-14T13:17:03Z" LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/multiqc/.config.vsh.yaml b/target/executable/multiqc/.config.vsh.yaml index 35efd0a2..87de14cc 100644 --- a/target/executable/multiqc/.config.vsh.yaml +++ b/target/executable/multiqc/.config.vsh.yaml @@ -456,9 +456,9 @@ build_info: output: "target/executable/multiqc" executable: "target/executable/multiqc/multiqc" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/multiqc/multiqc b/target/executable/multiqc/multiqc index d2fbe0ee..05c03cd7 100755 --- a/target/executable/multiqc/multiqc +++ b/target/executable/multiqc/multiqc @@ -637,9 +637,9 @@ RUN multiqc --version | sed 's/multiqc, version\s\(.*\)/multiqc: "\1"/' > /var/s LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component multiqc" -LABEL org.opencontainers.image.created="2024-11-08T09:45:01Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:52Z" LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/nanoplot/.config.vsh.yaml b/target/executable/nanoplot/.config.vsh.yaml index 494d23b2..6609f481 100644 --- a/target/executable/nanoplot/.config.vsh.yaml +++ b/target/executable/nanoplot/.config.vsh.yaml @@ -492,9 +492,9 @@ build_info: output: "target/executable/nanoplot" executable: "target/executable/nanoplot/nanoplot" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/nanoplot/nanoplot b/target/executable/nanoplot/nanoplot index 3b2f52df..476100e4 100755 --- a/target/executable/nanoplot/nanoplot +++ b/target/executable/nanoplot/nanoplot @@ -661,9 +661,9 @@ RUN version=$(NanoPlot --version) && \ echo "$version" > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component nanoplot" -LABEL org.opencontainers.image.created="2024-11-08T09:45:01Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:52Z" LABEL org.opencontainers.image.source="https://github.com/wdecoster/NanoPlot" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/pear/.config.vsh.yaml b/target/executable/pear/.config.vsh.yaml index ffd86918..30bbcb99 100644 --- a/target/executable/pear/.config.vsh.yaml +++ b/target/executable/pear/.config.vsh.yaml @@ -398,9 +398,9 @@ build_info: output: "target/executable/pear" executable: "target/executable/pear/pear" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/pear/pear b/target/executable/pear/pear index 0a71f519..013f6436 100755 --- a/target/executable/pear/pear +++ b/target/executable/pear/pear @@ -597,9 +597,9 @@ echo "pear: $version" > /var/software_versions.txt LABEL org.opencontainers.image.authors="Kai Waldrant" LABEL org.opencontainers.image.description="Companion container for running component pear" -LABEL org.opencontainers.image.created="2024-11-08T09:45:05Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:56Z" LABEL org.opencontainers.image.source="https://github.com/tseemann/PEAR" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml b/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml index 94502883..b608204b 100644 --- a/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml +++ b/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml @@ -264,9 +264,9 @@ build_info: output: "target/executable/qualimap/qualimap_rnaseq" executable: "target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq b/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq index e5df37b2..f3362e8e 100755 --- a/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq +++ b/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq @@ -527,9 +527,9 @@ RUN echo QualiMap: $(qualimap 2>&1 | grep QualiMap | sed 's/^.*QualiMap//') > /v LABEL org.opencontainers.image.authors="Dorien Roosen" LABEL org.opencontainers.image.description="Companion container for running component qualimap qualimap_rnaseq" -LABEL org.opencontainers.image.created="2024-11-08T09:44:58Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:49Z" LABEL org.opencontainers.image.source="https://bitbucket.org/kokonech/qualimap/commits/branch/master" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml b/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml index a2e0d307..31b16eaf 100644 --- a/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml +++ b/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml @@ -852,9 +852,9 @@ build_info: output: "target/executable/rsem/rsem_calculate_expression" executable: "target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression b/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression index 91203d34..1703bc3b 100755 --- a/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression +++ b/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression @@ -991,9 +991,9 @@ echo "bowtie: `bowtie --version | grep -oP 'bowtie-align-s version \K\d+\.\d+\.\ echo "HISAT2: `hisat2 --version | grep -oP 'hisat2-align-s version \K\d+\.\d+\.\d+'`" >> /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component rsem rsem_calculate_expression" -LABEL org.opencontainers.image.created="2024-11-08T09:44:57Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:47Z" LABEL org.opencontainers.image.source="https://github.com/deweylab/RSEM" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml b/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml index 9d7e12a5..cd55bfbb 100644 --- a/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml +++ b/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml @@ -416,9 +416,9 @@ build_info: output: "target/executable/rsem/rsem_prepare_reference" executable: "target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference b/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference index f4c16f0d..57c0698a 100755 --- a/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference +++ b/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference @@ -656,9 +656,9 @@ echo "HISAT2: `hisat2 --version | grep -oP 'hisat2-align-s version \K\d+\.\d+\.\ LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component rsem rsem_prepare_reference" -LABEL org.opencontainers.image.created="2024-11-08T09:44:58Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:48Z" LABEL org.opencontainers.image.source="https://github.com/deweylab/RSEM" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/rseqc/rseqc_bamstat/.config.vsh.yaml b/target/executable/rseqc/rseqc_bamstat/.config.vsh.yaml index 8f896e04..6d316e47 100644 --- a/target/executable/rseqc/rseqc_bamstat/.config.vsh.yaml +++ b/target/executable/rseqc/rseqc_bamstat/.config.vsh.yaml @@ -175,9 +175,9 @@ build_info: output: "target/executable/rseqc/rseqc_bamstat" executable: "target/executable/rseqc/rseqc_bamstat/rseqc_bamstat" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/rseqc/rseqc_bamstat/rseqc_bamstat b/target/executable/rseqc/rseqc_bamstat/rseqc_bamstat index f7656099..bc41e92e 100755 --- a/target/executable/rseqc/rseqc_bamstat/rseqc_bamstat +++ b/target/executable/rseqc/rseqc_bamstat/rseqc_bamstat @@ -477,9 +477,9 @@ RUN echo "RSeQC bam_stat.py: $(bam_stat.py --version | cut -d' ' -f2-)" > /var/s LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component rseqc rseqc_bamstat" -LABEL org.opencontainers.image.created="2024-11-08T09:45:04Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:55Z" LABEL org.opencontainers.image.source="https://github.com/MonashBioinformaticsPlatform/RSeQC" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/rseqc/rseqc_inferexperiment/.config.vsh.yaml b/target/executable/rseqc/rseqc_inferexperiment/.config.vsh.yaml index 5dbac33a..a5338a0a 100644 --- a/target/executable/rseqc/rseqc_inferexperiment/.config.vsh.yaml +++ b/target/executable/rseqc/rseqc_inferexperiment/.config.vsh.yaml @@ -201,9 +201,9 @@ build_info: output: "target/executable/rseqc/rseqc_inferexperiment" executable: "target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment b/target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment index ee773401..459e73bf 100755 --- a/target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment +++ b/target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment @@ -488,9 +488,9 @@ RUN echo "RSeQC - infer_experiment.py: $(infer_experiment.py --version | cut -d' LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component rseqc rseqc_inferexperiment" -LABEL org.opencontainers.image.created="2024-11-08T09:45:04Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:55Z" LABEL org.opencontainers.image.source="https://github.com/MonashBioinformaticsPlatform/RSeQC" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/rseqc/rseqc_inner_distance/.config.vsh.yaml b/target/executable/rseqc/rseqc_inner_distance/.config.vsh.yaml index 5f2d1d12..e70d9ffa 100644 --- a/target/executable/rseqc/rseqc_inner_distance/.config.vsh.yaml +++ b/target/executable/rseqc/rseqc_inner_distance/.config.vsh.yaml @@ -294,9 +294,9 @@ build_info: output: "target/executable/rseqc/rseqc_inner_distance" executable: "target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance b/target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance index 997bd512..d4e273eb 100755 --- a/target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance +++ b/target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance @@ -532,9 +532,9 @@ RUN echo "RSeQC - inner_distance.py: $(inner_distance.py --version | cut -d' ' - LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component rseqc rseqc_inner_distance" -LABEL org.opencontainers.image.created="2024-11-08T09:45:03Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:55Z" LABEL org.opencontainers.image.source="https://github.com/MonashBioinformaticsPlatform/RSeQC" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/salmon/salmon_index/.config.vsh.yaml b/target/executable/salmon/salmon_index/.config.vsh.yaml index 03bdc812..67f07e05 100644 --- a/target/executable/salmon/salmon_index/.config.vsh.yaml +++ b/target/executable/salmon/salmon_index/.config.vsh.yaml @@ -277,9 +277,9 @@ build_info: output: "target/executable/salmon/salmon_index" executable: "target/executable/salmon/salmon_index/salmon_index" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/salmon/salmon_index/salmon_index b/target/executable/salmon/salmon_index/salmon_index index d5baac2b..a6abfa6c 100755 --- a/target/executable/salmon/salmon_index/salmon_index +++ b/target/executable/salmon/salmon_index/salmon_index @@ -546,9 +546,9 @@ RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/softwar LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_index" -LABEL org.opencontainers.image.created="2024-11-08T09:45:07Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:58Z" LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/salmon/salmon_quant/.config.vsh.yaml b/target/executable/salmon/salmon_quant/.config.vsh.yaml index b73daff2..daaf6560 100644 --- a/target/executable/salmon/salmon_quant/.config.vsh.yaml +++ b/target/executable/salmon/salmon_quant/.config.vsh.yaml @@ -1173,9 +1173,9 @@ build_info: output: "target/executable/salmon/salmon_quant" executable: "target/executable/salmon/salmon_quant/salmon_quant" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/salmon/salmon_quant/salmon_quant b/target/executable/salmon/salmon_quant/salmon_quant index fd1fe3f0..19c4d810 100755 --- a/target/executable/salmon/salmon_quant/salmon_quant +++ b/target/executable/salmon/salmon_quant/salmon_quant @@ -1168,9 +1168,9 @@ RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/softwar LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_quant" -LABEL org.opencontainers.image.created="2024-11-08T09:45:06Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:58Z" LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_collate/.config.vsh.yaml b/target/executable/samtools/samtools_collate/.config.vsh.yaml index 2198dbf0..a3a34388 100644 --- a/target/executable/samtools/samtools_collate/.config.vsh.yaml +++ b/target/executable/samtools/samtools_collate/.config.vsh.yaml @@ -264,9 +264,9 @@ build_info: output: "target/executable/samtools/samtools_collate" executable: "target/executable/samtools/samtools_collate/samtools_collate" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_collate/samtools_collate b/target/executable/samtools/samtools_collate/samtools_collate index 2532ff27..1e8a3ca8 100755 --- a/target/executable/samtools/samtools_collate/samtools_collate +++ b/target/executable/samtools/samtools_collate/samtools_collate @@ -519,9 +519,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_collate" -LABEL org.opencontainers.image.created="2024-11-08T09:45:04Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:55Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_faidx/.config.vsh.yaml b/target/executable/samtools/samtools_faidx/.config.vsh.yaml index 163d4111..918bb2d2 100644 --- a/target/executable/samtools/samtools_faidx/.config.vsh.yaml +++ b/target/executable/samtools/samtools_faidx/.config.vsh.yaml @@ -243,9 +243,9 @@ build_info: output: "target/executable/samtools/samtools_faidx" executable: "target/executable/samtools/samtools_faidx/samtools_faidx" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_faidx/samtools_faidx b/target/executable/samtools/samtools_faidx/samtools_faidx index 081d6272..761a1634 100755 --- a/target/executable/samtools/samtools_faidx/samtools_faidx +++ b/target/executable/samtools/samtools_faidx/samtools_faidx @@ -512,9 +512,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_faidx" -LABEL org.opencontainers.image.created="2024-11-08T09:45:05Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:56Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_fasta/.config.vsh.yaml b/target/executable/samtools/samtools_fasta/.config.vsh.yaml index 20e6eaec..9748ae7e 100644 --- a/target/executable/samtools/samtools_fasta/.config.vsh.yaml +++ b/target/executable/samtools/samtools_fasta/.config.vsh.yaml @@ -433,9 +433,9 @@ build_info: output: "target/executable/samtools/samtools_fasta" executable: "target/executable/samtools/samtools_fasta/samtools_fasta" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_fasta/samtools_fasta b/target/executable/samtools/samtools_fasta/samtools_fasta index 89267b0f..96291ade 100755 --- a/target/executable/samtools/samtools_fasta/samtools_fasta +++ b/target/executable/samtools/samtools_fasta/samtools_fasta @@ -625,9 +625,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_fasta" -LABEL org.opencontainers.image.created="2024-11-08T09:45:05Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:57Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_fastq/.config.vsh.yaml b/target/executable/samtools/samtools_fastq/.config.vsh.yaml index 0726c3de..142732be 100644 --- a/target/executable/samtools/samtools_fastq/.config.vsh.yaml +++ b/target/executable/samtools/samtools_fastq/.config.vsh.yaml @@ -433,9 +433,9 @@ build_info: output: "target/executable/samtools/samtools_fastq" executable: "target/executable/samtools/samtools_fastq/samtools_fastq" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_fastq/samtools_fastq b/target/executable/samtools/samtools_fastq/samtools_fastq index 2b2f3617..694c2697 100755 --- a/target/executable/samtools/samtools_fastq/samtools_fastq +++ b/target/executable/samtools/samtools_fastq/samtools_fastq @@ -626,9 +626,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_fastq" -LABEL org.opencontainers.image.created="2024-11-08T09:45:03Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:54Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_flagstat/.config.vsh.yaml b/target/executable/samtools/samtools_flagstat/.config.vsh.yaml index 23682352..32c43087 100644 --- a/target/executable/samtools/samtools_flagstat/.config.vsh.yaml +++ b/target/executable/samtools/samtools_flagstat/.config.vsh.yaml @@ -173,9 +173,9 @@ build_info: output: "target/executable/samtools/samtools_flagstat" executable: "target/executable/samtools/samtools_flagstat/samtools_flagstat" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_flagstat/samtools_flagstat b/target/executable/samtools/samtools_flagstat/samtools_flagstat index 60ab1d88..dd1b6974 100755 --- a/target/executable/samtools/samtools_flagstat/samtools_flagstat +++ b/target/executable/samtools/samtools_flagstat/samtools_flagstat @@ -474,9 +474,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_flagstat" -LABEL org.opencontainers.image.created="2024-11-08T09:45:03Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:55Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_idxstats/.config.vsh.yaml b/target/executable/samtools/samtools_idxstats/.config.vsh.yaml index d8271086..f8094ac7 100644 --- a/target/executable/samtools/samtools_idxstats/.config.vsh.yaml +++ b/target/executable/samtools/samtools_idxstats/.config.vsh.yaml @@ -183,9 +183,9 @@ build_info: output: "target/executable/samtools/samtools_idxstats" executable: "target/executable/samtools/samtools_idxstats/samtools_idxstats" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_idxstats/samtools_idxstats b/target/executable/samtools/samtools_idxstats/samtools_idxstats index 21ce37bd..dfb5dc3e 100755 --- a/target/executable/samtools/samtools_idxstats/samtools_idxstats +++ b/target/executable/samtools/samtools_idxstats/samtools_idxstats @@ -478,9 +478,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_idxstats" -LABEL org.opencontainers.image.created="2024-11-08T09:45:06Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:57Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_index/.config.vsh.yaml b/target/executable/samtools/samtools_index/.config.vsh.yaml index a062eb50..62fd63d8 100644 --- a/target/executable/samtools/samtools_index/.config.vsh.yaml +++ b/target/executable/samtools/samtools_index/.config.vsh.yaml @@ -189,9 +189,9 @@ build_info: output: "target/executable/samtools/samtools_index" executable: "target/executable/samtools/samtools_index/samtools_index" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_index/samtools_index b/target/executable/samtools/samtools_index/samtools_index index eb21b3e2..181458f2 100755 --- a/target/executable/samtools/samtools_index/samtools_index +++ b/target/executable/samtools/samtools_index/samtools_index @@ -485,9 +485,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_index" -LABEL org.opencontainers.image.created="2024-11-08T09:45:04Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:55Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_sort/.config.vsh.yaml b/target/executable/samtools/samtools_sort/.config.vsh.yaml index c5493261..a907962b 100644 --- a/target/executable/samtools/samtools_sort/.config.vsh.yaml +++ b/target/executable/samtools/samtools_sort/.config.vsh.yaml @@ -332,9 +332,9 @@ build_info: output: "target/executable/samtools/samtools_sort" executable: "target/executable/samtools/samtools_sort/samtools_sort" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_sort/samtools_sort b/target/executable/samtools/samtools_sort/samtools_sort index 3bfe8fe0..76e07885 100755 --- a/target/executable/samtools/samtools_sort/samtools_sort +++ b/target/executable/samtools/samtools_sort/samtools_sort @@ -556,9 +556,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_sort" -LABEL org.opencontainers.image.created="2024-11-08T09:45:05Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:56Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_stats/.config.vsh.yaml b/target/executable/samtools/samtools_stats/.config.vsh.yaml index 38279b86..fb916fb7 100644 --- a/target/executable/samtools/samtools_stats/.config.vsh.yaml +++ b/target/executable/samtools/samtools_stats/.config.vsh.yaml @@ -401,9 +401,9 @@ build_info: output: "target/executable/samtools/samtools_stats" executable: "target/executable/samtools/samtools_stats/samtools_stats" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_stats/samtools_stats b/target/executable/samtools/samtools_stats/samtools_stats index 0a21fc6d..2f696a68 100755 --- a/target/executable/samtools/samtools_stats/samtools_stats +++ b/target/executable/samtools/samtools_stats/samtools_stats @@ -575,9 +575,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_stats" -LABEL org.opencontainers.image.created="2024-11-08T09:45:04Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:56Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/samtools/samtools_view/.config.vsh.yaml b/target/executable/samtools/samtools_view/.config.vsh.yaml index 90021bb1..a3ff135c 100644 --- a/target/executable/samtools/samtools_view/.config.vsh.yaml +++ b/target/executable/samtools/samtools_view/.config.vsh.yaml @@ -665,9 +665,9 @@ build_info: output: "target/executable/samtools/samtools_view" executable: "target/executable/samtools/samtools_view/samtools_view" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/samtools/samtools_view/samtools_view b/target/executable/samtools/samtools_view/samtools_view index 1ac29759..6a6bca43 100755 --- a/target/executable/samtools/samtools_view/samtools_view +++ b/target/executable/samtools/samtools_view/samtools_view @@ -825,9 +825,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_view" -LABEL org.opencontainers.image.created="2024-11-08T09:45:03Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:54Z" LABEL org.opencontainers.image.source="https://github.com/samtools/samtools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/seqtk/seqtk_sample/.config.vsh.yaml b/target/executable/seqtk/seqtk_sample/.config.vsh.yaml index bd4086ea..6cb74ad7 100644 --- a/target/executable/seqtk/seqtk_sample/.config.vsh.yaml +++ b/target/executable/seqtk/seqtk_sample/.config.vsh.yaml @@ -173,9 +173,9 @@ build_info: output: "target/executable/seqtk/seqtk_sample" executable: "target/executable/seqtk/seqtk_sample/seqtk_sample" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/seqtk/seqtk_sample/seqtk_sample b/target/executable/seqtk/seqtk_sample/seqtk_sample index 9b88554b..cb773fd9 100755 --- a/target/executable/seqtk/seqtk_sample/seqtk_sample +++ b/target/executable/seqtk/seqtk_sample/seqtk_sample @@ -481,9 +481,9 @@ FROM quay.io/biocontainers/seqtk:1.4--he4a0461_2 ENTRYPOINT [] LABEL org.opencontainers.image.authors="Jakub Majercik" LABEL org.opencontainers.image.description="Companion container for running component seqtk seqtk_sample" -LABEL org.opencontainers.image.created="2024-11-08T09:45:02Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:53Z" LABEL org.opencontainers.image.source="https://github.com/lh3/seqtk/tree/v1.4" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml b/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml index 4a3e8491..3e9fd6cf 100644 --- a/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml +++ b/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml @@ -196,9 +196,9 @@ build_info: output: "target/executable/seqtk/seqtk_subseq" executable: "target/executable/seqtk/seqtk_subseq/seqtk_subseq" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/seqtk/seqtk_subseq/seqtk_subseq b/target/executable/seqtk/seqtk_subseq/seqtk_subseq index df0e071b..10f478c3 100755 --- a/target/executable/seqtk/seqtk_subseq/seqtk_subseq +++ b/target/executable/seqtk/seqtk_subseq/seqtk_subseq @@ -491,9 +491,9 @@ RUN echo $(echo $(seqtk 2>&1) | sed -n 's/.*\(Version: [^ ]*\).*/\1/p') > /var/s LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo" LABEL org.opencontainers.image.description="Companion container for running component seqtk seqtk_subseq" -LABEL org.opencontainers.image.created="2024-11-08T09:45:02Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:53Z" LABEL org.opencontainers.image.source="https://github.com/lh3/seqtk/tree/v1.4" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/sgdemux/.config.vsh.yaml b/target/executable/sgdemux/.config.vsh.yaml new file mode 100644 index 00000000..f0abe87f --- /dev/null +++ b/target/executable/sgdemux/.config.vsh.yaml @@ -0,0 +1,456 @@ +name: "sgdemux" +version: "main" +authors: +- name: "Dries Schaumont" + roles: + - "author" + - "maintainer" + info: + links: + email: "dries@data-intuitive.com" + github: "DriesSchaumont" + orcid: "0000-0002-4389-0440" + linkedin: "dries-schaumont" + organizations: + - name: "Data Intuitive" + href: "https://www.data-intuitive.com" + role: "Data Scientist" +argument_groups: +- name: "Input" + arguments: + - type: "file" + name: "--fastqs" + alternatives: + - "-f" + description: "Path to the input FASTQs, or path prefix if not a file" + info: null + example: + - "sample1_r1.fq;sample1_r2.fq;sample2_r1.fq;sample2_r2.fq" + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--sample_metadata" + alternatives: + - "-s" + description: "Path to the sample metadata CSV file including sample names and\ + \ barcode sequences" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output" + arguments: + - type: "file" + name: "--sample_fastq" + description: "The directory containing demultiplexed sample FASTQ files." + info: null + example: + - "output" + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--metrics" + description: "Demultiplexing summary statisitcs:\n - control_reads_omitted: The\ + \ number of reads that were omitted for being control reads.\n - failing_reads_omitted:\ + \ The number of reads that were omitted for having failed QC.\n - total_templates:\ + \ The total number of template reads that were output.\n" + info: null + example: + - "metrics.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--most_frequent_unmatched" + description: "It contains the (approximate) counts of the most prevelant observed\ + \ barcode sequences\nthat did not match to one of the expected barcodes. Can\ + \ only be created when 'most_unmatched_to_output'\nis not set to 0.\n" + info: null + example: + - "most_frequent_unmatched.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--sample_barcode_hop_metrics" + description: "File containing the frequently observed barcodes that are unexpected\n\ + combinations of expected barcodes in a dual-indexed run.\n" + info: null + example: + - "sample_barcode_hop_metrics.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--per_project_metrics" + description: "Aggregates the metrics by project (aggregates the metrics across\ + \ samples with the same project) and\nhas the same columns as `--metrics`. In\ + \ this case, sample_ID will contain the project name (or None if no project\ + \ is given).\nTHe barcode will contain all Ns. The undetermined sample will\ + \ not be aggregated with any other sample.\n" + info: null + example: + - "per_project_metrics.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--per_sample_metrics" + description: "Tab-separated file containing statistics per sample.\n" + info: null + example: + - "per_sample_metrics.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" +- name: "Arguments" + arguments: + - type: "string" + name: "--read_structures" + alternatives: + - "-r" + description: "Read structures, one per input FASTQ. Do not provide when using\ + \ a path prefix for FASTQs" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "integer" + name: "--allowed_mismatches" + alternatives: + - "-m" + description: "Number of allowed mismatches between the observed barcode and the\ + \ expected barcode" + info: null + example: + - 1 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--min_delta" + alternatives: + - "-d" + description: "The minimum allowed difference between an observed barcode and the\ + \ second closest expected barcode" + info: null + example: + - 2 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--free_ns" + alternatives: + - "-F" + description: "Number of N's to allow in a barcode without counting against the\ + \ allowed_mismatches" + info: null + example: + - 1 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--max_no_calls" + alternatives: + - "-N" + description: "Max no-calls (N's) in a barcode before it is considered unmatchable.\n\ + A barcode with total N's greater than 'max_no_call' will be considered unmatchable.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--quality_mask_threshold" + alternatives: + - "-M" + description: "Mask template bases with quality scores less than specified value(s).\n\ + Sample barcode/index and UMI bases are never masked. If provided either a single\ + \ value,\nor one value per FASTQ must be provided.\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "boolean_true" + name: "--filter_control_reads" + alternatives: + - "-C" + description: "Filter out control reads" + info: null + direction: "input" + - type: "boolean_true" + name: "--filter_failing_quality" + alternatives: + - "-Q" + description: "Filter reads failing quality filter\n" + info: null + direction: "input" + - type: "string" + name: "--output_types" + alternatives: + - "-T" + description: "The types of output FASTQs to write.\nFor each read structure, all\ + \ segment types listed will be output to a FASTQ file.\n\nThese may be any of\ + \ the following:\n - `T` - Template bases\n - `B` - Sample barcode bases\n -\ + \ `M` - Molecular barcode bases\n - `S` - Skip bases\n" + info: null + example: + - "T" + required: false + choices: + - "T" + - "B" + - "S" + - "M" + direction: "input" + multiple: true + multiple_sep: ";" + - type: "string" + name: "--undetermined_sample_name" + alternatives: + - "-u" + description: "The sample name for undetermined reads (reads that do not match\ + \ an expected barcode)\n" + info: null + example: + - "Undetermined" + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--most_unmatched_to_output" + alternatives: + - "-U" + description: "Output the most frequent \"unmatched\" barcodes up to this number.\n\ + If set to 0 unmatched barcodes will not be collected, improving overall performance.\n" + info: null + example: + - 1000 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--override_matcher" + description: "If the sample barcodes are > 12 bp long, a cached hamming distance\ + \ matcher is used.\nIf the barcodes are less than or equal to 12 bp long, all\ + \ possible matches are precomputed.\nThis option allows for overriding that\ + \ heuristic.\n" + info: null + required: false + choices: + - "cached-hamming-distance" + - "pre-compute" + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--skip_read_name_check" + description: "If this is true, then all the read names across FASTQs will not\ + \ be enforced to be the same.\nThis may be useful when the read names are known\ + \ to be the same and performance matters.\nRegardless, the first read name in\ + \ each FASTQ will always be checked.\n" + info: null + direction: "input" + - type: "boolean_true" + name: "--sample_barcode_in_fastq_header" + description: "If this is true, then the sample barcode is expected to be in the\ + \ FASTQ read header.\nFor dual indexed data, the barcodes must be `+` (plus)\ + \ delimited. Additionally, if true,\nthen neither index FASTQ files nor sample\ + \ barcode segments in the read structure may be specified.\n" + info: null + direction: "input" + - type: "string" + name: "--metric_prefix" + description: "Prepend this prefix to all output metric file names\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--lane" + alternatives: + - "-l" + description: "Select a subset of lanes to demultiplex. Will cause only samples\ + \ and input FASTQs with\nthe given `Lane`(s) to be demultiplexed. Samples without\ + \ a lane will be ignored, and\nFASTQs without lane information will be ignored\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" +resources: +- type: "bash_script" + path: "script.sh" + is_executable: true +description: "Demultiplex sequence data generated on Singular Genomics' sequencing\ + \ instruments.\n" +test_resources: +- type: "bash_script" + path: "test.sh" + is_executable: true +- type: "file" + path: "test_data" +info: null +status: "enabled" +requirements: + commands: + - "ps" +keywords: +- "demultiplex" +- "fastq" +license: "Proprietairy" +links: + repository: "https://github.com/Singular-Genomics/singular-demux" +runners: +- type: "executable" + id: "executable" + docker_setup_strategy: "ifneedbepullelsecachedbuild" +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "docker" + id: "docker" + image: "continuumio/miniconda3:latest" + target_registry: "images.viash-hub.com" + target_tag: "main" + namespace_separator: "/" + setup: + - type: "apt" + packages: + - "procps" + interactive: false + - type: "docker" + run: + - "conda install -c conda-forge -c bioconda sgdemux && \\\necho \"sgdemux: $(sgdemux\ + \ --version | cut -d' ' -f2)\" > /var/software_versions.txt\n" + entrypoint: [] + cmd: null +- type: "native" + id: "native" +build_info: + config: "src/sgdemux/config.vsh.yaml" + runner: "executable" + engine: "docker|native" + output: "target/executable/sgdemux" + executable: "target/executable/sgdemux/sgdemux" + viash_version: "0.9.0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" +package_config: + name: "biobox" + version: "main" + description: "A collection of bioinformatics tools for working with sequence data.\n" + info: null + viash_version: "0.9.0" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'main'" + keywords: + - "bioinformatics" + - "modules" + - "sequencing" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/biobox" + issue_tracker: "https://github.com/viash-hub/biobox/issues" diff --git a/target/executable/sgdemux/sgdemux b/target/executable/sgdemux/sgdemux new file mode 100755 index 00000000..7247ac28 --- /dev/null +++ b/target/executable/sgdemux/sgdemux @@ -0,0 +1,1952 @@ +#!/usr/bin/env bash + +# sgdemux main +# +# This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative +# work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data +# Intuitive. +# +# The component may contain files which fall under a different license. The +# authors of this component should specify the license in the header of such +# files, or include a separate license file detailing the licenses of all included +# files. +# +# Component authors: +# * Dries Schaumont (author, maintainer) + +set -e + +if [ -z "$VIASH_TEMP" ]; then + VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$VIASH_TEMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMP} + VIASH_TEMP=${VIASH_TEMP:-$TMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$TMP} + VIASH_TEMP=${VIASH_TEMP:-$TEMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$TEMP} + VIASH_TEMP=${VIASH_TEMP:-/tmp} +fi + +# define helper functions +# ViashQuote: put quotes around non flag values +# $1 : unquoted string +# return : possibly quoted string +# examples: +# ViashQuote --foo # returns --foo +# ViashQuote bar # returns 'bar' +# Viashquote --foo=bar # returns --foo='bar' +function ViashQuote { + if [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+=.+$ ]]; then + echo "$1" | sed "s#=\(.*\)#='\1'#" + elif [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+$ ]]; then + echo "$1" + else + echo "'$1'" + fi +} +# ViashRemoveFlags: Remove leading flag +# $1 : string with a possible leading flag +# return : string without possible leading flag +# examples: +# ViashRemoveFlags --foo=bar # returns bar +function ViashRemoveFlags { + echo "$1" | sed 's/^--*[a-zA-Z0-9_\-]*=//' +} +# ViashSourceDir: return the path of a bash file, following symlinks +# usage : ViashSourceDir ${BASH_SOURCE[0]} +# $1 : Should always be set to ${BASH_SOURCE[0]} +# returns : The absolute path of the bash file +function ViashSourceDir { + local source="$1" + while [ -h "$source" ]; do + local dir="$( cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd )" + source="$(readlink "$source")" + [[ $source != /* ]] && source="$dir/$source" + done + cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd +} +# ViashFindTargetDir: return the path of the '.build.yaml' file, following symlinks +# usage : ViashFindTargetDir 'ScriptPath' +# $1 : The location from where to start the upward search +# returns : The absolute path of the '.build.yaml' file +function ViashFindTargetDir { + local source="$1" + while [[ "$source" != "" && ! -e "$source/.build.yaml" ]]; do + source=${source%/*} + done + echo $source +} +# see https://en.wikipedia.org/wiki/Syslog#Severity_level +VIASH_LOGCODE_EMERGENCY=0 +VIASH_LOGCODE_ALERT=1 +VIASH_LOGCODE_CRITICAL=2 +VIASH_LOGCODE_ERROR=3 +VIASH_LOGCODE_WARNING=4 +VIASH_LOGCODE_NOTICE=5 +VIASH_LOGCODE_INFO=6 +VIASH_LOGCODE_DEBUG=7 +VIASH_VERBOSITY=$VIASH_LOGCODE_NOTICE + +# ViashLog: Log events depending on the verbosity level +# usage: ViashLog 1 alert Oh no something went wrong! +# $1: required verbosity level +# $2: display tag +# $3+: messages to display +# stdout: Your input, prepended by '[$2] '. +function ViashLog { + local required_level="$1" + local display_tag="$2" + shift 2 + if [ $VIASH_VERBOSITY -ge $required_level ]; then + >&2 echo "[$display_tag]" "$@" + fi +} + +# ViashEmergency: log events when the system is unstable +# usage: ViashEmergency Oh no something went wrong. +# stdout: Your input, prepended by '[emergency] '. +function ViashEmergency { + ViashLog $VIASH_LOGCODE_EMERGENCY emergency "$@" +} + +# ViashAlert: log events when actions must be taken immediately (e.g. corrupted system database) +# usage: ViashAlert Oh no something went wrong. +# stdout: Your input, prepended by '[alert] '. +function ViashAlert { + ViashLog $VIASH_LOGCODE_ALERT alert "$@" +} + +# ViashCritical: log events when a critical condition occurs +# usage: ViashCritical Oh no something went wrong. +# stdout: Your input, prepended by '[critical] '. +function ViashCritical { + ViashLog $VIASH_LOGCODE_CRITICAL critical "$@" +} + +# ViashError: log events when an error condition occurs +# usage: ViashError Oh no something went wrong. +# stdout: Your input, prepended by '[error] '. +function ViashError { + ViashLog $VIASH_LOGCODE_ERROR error "$@" +} + +# ViashWarning: log potentially abnormal events +# usage: ViashWarning Something may have gone wrong. +# stdout: Your input, prepended by '[warning] '. +function ViashWarning { + ViashLog $VIASH_LOGCODE_WARNING warning "$@" +} + +# ViashNotice: log significant but normal events +# usage: ViashNotice This just happened. +# stdout: Your input, prepended by '[notice] '. +function ViashNotice { + ViashLog $VIASH_LOGCODE_NOTICE notice "$@" +} + +# ViashInfo: log normal events +# usage: ViashInfo This just happened. +# stdout: Your input, prepended by '[info] '. +function ViashInfo { + ViashLog $VIASH_LOGCODE_INFO info "$@" +} + +# ViashDebug: log all events, for debugging purposes +# usage: ViashDebug This just happened. +# stdout: Your input, prepended by '[debug] '. +function ViashDebug { + ViashLog $VIASH_LOGCODE_DEBUG debug "$@" +} + +# find source folder of this component +VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}` + +# find the root of the built components & dependencies +VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR` + +# define meta fields +VIASH_META_NAME="sgdemux" +VIASH_META_FUNCTIONALITY_NAME="sgdemux" +VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME" +VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml" +VIASH_META_TEMP_DIR="$VIASH_TEMP" + + +# ViashHelp: Display helpful explanation about this executable +function ViashHelp { + echo "sgdemux main" + echo "" + echo "Demultiplex sequence data generated on Singular Genomics' sequencing" + echo "instruments." + echo "" + echo "Input:" + echo " -f, --fastqs" + echo " type: file, required parameter, multiple values allowed, file must exist" + echo " example: sample1_r1.fq;sample1_r2.fq;sample2_r1.fq;sample2_r2.fq" + echo " Path to the input FASTQs, or path prefix if not a file" + echo "" + echo " -s, --sample_metadata" + echo " type: file, required parameter, file must exist" + echo " Path to the sample metadata CSV file including sample names and barcode" + echo " sequences" + echo "" + echo "Output:" + echo " --sample_fastq" + echo " type: file, required parameter, output, file must exist" + echo " example: output" + echo " The directory containing demultiplexed sample FASTQ files." + echo "" + echo " --metrics" + echo " type: file, output, file must exist" + echo " example: metrics.tsv" + echo " Demultiplexing summary statisitcs:" + echo " - control_reads_omitted: The number of reads that were omitted for" + echo " being control reads." + echo " - failing_reads_omitted: The number of reads that were omitted for" + echo " having failed QC." + echo " - total_templates: The total number of template reads that were" + echo " output." + echo "" + echo " --most_frequent_unmatched" + echo " type: file, output, file must exist" + echo " example: most_frequent_unmatched.tsv" + echo " It contains the (approximate) counts of the most prevelant observed" + echo " barcode sequences" + echo " that did not match to one of the expected barcodes. Can only be created" + echo " when 'most_unmatched_to_output'" + echo " is not set to 0." + echo "" + echo " --sample_barcode_hop_metrics" + echo " type: file, output, file must exist" + echo " example: sample_barcode_hop_metrics.tsv" + echo " File containing the frequently observed barcodes that are unexpected" + echo " combinations of expected barcodes in a dual-indexed run." + echo "" + echo " --per_project_metrics" + echo " type: file, output, file must exist" + echo " example: per_project_metrics.tsv" + echo " Aggregates the metrics by project (aggregates the metrics across samples" + echo " with the same project) and" + echo " has the same columns as \`--metrics\`. In this case, sample_ID will" + echo " contain the project name (or None if no project is given)." + echo " THe barcode will contain all Ns. The undetermined sample will not be" + echo " aggregated with any other sample." + echo "" + echo " --per_sample_metrics" + echo " type: file, output, file must exist" + echo " example: per_sample_metrics.tsv" + echo " Tab-separated file containing statistics per sample." + echo "" + echo "Arguments:" + echo " -r, --read_structures" + echo " type: string, multiple values allowed" + echo " Read structures, one per input FASTQ. Do not provide when using a path" + echo " prefix for FASTQs" + echo "" + echo " -m, --allowed_mismatches" + echo " type: integer" + echo " example: 1" + echo " Number of allowed mismatches between the observed barcode and the" + echo " expected barcode" + echo "" + echo " -d, --min_delta" + echo " type: integer" + echo " example: 2" + echo " The minimum allowed difference between an observed barcode and the" + echo " second closest expected barcode" + echo "" + echo " -F, --free_ns" + echo " type: integer" + echo " example: 1" + echo " Number of N's to allow in a barcode without counting against the" + echo " allowed_mismatches" + echo "" + echo " -N, --max_no_calls" + echo " type: integer" + echo " Max no-calls (N's) in a barcode before it is considered unmatchable." + echo " A barcode with total N's greater than 'max_no_call' will be considered" + echo " unmatchable." + echo "" + echo " -M, --quality_mask_threshold" + echo " type: integer, multiple values allowed" + echo " Mask template bases with quality scores less than specified value(s)." + echo " Sample barcode/index and UMI bases are never masked. If provided either" + echo " a single value," + echo " or one value per FASTQ must be provided." + echo "" + echo " -C, --filter_control_reads" + echo " type: boolean_true" + echo " Filter out control reads" + echo "" + echo " -Q, --filter_failing_quality" + echo " type: boolean_true" + echo " Filter reads failing quality filter" + echo "" + echo " -T, --output_types" + echo " type: string, multiple values allowed" + echo " example: T" + echo " choices: [ T, B, S, M ]" + echo " The types of output FASTQs to write." + echo " For each read structure, all segment types listed will be output to a" + echo " FASTQ file." + echo " These may be any of the following:" + echo " - \`T\` - Template bases" + echo " - \`B\` - Sample barcode bases" + echo " - \`M\` - Molecular barcode bases" + echo " - \`S\` - Skip bases" + echo "" + echo " -u, --undetermined_sample_name" + echo " type: string" + echo " example: Undetermined" + echo " The sample name for undetermined reads (reads that do not match an" + echo " expected barcode)" + echo "" + echo " -U, --most_unmatched_to_output" + echo " type: integer" + echo " example: 1000" + echo " Output the most frequent \"unmatched\" barcodes up to this number." + echo " If set to 0 unmatched barcodes will not be collected, improving overall" + echo " performance." + echo "" + echo " --override_matcher" + echo " type: string" + echo " choices: [ cached-hamming-distance, pre-compute ]" + echo " If the sample barcodes are > 12 bp long, a cached hamming distance" + echo " matcher is used." + echo " If the barcodes are less than or equal to 12 bp long, all possible" + echo " matches are precomputed." + echo " This option allows for overriding that heuristic." + echo "" + echo " --skip_read_name_check" + echo " type: boolean_true" + echo " If this is true, then all the read names across FASTQs will not be" + echo " enforced to be the same." + echo " This may be useful when the read names are known to be the same and" + echo " performance matters." + echo " Regardless, the first read name in each FASTQ will always be checked." + echo "" + echo " --sample_barcode_in_fastq_header" + echo " type: boolean_true" + echo " If this is true, then the sample barcode is expected to be in the FASTQ" + echo " read header." + echo " For dual indexed data, the barcodes must be \`+\` (plus) delimited." + echo " Additionally, if true," + echo " then neither index FASTQ files nor sample barcode segments in the read" + echo " structure may be specified." + echo "" + echo " --metric_prefix" + echo " type: string" + echo " Prepend this prefix to all output metric file names" + echo "" + echo " -l, --lane" + echo " type: integer, multiple values allowed" + echo " Select a subset of lanes to demultiplex. Will cause only samples and" + echo " input FASTQs with" + echo " the given \`Lane\`(s) to be demultiplexed. Samples without a lane will be" + echo " ignored, and" + echo " FASTQs without lane information will be ignored" +} + +# initialise variables +VIASH_MODE='run' +VIASH_ENGINE_ID='docker' + +######## Helper functions for setting up Docker images for viash ######## +# expects: ViashDockerBuild + +# ViashDockerInstallationCheck: check whether Docker is installed correctly +# +# examples: +# ViashDockerInstallationCheck +function ViashDockerInstallationCheck { + ViashDebug "Checking whether Docker is installed" + if [ ! command -v docker &> /dev/null ]; then + ViashCritical "Docker doesn't seem to be installed. See 'https://docs.docker.com/get-docker/' for instructions." + exit 1 + fi + + ViashDebug "Checking whether the Docker daemon is running" + local save=$-; set +e + local docker_version=$(docker version --format '{{.Client.APIVersion}}' 2> /dev/null) + local out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashCritical "Docker daemon does not seem to be running. Try one of the following:" + ViashCritical "- Try running 'dockerd' in the command line" + ViashCritical "- See https://docs.docker.com/config/daemon/" + exit 1 + fi +} + +# ViashDockerRemoteTagCheck: check whether a Docker image is available +# on a remote. Assumes `docker login` has been performed, if relevant. +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# ViashDockerRemoteTagCheck python:latest +# echo $? # returns '0' +# ViashDockerRemoteTagCheck sdaizudceahifu +# echo $? # returns '1' +function ViashDockerRemoteTagCheck { + docker manifest inspect $1 > /dev/null 2> /dev/null +} + +# ViashDockerLocalTagCheck: check whether a Docker image is available locally +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# docker pull python:latest +# ViashDockerLocalTagCheck python:latest +# echo $? # returns '0' +# ViashDockerLocalTagCheck sdaizudceahifu +# echo $? # returns '1' +function ViashDockerLocalTagCheck { + [ -n "$(docker images -q $1)" ] +} + +# ViashDockerPull: pull a Docker image +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# ViashDockerPull python:latest +# echo $? # returns '0' +# ViashDockerPull sdaizudceahifu +# echo $? # returns '1' +function ViashDockerPull { + ViashNotice "Checking if Docker image is available at '$1'" + if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then + docker pull $1 && return 0 || return 1 + else + local save=$-; set +e + docker pull $1 2> /dev/null > /dev/null + local out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashWarning "Could not pull from '$1'. Docker image doesn't exist or is not accessible." + fi + return $out + fi +} + +# ViashDockerPush: push a Docker image +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# ViashDockerPush python:latest +# echo $? # returns '0' +# ViashDockerPush sdaizudceahifu +# echo $? # returns '1' +function ViashDockerPush { + ViashNotice "Pushing image to '$1'" + local save=$-; set +e + local out + if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then + docker push $1 + out=$? + else + docker push $1 2> /dev/null > /dev/null + out=$? + fi + [[ $save =~ e ]] && set -e + if [ $out -eq 0 ]; then + ViashNotice "Container '$1' push succeeded." + else + ViashError "Container '$1' push errored. You might not be logged in or have the necessary permissions." + fi + return $out +} + +# ViashDockerPullElseBuild: pull a Docker image, else build it +# +# $1 : image identifier with format `[registry/]image[:tag]` +# ViashDockerBuild : a Bash function which builds a docker image, takes image identifier as argument. +# examples: +# ViashDockerPullElseBuild mynewcomponent +function ViashDockerPullElseBuild { + local save=$-; set +e + ViashDockerPull $1 + local out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashDockerBuild $@ + fi +} + +# ViashDockerSetup: create a Docker image, according to specified docker setup strategy +# +# $1 : image identifier with format `[registry/]image[:tag]` +# $2 : docker setup strategy, see DockerSetupStrategy.scala +# examples: +# ViashDockerSetup mynewcomponent alwaysbuild +function ViashDockerSetup { + local image_id="$1" + local setup_strategy="$2" + if [ "$setup_strategy" == "alwaysbuild" -o "$setup_strategy" == "build" -o "$setup_strategy" == "b" ]; then + ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "alwayspull" -o "$setup_strategy" == "pull" -o "$setup_strategy" == "p" ]; then + ViashDockerPull $image_id + elif [ "$setup_strategy" == "alwayspullelsebuild" -o "$setup_strategy" == "pullelsebuild" ]; then + ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "alwayspullelsecachedbuild" -o "$setup_strategy" == "pullelsecachedbuild" ]; then + ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "alwayscachedbuild" -o "$setup_strategy" == "cachedbuild" -o "$setup_strategy" == "cb" ]; then + ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id") + elif [[ "$setup_strategy" =~ ^ifneedbe ]]; then + local save=$-; set +e + ViashDockerLocalTagCheck $image_id + local outCheck=$? + [[ $save =~ e ]] && set -e + if [ $outCheck -eq 0 ]; then + ViashInfo "Image $image_id already exists" + elif [ "$setup_strategy" == "ifneedbebuild" ]; then + ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "ifneedbecachedbuild" ]; then + ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "ifneedbepull" ]; then + ViashDockerPull $image_id + elif [ "$setup_strategy" == "ifneedbepullelsebuild" ]; then + ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "ifneedbepullelsecachedbuild" ]; then + ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id") + else + ViashError "Unrecognised Docker strategy: $setup_strategy" + exit 1 + fi + elif [ "$setup_strategy" == "push" -o "$setup_strategy" == "forcepush" -o "$setup_strategy" == "alwayspush" ]; then + ViashDockerPush "$image_id" + elif [ "$setup_strategy" == "pushifnotpresent" -o "$setup_strategy" == "gentlepush" -o "$setup_strategy" == "maybepush" ]; then + local save=$-; set +e + ViashDockerRemoteTagCheck $image_id + local outCheck=$? + [[ $save =~ e ]] && set -e + if [ $outCheck -eq 0 ]; then + ViashNotice "Container '$image_id' exists, doing nothing." + else + ViashNotice "Container '$image_id' does not yet exist." + ViashDockerPush "$image_id" + fi + elif [ "$setup_strategy" == "donothing" -o "$setup_strategy" == "meh" ]; then + ViashNotice "Skipping setup." + else + ViashError "Unrecognised Docker strategy: $setup_strategy" + exit 1 + fi +} + +# ViashDockerCheckCommands: Check whether a docker container has the required commands +# +# $1 : image identifier with format `[registry/]image[:tag]` +# $@ : commands to verify being present +# examples: +# ViashDockerCheckCommands bash:4.0 bash ps foo +function ViashDockerCheckCommands { + local image_id="$1" + shift 1 + local commands="$@" + local save=$-; set +e + local missing # mark 'missing' as local in advance, otherwise the exit code of the command will be missing and always be '0' + missing=$(docker run --rm --entrypoint=sh "$image_id" -c "for command in $commands; do command -v \$command >/dev/null 2>&1; if [ \$? -ne 0 ]; then echo \$command; exit 1; fi; done") + local outCheck=$? + [[ $save =~ e ]] && set -e + if [ $outCheck -ne 0 ]; then + ViashError "Docker container '$image_id' does not contain command '$missing'." + exit 1 + fi +} + +# ViashDockerBuild: build a docker image +# $1 : image identifier with format `[registry/]image[:tag]` +# $... : additional arguments to pass to docker build +# $VIASH_META_TEMP_DIR : temporary directory to store dockerfile & optional resources in +# $VIASH_META_NAME : name of the component +# $VIASH_META_RESOURCES_DIR : directory containing the resources +# $VIASH_VERBOSITY : verbosity level +# exit code $? : whether or not the image was built successfully +function ViashDockerBuild { + local image_id="$1" + shift 1 + + # create temporary directory to store dockerfile & optional resources in + local tmpdir=$(mktemp -d "$VIASH_META_TEMP_DIR/dockerbuild-$VIASH_META_NAME-XXXXXX") + local dockerfile="$tmpdir/Dockerfile" + function clean_up { + rm -rf "$tmpdir" + } + trap clean_up EXIT + + # store dockerfile and resources + ViashDockerfile "$VIASH_ENGINE_ID" > "$dockerfile" + + # generate the build command + local docker_build_cmd="docker build -t '$image_id' $@ '$VIASH_META_RESOURCES_DIR' -f '$dockerfile'" + + # build the container + ViashNotice "Building container '$image_id' with Dockerfile" + ViashInfo "$docker_build_cmd" + local save=$-; set +e + if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then + eval $docker_build_cmd + else + eval $docker_build_cmd &> "$tmpdir/docker_build.log" + fi + + # check exit code + local out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashError "Error occurred while building container '$image_id'" + if [ $VIASH_VERBOSITY -lt $VIASH_LOGCODE_INFO ]; then + ViashError "Transcript: --------------------------------" + cat "$tmpdir/docker_build.log" + ViashError "End of transcript --------------------------" + fi + exit 1 + fi +} + +######## End of helper functions for setting up Docker images for viash ######## + +# ViashDockerFile: print the dockerfile to stdout +# $1 : engine identifier +# return : dockerfile required to run this component +# examples: +# ViashDockerFile +function ViashDockerfile { + local engine_id="$1" + + if [[ "$engine_id" == "docker" ]]; then + cat << 'VIASHDOCKER' +FROM continuumio/miniconda3:latest +ENTRYPOINT [] +RUN apt-get update && \ + DEBIAN_FRONTEND=noninteractive apt-get install -y procps && \ + rm -rf /var/lib/apt/lists/* + +RUN conda install -c conda-forge -c bioconda sgdemux && \ +echo "sgdemux: $(sgdemux --version | cut -d' ' -f2)" > /var/software_versions.txt + +LABEL org.opencontainers.image.authors="Dries Schaumont" +LABEL org.opencontainers.image.description="Companion container for running component sgdemux" +LABEL org.opencontainers.image.created="2024-11-14T13:16:56Z" +LABEL org.opencontainers.image.source="https://github.com/Singular-Genomics/singular-demux" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" +LABEL org.opencontainers.image.version="main" + +VIASHDOCKER + fi +} + +# ViashDockerBuildArgs: return the arguments to pass to docker build +# $1 : engine identifier +# return : arguments to pass to docker build +function ViashDockerBuildArgs { + local engine_id="$1" + + if [[ "$engine_id" == "docker" ]]; then + echo "" + fi +} + +# ViashAbsolutePath: generate absolute path from relative path +# borrowed from https://stackoverflow.com/a/21951256 +# $1 : relative filename +# return : absolute path +# examples: +# ViashAbsolutePath some_file.txt # returns /path/to/some_file.txt +# ViashAbsolutePath /foo/bar/.. # returns /foo +function ViashAbsolutePath { + local thePath + local parr + local outp + local len + if [[ ! "$1" =~ ^/ ]]; then + thePath="$PWD/$1" + else + thePath="$1" + fi + echo "$thePath" | ( + IFS=/ + read -a parr + declare -a outp + for i in "${parr[@]}"; do + case "$i" in + ''|.) continue ;; + ..) + len=${#outp[@]} + if ((len==0)); then + continue + else + unset outp[$((len-1))] + fi + ;; + *) + len=${#outp[@]} + outp[$len]="$i" + ;; + esac + done + echo /"${outp[*]}" + ) +} +# ViashDockerAutodetectMount: auto configuring docker mounts from parameters +# $1 : The parameter value +# returns : New parameter +# $VIASH_DIRECTORY_MOUNTS : Added another parameter to be passed to docker +# $VIASH_DOCKER_AUTOMOUNT_PREFIX : The prefix to be used for the automounts +# examples: +# ViashDockerAutodetectMount /path/to/bar # returns '/viash_automount/path/to/bar' +# ViashDockerAutodetectMountArg /path/to/bar # returns '--volume="/path/to:/viash_automount/path/to"' +function ViashDockerAutodetectMount { + local abs_path=$(ViashAbsolutePath "$1") + local mount_source + local base_name + if [ -d "$abs_path" ]; then + mount_source="$abs_path" + base_name="" + else + mount_source=`dirname "$abs_path"` + base_name=`basename "$abs_path"` + fi + local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source" + if [ -z "$base_name" ]; then + echo "$mount_target" + else + echo "$mount_target/$base_name" + fi +} +function ViashDockerAutodetectMountArg { + local abs_path=$(ViashAbsolutePath "$1") + local mount_source + local base_name + if [ -d "$abs_path" ]; then + mount_source="$abs_path" + base_name="" + else + mount_source=`dirname "$abs_path"` + base_name=`basename "$abs_path"` + fi + local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source" + ViashDebug "ViashDockerAutodetectMountArg $1 -> $mount_source -> $mount_target" + echo "--volume=\"$mount_source:$mount_target\"" +} +function ViashDockerStripAutomount { + local abs_path=$(ViashAbsolutePath "$1") + echo "${abs_path#$VIASH_DOCKER_AUTOMOUNT_PREFIX}" +} +# initialise variables +VIASH_DIRECTORY_MOUNTS=() + +# configure default docker automount prefix if it is unset +if [ -z "${VIASH_DOCKER_AUTOMOUNT_PREFIX+x}" ]; then + VIASH_DOCKER_AUTOMOUNT_PREFIX="/viash_automount" +fi + +# initialise docker variables +VIASH_DOCKER_RUN_ARGS=(-i --rm) + +# initialise array +VIASH_POSITIONAL_ARGS='' + +while [[ $# -gt 0 ]]; do + case "$1" in + -h|--help) + ViashHelp + exit + ;; + ---v|---verbose) + let "VIASH_VERBOSITY=VIASH_VERBOSITY+1" + shift 1 + ;; + ---verbosity) + VIASH_VERBOSITY="$2" + shift 2 + ;; + ---verbosity=*) + VIASH_VERBOSITY="$(ViashRemoveFlags "$1")" + shift 1 + ;; + --version) + echo "sgdemux main" + exit + ;; + --fastqs) + if [ -z "$VIASH_PAR_FASTQS" ]; then + VIASH_PAR_FASTQS="$2" + else + VIASH_PAR_FASTQS="$VIASH_PAR_FASTQS;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --fastqs. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --fastqs=*) + if [ -z "$VIASH_PAR_FASTQS" ]; then + VIASH_PAR_FASTQS=$(ViashRemoveFlags "$1") + else + VIASH_PAR_FASTQS="$VIASH_PAR_FASTQS;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + -f) + if [ -z "$VIASH_PAR_FASTQS" ]; then + VIASH_PAR_FASTQS="$2" + else + VIASH_PAR_FASTQS="$VIASH_PAR_FASTQS;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to -f. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --sample_metadata) + [ -n "$VIASH_PAR_SAMPLE_METADATA" ] && ViashError Bad arguments for option \'--sample_metadata\': \'$VIASH_PAR_SAMPLE_METADATA\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_SAMPLE_METADATA="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --sample_metadata. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --sample_metadata=*) + [ -n "$VIASH_PAR_SAMPLE_METADATA" ] && ViashError Bad arguments for option \'--sample_metadata=*\': \'$VIASH_PAR_SAMPLE_METADATA\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_SAMPLE_METADATA=$(ViashRemoveFlags "$1") + shift 1 + ;; + -s) + [ -n "$VIASH_PAR_SAMPLE_METADATA" ] && ViashError Bad arguments for option \'-s\': \'$VIASH_PAR_SAMPLE_METADATA\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_SAMPLE_METADATA="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -s. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --sample_fastq) + [ -n "$VIASH_PAR_SAMPLE_FASTQ" ] && ViashError Bad arguments for option \'--sample_fastq\': \'$VIASH_PAR_SAMPLE_FASTQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_SAMPLE_FASTQ="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --sample_fastq. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --sample_fastq=*) + [ -n "$VIASH_PAR_SAMPLE_FASTQ" ] && ViashError Bad arguments for option \'--sample_fastq=*\': \'$VIASH_PAR_SAMPLE_FASTQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_SAMPLE_FASTQ=$(ViashRemoveFlags "$1") + shift 1 + ;; + --metrics) + [ -n "$VIASH_PAR_METRICS" ] && ViashError Bad arguments for option \'--metrics\': \'$VIASH_PAR_METRICS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_METRICS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --metrics. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --metrics=*) + [ -n "$VIASH_PAR_METRICS" ] && ViashError Bad arguments for option \'--metrics=*\': \'$VIASH_PAR_METRICS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_METRICS=$(ViashRemoveFlags "$1") + shift 1 + ;; + --most_frequent_unmatched) + [ -n "$VIASH_PAR_MOST_FREQUENT_UNMATCHED" ] && ViashError Bad arguments for option \'--most_frequent_unmatched\': \'$VIASH_PAR_MOST_FREQUENT_UNMATCHED\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MOST_FREQUENT_UNMATCHED="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --most_frequent_unmatched. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --most_frequent_unmatched=*) + [ -n "$VIASH_PAR_MOST_FREQUENT_UNMATCHED" ] && ViashError Bad arguments for option \'--most_frequent_unmatched=*\': \'$VIASH_PAR_MOST_FREQUENT_UNMATCHED\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MOST_FREQUENT_UNMATCHED=$(ViashRemoveFlags "$1") + shift 1 + ;; + --sample_barcode_hop_metrics) + [ -n "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS" ] && ViashError Bad arguments for option \'--sample_barcode_hop_metrics\': \'$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --sample_barcode_hop_metrics. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --sample_barcode_hop_metrics=*) + [ -n "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS" ] && ViashError Bad arguments for option \'--sample_barcode_hop_metrics=*\': \'$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS=$(ViashRemoveFlags "$1") + shift 1 + ;; + --per_project_metrics) + [ -n "$VIASH_PAR_PER_PROJECT_METRICS" ] && ViashError Bad arguments for option \'--per_project_metrics\': \'$VIASH_PAR_PER_PROJECT_METRICS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PER_PROJECT_METRICS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --per_project_metrics. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --per_project_metrics=*) + [ -n "$VIASH_PAR_PER_PROJECT_METRICS" ] && ViashError Bad arguments for option \'--per_project_metrics=*\': \'$VIASH_PAR_PER_PROJECT_METRICS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PER_PROJECT_METRICS=$(ViashRemoveFlags "$1") + shift 1 + ;; + --per_sample_metrics) + [ -n "$VIASH_PAR_PER_SAMPLE_METRICS" ] && ViashError Bad arguments for option \'--per_sample_metrics\': \'$VIASH_PAR_PER_SAMPLE_METRICS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PER_SAMPLE_METRICS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --per_sample_metrics. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --per_sample_metrics=*) + [ -n "$VIASH_PAR_PER_SAMPLE_METRICS" ] && ViashError Bad arguments for option \'--per_sample_metrics=*\': \'$VIASH_PAR_PER_SAMPLE_METRICS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_PER_SAMPLE_METRICS=$(ViashRemoveFlags "$1") + shift 1 + ;; + --read_structures) + if [ -z "$VIASH_PAR_READ_STRUCTURES" ]; then + VIASH_PAR_READ_STRUCTURES="$2" + else + VIASH_PAR_READ_STRUCTURES="$VIASH_PAR_READ_STRUCTURES;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --read_structures. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --read_structures=*) + if [ -z "$VIASH_PAR_READ_STRUCTURES" ]; then + VIASH_PAR_READ_STRUCTURES=$(ViashRemoveFlags "$1") + else + VIASH_PAR_READ_STRUCTURES="$VIASH_PAR_READ_STRUCTURES;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + -r) + if [ -z "$VIASH_PAR_READ_STRUCTURES" ]; then + VIASH_PAR_READ_STRUCTURES="$2" + else + VIASH_PAR_READ_STRUCTURES="$VIASH_PAR_READ_STRUCTURES;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to -r. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --allowed_mismatches) + [ -n "$VIASH_PAR_ALLOWED_MISMATCHES" ] && ViashError Bad arguments for option \'--allowed_mismatches\': \'$VIASH_PAR_ALLOWED_MISMATCHES\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_ALLOWED_MISMATCHES="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --allowed_mismatches. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --allowed_mismatches=*) + [ -n "$VIASH_PAR_ALLOWED_MISMATCHES" ] && ViashError Bad arguments for option \'--allowed_mismatches=*\': \'$VIASH_PAR_ALLOWED_MISMATCHES\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_ALLOWED_MISMATCHES=$(ViashRemoveFlags "$1") + shift 1 + ;; + -m) + [ -n "$VIASH_PAR_ALLOWED_MISMATCHES" ] && ViashError Bad arguments for option \'-m\': \'$VIASH_PAR_ALLOWED_MISMATCHES\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_ALLOWED_MISMATCHES="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -m. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --min_delta) + [ -n "$VIASH_PAR_MIN_DELTA" ] && ViashError Bad arguments for option \'--min_delta\': \'$VIASH_PAR_MIN_DELTA\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MIN_DELTA="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --min_delta. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --min_delta=*) + [ -n "$VIASH_PAR_MIN_DELTA" ] && ViashError Bad arguments for option \'--min_delta=*\': \'$VIASH_PAR_MIN_DELTA\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MIN_DELTA=$(ViashRemoveFlags "$1") + shift 1 + ;; + -d) + [ -n "$VIASH_PAR_MIN_DELTA" ] && ViashError Bad arguments for option \'-d\': \'$VIASH_PAR_MIN_DELTA\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MIN_DELTA="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -d. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --free_ns) + [ -n "$VIASH_PAR_FREE_NS" ] && ViashError Bad arguments for option \'--free_ns\': \'$VIASH_PAR_FREE_NS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FREE_NS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --free_ns. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --free_ns=*) + [ -n "$VIASH_PAR_FREE_NS" ] && ViashError Bad arguments for option \'--free_ns=*\': \'$VIASH_PAR_FREE_NS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FREE_NS=$(ViashRemoveFlags "$1") + shift 1 + ;; + -F) + [ -n "$VIASH_PAR_FREE_NS" ] && ViashError Bad arguments for option \'-F\': \'$VIASH_PAR_FREE_NS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FREE_NS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -F. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --max_no_calls) + [ -n "$VIASH_PAR_MAX_NO_CALLS" ] && ViashError Bad arguments for option \'--max_no_calls\': \'$VIASH_PAR_MAX_NO_CALLS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MAX_NO_CALLS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --max_no_calls. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --max_no_calls=*) + [ -n "$VIASH_PAR_MAX_NO_CALLS" ] && ViashError Bad arguments for option \'--max_no_calls=*\': \'$VIASH_PAR_MAX_NO_CALLS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MAX_NO_CALLS=$(ViashRemoveFlags "$1") + shift 1 + ;; + -N) + [ -n "$VIASH_PAR_MAX_NO_CALLS" ] && ViashError Bad arguments for option \'-N\': \'$VIASH_PAR_MAX_NO_CALLS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MAX_NO_CALLS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -N. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --quality_mask_threshold) + if [ -z "$VIASH_PAR_QUALITY_MASK_THRESHOLD" ]; then + VIASH_PAR_QUALITY_MASK_THRESHOLD="$2" + else + VIASH_PAR_QUALITY_MASK_THRESHOLD="$VIASH_PAR_QUALITY_MASK_THRESHOLD;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --quality_mask_threshold. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --quality_mask_threshold=*) + if [ -z "$VIASH_PAR_QUALITY_MASK_THRESHOLD" ]; then + VIASH_PAR_QUALITY_MASK_THRESHOLD=$(ViashRemoveFlags "$1") + else + VIASH_PAR_QUALITY_MASK_THRESHOLD="$VIASH_PAR_QUALITY_MASK_THRESHOLD;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + -M) + if [ -z "$VIASH_PAR_QUALITY_MASK_THRESHOLD" ]; then + VIASH_PAR_QUALITY_MASK_THRESHOLD="$2" + else + VIASH_PAR_QUALITY_MASK_THRESHOLD="$VIASH_PAR_QUALITY_MASK_THRESHOLD;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to -M. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --filter_control_reads) + [ -n "$VIASH_PAR_FILTER_CONTROL_READS" ] && ViashError Bad arguments for option \'--filter_control_reads\': \'$VIASH_PAR_FILTER_CONTROL_READS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FILTER_CONTROL_READS=true + shift 1 + ;; + -C) + [ -n "$VIASH_PAR_FILTER_CONTROL_READS" ] && ViashError Bad arguments for option \'-C\': \'$VIASH_PAR_FILTER_CONTROL_READS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FILTER_CONTROL_READS=true + shift 1 + ;; + --filter_failing_quality) + [ -n "$VIASH_PAR_FILTER_FAILING_QUALITY" ] && ViashError Bad arguments for option \'--filter_failing_quality\': \'$VIASH_PAR_FILTER_FAILING_QUALITY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FILTER_FAILING_QUALITY=true + shift 1 + ;; + -Q) + [ -n "$VIASH_PAR_FILTER_FAILING_QUALITY" ] && ViashError Bad arguments for option \'-Q\': \'$VIASH_PAR_FILTER_FAILING_QUALITY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_FILTER_FAILING_QUALITY=true + shift 1 + ;; + --output_types) + if [ -z "$VIASH_PAR_OUTPUT_TYPES" ]; then + VIASH_PAR_OUTPUT_TYPES="$2" + else + VIASH_PAR_OUTPUT_TYPES="$VIASH_PAR_OUTPUT_TYPES;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --output_types. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --output_types=*) + if [ -z "$VIASH_PAR_OUTPUT_TYPES" ]; then + VIASH_PAR_OUTPUT_TYPES=$(ViashRemoveFlags "$1") + else + VIASH_PAR_OUTPUT_TYPES="$VIASH_PAR_OUTPUT_TYPES;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + -T) + if [ -z "$VIASH_PAR_OUTPUT_TYPES" ]; then + VIASH_PAR_OUTPUT_TYPES="$2" + else + VIASH_PAR_OUTPUT_TYPES="$VIASH_PAR_OUTPUT_TYPES;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to -T. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --undetermined_sample_name) + [ -n "$VIASH_PAR_UNDETERMINED_SAMPLE_NAME" ] && ViashError Bad arguments for option \'--undetermined_sample_name\': \'$VIASH_PAR_UNDETERMINED_SAMPLE_NAME\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_UNDETERMINED_SAMPLE_NAME="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --undetermined_sample_name. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --undetermined_sample_name=*) + [ -n "$VIASH_PAR_UNDETERMINED_SAMPLE_NAME" ] && ViashError Bad arguments for option \'--undetermined_sample_name=*\': \'$VIASH_PAR_UNDETERMINED_SAMPLE_NAME\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_UNDETERMINED_SAMPLE_NAME=$(ViashRemoveFlags "$1") + shift 1 + ;; + -u) + [ -n "$VIASH_PAR_UNDETERMINED_SAMPLE_NAME" ] && ViashError Bad arguments for option \'-u\': \'$VIASH_PAR_UNDETERMINED_SAMPLE_NAME\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_UNDETERMINED_SAMPLE_NAME="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -u. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --most_unmatched_to_output) + [ -n "$VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT" ] && ViashError Bad arguments for option \'--most_unmatched_to_output\': \'$VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --most_unmatched_to_output. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --most_unmatched_to_output=*) + [ -n "$VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT" ] && ViashError Bad arguments for option \'--most_unmatched_to_output=*\': \'$VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT=$(ViashRemoveFlags "$1") + shift 1 + ;; + -U) + [ -n "$VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT" ] && ViashError Bad arguments for option \'-U\': \'$VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to -U. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --override_matcher) + [ -n "$VIASH_PAR_OVERRIDE_MATCHER" ] && ViashError Bad arguments for option \'--override_matcher\': \'$VIASH_PAR_OVERRIDE_MATCHER\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_OVERRIDE_MATCHER="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --override_matcher. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --override_matcher=*) + [ -n "$VIASH_PAR_OVERRIDE_MATCHER" ] && ViashError Bad arguments for option \'--override_matcher=*\': \'$VIASH_PAR_OVERRIDE_MATCHER\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_OVERRIDE_MATCHER=$(ViashRemoveFlags "$1") + shift 1 + ;; + --skip_read_name_check) + [ -n "$VIASH_PAR_SKIP_READ_NAME_CHECK" ] && ViashError Bad arguments for option \'--skip_read_name_check\': \'$VIASH_PAR_SKIP_READ_NAME_CHECK\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_SKIP_READ_NAME_CHECK=true + shift 1 + ;; + --sample_barcode_in_fastq_header) + [ -n "$VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER" ] && ViashError Bad arguments for option \'--sample_barcode_in_fastq_header\': \'$VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER=true + shift 1 + ;; + --metric_prefix) + [ -n "$VIASH_PAR_METRIC_PREFIX" ] && ViashError Bad arguments for option \'--metric_prefix\': \'$VIASH_PAR_METRIC_PREFIX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_METRIC_PREFIX="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --metric_prefix. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --metric_prefix=*) + [ -n "$VIASH_PAR_METRIC_PREFIX" ] && ViashError Bad arguments for option \'--metric_prefix=*\': \'$VIASH_PAR_METRIC_PREFIX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_METRIC_PREFIX=$(ViashRemoveFlags "$1") + shift 1 + ;; + --lane) + if [ -z "$VIASH_PAR_LANE" ]; then + VIASH_PAR_LANE="$2" + else + VIASH_PAR_LANE="$VIASH_PAR_LANE;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --lane. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --lane=*) + if [ -z "$VIASH_PAR_LANE" ]; then + VIASH_PAR_LANE=$(ViashRemoveFlags "$1") + else + VIASH_PAR_LANE="$VIASH_PAR_LANE;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + -l) + if [ -z "$VIASH_PAR_LANE" ]; then + VIASH_PAR_LANE="$2" + else + VIASH_PAR_LANE="$VIASH_PAR_LANE;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to -l. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + ---engine) + VIASH_ENGINE_ID="$2" + shift 2 + ;; + ---engine=*) + VIASH_ENGINE_ID="$(ViashRemoveFlags "$1")" + shift 1 + ;; + ---setup) + VIASH_MODE='setup' + VIASH_SETUP_STRATEGY="$2" + shift 2 + ;; + ---setup=*) + VIASH_MODE='setup' + VIASH_SETUP_STRATEGY="$(ViashRemoveFlags "$1")" + shift 1 + ;; + ---dockerfile) + VIASH_MODE='dockerfile' + shift 1 + ;; + ---docker_run_args) + VIASH_DOCKER_RUN_ARGS+=("$2") + shift 2 + ;; + ---docker_run_args=*) + VIASH_DOCKER_RUN_ARGS+=("$(ViashRemoveFlags "$1")") + shift 1 + ;; + ---docker_image_id) + VIASH_MODE='docker_image_id' + shift 1 + ;; + ---debug) + VIASH_MODE='debug' + shift 1 + ;; + ---cpus) + [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_CPUS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to ---cpus. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + ---cpus=*) + [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus=*\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_CPUS=$(ViashRemoveFlags "$1") + shift 1 + ;; + ---memory) + [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_MEMORY="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to ---memory. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + ---memory=*) + [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory=*\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_MEMORY=$(ViashRemoveFlags "$1") + shift 1 + ;; + *) # positional arg or unknown option + # since the positional args will be eval'd, can we always quote, instead of using ViashQuote + VIASH_POSITIONAL_ARGS="$VIASH_POSITIONAL_ARGS '$1'" + [[ $1 == -* ]] && ViashWarning $1 looks like a parameter but is not a defined parameter and will instead be treated as a positional argument. Use "--help" to get more information on the parameters. + shift # past argument + ;; + esac +done + +# parse positional parameters +eval set -- $VIASH_POSITIONAL_ARGS + + +if [ "$VIASH_ENGINE_ID" == "native" ] ; then + VIASH_ENGINE_TYPE='native' +elif [ "$VIASH_ENGINE_ID" == "docker" ] ; then + VIASH_ENGINE_TYPE='docker' +else + ViashError "Engine '$VIASH_ENGINE_ID' is not recognized. Options are: docker, native." + exit 1 +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # check if docker is installed properly + ViashDockerInstallationCheck + + # determine docker image id + if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then + VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/sgdemux:main' + fi + + # print dockerfile + if [ "$VIASH_MODE" == "dockerfile" ]; then + ViashDockerfile "$VIASH_ENGINE_ID" + exit 0 + + elif [ "$VIASH_MODE" == "docker_image_id" ]; then + echo "$VIASH_DOCKER_IMAGE_ID" + exit 0 + + # enter docker container + elif [[ "$VIASH_MODE" == "debug" ]]; then + VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} -v '$(pwd)':/pwd --workdir /pwd -t $VIASH_DOCKER_IMAGE_ID" + ViashNotice "+ $VIASH_CMD" + eval $VIASH_CMD + exit + + # build docker image + elif [ "$VIASH_MODE" == "setup" ]; then + ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" "$VIASH_SETUP_STRATEGY" + ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash' + exit 0 + fi + + # check if docker image exists + ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" ifneedbepullelsecachedbuild + ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash' +fi + +# setting computational defaults + +# helper function for parsing memory strings +function ViashMemoryAsBytes { + local memory=`echo "$1" | tr '[:upper:]' '[:lower:]' | tr -d '[:space:]'` + local memory_regex='^([0-9]+)([kmgtp]i?b?|b)$' + if [[ $memory =~ $memory_regex ]]; then + local number=${memory/[^0-9]*/} + local symbol=${memory/*[0-9]/} + + case $symbol in + b) memory_b=$number ;; + kb|k) memory_b=$(( $number * 1000 )) ;; + mb|m) memory_b=$(( $number * 1000 * 1000 )) ;; + gb|g) memory_b=$(( $number * 1000 * 1000 * 1000 )) ;; + tb|t) memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 )) ;; + pb|p) memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 * 1000 )) ;; + kib|ki) memory_b=$(( $number * 1024 )) ;; + mib|mi) memory_b=$(( $number * 1024 * 1024 )) ;; + gib|gi) memory_b=$(( $number * 1024 * 1024 * 1024 )) ;; + tib|ti) memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 )) ;; + pib|pi) memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 * 1024 )) ;; + esac + echo "$memory_b" + fi +} +# compute memory in different units +if [ ! -z ${VIASH_META_MEMORY+x} ]; then + VIASH_META_MEMORY_B=`ViashMemoryAsBytes $VIASH_META_MEMORY` + # do not define other variables if memory_b is an empty string + if [ ! -z "$VIASH_META_MEMORY_B" ]; then + VIASH_META_MEMORY_KB=$(( ($VIASH_META_MEMORY_B+999) / 1000 )) + VIASH_META_MEMORY_MB=$(( ($VIASH_META_MEMORY_KB+999) / 1000 )) + VIASH_META_MEMORY_GB=$(( ($VIASH_META_MEMORY_MB+999) / 1000 )) + VIASH_META_MEMORY_TB=$(( ($VIASH_META_MEMORY_GB+999) / 1000 )) + VIASH_META_MEMORY_PB=$(( ($VIASH_META_MEMORY_TB+999) / 1000 )) + VIASH_META_MEMORY_KIB=$(( ($VIASH_META_MEMORY_B+1023) / 1024 )) + VIASH_META_MEMORY_MIB=$(( ($VIASH_META_MEMORY_KIB+1023) / 1024 )) + VIASH_META_MEMORY_GIB=$(( ($VIASH_META_MEMORY_MIB+1023) / 1024 )) + VIASH_META_MEMORY_TIB=$(( ($VIASH_META_MEMORY_GIB+1023) / 1024 )) + VIASH_META_MEMORY_PIB=$(( ($VIASH_META_MEMORY_TIB+1023) / 1024 )) + else + # unset memory if string is empty + unset $VIASH_META_MEMORY_B + fi +fi +# unset nproc if string is empty +if [ -z "$VIASH_META_CPUS" ]; then + unset $VIASH_META_CPUS +fi + + +# check whether required parameters exist +if [ -z ${VIASH_PAR_FASTQS+x} ]; then + ViashError '--fastqs' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_PAR_SAMPLE_METADATA+x} ]; then + ViashError '--sample_metadata' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_PAR_SAMPLE_FASTQ+x} ]; then + ViashError '--sample_fastq' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_NAME+x} ]; then + ViashError 'name' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then + ViashError 'functionality_name' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_RESOURCES_DIR+x} ]; then + ViashError 'resources_dir' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_EXECUTABLE+x} ]; then + ViashError 'executable' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_CONFIG+x} ]; then + ViashError 'config' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_TEMP_DIR+x} ]; then + ViashError 'temp_dir' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi + +# filling in defaults +if [ -z ${VIASH_PAR_FILTER_CONTROL_READS+x} ]; then + VIASH_PAR_FILTER_CONTROL_READS="false" +fi +if [ -z ${VIASH_PAR_FILTER_FAILING_QUALITY+x} ]; then + VIASH_PAR_FILTER_FAILING_QUALITY="false" +fi +if [ -z ${VIASH_PAR_SKIP_READ_NAME_CHECK+x} ]; then + VIASH_PAR_SKIP_READ_NAME_CHECK="false" +fi +if [ -z ${VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER+x} ]; then + VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER="false" +fi + +# check whether required files exist +if [ ! -z "$VIASH_PAR_FASTQS" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_FASTQS; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_SAMPLE_METADATA" ] && [ ! -e "$VIASH_PAR_SAMPLE_METADATA" ]; then + ViashError "Input file '$VIASH_PAR_SAMPLE_METADATA' does not exist." + exit 1 +fi + +# check whether parameters values are of the right type +if [[ -n "$VIASH_PAR_ALLOWED_MISMATCHES" ]]; then + if ! [[ "$VIASH_PAR_ALLOWED_MISMATCHES" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--allowed_mismatches' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_MIN_DELTA" ]]; then + if ! [[ "$VIASH_PAR_MIN_DELTA" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--min_delta' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_FREE_NS" ]]; then + if ! [[ "$VIASH_PAR_FREE_NS" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--free_ns' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_MAX_NO_CALLS" ]]; then + if ! [[ "$VIASH_PAR_MAX_NO_CALLS" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--max_no_calls' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [ -n "$VIASH_PAR_QUALITY_MASK_THRESHOLD" ]; then + IFS=';' + set -f + for val in $VIASH_PAR_QUALITY_MASK_THRESHOLD; do + if ! [[ "${val}" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--quality_mask_threshold' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi + done + set +f + unset IFS +fi + +if [[ -n "$VIASH_PAR_FILTER_CONTROL_READS" ]]; then + if ! [[ "$VIASH_PAR_FILTER_CONTROL_READS" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--filter_control_reads' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_FILTER_FAILING_QUALITY" ]]; then + if ! [[ "$VIASH_PAR_FILTER_FAILING_QUALITY" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--filter_failing_quality' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT" ]]; then + if ! [[ "$VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--most_unmatched_to_output' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_SKIP_READ_NAME_CHECK" ]]; then + if ! [[ "$VIASH_PAR_SKIP_READ_NAME_CHECK" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--skip_read_name_check' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER" ]]; then + if ! [[ "$VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then + ViashError '--sample_barcode_in_fastq_header' has to be a boolean_true. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [ -n "$VIASH_PAR_LANE" ]; then + IFS=';' + set -f + for val in $VIASH_PAR_LANE; do + if ! [[ "${val}" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--lane' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi + done + set +f + unset IFS +fi + +if [[ -n "$VIASH_META_CPUS" ]]; then + if ! [[ "$VIASH_META_CPUS" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'cpus' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_B" ]]; then + if ! [[ "$VIASH_META_MEMORY_B" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_b' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_KB" ]]; then + if ! [[ "$VIASH_META_MEMORY_KB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_kb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_MB" ]]; then + if ! [[ "$VIASH_META_MEMORY_MB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_mb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_GB" ]]; then + if ! [[ "$VIASH_META_MEMORY_GB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_gb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_TB" ]]; then + if ! [[ "$VIASH_META_MEMORY_TB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_tb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_PB" ]]; then + if ! [[ "$VIASH_META_MEMORY_PB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_pb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_KIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_KIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_kib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_MIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_MIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_mib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_GIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_GIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_gib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_TIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_TIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_tib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_PIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_PIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_pib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi + +# check whether value is belongs to a set of choices +if [ ! -z "$VIASH_PAR_OUTPUT_TYPES" ]; then + VIASH_PAR_OUTPUT_TYPES_CHOICES=("T;B;S;M") + IFS=';' + set -f + for val in $VIASH_PAR_OUTPUT_TYPES; do + if ! [[ ";${VIASH_PAR_OUTPUT_TYPES_CHOICES[*]};" =~ ";${val};" ]]; then + ViashError '--output_types' specified value of \'${val}\' is not in the list of allowed values. Use "--help" to get more information on the parameters. + exit 1 + fi + done + set +f + unset IFS +fi + +if [ ! -z "$VIASH_PAR_OVERRIDE_MATCHER" ]; then + VIASH_PAR_OVERRIDE_MATCHER_CHOICES=("cached-hamming-distance;pre-compute") + IFS=';' + set -f + if ! [[ ";${VIASH_PAR_OVERRIDE_MATCHER_CHOICES[*]};" =~ ";$VIASH_PAR_OVERRIDE_MATCHER;" ]]; then + ViashError '--override_matcher' specified value of \'$VIASH_PAR_OVERRIDE_MATCHER\' is not in the list of allowed values. Use "--help" to get more information on the parameters. + exit 1 + fi + set +f + unset IFS +fi + +# create parent directories of output files, if so desired +if [ ! -z "$VIASH_PAR_SAMPLE_FASTQ" ] && [ ! -d "$(dirname "$VIASH_PAR_SAMPLE_FASTQ")" ]; then + mkdir -p "$(dirname "$VIASH_PAR_SAMPLE_FASTQ")" +fi +if [ ! -z "$VIASH_PAR_METRICS" ] && [ ! -d "$(dirname "$VIASH_PAR_METRICS")" ]; then + mkdir -p "$(dirname "$VIASH_PAR_METRICS")" +fi +if [ ! -z "$VIASH_PAR_MOST_FREQUENT_UNMATCHED" ] && [ ! -d "$(dirname "$VIASH_PAR_MOST_FREQUENT_UNMATCHED")" ]; then + mkdir -p "$(dirname "$VIASH_PAR_MOST_FREQUENT_UNMATCHED")" +fi +if [ ! -z "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS" ] && [ ! -d "$(dirname "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS")" ]; then + mkdir -p "$(dirname "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS")" +fi +if [ ! -z "$VIASH_PAR_PER_PROJECT_METRICS" ] && [ ! -d "$(dirname "$VIASH_PAR_PER_PROJECT_METRICS")" ]; then + mkdir -p "$(dirname "$VIASH_PAR_PER_PROJECT_METRICS")" +fi +if [ ! -z "$VIASH_PAR_PER_SAMPLE_METRICS" ] && [ ! -d "$(dirname "$VIASH_PAR_PER_SAMPLE_METRICS")" ]; then + mkdir -p "$(dirname "$VIASH_PAR_PER_SAMPLE_METRICS")" +fi + +if [ "$VIASH_ENGINE_ID" == "native" ] ; then + if [ "$VIASH_MODE" == "run" ]; then + VIASH_CMD="bash" + else + ViashError "Engine '$VIASH_ENGINE_ID' does not support mode '$VIASH_MODE'." + exit 1 + fi +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # detect volumes from file arguments + VIASH_CHOWN_VARS=() +if [ ! -z "$VIASH_PAR_FASTQS" ]; then + VIASH_TEST_FASTQS=() + IFS=';' + for var in $VIASH_PAR_FASTQS; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_FASTQS+=( "$var" ) + done + VIASH_PAR_FASTQS=$(IFS=';' ; echo "${VIASH_TEST_FASTQS[*]}") +fi +if [ ! -z "$VIASH_PAR_SAMPLE_METADATA" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_SAMPLE_METADATA")" ) + VIASH_PAR_SAMPLE_METADATA=$(ViashDockerAutodetectMount "$VIASH_PAR_SAMPLE_METADATA") +fi +if [ ! -z "$VIASH_PAR_SAMPLE_FASTQ" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_SAMPLE_FASTQ")" ) + VIASH_PAR_SAMPLE_FASTQ=$(ViashDockerAutodetectMount "$VIASH_PAR_SAMPLE_FASTQ") + VIASH_CHOWN_VARS+=( "$VIASH_PAR_SAMPLE_FASTQ" ) +fi +if [ ! -z "$VIASH_PAR_METRICS" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_METRICS")" ) + VIASH_PAR_METRICS=$(ViashDockerAutodetectMount "$VIASH_PAR_METRICS") + VIASH_CHOWN_VARS+=( "$VIASH_PAR_METRICS" ) +fi +if [ ! -z "$VIASH_PAR_MOST_FREQUENT_UNMATCHED" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_MOST_FREQUENT_UNMATCHED")" ) + VIASH_PAR_MOST_FREQUENT_UNMATCHED=$(ViashDockerAutodetectMount "$VIASH_PAR_MOST_FREQUENT_UNMATCHED") + VIASH_CHOWN_VARS+=( "$VIASH_PAR_MOST_FREQUENT_UNMATCHED" ) +fi +if [ ! -z "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS")" ) + VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS=$(ViashDockerAutodetectMount "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS") + VIASH_CHOWN_VARS+=( "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS" ) +fi +if [ ! -z "$VIASH_PAR_PER_PROJECT_METRICS" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_PER_PROJECT_METRICS")" ) + VIASH_PAR_PER_PROJECT_METRICS=$(ViashDockerAutodetectMount "$VIASH_PAR_PER_PROJECT_METRICS") + VIASH_CHOWN_VARS+=( "$VIASH_PAR_PER_PROJECT_METRICS" ) +fi +if [ ! -z "$VIASH_PAR_PER_SAMPLE_METRICS" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_PER_SAMPLE_METRICS")" ) + VIASH_PAR_PER_SAMPLE_METRICS=$(ViashDockerAutodetectMount "$VIASH_PAR_PER_SAMPLE_METRICS") + VIASH_CHOWN_VARS+=( "$VIASH_PAR_PER_SAMPLE_METRICS" ) +fi +if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" ) + VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR") +fi +if [ ! -z "$VIASH_META_EXECUTABLE" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_EXECUTABLE")" ) + VIASH_META_EXECUTABLE=$(ViashDockerAutodetectMount "$VIASH_META_EXECUTABLE") +fi +if [ ! -z "$VIASH_META_CONFIG" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_CONFIG")" ) + VIASH_META_CONFIG=$(ViashDockerAutodetectMount "$VIASH_META_CONFIG") +fi +if [ ! -z "$VIASH_META_TEMP_DIR" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_TEMP_DIR")" ) + VIASH_META_TEMP_DIR=$(ViashDockerAutodetectMount "$VIASH_META_TEMP_DIR") +fi + + # get unique mounts + VIASH_UNIQUE_MOUNTS=($(for val in "${VIASH_DIRECTORY_MOUNTS[@]}"; do echo "$val"; done | sort -u)) +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # change file ownership + function ViashPerformChown { + if (( ${#VIASH_CHOWN_VARS[@]} )); then + set +e + VIASH_CMD="docker run --entrypoint=bash --rm ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID -c 'chown $(id -u):$(id -g) --silent --recursive ${VIASH_CHOWN_VARS[@]}'" + ViashDebug "+ $VIASH_CMD" + eval $VIASH_CMD + set -e + fi + } + trap ViashPerformChown EXIT +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # helper function for filling in extra docker args + if [ ! -z "$VIASH_META_MEMORY_B" ]; then + VIASH_DOCKER_RUN_ARGS+=("--memory=${VIASH_META_MEMORY_B}") + fi + if [ ! -z "$VIASH_META_CPUS" ]; then + VIASH_DOCKER_RUN_ARGS+=("--cpus=${VIASH_META_CPUS}") + fi +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID" +fi + + +# set dependency paths + + +ViashDebug "Running command: $(echo $VIASH_CMD)" +cat << VIASHEOF | eval $VIASH_CMD +set -e +tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-sgdemux-XXXXXX").sh +function clean_up { + rm "\$tempscript" +} +function interrupt { + echo -e "\nCTRL-C Pressed..." + exit 1 +} +trap clean_up EXIT +trap interrupt INT SIGINT +cat > "\$tempscript" << 'VIASHMAIN' +#!/bin/bash + +set -eo pipefail + +## VIASH START +# The following code has been auto-generated by Viash. +$( if [ ! -z ${VIASH_PAR_FASTQS+x} ]; then echo "${VIASH_PAR_FASTQS}" | sed "s#'#'\"'\"'#g;s#.*#par_fastqs='&'#" ; else echo "# par_fastqs="; fi ) +$( if [ ! -z ${VIASH_PAR_SAMPLE_METADATA+x} ]; then echo "${VIASH_PAR_SAMPLE_METADATA}" | sed "s#'#'\"'\"'#g;s#.*#par_sample_metadata='&'#" ; else echo "# par_sample_metadata="; fi ) +$( if [ ! -z ${VIASH_PAR_SAMPLE_FASTQ+x} ]; then echo "${VIASH_PAR_SAMPLE_FASTQ}" | sed "s#'#'\"'\"'#g;s#.*#par_sample_fastq='&'#" ; else echo "# par_sample_fastq="; fi ) +$( if [ ! -z ${VIASH_PAR_METRICS+x} ]; then echo "${VIASH_PAR_METRICS}" | sed "s#'#'\"'\"'#g;s#.*#par_metrics='&'#" ; else echo "# par_metrics="; fi ) +$( if [ ! -z ${VIASH_PAR_MOST_FREQUENT_UNMATCHED+x} ]; then echo "${VIASH_PAR_MOST_FREQUENT_UNMATCHED}" | sed "s#'#'\"'\"'#g;s#.*#par_most_frequent_unmatched='&'#" ; else echo "# par_most_frequent_unmatched="; fi ) +$( if [ ! -z ${VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS+x} ]; then echo "${VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS}" | sed "s#'#'\"'\"'#g;s#.*#par_sample_barcode_hop_metrics='&'#" ; else echo "# par_sample_barcode_hop_metrics="; fi ) +$( if [ ! -z ${VIASH_PAR_PER_PROJECT_METRICS+x} ]; then echo "${VIASH_PAR_PER_PROJECT_METRICS}" | sed "s#'#'\"'\"'#g;s#.*#par_per_project_metrics='&'#" ; else echo "# par_per_project_metrics="; fi ) +$( if [ ! -z ${VIASH_PAR_PER_SAMPLE_METRICS+x} ]; then echo "${VIASH_PAR_PER_SAMPLE_METRICS}" | sed "s#'#'\"'\"'#g;s#.*#par_per_sample_metrics='&'#" ; else echo "# par_per_sample_metrics="; fi ) +$( if [ ! -z ${VIASH_PAR_READ_STRUCTURES+x} ]; then echo "${VIASH_PAR_READ_STRUCTURES}" | sed "s#'#'\"'\"'#g;s#.*#par_read_structures='&'#" ; else echo "# par_read_structures="; fi ) +$( if [ ! -z ${VIASH_PAR_ALLOWED_MISMATCHES+x} ]; then echo "${VIASH_PAR_ALLOWED_MISMATCHES}" | sed "s#'#'\"'\"'#g;s#.*#par_allowed_mismatches='&'#" ; else echo "# par_allowed_mismatches="; fi ) +$( if [ ! -z ${VIASH_PAR_MIN_DELTA+x} ]; then echo "${VIASH_PAR_MIN_DELTA}" | sed "s#'#'\"'\"'#g;s#.*#par_min_delta='&'#" ; else echo "# par_min_delta="; fi ) +$( if [ ! -z ${VIASH_PAR_FREE_NS+x} ]; then echo "${VIASH_PAR_FREE_NS}" | sed "s#'#'\"'\"'#g;s#.*#par_free_ns='&'#" ; else echo "# par_free_ns="; fi ) +$( if [ ! -z ${VIASH_PAR_MAX_NO_CALLS+x} ]; then echo "${VIASH_PAR_MAX_NO_CALLS}" | sed "s#'#'\"'\"'#g;s#.*#par_max_no_calls='&'#" ; else echo "# par_max_no_calls="; fi ) +$( if [ ! -z ${VIASH_PAR_QUALITY_MASK_THRESHOLD+x} ]; then echo "${VIASH_PAR_QUALITY_MASK_THRESHOLD}" | sed "s#'#'\"'\"'#g;s#.*#par_quality_mask_threshold='&'#" ; else echo "# par_quality_mask_threshold="; fi ) +$( if [ ! -z ${VIASH_PAR_FILTER_CONTROL_READS+x} ]; then echo "${VIASH_PAR_FILTER_CONTROL_READS}" | sed "s#'#'\"'\"'#g;s#.*#par_filter_control_reads='&'#" ; else echo "# par_filter_control_reads="; fi ) +$( if [ ! -z ${VIASH_PAR_FILTER_FAILING_QUALITY+x} ]; then echo "${VIASH_PAR_FILTER_FAILING_QUALITY}" | sed "s#'#'\"'\"'#g;s#.*#par_filter_failing_quality='&'#" ; else echo "# par_filter_failing_quality="; fi ) +$( if [ ! -z ${VIASH_PAR_OUTPUT_TYPES+x} ]; then echo "${VIASH_PAR_OUTPUT_TYPES}" | sed "s#'#'\"'\"'#g;s#.*#par_output_types='&'#" ; else echo "# par_output_types="; fi ) +$( if [ ! -z ${VIASH_PAR_UNDETERMINED_SAMPLE_NAME+x} ]; then echo "${VIASH_PAR_UNDETERMINED_SAMPLE_NAME}" | sed "s#'#'\"'\"'#g;s#.*#par_undetermined_sample_name='&'#" ; else echo "# par_undetermined_sample_name="; fi ) +$( if [ ! -z ${VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT+x} ]; then echo "${VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_most_unmatched_to_output='&'#" ; else echo "# par_most_unmatched_to_output="; fi ) +$( if [ ! -z ${VIASH_PAR_OVERRIDE_MATCHER+x} ]; then echo "${VIASH_PAR_OVERRIDE_MATCHER}" | sed "s#'#'\"'\"'#g;s#.*#par_override_matcher='&'#" ; else echo "# par_override_matcher="; fi ) +$( if [ ! -z ${VIASH_PAR_SKIP_READ_NAME_CHECK+x} ]; then echo "${VIASH_PAR_SKIP_READ_NAME_CHECK}" | sed "s#'#'\"'\"'#g;s#.*#par_skip_read_name_check='&'#" ; else echo "# par_skip_read_name_check="; fi ) +$( if [ ! -z ${VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER+x} ]; then echo "${VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER}" | sed "s#'#'\"'\"'#g;s#.*#par_sample_barcode_in_fastq_header='&'#" ; else echo "# par_sample_barcode_in_fastq_header="; fi ) +$( if [ ! -z ${VIASH_PAR_METRIC_PREFIX+x} ]; then echo "${VIASH_PAR_METRIC_PREFIX}" | sed "s#'#'\"'\"'#g;s#.*#par_metric_prefix='&'#" ; else echo "# par_metric_prefix="; fi ) +$( if [ ! -z ${VIASH_PAR_LANE+x} ]; then echo "${VIASH_PAR_LANE}" | sed "s#'#'\"'\"'#g;s#.*#par_lane='&'#" ; else echo "# par_lane="; fi ) +$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi ) +$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi ) +$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi ) +$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\"'\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi ) +$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi ) +$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi ) +$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\"'\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi ) + +## VIASH END + +unset_if_false=( + par_filter_control_reads + par_filter_failing_quality + par_skip_read_name_check + par_sample_barcode_in_fastq_header +) + +for par in \${unset_if_false[@]}; do + test_val="\${!par}" + [[ "\$test_val" == "false" ]] && unset \$par +done + +# Create arrays for inputs that contain multiple arguments +IFS=";" read -ra fastqs <<< "\$par_fastqs" +IFS=";" read -ra read_structures <<< "\$par_read_structures" +IFS=";" read -ra lane <<< "\$par_lane" +IFS=";" read -ra quality_mask_threashold <<< "\$par_quality_mask_threshold" +IFS=";" read -ra output_types <<< "\$par_output_types" + +echo "> Creating temporary directory" +# create temporary directory and clean up on exit +TMPDIR=\$(mktemp -d "\$meta_temp_dir/\$meta_name-XXXXXX") +function clean_up { + [[ -d "\$TMPDIR" ]] && rm -rf "\$TMPDIR" +} +trap clean_up EXIT +echo "> Temporary directory '\$TMPDIR' created" + +if [ "\$par_most_unmatched_to_output" -eq "0" ] && [ ! -z "\$par_most_frequent_unmatched" ]; then + echo "Requested to output 'most_frequent_unmatched' file, but 'most_unmatched_to_output' is set to 0." + exit 1 +fi + +# The sgdemux documentation recommends the following settings: +# 1/3 of available threads for compression +# 1/6 of available threads for writing +# 1/6-1/3 of available threads for demultiplexing +declare -A thread_settings=(["compression_threads"]="3" + ["writing_threads"]="6" + ["demultiplexing_threads"]="3" + ) +if [ ! -z "\$meta_cpus" ]; then + for setting_var in "\${!thread_settings[@]}"; do + denominator=\${thread_settings[\$setting_var]} + result=\$(( \$meta_cpus / \$denominator )) + if (( \$result == 0 )); then + result=1 + fi + declare \$setting_var=\$result + done +fi + +args=( + --fastqs \${fastqs[@]} + --sample-metadata "\$par_sample_metadata" + --output-dir "\$TMPDIR" + \${demultiplexing_threads:+--demux-threads \$demultiplexing_threads} + \${writing_threads:+--writer-threads \$writing_threads} + \${compression_threads:+--compressor-threads \$compression_threads} + \${par_allowed_mismatches:+--allowed-mismatches \$par_allowed_mismatches} + \${par_min_delta:+--min-delta \$par_min_delta} + \${par_free_ns:+--free-ns \$par_free_ns} + \${par_max_no_calls:+--max-no-calls \$par_max_no_calls} + \${quality_mask_threashold:+--quality-mask-threshold "\${quality_mask_threashold[*]}" } + \${output_types:+--output-types "\${output_types[*]}"} + \${par_undetermined_sample_name:+--undetermined-sample-name \${par_undetermined_sample_name}} + \${par_most_unmatched_to_output:+--par-most-unmatched-to-output \${par_most_unmatched_to_output}} + \${par_override_matcher:+--override-matcher \$par_override_matcher} + \${par_metric_prefix:+--metric-prefix \$par_metric_prefix} + \${lane:+--lane "\${lane[*]}"} + \${read_structures:+--read-structures \${read_structures[*]}} + \${par_filter_control_reads:+--filter-control-reads} + \${par_filter_failing_quality:+--filter-failing-quality} + \${par_skip_read_name_check:+--skip-read-name-check} + \${par_sample_barcode_in_fastq_header:+--sample-barcode-in-fastq-header} +) + +echo "> Running sgdemux with arguments: \${args[@]}" +sgdemux \${args[@]} +echo "> Done running sgdemux" + +echo "> Copying FASTQ files to \$par_sample_fastq" +find "\$TMPDIR" -type f -name "*.fastq.gz" -exec mv '{}' "\$par_sample_fastq" \\; + +declare -A output_files=(["metrics.tsv"]="par_metrics" + ["most_frequent_unmatched.tsv"]="par_most_frequent_unmatched" + ["sample_barcode_hop_metrics.tsv"]="par_sample_barcode_hop_metrics" + ["per_project_metrics.tsv"]="par_per_project_metrics" + ["per_sample_metrics.tsv"]="par_per_sample_metrics" + ) + +for output_file_name in "\${!output_files[@]}"; do + output_arg_variable_name=\${output_files[\$output_file_name]} + destination="\${!output_arg_variable_name}" + if [ ! -z "\$destination" ]; then + echo "> Copying \$output_file file to \$destination" + output_file="\$TMPDIR/\$output_file_name" + if [ ! -f "\$output_file" ]; then + echo "Expected a '\$output_file_name' to have been created! Exiting..." + exit 1 + fi + cp "\$output_file" "\$destination" + fi +done + +echo "> Finished!" +VIASHMAIN +bash "\$tempscript" & +wait "\$!" + +VIASHEOF + + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # strip viash automount from file paths + + if [ ! -z "$VIASH_PAR_FASTQS" ]; then + unset VIASH_TEST_FASTQS + IFS=';' + for var in $VIASH_PAR_FASTQS; do + unset IFS + if [ -z "$VIASH_TEST_FASTQS" ]; then + VIASH_TEST_FASTQS="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_FASTQS="$VIASH_TEST_FASTQS;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_FASTQS="$VIASH_TEST_FASTQS" + fi + if [ ! -z "$VIASH_PAR_SAMPLE_METADATA" ]; then + VIASH_PAR_SAMPLE_METADATA=$(ViashDockerStripAutomount "$VIASH_PAR_SAMPLE_METADATA") + fi + if [ ! -z "$VIASH_PAR_SAMPLE_FASTQ" ]; then + VIASH_PAR_SAMPLE_FASTQ=$(ViashDockerStripAutomount "$VIASH_PAR_SAMPLE_FASTQ") + fi + if [ ! -z "$VIASH_PAR_METRICS" ]; then + VIASH_PAR_METRICS=$(ViashDockerStripAutomount "$VIASH_PAR_METRICS") + fi + if [ ! -z "$VIASH_PAR_MOST_FREQUENT_UNMATCHED" ]; then + VIASH_PAR_MOST_FREQUENT_UNMATCHED=$(ViashDockerStripAutomount "$VIASH_PAR_MOST_FREQUENT_UNMATCHED") + fi + if [ ! -z "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS" ]; then + VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS=$(ViashDockerStripAutomount "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS") + fi + if [ ! -z "$VIASH_PAR_PER_PROJECT_METRICS" ]; then + VIASH_PAR_PER_PROJECT_METRICS=$(ViashDockerStripAutomount "$VIASH_PAR_PER_PROJECT_METRICS") + fi + if [ ! -z "$VIASH_PAR_PER_SAMPLE_METRICS" ]; then + VIASH_PAR_PER_SAMPLE_METRICS=$(ViashDockerStripAutomount "$VIASH_PAR_PER_SAMPLE_METRICS") + fi + if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then + VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR") + fi + if [ ! -z "$VIASH_META_EXECUTABLE" ]; then + VIASH_META_EXECUTABLE=$(ViashDockerStripAutomount "$VIASH_META_EXECUTABLE") + fi + if [ ! -z "$VIASH_META_CONFIG" ]; then + VIASH_META_CONFIG=$(ViashDockerStripAutomount "$VIASH_META_CONFIG") + fi + if [ ! -z "$VIASH_META_TEMP_DIR" ]; then + VIASH_META_TEMP_DIR=$(ViashDockerStripAutomount "$VIASH_META_TEMP_DIR") + fi +fi + + +# check whether required files exist +if [ ! -z "$VIASH_PAR_SAMPLE_FASTQ" ] && [ ! -e "$VIASH_PAR_SAMPLE_FASTQ" ]; then + ViashError "Output file '$VIASH_PAR_SAMPLE_FASTQ' does not exist." + exit 1 +fi +if [ ! -z "$VIASH_PAR_METRICS" ] && [ ! -e "$VIASH_PAR_METRICS" ]; then + ViashError "Output file '$VIASH_PAR_METRICS' does not exist." + exit 1 +fi +if [ ! -z "$VIASH_PAR_MOST_FREQUENT_UNMATCHED" ] && [ ! -e "$VIASH_PAR_MOST_FREQUENT_UNMATCHED" ]; then + ViashError "Output file '$VIASH_PAR_MOST_FREQUENT_UNMATCHED' does not exist." + exit 1 +fi +if [ ! -z "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS" ] && [ ! -e "$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS" ]; then + ViashError "Output file '$VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS' does not exist." + exit 1 +fi +if [ ! -z "$VIASH_PAR_PER_PROJECT_METRICS" ] && [ ! -e "$VIASH_PAR_PER_PROJECT_METRICS" ]; then + ViashError "Output file '$VIASH_PAR_PER_PROJECT_METRICS' does not exist." + exit 1 +fi +if [ ! -z "$VIASH_PAR_PER_SAMPLE_METRICS" ] && [ ! -e "$VIASH_PAR_PER_SAMPLE_METRICS" ]; then + ViashError "Output file '$VIASH_PAR_PER_SAMPLE_METRICS' does not exist." + exit 1 +fi + + +exit 0 diff --git a/target/executable/snpeff/.config.vsh.yaml b/target/executable/snpeff/.config.vsh.yaml index 3763549c..0c7ca8bd 100644 --- a/target/executable/snpeff/.config.vsh.yaml +++ b/target/executable/snpeff/.config.vsh.yaml @@ -628,9 +628,9 @@ build_info: output: "target/executable/snpeff" executable: "target/executable/snpeff/snpeff" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/snpeff/snpeff b/target/executable/snpeff/snpeff index 9726646e..8461df3f 100755 --- a/target/executable/snpeff/snpeff +++ b/target/executable/snpeff/snpeff @@ -756,9 +756,9 @@ version_trimmed=$(echo "$version" | awk '{print $1, $2}') && \ echo "$version_trimmed" > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component snpeff" -LABEL org.opencontainers.image.created="2024-11-08T09:45:01Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:52Z" LABEL org.opencontainers.image.source="https://github.com/pcingola/SnpEff" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/sortmerna/.config.vsh.yaml b/target/executable/sortmerna/.config.vsh.yaml index 05e7b56a..9aaab7a4 100644 --- a/target/executable/sortmerna/.config.vsh.yaml +++ b/target/executable/sortmerna/.config.vsh.yaml @@ -594,9 +594,9 @@ build_info: output: "target/executable/sortmerna" executable: "target/executable/sortmerna/sortmerna" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/sortmerna/sortmerna b/target/executable/sortmerna/sortmerna index 5722ad7b..d5c36ced 100755 --- a/target/executable/sortmerna/sortmerna +++ b/target/executable/sortmerna/sortmerna @@ -740,9 +740,9 @@ ENTRYPOINT [] RUN echo SortMeRNA: `sortmerna --version | sed -n 's/.*version \([0-9]\+\.[0-9]\+\.[0-9]\+\).*/\1/p'` LABEL org.opencontainers.image.description="Companion container for running component sortmerna" -LABEL org.opencontainers.image.created="2024-11-08T09:45:02Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:53Z" LABEL org.opencontainers.image.source="https://github.com/sortmerna/sortmerna" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/star/star_align_reads/.config.vsh.yaml b/target/executable/star/star_align_reads/.config.vsh.yaml index 427a83d2..421f2568 100644 --- a/target/executable/star/star_align_reads/.config.vsh.yaml +++ b/target/executable/star/star_align_reads/.config.vsh.yaml @@ -2663,9 +2663,9 @@ build_info: output: "target/executable/star/star_align_reads" executable: "target/executable/star/star_align_reads/star_align_reads" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/star/star_align_reads/star_align_reads b/target/executable/star/star_align_reads/star_align_reads index d6e08815..78c97d62 100755 --- a/target/executable/star/star_align_reads/star_align_reads +++ b/target/executable/star/star_align_reads/star_align_reads @@ -1920,9 +1920,9 @@ RUN STAR --version | sed 's#\(.*\)#star: "\1"#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Angela Oliveira Pisco, Robrecht Cannoodt" LABEL org.opencontainers.image.description="Companion container for running component star star_align_reads" -LABEL org.opencontainers.image.created="2024-11-08T09:45:00Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:50Z" LABEL org.opencontainers.image.source="https://github.com/alexdobin/STAR" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/star/star_genome_generate/.config.vsh.yaml b/target/executable/star/star_genome_generate/.config.vsh.yaml index bfd8fcdc..e9d7fe1a 100644 --- a/target/executable/star/star_genome_generate/.config.vsh.yaml +++ b/target/executable/star/star_genome_generate/.config.vsh.yaml @@ -333,9 +333,9 @@ build_info: output: "target/executable/star/star_genome_generate" executable: "target/executable/star/star_genome_generate/star_genome_generate" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/star/star_genome_generate/star_genome_generate b/target/executable/star/star_genome_generate/star_genome_generate index 58122e6d..4c778deb 100755 --- a/target/executable/star/star_genome_generate/star_genome_generate +++ b/target/executable/star/star_genome_generate/star_genome_generate @@ -577,9 +577,9 @@ RUN STAR --version | sed 's#\(.*\)#star: "\1"#' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component star star_genome_generate" -LABEL org.opencontainers.image.created="2024-11-08T09:45:00Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:51Z" LABEL org.opencontainers.image.source="https://github.com/alexdobin/STAR" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/trimgalore/.config.vsh.yaml b/target/executable/trimgalore/.config.vsh.yaml index 932ba16a..638d48f7 100644 --- a/target/executable/trimgalore/.config.vsh.yaml +++ b/target/executable/trimgalore/.config.vsh.yaml @@ -770,9 +770,9 @@ build_info: output: "target/executable/trimgalore" executable: "target/executable/trimgalore/trimgalore" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/trimgalore/trimgalore b/target/executable/trimgalore/trimgalore index cca799bd..bc3c007b 100755 --- a/target/executable/trimgalore/trimgalore +++ b/target/executable/trimgalore/trimgalore @@ -881,9 +881,9 @@ RUN echo "TrimGalore: `trim_galore --version | sed -n 's/.*version\s\+\([0-9]\+\ LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa" LABEL org.opencontainers.image.description="Companion container for running component trimgalore" -LABEL org.opencontainers.image.created="2024-11-08T09:45:02Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:53Z" LABEL org.opencontainers.image.source="https://github.com/FelixKrueger/TrimGalore" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml b/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml index 2ebdf942..da0a3c96 100644 --- a/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml +++ b/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml @@ -611,9 +611,9 @@ build_info: output: "target/executable/umi_tools/umi_tools_dedup" executable: "target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup b/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup index c145da63..c10d2865 100755 --- a/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup +++ b/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup @@ -770,9 +770,9 @@ RUN umi_tools -v | sed 's/ version//g' > /var/software_versions.txt LABEL org.opencontainers.image.authors="Emma Rousseau" LABEL org.opencontainers.image.description="Companion container for running component umi_tools umi_tools_dedup" -LABEL org.opencontainers.image.created="2024-11-08T09:45:03Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:54Z" LABEL org.opencontainers.image.source="https://github.com/CGATOxford/UMI-tools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml b/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml index 5c427557..cf5af54c 100644 --- a/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml +++ b/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml @@ -434,9 +434,9 @@ build_info: output: "target/executable/umi_tools/umi_tools_extract" executable: "target/executable/umi_tools/umi_tools_extract/umi_tools_extract" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/umi_tools/umi_tools_extract/umi_tools_extract b/target/executable/umi_tools/umi_tools_extract/umi_tools_extract index 4d4ed9c7..d7992497 100755 --- a/target/executable/umi_tools/umi_tools_extract/umi_tools_extract +++ b/target/executable/umi_tools/umi_tools_extract/umi_tools_extract @@ -630,9 +630,9 @@ ENTRYPOINT [] RUN umi_tools -v | sed 's/ version//g' > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component umi_tools umi_tools_extract" -LABEL org.opencontainers.image.created="2024-11-08T09:45:02Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:53Z" LABEL org.opencontainers.image.source="https://github.com/CGATOxford/UMI-tools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml b/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml index c0a3edf7..408f5016 100644 --- a/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml +++ b/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml @@ -256,9 +256,9 @@ build_info: output: "target/executable/umi_tools/umi_tools_prepareforrsem" executable: "target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem b/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem index 67917f34..4fd6be66 100755 --- a/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem +++ b/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem @@ -519,9 +519,9 @@ ENTRYPOINT [] RUN umi_tools -v | sed 's/ version//g' > /var/software_versions.txt LABEL org.opencontainers.image.description="Companion container for running component umi_tools umi_tools_prepareforrsem" -LABEL org.opencontainers.image.created="2024-11-08T09:45:03Z" +LABEL org.opencontainers.image.created="2024-11-14T13:16:54Z" LABEL org.opencontainers.image.source="https://github.com/CGATOxford/UMI-tools" -LABEL org.opencontainers.image.revision="1d17ce01e25569c8e898b8160af1480ad22fc986" +LABEL org.opencontainers.image.revision="065297be5fb2d88020fc50e042bb3f49c9254ae9" LABEL org.opencontainers.image.version="main" VIASHDOCKER diff --git a/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml index c60fdb13..2c4879f4 100644 --- a/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml @@ -235,9 +235,9 @@ build_info: output: "target/nextflow/agat/agat_convert_bed2gff" executable: "target/nextflow/agat/agat_convert_bed2gff/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_bed2gff/main.nf b/target/nextflow/agat/agat_convert_bed2gff/main.nf index 81c62ed5..51bfacc0 100644 --- a/target/nextflow/agat/agat_convert_bed2gff/main.nf +++ b/target/nextflow/agat/agat_convert_bed2gff/main.nf @@ -3092,9 +3092,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_bed2gff", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml index c2715462..180fcbe6 100644 --- a/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml @@ -225,9 +225,9 @@ build_info: output: "target/nextflow/agat/agat_convert_embl2gff" executable: "target/nextflow/agat/agat_convert_embl2gff/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_embl2gff/main.nf b/target/nextflow/agat/agat_convert_embl2gff/main.nf index 78856e8b..80ec1176 100644 --- a/target/nextflow/agat/agat_convert_embl2gff/main.nf +++ b/target/nextflow/agat/agat_convert_embl2gff/main.nf @@ -3085,9 +3085,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_embl2gff", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml index 748f3fe0..98fbcabb 100644 --- a/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml @@ -230,9 +230,9 @@ build_info: output: "target/nextflow/agat/agat_convert_genscan2gff" executable: "target/nextflow/agat/agat_convert_genscan2gff/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_genscan2gff/main.nf b/target/nextflow/agat/agat_convert_genscan2gff/main.nf index 89737616..919cbc14 100644 --- a/target/nextflow/agat/agat_convert_genscan2gff/main.nf +++ b/target/nextflow/agat/agat_convert_genscan2gff/main.nf @@ -3087,9 +3087,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_genscan2gff", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_mfannot2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_mfannot2gff/.config.vsh.yaml index 281ce9cc..c3f220b0 100644 --- a/target/nextflow/agat/agat_convert_mfannot2gff/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_mfannot2gff/.config.vsh.yaml @@ -186,9 +186,9 @@ build_info: output: "target/nextflow/agat/agat_convert_mfannot2gff" executable: "target/nextflow/agat/agat_convert_mfannot2gff/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_mfannot2gff/main.nf b/target/nextflow/agat/agat_convert_mfannot2gff/main.nf index 5153b769..fd498d98 100644 --- a/target/nextflow/agat/agat_convert_mfannot2gff/main.nf +++ b/target/nextflow/agat/agat_convert_mfannot2gff/main.nf @@ -3047,9 +3047,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_mfannot2gff", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml b/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml index 5418bd81..0497e3bf 100644 --- a/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml @@ -228,9 +228,9 @@ build_info: output: "target/nextflow/agat/agat_convert_sp_gff2gtf" executable: "target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf b/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf index 0723dbac..fac4b555 100644 --- a/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf +++ b/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf @@ -3068,9 +3068,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_sp_gff2gtf", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml b/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml index 11f91054..e1f40baf 100644 --- a/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml @@ -188,9 +188,9 @@ build_info: output: "target/nextflow/agat/agat_convert_sp_gff2tsv" executable: "target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf b/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf index 67b99997..17553814 100644 --- a/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf +++ b/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf @@ -3046,9 +3046,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_sp_gff2tsv", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml b/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml index bcee10f8..6db345ff 100644 --- a/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml +++ b/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml @@ -195,9 +195,9 @@ build_info: output: "target/nextflow/agat/agat_convert_sp_gxf2gxf" executable: "target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf b/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf index 09cf924a..81cedf7f 100644 --- a/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf +++ b/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf @@ -3046,9 +3046,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_convert_sp_gxf2gxf", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_sp_add_introns/.config.vsh.yaml b/target/nextflow/agat/agat_sp_add_introns/.config.vsh.yaml index b11003ad..4fb2cb17 100644 --- a/target/nextflow/agat/agat_sp_add_introns/.config.vsh.yaml +++ b/target/nextflow/agat/agat_sp_add_introns/.config.vsh.yaml @@ -186,9 +186,9 @@ build_info: output: "target/nextflow/agat/agat_sp_add_introns" executable: "target/nextflow/agat/agat_sp_add_introns/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_sp_add_introns/main.nf b/target/nextflow/agat/agat_sp_add_introns/main.nf index e25a217d..68bf8fd0 100644 --- a/target/nextflow/agat/agat_sp_add_introns/main.nf +++ b/target/nextflow/agat/agat_sp_add_introns/main.nf @@ -3049,9 +3049,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_sp_add_introns", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml index ed99a752..643107f6 100644 --- a/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml +++ b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml @@ -236,9 +236,9 @@ build_info: output: "target/nextflow/agat/agat_sp_filter_feature_from_kill_list" executable: "target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf index bc1fb6b6..fe93255d 100644 --- a/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf +++ b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf @@ -3096,9 +3096,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_sp_filter_feature_from_kill_list", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_sp_merge_annotations/.config.vsh.yaml b/target/nextflow/agat/agat_sp_merge_annotations/.config.vsh.yaml index f29134f3..e021e668 100644 --- a/target/nextflow/agat/agat_sp_merge_annotations/.config.vsh.yaml +++ b/target/nextflow/agat/agat_sp_merge_annotations/.config.vsh.yaml @@ -184,9 +184,9 @@ build_info: output: "target/nextflow/agat/agat_sp_merge_annotations" executable: "target/nextflow/agat/agat_sp_merge_annotations/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_sp_merge_annotations/main.nf b/target/nextflow/agat/agat_sp_merge_annotations/main.nf index ba1db661..3de196a5 100644 --- a/target/nextflow/agat/agat_sp_merge_annotations/main.nf +++ b/target/nextflow/agat/agat_sp_merge_annotations/main.nf @@ -3046,9 +3046,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_sp_merge_annotations", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_sp_statistics/.config.vsh.yaml b/target/nextflow/agat/agat_sp_statistics/.config.vsh.yaml index 6cef925f..3e08d825 100644 --- a/target/nextflow/agat/agat_sp_statistics/.config.vsh.yaml +++ b/target/nextflow/agat/agat_sp_statistics/.config.vsh.yaml @@ -231,9 +231,9 @@ build_info: output: "target/nextflow/agat/agat_sp_statistics" executable: "target/nextflow/agat/agat_sp_statistics/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_sp_statistics/main.nf b/target/nextflow/agat/agat_sp_statistics/main.nf index 6200ecd9..d3c76bf2 100644 --- a/target/nextflow/agat/agat_sp_statistics/main.nf +++ b/target/nextflow/agat/agat_sp_statistics/main.nf @@ -3096,9 +3096,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_sp_statistics", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/agat/agat_sq_stat_basic/.config.vsh.yaml b/target/nextflow/agat/agat_sq_stat_basic/.config.vsh.yaml index f510c3c9..2d5c3fd6 100644 --- a/target/nextflow/agat/agat_sq_stat_basic/.config.vsh.yaml +++ b/target/nextflow/agat/agat_sq_stat_basic/.config.vsh.yaml @@ -227,9 +227,9 @@ build_info: output: "target/nextflow/agat/agat_sq_stat_basic" executable: "target/nextflow/agat/agat_sq_stat_basic/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/agat/agat_sq_stat_basic/main.nf b/target/nextflow/agat/agat_sq_stat_basic/main.nf index 897ec886..61a9f5ad 100644 --- a/target/nextflow/agat/agat_sq_stat_basic/main.nf +++ b/target/nextflow/agat/agat_sq_stat_basic/main.nf @@ -3082,9 +3082,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/agat/agat_sq_stat_basic", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/arriba/.config.vsh.yaml b/target/nextflow/arriba/.config.vsh.yaml index 7f1383a5..4a51b1ac 100644 --- a/target/nextflow/arriba/.config.vsh.yaml +++ b/target/nextflow/arriba/.config.vsh.yaml @@ -706,9 +706,9 @@ build_info: output: "target/nextflow/arriba" executable: "target/nextflow/arriba/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/arriba/main.nf b/target/nextflow/arriba/main.nf index 47ff80c3..3b94c294 100644 --- a/target/nextflow/arriba/main.nf +++ b/target/nextflow/arriba/main.nf @@ -3592,9 +3592,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/arriba", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml b/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml index 4566f077..2351b5b1 100644 --- a/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml +++ b/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml @@ -368,9 +368,9 @@ build_info: output: "target/nextflow/bbmap/bbmap_bbsplit" executable: "target/nextflow/bbmap/bbmap_bbsplit/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bbmap/bbmap_bbsplit/main.nf b/target/nextflow/bbmap/bbmap_bbsplit/main.nf index 2ef3574e..f001e5a8 100644 --- a/target/nextflow/bbmap/bbmap_bbsplit/main.nf +++ b/target/nextflow/bbmap/bbmap_bbsplit/main.nf @@ -3220,9 +3220,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bbmap/bbmap_bbsplit", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml index 2d645c32..a0cc44c6 100644 --- a/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml @@ -469,9 +469,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_annotate" executable: "target/nextflow/bcftools/bcftools_annotate/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_annotate/main.nf b/target/nextflow/bcftools/bcftools_annotate/main.nf index f847f79e..61bad867 100644 --- a/target/nextflow/bcftools/bcftools_annotate/main.nf +++ b/target/nextflow/bcftools/bcftools_annotate/main.nf @@ -3335,9 +3335,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_annotate", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml index f67eceb0..3e1fe57b 100644 --- a/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml @@ -335,9 +335,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_concat" executable: "target/nextflow/bcftools/bcftools_concat/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_concat/main.nf b/target/nextflow/bcftools/bcftools_concat/main.nf index 62ff7895..a9772afe 100644 --- a/target/nextflow/bcftools/bcftools_concat/main.nf +++ b/target/nextflow/bcftools/bcftools_concat/main.nf @@ -3207,9 +3207,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_concat", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml index 539c2f89..4b37250b 100644 --- a/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml @@ -416,9 +416,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_norm" executable: "target/nextflow/bcftools/bcftools_norm/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_norm/main.nf b/target/nextflow/bcftools/bcftools_norm/main.nf index c6da6841..54456bc7 100644 --- a/target/nextflow/bcftools/bcftools_norm/main.nf +++ b/target/nextflow/bcftools/bcftools_norm/main.nf @@ -3300,9 +3300,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_norm", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml index 955b2fdc..ef90de86 100644 --- a/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml @@ -185,9 +185,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_sort" executable: "target/nextflow/bcftools/bcftools_sort/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_sort/main.nf b/target/nextflow/bcftools/bcftools_sort/main.nf index a0c367a8..04f77511 100644 --- a/target/nextflow/bcftools/bcftools_sort/main.nf +++ b/target/nextflow/bcftools/bcftools_sort/main.nf @@ -3048,9 +3048,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_sort", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml index 85f818e9..a4cf26db 100644 --- a/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml +++ b/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml @@ -458,9 +458,9 @@ build_info: output: "target/nextflow/bcftools/bcftools_stats" executable: "target/nextflow/bcftools/bcftools_stats/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcftools/bcftools_stats/main.nf b/target/nextflow/bcftools/bcftools_stats/main.nf index fc061aa4..93177888 100644 --- a/target/nextflow/bcftools/bcftools_stats/main.nf +++ b/target/nextflow/bcftools/bcftools_stats/main.nf @@ -3337,9 +3337,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcftools/bcftools_stats", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bcl_convert/.config.vsh.yaml b/target/nextflow/bcl_convert/.config.vsh.yaml index 5e964f84..29448720 100644 --- a/target/nextflow/bcl_convert/.config.vsh.yaml +++ b/target/nextflow/bcl_convert/.config.vsh.yaml @@ -418,9 +418,9 @@ build_info: output: "target/nextflow/bcl_convert" executable: "target/nextflow/bcl_convert/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bcl_convert/main.nf b/target/nextflow/bcl_convert/main.nf index 0772da6a..340630bb 100644 --- a/target/nextflow/bcl_convert/main.nf +++ b/target/nextflow/bcl_convert/main.nf @@ -3329,9 +3329,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bcl_convert", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml index 2f424193..b3b845a6 100644 --- a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml +++ b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml @@ -274,9 +274,9 @@ build_info: output: "target/nextflow/bd_rhapsody/bd_rhapsody_make_reference" executable: "target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf index 7c42d337..a7891502 100644 --- a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf +++ b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf @@ -3146,9 +3146,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bd_rhapsody/bd_rhapsody_make_reference", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml index 73357a7e..cccaac61 100644 --- a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml +++ b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml @@ -1115,9 +1115,9 @@ build_info: output: "target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis" executable: "target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf index 932efb40..e638c398 100644 --- a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf +++ b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf @@ -4193,9 +4193,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_bamtobed/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bamtobed/.config.vsh.yaml index 649f87d4..8ba45bbc 100644 --- a/target/nextflow/bedtools/bedtools_bamtobed/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_bamtobed/.config.vsh.yaml @@ -235,9 +235,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_bamtobed" executable: "target/nextflow/bedtools/bedtools_bamtobed/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_bamtobed/main.nf b/target/nextflow/bedtools/bedtools_bamtobed/main.nf index 5e7dad1a..eb1db7a1 100644 --- a/target/nextflow/bedtools/bedtools_bamtobed/main.nf +++ b/target/nextflow/bedtools/bedtools_bamtobed/main.nf @@ -3101,9 +3101,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_bamtobed", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml index 660f89af..7b59cdc3 100644 --- a/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml @@ -187,9 +187,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_bamtofastq" executable: "target/nextflow/bedtools/bedtools_bamtofastq/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_bamtofastq/main.nf b/target/nextflow/bedtools/bedtools_bamtofastq/main.nf index da489d60..5f4ff515 100644 --- a/target/nextflow/bedtools/bedtools_bamtofastq/main.nf +++ b/target/nextflow/bedtools/bedtools_bamtofastq/main.nf @@ -3050,9 +3050,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_bamtofastq", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml index f325fc7b..7c2436ec 100644 --- a/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml @@ -176,9 +176,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_bed12tobed6" executable: "target/nextflow/bedtools/bedtools_bed12tobed6/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf b/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf index cd61762a..3e1da545 100644 --- a/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf +++ b/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf @@ -3035,9 +3035,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_bed12tobed6", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml index f2af53db..898a5f83 100644 --- a/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml @@ -214,9 +214,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_bedtobam" executable: "target/nextflow/bedtools/bedtools_bedtobam/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_bedtobam/main.nf b/target/nextflow/bedtools/bedtools_bedtobam/main.nf index 76cbc150..06a46328 100644 --- a/target/nextflow/bedtools/bedtools_bedtobam/main.nf +++ b/target/nextflow/bedtools/bedtools_bedtobam/main.nf @@ -3083,9 +3083,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_bedtobam", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml index 47836d10..e811c89b 100644 --- a/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml @@ -337,9 +337,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_genomecov" executable: "target/nextflow/bedtools/bedtools_genomecov/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_genomecov/main.nf b/target/nextflow/bedtools/bedtools_genomecov/main.nf index ca6aa249..55d1b17b 100644 --- a/target/nextflow/bedtools/bedtools_genomecov/main.nf +++ b/target/nextflow/bedtools/bedtools_genomecov/main.nf @@ -3207,9 +3207,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_genomecov", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml index 445201ee..d933a86a 100644 --- a/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml @@ -232,9 +232,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_getfasta" executable: "target/nextflow/bedtools/bedtools_getfasta/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_getfasta/main.nf b/target/nextflow/bedtools/bedtools_getfasta/main.nf index 856fecd6..0b3c47fa 100644 --- a/target/nextflow/bedtools/bedtools_getfasta/main.nf +++ b/target/nextflow/bedtools/bedtools_getfasta/main.nf @@ -3086,9 +3086,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_getfasta", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml index cac7af6a..2be297fa 100644 --- a/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml @@ -273,9 +273,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_groupby" executable: "target/nextflow/bedtools/bedtools_groupby/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_groupby/main.nf b/target/nextflow/bedtools/bedtools_groupby/main.nf index 2c0b07d2..01c75aa3 100644 --- a/target/nextflow/bedtools/bedtools_groupby/main.nf +++ b/target/nextflow/bedtools/bedtools_groupby/main.nf @@ -3130,9 +3130,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_groupby", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml index 30beafaf..084fd5b6 100644 --- a/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml @@ -410,9 +410,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_intersect" executable: "target/nextflow/bedtools/bedtools_intersect/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_intersect/main.nf b/target/nextflow/bedtools/bedtools_intersect/main.nf index de836492..5acf60e5 100644 --- a/target/nextflow/bedtools/bedtools_intersect/main.nf +++ b/target/nextflow/bedtools/bedtools_intersect/main.nf @@ -3282,9 +3282,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_intersect", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml index c419d81b..494a39d9 100644 --- a/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml @@ -210,9 +210,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_links" executable: "target/nextflow/bedtools/bedtools_links/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_links/main.nf b/target/nextflow/bedtools/bedtools_links/main.nf index 0ce6b3bd..3d8ecebd 100644 --- a/target/nextflow/bedtools/bedtools_links/main.nf +++ b/target/nextflow/bedtools/bedtools_links/main.nf @@ -3073,9 +3073,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_links", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml index c1f74238..07a82311 100644 --- a/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml @@ -279,9 +279,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_merge" executable: "target/nextflow/bedtools/bedtools_merge/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_merge/main.nf b/target/nextflow/bedtools/bedtools_merge/main.nf index 9f50d4ea..6b8c7b09 100644 --- a/target/nextflow/bedtools/bedtools_merge/main.nf +++ b/target/nextflow/bedtools/bedtools_merge/main.nf @@ -3134,9 +3134,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_merge", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml index 054419d6..ec155d12 100644 --- a/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml +++ b/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml @@ -222,9 +222,9 @@ build_info: output: "target/nextflow/bedtools/bedtools_sort" executable: "target/nextflow/bedtools/bedtools_sort/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/bedtools/bedtools_sort/main.nf b/target/nextflow/bedtools/bedtools_sort/main.nf index 67349dd7..ef7464fd 100644 --- a/target/nextflow/bedtools/bedtools_sort/main.nf +++ b/target/nextflow/bedtools/bedtools_sort/main.nf @@ -3092,9 +3092,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/bedtools/bedtools_sort", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml b/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml index 6c23b9df..1ab478e6 100644 --- a/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml +++ b/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml @@ -158,9 +158,9 @@ build_info: output: "target/nextflow/busco/busco_download_datasets" executable: "target/nextflow/busco/busco_download_datasets/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/busco/busco_download_datasets/main.nf b/target/nextflow/busco/busco_download_datasets/main.nf index 44ea971d..de44824d 100644 --- a/target/nextflow/busco/busco_download_datasets/main.nf +++ b/target/nextflow/busco/busco_download_datasets/main.nf @@ -3011,9 +3011,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/busco/busco_download_datasets", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml b/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml index c414303b..b2de40e1 100644 --- a/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml +++ b/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml @@ -145,9 +145,9 @@ build_info: output: "target/nextflow/busco/busco_list_datasets" executable: "target/nextflow/busco/busco_list_datasets/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/busco/busco_list_datasets/main.nf b/target/nextflow/busco/busco_list_datasets/main.nf index 7faebaf6..60032500 100644 --- a/target/nextflow/busco/busco_list_datasets/main.nf +++ b/target/nextflow/busco/busco_list_datasets/main.nf @@ -2997,9 +2997,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/busco/busco_list_datasets", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/busco/busco_run/.config.vsh.yaml b/target/nextflow/busco/busco_run/.config.vsh.yaml index 263b6344..ef6cd477 100644 --- a/target/nextflow/busco/busco_run/.config.vsh.yaml +++ b/target/nextflow/busco/busco_run/.config.vsh.yaml @@ -423,9 +423,9 @@ build_info: output: "target/nextflow/busco/busco_run" executable: "target/nextflow/busco/busco_run/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/busco/busco_run/main.nf b/target/nextflow/busco/busco_run/main.nf index 69198bf6..298e81c6 100644 --- a/target/nextflow/busco/busco_run/main.nf +++ b/target/nextflow/busco/busco_run/main.nf @@ -3309,9 +3309,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/busco/busco_run", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/cellranger/cellranger_mkref/.config.vsh.yaml b/target/nextflow/cellranger/cellranger_mkref/.config.vsh.yaml index 4509a740..66606e40 100644 --- a/target/nextflow/cellranger/cellranger_mkref/.config.vsh.yaml +++ b/target/nextflow/cellranger/cellranger_mkref/.config.vsh.yaml @@ -195,9 +195,9 @@ build_info: output: "target/nextflow/cellranger/cellranger_mkref" executable: "target/nextflow/cellranger/cellranger_mkref/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/cellranger/cellranger_mkref/main.nf b/target/nextflow/cellranger/cellranger_mkref/main.nf index ebb2c1df..d6bfcac6 100644 --- a/target/nextflow/cellranger/cellranger_mkref/main.nf +++ b/target/nextflow/cellranger/cellranger_mkref/main.nf @@ -3059,9 +3059,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/cellranger/cellranger_mkref", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/cutadapt/.config.vsh.yaml b/target/nextflow/cutadapt/.config.vsh.yaml index 80a56723..7692205e 100644 --- a/target/nextflow/cutadapt/.config.vsh.yaml +++ b/target/nextflow/cutadapt/.config.vsh.yaml @@ -740,9 +740,9 @@ build_info: output: "target/nextflow/cutadapt" executable: "target/nextflow/cutadapt/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/cutadapt/main.nf b/target/nextflow/cutadapt/main.nf index 41965e08..fc46723e 100644 --- a/target/nextflow/cutadapt/main.nf +++ b/target/nextflow/cutadapt/main.nf @@ -3619,9 +3619,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/cutadapt", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/falco/.config.vsh.yaml b/target/nextflow/falco/.config.vsh.yaml index 38928c23..5e459442 100644 --- a/target/nextflow/falco/.config.vsh.yaml +++ b/target/nextflow/falco/.config.vsh.yaml @@ -317,9 +317,9 @@ build_info: output: "target/nextflow/falco" executable: "target/nextflow/falco/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/falco/main.nf b/target/nextflow/falco/main.nf index 2c026829..70a90d0d 100644 --- a/target/nextflow/falco/main.nf +++ b/target/nextflow/falco/main.nf @@ -3170,9 +3170,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/falco", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/fastp/.config.vsh.yaml b/target/nextflow/fastp/.config.vsh.yaml index dc595895..b53bd357 100644 --- a/target/nextflow/fastp/.config.vsh.yaml +++ b/target/nextflow/fastp/.config.vsh.yaml @@ -1083,9 +1083,9 @@ build_info: output: "target/nextflow/fastp" executable: "target/nextflow/fastp/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/fastp/main.nf b/target/nextflow/fastp/main.nf index 92e05da2..8302aa12 100644 --- a/target/nextflow/fastp/main.nf +++ b/target/nextflow/fastp/main.nf @@ -4023,9 +4023,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/fastp", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/fastqc/.config.vsh.yaml b/target/nextflow/fastqc/.config.vsh.yaml index c1704d1b..4e9fd29e 100644 --- a/target/nextflow/fastqc/.config.vsh.yaml +++ b/target/nextflow/fastqc/.config.vsh.yaml @@ -340,9 +340,9 @@ build_info: output: "target/nextflow/fastqc" executable: "target/nextflow/fastqc/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/fastqc/main.nf b/target/nextflow/fastqc/main.nf index 957d5baa..d3ac11de 100644 --- a/target/nextflow/fastqc/main.nf +++ b/target/nextflow/fastqc/main.nf @@ -3182,9 +3182,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/fastqc", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/featurecounts/.config.vsh.yaml b/target/nextflow/featurecounts/.config.vsh.yaml index f76f3c41..0b4a6e04 100644 --- a/target/nextflow/featurecounts/.config.vsh.yaml +++ b/target/nextflow/featurecounts/.config.vsh.yaml @@ -645,9 +645,9 @@ build_info: output: "target/nextflow/featurecounts" executable: "target/nextflow/featurecounts/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/featurecounts/main.nf b/target/nextflow/featurecounts/main.nf index 0850e9be..042bf2be 100644 --- a/target/nextflow/featurecounts/main.nf +++ b/target/nextflow/featurecounts/main.nf @@ -3549,9 +3549,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/featurecounts", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/fq_subsample/.config.vsh.yaml b/target/nextflow/fq_subsample/.config.vsh.yaml index 39110a79..38256e24 100644 --- a/target/nextflow/fq_subsample/.config.vsh.yaml +++ b/target/nextflow/fq_subsample/.config.vsh.yaml @@ -190,9 +190,9 @@ build_info: output: "target/nextflow/fq_subsample" executable: "target/nextflow/fq_subsample/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/fq_subsample/main.nf b/target/nextflow/fq_subsample/main.nf index 08699856..164ea697 100644 --- a/target/nextflow/fq_subsample/main.nf +++ b/target/nextflow/fq_subsample/main.nf @@ -3032,9 +3032,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/fq_subsample", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/gffread/.config.vsh.yaml b/target/nextflow/gffread/.config.vsh.yaml index 1885da2a..a6b5707e 100644 --- a/target/nextflow/gffread/.config.vsh.yaml +++ b/target/nextflow/gffread/.config.vsh.yaml @@ -685,9 +685,9 @@ build_info: output: "target/nextflow/gffread" executable: "target/nextflow/gffread/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/gffread/main.nf b/target/nextflow/gffread/main.nf index 29cd13ae..e0a17647 100644 --- a/target/nextflow/gffread/main.nf +++ b/target/nextflow/gffread/main.nf @@ -3606,9 +3606,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/gffread", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml b/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml index 48bd65c9..6f4e5095 100644 --- a/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml +++ b/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml @@ -218,9 +218,9 @@ build_info: output: "target/nextflow/kallisto/kallisto_index" executable: "target/nextflow/kallisto/kallisto_index/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/kallisto/kallisto_index/main.nf b/target/nextflow/kallisto/kallisto_index/main.nf index 1eb3837c..83087973 100644 --- a/target/nextflow/kallisto/kallisto_index/main.nf +++ b/target/nextflow/kallisto/kallisto_index/main.nf @@ -3071,9 +3071,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/kallisto/kallisto_index", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml b/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml index 03b311f5..7e3c350d 100644 --- a/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml +++ b/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml @@ -246,9 +246,9 @@ build_info: output: "target/nextflow/kallisto/kallisto_quant" executable: "target/nextflow/kallisto/kallisto_quant/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/kallisto/kallisto_quant/main.nf b/target/nextflow/kallisto/kallisto_quant/main.nf index 14aacff8..71f06708 100644 --- a/target/nextflow/kallisto/kallisto_quant/main.nf +++ b/target/nextflow/kallisto/kallisto_quant/main.nf @@ -3105,9 +3105,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/kallisto/kallisto_quant", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml b/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml index 7470eb7f..fd9b4d03 100644 --- a/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml +++ b/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml @@ -507,9 +507,9 @@ build_info: output: "target/nextflow/lofreq/lofreq_call" executable: "target/nextflow/lofreq/lofreq_call/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/lofreq/lofreq_call/main.nf b/target/nextflow/lofreq/lofreq_call/main.nf index b5917320..efeb2f92 100644 --- a/target/nextflow/lofreq/lofreq_call/main.nf +++ b/target/nextflow/lofreq/lofreq_call/main.nf @@ -3414,9 +3414,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/lofreq/lofreq_call", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml b/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml index ff5c87cb..4f928853 100644 --- a/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml +++ b/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml @@ -215,9 +215,9 @@ build_info: output: "target/nextflow/lofreq/lofreq_indelqual" executable: "target/nextflow/lofreq/lofreq_indelqual/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/lofreq/lofreq_indelqual/main.nf b/target/nextflow/lofreq/lofreq_indelqual/main.nf index 08f57e2e..fe768152 100644 --- a/target/nextflow/lofreq/lofreq_indelqual/main.nf +++ b/target/nextflow/lofreq/lofreq_indelqual/main.nf @@ -3077,9 +3077,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/lofreq/lofreq_indelqual", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/multiqc/.config.vsh.yaml b/target/nextflow/multiqc/.config.vsh.yaml index beccf813..7d5d881b 100644 --- a/target/nextflow/multiqc/.config.vsh.yaml +++ b/target/nextflow/multiqc/.config.vsh.yaml @@ -456,9 +456,9 @@ build_info: output: "target/nextflow/multiqc" executable: "target/nextflow/multiqc/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/multiqc/main.nf b/target/nextflow/multiqc/main.nf index e55ed7d9..026c3311 100644 --- a/target/nextflow/multiqc/main.nf +++ b/target/nextflow/multiqc/main.nf @@ -3366,9 +3366,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/multiqc", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/nanoplot/.config.vsh.yaml b/target/nextflow/nanoplot/.config.vsh.yaml index b2d90e5d..bf063f20 100644 --- a/target/nextflow/nanoplot/.config.vsh.yaml +++ b/target/nextflow/nanoplot/.config.vsh.yaml @@ -492,9 +492,9 @@ build_info: output: "target/nextflow/nanoplot" executable: "target/nextflow/nanoplot/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/nanoplot/main.nf b/target/nextflow/nanoplot/main.nf index e7d6349e..e72c1b0a 100644 --- a/target/nextflow/nanoplot/main.nf +++ b/target/nextflow/nanoplot/main.nf @@ -3397,9 +3397,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/nanoplot", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/pear/.config.vsh.yaml b/target/nextflow/pear/.config.vsh.yaml index da90ea13..535b3ead 100644 --- a/target/nextflow/pear/.config.vsh.yaml +++ b/target/nextflow/pear/.config.vsh.yaml @@ -398,9 +398,9 @@ build_info: output: "target/nextflow/pear" executable: "target/nextflow/pear/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/pear/main.nf b/target/nextflow/pear/main.nf index 3f889204..9ee9e6e6 100644 --- a/target/nextflow/pear/main.nf +++ b/target/nextflow/pear/main.nf @@ -3259,9 +3259,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/pear", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml b/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml index 71d5a85c..35d00c44 100644 --- a/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml +++ b/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml @@ -264,9 +264,9 @@ build_info: output: "target/nextflow/qualimap/qualimap_rnaseq" executable: "target/nextflow/qualimap/qualimap_rnaseq/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/qualimap/qualimap_rnaseq/main.nf b/target/nextflow/qualimap/qualimap_rnaseq/main.nf index 53673e17..0be20f5b 100644 --- a/target/nextflow/qualimap/qualimap_rnaseq/main.nf +++ b/target/nextflow/qualimap/qualimap_rnaseq/main.nf @@ -3129,9 +3129,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/qualimap/qualimap_rnaseq", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml b/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml index d081207e..22d57213 100644 --- a/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml +++ b/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml @@ -852,9 +852,9 @@ build_info: output: "target/nextflow/rsem/rsem_calculate_expression" executable: "target/nextflow/rsem/rsem_calculate_expression/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/rsem/rsem_calculate_expression/main.nf b/target/nextflow/rsem/rsem_calculate_expression/main.nf index 2c6d42c0..238f1177 100644 --- a/target/nextflow/rsem/rsem_calculate_expression/main.nf +++ b/target/nextflow/rsem/rsem_calculate_expression/main.nf @@ -3661,9 +3661,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/rsem/rsem_calculate_expression", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml b/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml index 12a63adb..e7ab7012 100644 --- a/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml +++ b/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml @@ -416,9 +416,9 @@ build_info: output: "target/nextflow/rsem/rsem_prepare_reference" executable: "target/nextflow/rsem/rsem_prepare_reference/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/rsem/rsem_prepare_reference/main.nf b/target/nextflow/rsem/rsem_prepare_reference/main.nf index d953e178..610b6118 100644 --- a/target/nextflow/rsem/rsem_prepare_reference/main.nf +++ b/target/nextflow/rsem/rsem_prepare_reference/main.nf @@ -3245,9 +3245,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/rsem/rsem_prepare_reference", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/rseqc/rseqc_bamstat/.config.vsh.yaml b/target/nextflow/rseqc/rseqc_bamstat/.config.vsh.yaml index ed969c46..370b1ffa 100644 --- a/target/nextflow/rseqc/rseqc_bamstat/.config.vsh.yaml +++ b/target/nextflow/rseqc/rseqc_bamstat/.config.vsh.yaml @@ -175,9 +175,9 @@ build_info: output: "target/nextflow/rseqc/rseqc_bamstat" executable: "target/nextflow/rseqc/rseqc_bamstat/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/rseqc/rseqc_bamstat/main.nf b/target/nextflow/rseqc/rseqc_bamstat/main.nf index 60eb9af5..2bb1694d 100644 --- a/target/nextflow/rseqc/rseqc_bamstat/main.nf +++ b/target/nextflow/rseqc/rseqc_bamstat/main.nf @@ -3036,9 +3036,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/rseqc/rseqc_bamstat", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/rseqc/rseqc_inferexperiment/.config.vsh.yaml b/target/nextflow/rseqc/rseqc_inferexperiment/.config.vsh.yaml index ad892c57..b7df1cc7 100644 --- a/target/nextflow/rseqc/rseqc_inferexperiment/.config.vsh.yaml +++ b/target/nextflow/rseqc/rseqc_inferexperiment/.config.vsh.yaml @@ -201,9 +201,9 @@ build_info: output: "target/nextflow/rseqc/rseqc_inferexperiment" executable: "target/nextflow/rseqc/rseqc_inferexperiment/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/rseqc/rseqc_inferexperiment/main.nf b/target/nextflow/rseqc/rseqc_inferexperiment/main.nf index c8e8f453..99cf1f21 100644 --- a/target/nextflow/rseqc/rseqc_inferexperiment/main.nf +++ b/target/nextflow/rseqc/rseqc_inferexperiment/main.nf @@ -3069,9 +3069,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/rseqc/rseqc_inferexperiment", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/rseqc/rseqc_inner_distance/.config.vsh.yaml b/target/nextflow/rseqc/rseqc_inner_distance/.config.vsh.yaml index 0aec52fe..cea90355 100644 --- a/target/nextflow/rseqc/rseqc_inner_distance/.config.vsh.yaml +++ b/target/nextflow/rseqc/rseqc_inner_distance/.config.vsh.yaml @@ -294,9 +294,9 @@ build_info: output: "target/nextflow/rseqc/rseqc_inner_distance" executable: "target/nextflow/rseqc/rseqc_inner_distance/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/rseqc/rseqc_inner_distance/main.nf b/target/nextflow/rseqc/rseqc_inner_distance/main.nf index 584a6516..ac9f269a 100644 --- a/target/nextflow/rseqc/rseqc_inner_distance/main.nf +++ b/target/nextflow/rseqc/rseqc_inner_distance/main.nf @@ -3169,9 +3169,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/rseqc/rseqc_inner_distance", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/salmon/salmon_index/.config.vsh.yaml b/target/nextflow/salmon/salmon_index/.config.vsh.yaml index f54b5d56..ee479fca 100644 --- a/target/nextflow/salmon/salmon_index/.config.vsh.yaml +++ b/target/nextflow/salmon/salmon_index/.config.vsh.yaml @@ -277,9 +277,9 @@ build_info: output: "target/nextflow/salmon/salmon_index" executable: "target/nextflow/salmon/salmon_index/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/salmon/salmon_index/main.nf b/target/nextflow/salmon/salmon_index/main.nf index 6467e135..69eec34f 100644 --- a/target/nextflow/salmon/salmon_index/main.nf +++ b/target/nextflow/salmon/salmon_index/main.nf @@ -3129,9 +3129,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/salmon/salmon_index", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/salmon/salmon_quant/.config.vsh.yaml b/target/nextflow/salmon/salmon_quant/.config.vsh.yaml index 7607eb80..1ca63e71 100644 --- a/target/nextflow/salmon/salmon_quant/.config.vsh.yaml +++ b/target/nextflow/salmon/salmon_quant/.config.vsh.yaml @@ -1173,9 +1173,9 @@ build_info: output: "target/nextflow/salmon/salmon_quant" executable: "target/nextflow/salmon/salmon_quant/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/salmon/salmon_quant/main.nf b/target/nextflow/salmon/salmon_quant/main.nf index 0d5c49f0..df9d30c0 100644 --- a/target/nextflow/salmon/salmon_quant/main.nf +++ b/target/nextflow/salmon/salmon_quant/main.nf @@ -3964,9 +3964,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/salmon/salmon_quant", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_collate/.config.vsh.yaml b/target/nextflow/samtools/samtools_collate/.config.vsh.yaml index c78a616d..24932377 100644 --- a/target/nextflow/samtools/samtools_collate/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_collate/.config.vsh.yaml @@ -264,9 +264,9 @@ build_info: output: "target/nextflow/samtools/samtools_collate" executable: "target/nextflow/samtools/samtools_collate/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_collate/main.nf b/target/nextflow/samtools/samtools_collate/main.nf index c6936b53..7551dfb9 100644 --- a/target/nextflow/samtools/samtools_collate/main.nf +++ b/target/nextflow/samtools/samtools_collate/main.nf @@ -3140,9 +3140,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_collate", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml b/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml index 0bb77aa8..68838b83 100644 --- a/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml @@ -243,9 +243,9 @@ build_info: output: "target/nextflow/samtools/samtools_faidx" executable: "target/nextflow/samtools/samtools_faidx/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_faidx/main.nf b/target/nextflow/samtools/samtools_faidx/main.nf index 95c453f0..c4ac9e13 100644 --- a/target/nextflow/samtools/samtools_faidx/main.nf +++ b/target/nextflow/samtools/samtools_faidx/main.nf @@ -3112,9 +3112,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_faidx", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml b/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml index ecab932e..1b01f5b1 100644 --- a/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml @@ -433,9 +433,9 @@ build_info: output: "target/nextflow/samtools/samtools_fasta" executable: "target/nextflow/samtools/samtools_fasta/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_fasta/main.nf b/target/nextflow/samtools/samtools_fasta/main.nf index a0c0bd58..4ccfc2c1 100644 --- a/target/nextflow/samtools/samtools_fasta/main.nf +++ b/target/nextflow/samtools/samtools_fasta/main.nf @@ -3304,9 +3304,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_fasta", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml b/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml index b8cb3825..658c231a 100644 --- a/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml @@ -433,9 +433,9 @@ build_info: output: "target/nextflow/samtools/samtools_fastq" executable: "target/nextflow/samtools/samtools_fastq/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_fastq/main.nf b/target/nextflow/samtools/samtools_fastq/main.nf index cae8825d..0fb415d8 100644 --- a/target/nextflow/samtools/samtools_fastq/main.nf +++ b/target/nextflow/samtools/samtools_fastq/main.nf @@ -3304,9 +3304,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_fastq", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml b/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml index 293585f4..249982e3 100644 --- a/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml @@ -173,9 +173,9 @@ build_info: output: "target/nextflow/samtools/samtools_flagstat" executable: "target/nextflow/samtools/samtools_flagstat/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_flagstat/main.nf b/target/nextflow/samtools/samtools_flagstat/main.nf index c7f53c07..4c4395ce 100644 --- a/target/nextflow/samtools/samtools_flagstat/main.nf +++ b/target/nextflow/samtools/samtools_flagstat/main.nf @@ -3028,9 +3028,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_flagstat", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml b/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml index c3428359..bbad56a3 100644 --- a/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml @@ -183,9 +183,9 @@ build_info: output: "target/nextflow/samtools/samtools_idxstats" executable: "target/nextflow/samtools/samtools_idxstats/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_idxstats/main.nf b/target/nextflow/samtools/samtools_idxstats/main.nf index faddb414..60fb848c 100644 --- a/target/nextflow/samtools/samtools_idxstats/main.nf +++ b/target/nextflow/samtools/samtools_idxstats/main.nf @@ -3040,9 +3040,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_idxstats", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_index/.config.vsh.yaml b/target/nextflow/samtools/samtools_index/.config.vsh.yaml index 94d7b6fc..6f0ef1bb 100644 --- a/target/nextflow/samtools/samtools_index/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_index/.config.vsh.yaml @@ -189,9 +189,9 @@ build_info: output: "target/nextflow/samtools/samtools_index" executable: "target/nextflow/samtools/samtools_index/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_index/main.nf b/target/nextflow/samtools/samtools_index/main.nf index 39aefa31..7a857ef0 100644 --- a/target/nextflow/samtools/samtools_index/main.nf +++ b/target/nextflow/samtools/samtools_index/main.nf @@ -3053,9 +3053,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_index", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_sort/.config.vsh.yaml b/target/nextflow/samtools/samtools_sort/.config.vsh.yaml index a232b075..e6b54dd7 100644 --- a/target/nextflow/samtools/samtools_sort/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_sort/.config.vsh.yaml @@ -332,9 +332,9 @@ build_info: output: "target/nextflow/samtools/samtools_sort" executable: "target/nextflow/samtools/samtools_sort/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_sort/main.nf b/target/nextflow/samtools/samtools_sort/main.nf index 13fbc6fe..b488127f 100644 --- a/target/nextflow/samtools/samtools_sort/main.nf +++ b/target/nextflow/samtools/samtools_sort/main.nf @@ -3225,9 +3225,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_sort", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_stats/.config.vsh.yaml b/target/nextflow/samtools/samtools_stats/.config.vsh.yaml index 5b67ca25..8d001b6e 100644 --- a/target/nextflow/samtools/samtools_stats/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_stats/.config.vsh.yaml @@ -401,9 +401,9 @@ build_info: output: "target/nextflow/samtools/samtools_stats" executable: "target/nextflow/samtools/samtools_stats/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_stats/main.nf b/target/nextflow/samtools/samtools_stats/main.nf index 093dc9da..4b5e55e5 100644 --- a/target/nextflow/samtools/samtools_stats/main.nf +++ b/target/nextflow/samtools/samtools_stats/main.nf @@ -3295,9 +3295,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_stats", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/samtools/samtools_view/.config.vsh.yaml b/target/nextflow/samtools/samtools_view/.config.vsh.yaml index 0f2d0dcf..115c554d 100644 --- a/target/nextflow/samtools/samtools_view/.config.vsh.yaml +++ b/target/nextflow/samtools/samtools_view/.config.vsh.yaml @@ -665,9 +665,9 @@ build_info: output: "target/nextflow/samtools/samtools_view" executable: "target/nextflow/samtools/samtools_view/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/samtools/samtools_view/main.nf b/target/nextflow/samtools/samtools_view/main.nf index 8db4b937..726e2436 100644 --- a/target/nextflow/samtools/samtools_view/main.nf +++ b/target/nextflow/samtools/samtools_view/main.nf @@ -3476,9 +3476,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/samtools/samtools_view", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml b/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml index 8e069b3e..5b27ee90 100644 --- a/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml +++ b/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml @@ -173,9 +173,9 @@ build_info: output: "target/nextflow/seqtk/seqtk_sample" executable: "target/nextflow/seqtk/seqtk_sample/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/seqtk/seqtk_sample/main.nf b/target/nextflow/seqtk/seqtk_sample/main.nf index 6522365f..bcc19457 100644 --- a/target/nextflow/seqtk/seqtk_sample/main.nf +++ b/target/nextflow/seqtk/seqtk_sample/main.nf @@ -3030,9 +3030,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/seqtk/seqtk_sample", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml b/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml index 366653e3..92207a6c 100644 --- a/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml +++ b/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml @@ -196,9 +196,9 @@ build_info: output: "target/nextflow/seqtk/seqtk_subseq" executable: "target/nextflow/seqtk/seqtk_subseq/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/seqtk/seqtk_subseq/main.nf b/target/nextflow/seqtk/seqtk_subseq/main.nf index 5c0bcf8a..331a55ed 100644 --- a/target/nextflow/seqtk/seqtk_subseq/main.nf +++ b/target/nextflow/seqtk/seqtk_subseq/main.nf @@ -3060,9 +3060,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/seqtk/seqtk_subseq", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/sgdemux/.config.vsh.yaml b/target/nextflow/sgdemux/.config.vsh.yaml new file mode 100644 index 00000000..1431164a --- /dev/null +++ b/target/nextflow/sgdemux/.config.vsh.yaml @@ -0,0 +1,456 @@ +name: "sgdemux" +version: "main" +authors: +- name: "Dries Schaumont" + roles: + - "author" + - "maintainer" + info: + links: + email: "dries@data-intuitive.com" + github: "DriesSchaumont" + orcid: "0000-0002-4389-0440" + linkedin: "dries-schaumont" + organizations: + - name: "Data Intuitive" + href: "https://www.data-intuitive.com" + role: "Data Scientist" +argument_groups: +- name: "Input" + arguments: + - type: "file" + name: "--fastqs" + alternatives: + - "-f" + description: "Path to the input FASTQs, or path prefix if not a file" + info: null + example: + - "sample1_r1.fq;sample1_r2.fq;sample2_r1.fq;sample2_r2.fq" + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--sample_metadata" + alternatives: + - "-s" + description: "Path to the sample metadata CSV file including sample names and\ + \ barcode sequences" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output" + arguments: + - type: "file" + name: "--sample_fastq" + description: "The directory containing demultiplexed sample FASTQ files." + info: null + example: + - "output" + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--metrics" + description: "Demultiplexing summary statisitcs:\n - control_reads_omitted: The\ + \ number of reads that were omitted for being control reads.\n - failing_reads_omitted:\ + \ The number of reads that were omitted for having failed QC.\n - total_templates:\ + \ The total number of template reads that were output.\n" + info: null + example: + - "metrics.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--most_frequent_unmatched" + description: "It contains the (approximate) counts of the most prevelant observed\ + \ barcode sequences\nthat did not match to one of the expected barcodes. Can\ + \ only be created when 'most_unmatched_to_output'\nis not set to 0.\n" + info: null + example: + - "most_frequent_unmatched.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--sample_barcode_hop_metrics" + description: "File containing the frequently observed barcodes that are unexpected\n\ + combinations of expected barcodes in a dual-indexed run.\n" + info: null + example: + - "sample_barcode_hop_metrics.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--per_project_metrics" + description: "Aggregates the metrics by project (aggregates the metrics across\ + \ samples with the same project) and\nhas the same columns as `--metrics`. In\ + \ this case, sample_ID will contain the project name (or None if no project\ + \ is given).\nTHe barcode will contain all Ns. The undetermined sample will\ + \ not be aggregated with any other sample.\n" + info: null + example: + - "per_project_metrics.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--per_sample_metrics" + description: "Tab-separated file containing statistics per sample.\n" + info: null + example: + - "per_sample_metrics.tsv" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" +- name: "Arguments" + arguments: + - type: "string" + name: "--read_structures" + alternatives: + - "-r" + description: "Read structures, one per input FASTQ. Do not provide when using\ + \ a path prefix for FASTQs" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "integer" + name: "--allowed_mismatches" + alternatives: + - "-m" + description: "Number of allowed mismatches between the observed barcode and the\ + \ expected barcode" + info: null + example: + - 1 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--min_delta" + alternatives: + - "-d" + description: "The minimum allowed difference between an observed barcode and the\ + \ second closest expected barcode" + info: null + example: + - 2 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--free_ns" + alternatives: + - "-F" + description: "Number of N's to allow in a barcode without counting against the\ + \ allowed_mismatches" + info: null + example: + - 1 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--max_no_calls" + alternatives: + - "-N" + description: "Max no-calls (N's) in a barcode before it is considered unmatchable.\n\ + A barcode with total N's greater than 'max_no_call' will be considered unmatchable.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--quality_mask_threshold" + alternatives: + - "-M" + description: "Mask template bases with quality scores less than specified value(s).\n\ + Sample barcode/index and UMI bases are never masked. If provided either a single\ + \ value,\nor one value per FASTQ must be provided.\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "boolean_true" + name: "--filter_control_reads" + alternatives: + - "-C" + description: "Filter out control reads" + info: null + direction: "input" + - type: "boolean_true" + name: "--filter_failing_quality" + alternatives: + - "-Q" + description: "Filter reads failing quality filter\n" + info: null + direction: "input" + - type: "string" + name: "--output_types" + alternatives: + - "-T" + description: "The types of output FASTQs to write.\nFor each read structure, all\ + \ segment types listed will be output to a FASTQ file.\n\nThese may be any of\ + \ the following:\n - `T` - Template bases\n - `B` - Sample barcode bases\n -\ + \ `M` - Molecular barcode bases\n - `S` - Skip bases\n" + info: null + example: + - "T" + required: false + choices: + - "T" + - "B" + - "S" + - "M" + direction: "input" + multiple: true + multiple_sep: ";" + - type: "string" + name: "--undetermined_sample_name" + alternatives: + - "-u" + description: "The sample name for undetermined reads (reads that do not match\ + \ an expected barcode)\n" + info: null + example: + - "Undetermined" + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--most_unmatched_to_output" + alternatives: + - "-U" + description: "Output the most frequent \"unmatched\" barcodes up to this number.\n\ + If set to 0 unmatched barcodes will not be collected, improving overall performance.\n" + info: null + example: + - 1000 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--override_matcher" + description: "If the sample barcodes are > 12 bp long, a cached hamming distance\ + \ matcher is used.\nIf the barcodes are less than or equal to 12 bp long, all\ + \ possible matches are precomputed.\nThis option allows for overriding that\ + \ heuristic.\n" + info: null + required: false + choices: + - "cached-hamming-distance" + - "pre-compute" + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--skip_read_name_check" + description: "If this is true, then all the read names across FASTQs will not\ + \ be enforced to be the same.\nThis may be useful when the read names are known\ + \ to be the same and performance matters.\nRegardless, the first read name in\ + \ each FASTQ will always be checked.\n" + info: null + direction: "input" + - type: "boolean_true" + name: "--sample_barcode_in_fastq_header" + description: "If this is true, then the sample barcode is expected to be in the\ + \ FASTQ read header.\nFor dual indexed data, the barcodes must be `+` (plus)\ + \ delimited. Additionally, if true,\nthen neither index FASTQ files nor sample\ + \ barcode segments in the read structure may be specified.\n" + info: null + direction: "input" + - type: "string" + name: "--metric_prefix" + description: "Prepend this prefix to all output metric file names\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--lane" + alternatives: + - "-l" + description: "Select a subset of lanes to demultiplex. Will cause only samples\ + \ and input FASTQs with\nthe given `Lane`(s) to be demultiplexed. Samples without\ + \ a lane will be ignored, and\nFASTQs without lane information will be ignored\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" +resources: +- type: "bash_script" + path: "script.sh" + is_executable: true +description: "Demultiplex sequence data generated on Singular Genomics' sequencing\ + \ instruments.\n" +test_resources: +- type: "bash_script" + path: "test.sh" + is_executable: true +- type: "file" + path: "test_data" +info: null +status: "enabled" +requirements: + commands: + - "ps" +keywords: +- "demultiplex" +- "fastq" +license: "Proprietairy" +links: + repository: "https://github.com/Singular-Genomics/singular-demux" +runners: +- type: "executable" + id: "executable" + docker_setup_strategy: "ifneedbepullelsecachedbuild" +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "docker" + id: "docker" + image: "continuumio/miniconda3:latest" + target_registry: "images.viash-hub.com" + target_tag: "main" + namespace_separator: "/" + setup: + - type: "apt" + packages: + - "procps" + interactive: false + - type: "docker" + run: + - "conda install -c conda-forge -c bioconda sgdemux && \\\necho \"sgdemux: $(sgdemux\ + \ --version | cut -d' ' -f2)\" > /var/software_versions.txt\n" + entrypoint: [] + cmd: null +- type: "native" + id: "native" +build_info: + config: "src/sgdemux/config.vsh.yaml" + runner: "nextflow" + engine: "docker|native" + output: "target/nextflow/sgdemux" + executable: "target/nextflow/sgdemux/main.nf" + viash_version: "0.9.0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" +package_config: + name: "biobox" + version: "main" + description: "A collection of bioinformatics tools for working with sequence data.\n" + info: null + viash_version: "0.9.0" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'main'" + keywords: + - "bioinformatics" + - "modules" + - "sequencing" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/biobox" + issue_tracker: "https://github.com/viash-hub/biobox/issues" diff --git a/target/nextflow/sgdemux/main.nf b/target/nextflow/sgdemux/main.nf new file mode 100644 index 00000000..5307baa2 --- /dev/null +++ b/target/nextflow/sgdemux/main.nf @@ -0,0 +1,3984 @@ +// sgdemux main +// +// This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative +// work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data +// Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. +// +// Component authors: +// * Dries Schaumont (author, maintainer) + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def runIf_ = args.runIf + def id_ = args.id + + assert !runIf_ || runIf_ instanceof Closure: "runEach: must pass a Closure to runIf." + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def chPassthrough = null + def chRun = null + if (runIf_) { + def idRunIfBranch = id_ch.branch{ tup -> + run: runIf_(tup[0], tup[1], comp_) + passthrough: true + } + chPassthrough = idRunIfBranch.passthrough + chRun = idRunIfBranch.run + } else { + chRun = id_ch + chPassthrough = Channel.empty() + } + def data_ch = chRun | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + def return_ch = post_ch + | concat(chPassthrough) + + return_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(":") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey', or 'newKey:oldKey;newKey:oldKey' in case of multiple values" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$\\{id\\}', id_) + .replaceAll('\\$key', key_) + .replaceAll('\\$\\{key\\}', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$\\{id\\}', id_) + .replaceAll('\\$key', key_) + .replaceAll('\\$\\{key\\}', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$\\{id\\}', id_) + .replaceAll('\\$key', key_) + .replaceAll('\\$\\{key\\}', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModified.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModified + chPassthrough = Channel.empty() + } + + def chRunFiltered = workflowArgs.filter ? + chRun | filter{workflowArgs.filter(it)} : + chRun + + def chArgs = workflowArgs.fromState ? + chRunFiltered | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRunFiltered | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chRunFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "sgdemux", + "version" : "main", + "authors" : [ + { + "name" : "Dries Schaumont", + "roles" : [ + "author", + "maintainer" + ], + "info" : { + "links" : { + "email" : "dries@data-intuitive.com", + "github" : "DriesSchaumont", + "orcid" : "0000-0002-4389-0440", + "linkedin" : "dries-schaumont" + }, + "organizations" : [ + { + "name" : "Data Intuitive", + "href" : "https://www.data-intuitive.com", + "role" : "Data Scientist" + } + ] + } + } + ], + "argument_groups" : [ + { + "name" : "Input", + "arguments" : [ + { + "type" : "file", + "name" : "--fastqs", + "alternatives" : [ + "-f" + ], + "description" : "Path to the input FASTQs, or path prefix if not a file", + "example" : [ + "sample1_r1.fq;sample1_r2.fq;sample2_r1.fq;sample2_r2.fq" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--sample_metadata", + "alternatives" : [ + "-s" + ], + "description" : "Path to the sample metadata CSV file including sample names and barcode sequences", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output", + "arguments" : [ + { + "type" : "file", + "name" : "--sample_fastq", + "description" : "The directory containing demultiplexed sample FASTQ files.", + "example" : [ + "output" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--metrics", + "description" : "Demultiplexing summary statisitcs:\n - control_reads_omitted: The number of reads that were omitted for being control reads.\n - failing_reads_omitted: The number of reads that were omitted for having failed QC.\n - total_templates: The total number of template reads that were output.\n", + "example" : [ + "metrics.tsv" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--most_frequent_unmatched", + "description" : "It contains the (approximate) counts of the most prevelant observed barcode sequences\nthat did not match to one of the expected barcodes. Can only be created when 'most_unmatched_to_output'\nis not set to 0.\n", + "example" : [ + "most_frequent_unmatched.tsv" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--sample_barcode_hop_metrics", + "description" : "File containing the frequently observed barcodes that are unexpected\ncombinations of expected barcodes in a dual-indexed run.\n", + "example" : [ + "sample_barcode_hop_metrics.tsv" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--per_project_metrics", + "description" : "Aggregates the metrics by project (aggregates the metrics across samples with the same project) and\nhas the same columns as `--metrics`. In this case, sample_ID will contain the project name (or None if no project is given).\nTHe barcode will contain all Ns. The undetermined sample will not be aggregated with any other sample.\n", + "example" : [ + "per_project_metrics.tsv" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--per_sample_metrics", + "description" : "Tab-separated file containing statistics per sample.\n", + "example" : [ + "per_sample_metrics.tsv" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Arguments", + "arguments" : [ + { + "type" : "string", + "name" : "--read_structures", + "alternatives" : [ + "-r" + ], + "description" : "Read structures, one per input FASTQ. Do not provide when using a path prefix for FASTQs", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--allowed_mismatches", + "alternatives" : [ + "-m" + ], + "description" : "Number of allowed mismatches between the observed barcode and the expected barcode", + "example" : [ + 1 + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--min_delta", + "alternatives" : [ + "-d" + ], + "description" : "The minimum allowed difference between an observed barcode and the second closest expected barcode", + "example" : [ + 2 + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--free_ns", + "alternatives" : [ + "-F" + ], + "description" : "Number of N's to allow in a barcode without counting against the allowed_mismatches", + "example" : [ + 1 + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--max_no_calls", + "alternatives" : [ + "-N" + ], + "description" : "Max no-calls (N's) in a barcode before it is considered unmatchable.\nA barcode with total N's greater than 'max_no_call' will be considered unmatchable.\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--quality_mask_threshold", + "alternatives" : [ + "-M" + ], + "description" : "Mask template bases with quality scores less than specified value(s).\nSample barcode/index and UMI bases are never masked. If provided either a single value,\nor one value per FASTQ must be provided.\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--filter_control_reads", + "alternatives" : [ + "-C" + ], + "description" : "Filter out control reads", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--filter_failing_quality", + "alternatives" : [ + "-Q" + ], + "description" : "Filter reads failing quality filter\n", + "direction" : "input" + }, + { + "type" : "string", + "name" : "--output_types", + "alternatives" : [ + "-T" + ], + "description" : "The types of output FASTQs to write.\nFor each read structure, all segment types listed will be output to a FASTQ file.\n\nThese may be any of the following:\n - `T` - Template bases\n - `B` - Sample barcode bases\n - `M` - Molecular barcode bases\n - `S` - Skip bases\n", + "example" : [ + "T" + ], + "required" : false, + "choices" : [ + "T", + "B", + "S", + "M" + ], + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--undetermined_sample_name", + "alternatives" : [ + "-u" + ], + "description" : "The sample name for undetermined reads (reads that do not match an expected barcode)\n", + "example" : [ + "Undetermined" + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--most_unmatched_to_output", + "alternatives" : [ + "-U" + ], + "description" : "Output the most frequent \\"unmatched\\" barcodes up to this number.\nIf set to 0 unmatched barcodes will not be collected, improving overall performance.\n", + "example" : [ + 1000 + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--override_matcher", + "description" : "If the sample barcodes are > 12 bp long, a cached hamming distance matcher is used.\nIf the barcodes are less than or equal to 12 bp long, all possible matches are precomputed.\nThis option allows for overriding that heuristic.\n", + "required" : false, + "choices" : [ + "cached-hamming-distance", + "pre-compute" + ], + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--skip_read_name_check", + "description" : "If this is true, then all the read names across FASTQs will not be enforced to be the same.\nThis may be useful when the read names are known to be the same and performance matters.\nRegardless, the first read name in each FASTQ will always be checked.\n", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--sample_barcode_in_fastq_header", + "description" : "If this is true, then the sample barcode is expected to be in the FASTQ read header.\nFor dual indexed data, the barcodes must be `+` (plus) delimited. Additionally, if true,\nthen neither index FASTQ files nor sample barcode segments in the read structure may be specified.\n", + "direction" : "input" + }, + { + "type" : "string", + "name" : "--metric_prefix", + "description" : "Prepend this prefix to all output metric file names\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--lane", + "alternatives" : [ + "-l" + ], + "description" : "Select a subset of lanes to demultiplex. Will cause only samples and input FASTQs with\nthe given `Lane`(s) to be demultiplexed. Samples without a lane will be ignored, and\nFASTQs without lane information will be ignored\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "bash_script", + "path" : "script.sh", + "is_executable" : true + } + ], + "description" : "Demultiplex sequence data generated on Singular Genomics' sequencing instruments.\n", + "test_resources" : [ + { + "type" : "bash_script", + "path" : "test.sh", + "is_executable" : true + }, + { + "type" : "file", + "path" : "test_data" + } + ], + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "keywords" : [ + "demultiplex", + "fastq" + ], + "license" : "Proprietairy", + "links" : { + "repository" : "https://github.com/Singular-Genomics/singular-demux" + }, + "runners" : [ + { + "type" : "executable", + "id" : "executable", + "docker_setup_strategy" : "ifneedbepullelsecachedbuild" + }, + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "docker", + "id" : "docker", + "image" : "continuumio/miniconda3:latest", + "target_registry" : "images.viash-hub.com", + "target_tag" : "main", + "namespace_separator" : "/", + "setup" : [ + { + "type" : "apt", + "packages" : [ + "procps" + ], + "interactive" : false + }, + { + "type" : "docker", + "run" : [ + "conda install -c conda-forge -c bioconda sgdemux && \\\\\necho \\"sgdemux: $(sgdemux --version | cut -d' ' -f2)\\" > /var/software_versions.txt\n" + ] + } + ] + }, + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/sgdemux/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "docker|native", + "output" : "target/nextflow/sgdemux", + "viash_version" : "0.9.0", + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" + }, + "package_config" : { + "name" : "biobox", + "version" : "main", + "description" : "A collection of bioinformatics tools for working with sequence data.\n", + "viash_version" : "0.9.0", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'main'" + ], + "keywords" : [ + "bioinformatics", + "modules", + "sequencing" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/biobox", + "issue_tracker" : "https://github.com/viash-hub/biobox/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// inner workflow hook +def innerWorkflowFactory(args) { + def rawScript = '''set -e +tempscript=".viash_script.sh" +cat > "$tempscript" << VIASHMAIN +#!/bin/bash + +set -eo pipefail + +## VIASH START +# The following code has been auto-generated by Viash. +$( if [ ! -z ${VIASH_PAR_FASTQS+x} ]; then echo "${VIASH_PAR_FASTQS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_fastqs='&'#" ; else echo "# par_fastqs="; fi ) +$( if [ ! -z ${VIASH_PAR_SAMPLE_METADATA+x} ]; then echo "${VIASH_PAR_SAMPLE_METADATA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_sample_metadata='&'#" ; else echo "# par_sample_metadata="; fi ) +$( if [ ! -z ${VIASH_PAR_SAMPLE_FASTQ+x} ]; then echo "${VIASH_PAR_SAMPLE_FASTQ}" | sed "s#'#'\\"'\\"'#g;s#.*#par_sample_fastq='&'#" ; else echo "# par_sample_fastq="; fi ) +$( if [ ! -z ${VIASH_PAR_METRICS+x} ]; then echo "${VIASH_PAR_METRICS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_metrics='&'#" ; else echo "# par_metrics="; fi ) +$( if [ ! -z ${VIASH_PAR_MOST_FREQUENT_UNMATCHED+x} ]; then echo "${VIASH_PAR_MOST_FREQUENT_UNMATCHED}" | sed "s#'#'\\"'\\"'#g;s#.*#par_most_frequent_unmatched='&'#" ; else echo "# par_most_frequent_unmatched="; fi ) +$( if [ ! -z ${VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS+x} ]; then echo "${VIASH_PAR_SAMPLE_BARCODE_HOP_METRICS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_sample_barcode_hop_metrics='&'#" ; else echo "# par_sample_barcode_hop_metrics="; fi ) +$( if [ ! -z ${VIASH_PAR_PER_PROJECT_METRICS+x} ]; then echo "${VIASH_PAR_PER_PROJECT_METRICS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_per_project_metrics='&'#" ; else echo "# par_per_project_metrics="; fi ) +$( if [ ! -z ${VIASH_PAR_PER_SAMPLE_METRICS+x} ]; then echo "${VIASH_PAR_PER_SAMPLE_METRICS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_per_sample_metrics='&'#" ; else echo "# par_per_sample_metrics="; fi ) +$( if [ ! -z ${VIASH_PAR_READ_STRUCTURES+x} ]; then echo "${VIASH_PAR_READ_STRUCTURES}" | sed "s#'#'\\"'\\"'#g;s#.*#par_read_structures='&'#" ; else echo "# par_read_structures="; fi ) +$( if [ ! -z ${VIASH_PAR_ALLOWED_MISMATCHES+x} ]; then echo "${VIASH_PAR_ALLOWED_MISMATCHES}" | sed "s#'#'\\"'\\"'#g;s#.*#par_allowed_mismatches='&'#" ; else echo "# par_allowed_mismatches="; fi ) +$( if [ ! -z ${VIASH_PAR_MIN_DELTA+x} ]; then echo "${VIASH_PAR_MIN_DELTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_min_delta='&'#" ; else echo "# par_min_delta="; fi ) +$( if [ ! -z ${VIASH_PAR_FREE_NS+x} ]; then echo "${VIASH_PAR_FREE_NS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_free_ns='&'#" ; else echo "# par_free_ns="; fi ) +$( if [ ! -z ${VIASH_PAR_MAX_NO_CALLS+x} ]; then echo "${VIASH_PAR_MAX_NO_CALLS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_max_no_calls='&'#" ; else echo "# par_max_no_calls="; fi ) +$( if [ ! -z ${VIASH_PAR_QUALITY_MASK_THRESHOLD+x} ]; then echo "${VIASH_PAR_QUALITY_MASK_THRESHOLD}" | sed "s#'#'\\"'\\"'#g;s#.*#par_quality_mask_threshold='&'#" ; else echo "# par_quality_mask_threshold="; fi ) +$( if [ ! -z ${VIASH_PAR_FILTER_CONTROL_READS+x} ]; then echo "${VIASH_PAR_FILTER_CONTROL_READS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_filter_control_reads='&'#" ; else echo "# par_filter_control_reads="; fi ) +$( if [ ! -z ${VIASH_PAR_FILTER_FAILING_QUALITY+x} ]; then echo "${VIASH_PAR_FILTER_FAILING_QUALITY}" | sed "s#'#'\\"'\\"'#g;s#.*#par_filter_failing_quality='&'#" ; else echo "# par_filter_failing_quality="; fi ) +$( if [ ! -z ${VIASH_PAR_OUTPUT_TYPES+x} ]; then echo "${VIASH_PAR_OUTPUT_TYPES}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output_types='&'#" ; else echo "# par_output_types="; fi ) +$( if [ ! -z ${VIASH_PAR_UNDETERMINED_SAMPLE_NAME+x} ]; then echo "${VIASH_PAR_UNDETERMINED_SAMPLE_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#par_undetermined_sample_name='&'#" ; else echo "# par_undetermined_sample_name="; fi ) +$( if [ ! -z ${VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT+x} ]; then echo "${VIASH_PAR_MOST_UNMATCHED_TO_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_most_unmatched_to_output='&'#" ; else echo "# par_most_unmatched_to_output="; fi ) +$( if [ ! -z ${VIASH_PAR_OVERRIDE_MATCHER+x} ]; then echo "${VIASH_PAR_OVERRIDE_MATCHER}" | sed "s#'#'\\"'\\"'#g;s#.*#par_override_matcher='&'#" ; else echo "# par_override_matcher="; fi ) +$( if [ ! -z ${VIASH_PAR_SKIP_READ_NAME_CHECK+x} ]; then echo "${VIASH_PAR_SKIP_READ_NAME_CHECK}" | sed "s#'#'\\"'\\"'#g;s#.*#par_skip_read_name_check='&'#" ; else echo "# par_skip_read_name_check="; fi ) +$( if [ ! -z ${VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER+x} ]; then echo "${VIASH_PAR_SAMPLE_BARCODE_IN_FASTQ_HEADER}" | sed "s#'#'\\"'\\"'#g;s#.*#par_sample_barcode_in_fastq_header='&'#" ; else echo "# par_sample_barcode_in_fastq_header="; fi ) +$( if [ ! -z ${VIASH_PAR_METRIC_PREFIX+x} ]; then echo "${VIASH_PAR_METRIC_PREFIX}" | sed "s#'#'\\"'\\"'#g;s#.*#par_metric_prefix='&'#" ; else echo "# par_metric_prefix="; fi ) +$( if [ ! -z ${VIASH_PAR_LANE+x} ]; then echo "${VIASH_PAR_LANE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_lane='&'#" ; else echo "# par_lane="; fi ) +$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi ) +$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi ) +$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi ) +$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi ) +$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi ) +$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi ) +$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi ) + +## VIASH END + +unset_if_false=( + par_filter_control_reads + par_filter_failing_quality + par_skip_read_name_check + par_sample_barcode_in_fastq_header +) + +for par in \\${unset_if_false[@]}; do + test_val="\\${!par}" + [[ "\\$test_val" == "false" ]] && unset \\$par +done + +# Create arrays for inputs that contain multiple arguments +IFS=";" read -ra fastqs <<< "\\$par_fastqs" +IFS=";" read -ra read_structures <<< "\\$par_read_structures" +IFS=";" read -ra lane <<< "\\$par_lane" +IFS=";" read -ra quality_mask_threashold <<< "\\$par_quality_mask_threshold" +IFS=";" read -ra output_types <<< "\\$par_output_types" + +echo "> Creating temporary directory" +# create temporary directory and clean up on exit +TMPDIR=\\$(mktemp -d "\\$meta_temp_dir/\\$meta_name-XXXXXX") +function clean_up { + [[ -d "\\$TMPDIR" ]] && rm -rf "\\$TMPDIR" +} +trap clean_up EXIT +echo "> Temporary directory '\\$TMPDIR' created" + +if [ "\\$par_most_unmatched_to_output" -eq "0" ] && [ ! -z "\\$par_most_frequent_unmatched" ]; then + echo "Requested to output 'most_frequent_unmatched' file, but 'most_unmatched_to_output' is set to 0." + exit 1 +fi + +# The sgdemux documentation recommends the following settings: +# 1/3 of available threads for compression +# 1/6 of available threads for writing +# 1/6-1/3 of available threads for demultiplexing +declare -A thread_settings=(["compression_threads"]="3" + ["writing_threads"]="6" + ["demultiplexing_threads"]="3" + ) +if [ ! -z "\\$meta_cpus" ]; then + for setting_var in "\\${!thread_settings[@]}"; do + denominator=\\${thread_settings[\\$setting_var]} + result=\\$(( \\$meta_cpus / \\$denominator )) + if (( \\$result == 0 )); then + result=1 + fi + declare \\$setting_var=\\$result + done +fi + +args=( + --fastqs \\${fastqs[@]} + --sample-metadata "\\$par_sample_metadata" + --output-dir "\\$TMPDIR" + \\${demultiplexing_threads:+--demux-threads \\$demultiplexing_threads} + \\${writing_threads:+--writer-threads \\$writing_threads} + \\${compression_threads:+--compressor-threads \\$compression_threads} + \\${par_allowed_mismatches:+--allowed-mismatches \\$par_allowed_mismatches} + \\${par_min_delta:+--min-delta \\$par_min_delta} + \\${par_free_ns:+--free-ns \\$par_free_ns} + \\${par_max_no_calls:+--max-no-calls \\$par_max_no_calls} + \\${quality_mask_threashold:+--quality-mask-threshold "\\${quality_mask_threashold[*]}" } + \\${output_types:+--output-types "\\${output_types[*]}"} + \\${par_undetermined_sample_name:+--undetermined-sample-name \\${par_undetermined_sample_name}} + \\${par_most_unmatched_to_output:+--par-most-unmatched-to-output \\${par_most_unmatched_to_output}} + \\${par_override_matcher:+--override-matcher \\$par_override_matcher} + \\${par_metric_prefix:+--metric-prefix \\$par_metric_prefix} + \\${lane:+--lane "\\${lane[*]}"} + \\${read_structures:+--read-structures \\${read_structures[*]}} + \\${par_filter_control_reads:+--filter-control-reads} + \\${par_filter_failing_quality:+--filter-failing-quality} + \\${par_skip_read_name_check:+--skip-read-name-check} + \\${par_sample_barcode_in_fastq_header:+--sample-barcode-in-fastq-header} +) + +echo "> Running sgdemux with arguments: \\${args[@]}" +sgdemux \\${args[@]} +echo "> Done running sgdemux" + +echo "> Copying FASTQ files to \\$par_sample_fastq" +find "\\$TMPDIR" -type f -name "*.fastq.gz" -exec mv '{}' "\\$par_sample_fastq" \\\\; + +declare -A output_files=(["metrics.tsv"]="par_metrics" + ["most_frequent_unmatched.tsv"]="par_most_frequent_unmatched" + ["sample_barcode_hop_metrics.tsv"]="par_sample_barcode_hop_metrics" + ["per_project_metrics.tsv"]="par_per_project_metrics" + ["per_sample_metrics.tsv"]="par_per_sample_metrics" + ) + +for output_file_name in "\\${!output_files[@]}"; do + output_arg_variable_name=\\${output_files[\\$output_file_name]} + destination="\\${!output_arg_variable_name}" + if [ ! -z "\\$destination" ]; then + echo "> Copying \\$output_file file to \\$destination" + output_file="\\$TMPDIR/\\$output_file_name" + if [ ! -f "\\$output_file" ]; then + echo "Expected a '\\$output_file_name' to have been created! Exiting..." + exit 1 + fi + cp "\\$output_file" "\\$destination" + fi +done + +echo "> Finished!" +VIASHMAIN +bash "$tempscript" +''' + + return vdsl3WorkflowFactory(args, meta, rawScript) +} + + + +/** + * Generate a workflow for VDSL3 modules. + * + * This function is called by the workflowFactory() function. + * + * Input channel: [id, input_map] + * Output channel: [id, output_map] + * + * Internally, this workflow will convert the input channel + * to a format which the Nextflow module will be able to handle. + */ +def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) { + def key = args["key"] + def processObj = null + + workflow processWf { + take: input_ + main: + + if (processObj == null) { + processObj = _vdsl3ProcessFactory(args, meta, rawScript) + } + + output_ = input_ + | map { tuple -> + def id = tuple[0] + def data_ = tuple[1] + + if (workflow.stubRun) { + // add id if missing + data_ = [id: 'stub'] + data_ + } + + // process input files separately + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { par -> + def val = data_.containsKey(par.plainName) ? data_[par.plainName] : [] + def inputFiles = [] + if (val == null) { + inputFiles = [] + } else if (val instanceof List) { + inputFiles = val + } else if (val instanceof Path) { + inputFiles = [ val ] + } else { + inputFiles = [] + } + if (!workflow.stubRun) { + // throw error when an input file doesn't exist + inputFiles.each{ file -> + assert file.exists() : + "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" + + " Required input file does not exist.\n" + + " Path: '$file'.\n" + + " Expected input file to exist" + } + } + inputFiles + } + + // remove input files + def argsExclInputFiles = meta.config.allArguments + .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) } + .collectEntries { par -> + def parName = par.plainName + def val = data_[parName] + if (par.multiple && val instanceof Collection) { + val = val.join(par.multiple_sep) + } + if (par.direction == "output" && par.type == "file") { + val = val + .replaceAll('\\$id', id) + .replaceAll('\\$\\{id\\}', id) + .replaceAll('\\$key', key) + .replaceAll('\\$\\{key\\}', key) + } + [parName, val] + } + + [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ] + } + | processObj + | map { output -> + def outputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .indexed() + .collectEntries{ index, par -> + def out = output[index + 1] + // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678) + if (!out instanceof List || out.size() <= 1) { + if (par.multiple) { + out = [] + } else { + assert !par.required : + "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" + + " Required output file is missing" + out = null + } + } else if (out.size() == 2 && !par.multiple) { + out = out[1] + } else { + out = out.drop(1) + } + [ par.plainName, out ] + } + + // drop null outputs + outputFiles.removeAll{it.value == null} + + [ output[0], outputFiles ] + } + emit: output_ + } + + return processWf +} + +// depends on: session? +def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) { + // autodetect process key + def wfKey = workflowArgs["key"] + def procKeyPrefix = "${wfKey}_process" + def scriptMeta = nextflow.script.ScriptMeta.current() + def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)} + def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()} + def newNumber = (numbers + [-1]).max() + 1 + + def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber" + + if (newNumber > 0) { + log.warn "Key for module '${wfKey}' is duplicated.\n", + "If you run a component multiple times in the same workflow,\n" + + "it's recommended you set a unique key for every call,\n" + + "for example: ${wfKey}.run(key: \"foo\")." + } + + // subset directives and convert to list of tuples + def drctv = workflowArgs.directives + + // TODO: unit test the two commands below + // convert publish array into tags + def valueToStr = { val -> + // ignore closures + if (val instanceof CharSequence) { + if (!val.matches('^[{].*[}]$')) { + '"' + val + '"' + } else { + val + } + } else if (val instanceof List) { + "[" + val.collect{valueToStr(it)}.join(", ") + "]" + } else if (val instanceof Map) { + "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]" + } else { + val.inspect() + } + } + + // multiple entries allowed: label, publishdir + def drctvStrs = drctv.collect { key, value -> + if (key in ["label", "publishDir"]) { + value.collect{ val -> + if (val instanceof Map) { + "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else if (val == null) { + "" + } else { + "\n$key " + valueToStr(val) + } + }.join() + } else if (value instanceof Map) { + "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else { + "\n$key " + valueToStr(value) + } + }.join() + + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' } + .join() + + def outputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + // insert dummy into every output (see nextflow-io/nextflow#2678) + if (!par.multiple) { + ', path{[".exitcode", args.' + par.plainName + ']}' + } else { + ', path{[".exitcode"] + args.' + par.plainName + '}' + } + } + .join() + + // TODO: move this functionality somewhere else? + if (workflowArgs.auto.transcript) { + outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}' + } else { + outputPaths = outputPaths + ', path{[".exitcode"]}' + } + + // create dirs for output files (based on BashWrapper.createParentFiles) + def createParentStr = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" && it.create_parent } + .collect { par -> + def contents = "args[\"${par.plainName}\"] instanceof List ? args[\"${par.plainName}\"].join('\" \"') : args[\"${par.plainName}\"]" + "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent '\" + escapeText(${contents}) + \"'\" : \"\" }" + } + .join("\n") + + // construct inputFileExports + def inputFileExports = meta.config.allArguments + .findAll { it.type == "file" && it.direction.toLowerCase() == "input" } + .collect { par -> + def contents = "viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName}" + "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}='\" + escapeText(${contents}) + \"'\"}" + } + + // NOTE: if using docker, use /tmp instead of tmpDir! + def tmpDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('VIASH_TMPDIR') ?: + System.getenv('VIASH_TEMPDIR') ?: + System.getenv('VIASH_TMP') ?: + System.getenv('TEMP') ?: + System.getenv('TMPDIR') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMP') ?: + '/tmp' + ).toAbsolutePath() + + // construct stub + def stub = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // escape script + def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"') + + // publishdir assert + def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? + """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n Example: --publish_dir './output/'" """ : + "" + + // generate process string + def procStr = + """nextflow.enable.dsl=2 + | + |def escapeText = { s -> s.toString().replaceAll("'", "'\\\"'\\\"'") } + |process $procKey {$drctvStrs + |input: + | tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources") + |output: + | tuple val("\$id")$outputPaths, optional: true + |stub: + |\"\"\" + |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; } + |$stub + |\"\"\" + |script:$assertStr + |def parInject = args + | .findAll{key, value -> value != null} + | .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}='\${escapeText(value)}'"} + | .join("\\n") + |\"\"\" + |# meta exports + |export VIASH_META_RESOURCES_DIR="\${resourcesDir}" + |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}" + |export VIASH_META_NAME="${meta.config.name}" + |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME" + |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml" + |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" } + |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" } + |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then + | export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 )) + | export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 )) + | export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 )) + | export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 )) + | export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 )) + | export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 )) + | export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 )) + | export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 )) + | export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 )) + | export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 )) + |fi + | + |# meta synonyms + |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR" + |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR" + | + |# create output dirs if need be + |function mkdir_parent { + | for file in "\\\$@"; do + | mkdir -p "\\\$(dirname "\\\$file")" + | done + |} + |$createParentStr + | + |# argument exports${inputFileExports.join()} + |\$parInject + | + |# process script + |${escapedScript} + |\"\"\" + |} + |""".stripMargin() + + // TODO: print on debug + // if (workflowArgs.debug == true) { + // println("######################\n$procStr\n######################") + // } + + // write process to temp file + def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf") + addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) } + tempFile.text = procStr + + // create process from temp file + def binding = new nextflow.script.ScriptBinding([:]) + def session = nextflow.Nextflow.getSession() + def parser = new nextflow.script.ScriptParser(session) + .setModule(true) + .setBinding(binding) + def moduleScript = parser.runScript(tempFile) + .getScript() + + // register module in meta + def module = new nextflow.script.IncludeDef.Module(name: procKey) + scriptMeta.addModule(moduleScript, module.name, module.alias) + + // retrieve and return process from meta + return scriptMeta.getProcess(procKey) +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "container" : { + "registry" : "images.viash-hub.com", + "image" : "vsh/biobox/sgdemux", + "tag" : "main" + }, + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/nextflow/sgdemux/nextflow.config b/target/nextflow/sgdemux/nextflow.config new file mode 100644 index 00000000..c2728bdd --- /dev/null +++ b/target/nextflow/sgdemux/nextflow.config @@ -0,0 +1,126 @@ +manifest { + name = 'sgdemux' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'main' + description = 'Demultiplex sequence data generated on Singular Genomics\' sequencing instruments.\n' + author = 'Dries Schaumont' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/nextflow/sgdemux/nextflow_schema.json b/target/nextflow/sgdemux/nextflow_schema.json new file mode 100644 index 00000000..96d808c2 --- /dev/null +++ b/target/nextflow/sgdemux/nextflow_schema.json @@ -0,0 +1,342 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "sgdemux", +"description": "Demultiplex sequence data generated on Singular Genomics\u0027 sequencing instruments.\n", +"type": "object", +"definitions": { + + + + "arguments" : { + "title": "Arguments", + "type": "object", + "description": "No description", + "properties": { + + + "read_structures": { + "type": + "string", + "description": "Type: List of `string`, multiple_sep: `\";\"`. Read structures, one per input FASTQ", + "help_text": "Type: List of `string`, multiple_sep: `\";\"`. Read structures, one per input FASTQ. Do not provide when using a path prefix for FASTQs" + + } + + + , + "allowed_mismatches": { + "type": + "integer", + "description": "Type: `integer`, example: `1`. Number of allowed mismatches between the observed barcode and the expected barcode", + "help_text": "Type: `integer`, example: `1`. Number of allowed mismatches between the observed barcode and the expected barcode" + + } + + + , + "min_delta": { + "type": + "integer", + "description": "Type: `integer`, example: `2`. The minimum allowed difference between an observed barcode and the second closest expected barcode", + "help_text": "Type: `integer`, example: `2`. The minimum allowed difference between an observed barcode and the second closest expected barcode" + + } + + + , + "free_ns": { + "type": + "integer", + "description": "Type: `integer`, example: `1`. Number of N\u0027s to allow in a barcode without counting against the allowed_mismatches", + "help_text": "Type: `integer`, example: `1`. Number of N\u0027s to allow in a barcode without counting against the allowed_mismatches" + + } + + + , + "max_no_calls": { + "type": + "integer", + "description": "Type: `integer`. Max no-calls (N\u0027s) in a barcode before it is considered unmatchable", + "help_text": "Type: `integer`. Max no-calls (N\u0027s) in a barcode before it is considered unmatchable.\nA barcode with total N\u0027s greater than \u0027max_no_call\u0027 will be considered unmatchable.\n" + + } + + + , + "quality_mask_threshold": { + "type": + "string", + "description": "Type: List of `integer`, multiple_sep: `\";\"`. Mask template bases with quality scores less than specified value(s)", + "help_text": "Type: List of `integer`, multiple_sep: `\";\"`. Mask template bases with quality scores less than specified value(s).\nSample barcode/index and UMI bases are never masked. If provided either a single value,\nor one value per FASTQ must be provided.\n" + + } + + + , + "filter_control_reads": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Filter out control reads", + "help_text": "Type: `boolean_true`, default: `false`. Filter out control reads" + , + "default": "False" + } + + + , + "filter_failing_quality": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Filter reads failing quality filter\n", + "help_text": "Type: `boolean_true`, default: `false`. Filter reads failing quality filter\n" + , + "default": "False" + } + + + , + "output_types": { + "type": + "string", + "description": "Type: List of `string`, example: `T`, multiple_sep: `\";\"`, choices: ``T`, `B`, `S`, `M``. The types of output FASTQs to write", + "help_text": "Type: List of `string`, example: `T`, multiple_sep: `\";\"`, choices: ``T`, `B`, `S`, `M``. The types of output FASTQs to write.\nFor each read structure, all segment types listed will be output to a FASTQ file.\n\nThese may be any of the following:\n - `T` - Template bases\n - `B` - Sample barcode bases\n - `M` - Molecular barcode bases\n - `S` - Skip bases\n", + "enum": ["T", "B", "S", "M"] + + + } + + + , + "undetermined_sample_name": { + "type": + "string", + "description": "Type: `string`, example: `Undetermined`. The sample name for undetermined reads (reads that do not match an expected barcode)\n", + "help_text": "Type: `string`, example: `Undetermined`. The sample name for undetermined reads (reads that do not match an expected barcode)\n" + + } + + + , + "most_unmatched_to_output": { + "type": + "integer", + "description": "Type: `integer`, example: `1000`. Output the most frequent \"unmatched\" barcodes up to this number", + "help_text": "Type: `integer`, example: `1000`. Output the most frequent \"unmatched\" barcodes up to this number.\nIf set to 0 unmatched barcodes will not be collected, improving overall performance.\n" + + } + + + , + "override_matcher": { + "type": + "string", + "description": "Type: `string`, choices: ``cached-hamming-distance`, `pre-compute``. If the sample barcodes are \u003e 12 bp long, a cached hamming distance matcher is used", + "help_text": "Type: `string`, choices: ``cached-hamming-distance`, `pre-compute``. If the sample barcodes are \u003e 12 bp long, a cached hamming distance matcher is used.\nIf the barcodes are less than or equal to 12 bp long, all possible matches are precomputed.\nThis option allows for overriding that heuristic.\n", + "enum": ["cached-hamming-distance", "pre-compute"] + + + } + + + , + "skip_read_name_check": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. If this is true, then all the read names across FASTQs will not be enforced to be the same", + "help_text": "Type: `boolean_true`, default: `false`. If this is true, then all the read names across FASTQs will not be enforced to be the same.\nThis may be useful when the read names are known to be the same and performance matters.\nRegardless, the first read name in each FASTQ will always be checked.\n" + , + "default": "False" + } + + + , + "sample_barcode_in_fastq_header": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. If this is true, then the sample barcode is expected to be in the FASTQ read header", + "help_text": "Type: `boolean_true`, default: `false`. If this is true, then the sample barcode is expected to be in the FASTQ read header.\nFor dual indexed data, the barcodes must be `+` (plus) delimited. Additionally, if true,\nthen neither index FASTQ files nor sample barcode segments in the read structure may be specified.\n" + , + "default": "False" + } + + + , + "metric_prefix": { + "type": + "string", + "description": "Type: `string`. Prepend this prefix to all output metric file names\n", + "help_text": "Type: `string`. Prepend this prefix to all output metric file names\n" + + } + + + , + "lane": { + "type": + "string", + "description": "Type: List of `integer`, multiple_sep: `\";\"`. Select a subset of lanes to demultiplex", + "help_text": "Type: List of `integer`, multiple_sep: `\";\"`. Select a subset of lanes to demultiplex. Will cause only samples and input FASTQs with\nthe given `Lane`(s) to be demultiplexed. Samples without a lane will be ignored, and\nFASTQs without lane information will be ignored\n" + + } + + +} +}, + + + "input" : { + "title": "Input", + "type": "object", + "description": "No description", + "properties": { + + + "fastqs": { + "type": + "string", + "description": "Type: List of `file`, required, example: `sample1_r1.fq;sample1_r2.fq;sample2_r1.fq;sample2_r2.fq`, multiple_sep: `\";\"`. Path to the input FASTQs, or path prefix if not a file", + "help_text": "Type: List of `file`, required, example: `sample1_r1.fq;sample1_r2.fq;sample2_r1.fq;sample2_r2.fq`, multiple_sep: `\";\"`. Path to the input FASTQs, or path prefix if not a file" + + } + + + , + "sample_metadata": { + "type": + "string", + "description": "Type: `file`, required. Path to the sample metadata CSV file including sample names and barcode sequences", + "help_text": "Type: `file`, required. Path to the sample metadata CSV file including sample names and barcode sequences" + + } + + +} +}, + + + "output" : { + "title": "Output", + "type": "object", + "description": "No description", + "properties": { + + + "sample_fastq": { + "type": + "string", + "description": "Type: `file`, required, default: `$id.$key.sample_fastq.sample_fastq`, example: `output`. The directory containing demultiplexed sample FASTQ files", + "help_text": "Type: `file`, required, default: `$id.$key.sample_fastq.sample_fastq`, example: `output`. The directory containing demultiplexed sample FASTQ files." + , + "default": "$id.$key.sample_fastq.sample_fastq" + } + + + , + "metrics": { + "type": + "string", + "description": "Type: `file`, default: `$id.$key.metrics.tsv`, example: `metrics.tsv`. Demultiplexing summary statisitcs:\n - control_reads_omitted: The number of reads that were omitted for being control reads", + "help_text": "Type: `file`, default: `$id.$key.metrics.tsv`, example: `metrics.tsv`. Demultiplexing summary statisitcs:\n - control_reads_omitted: The number of reads that were omitted for being control reads.\n - failing_reads_omitted: The number of reads that were omitted for having failed QC.\n - total_templates: The total number of template reads that were output.\n" + , + "default": "$id.$key.metrics.tsv" + } + + + , + "most_frequent_unmatched": { + "type": + "string", + "description": "Type: `file`, default: `$id.$key.most_frequent_unmatched.tsv`, example: `most_frequent_unmatched.tsv`. It contains the (approximate) counts of the most prevelant observed barcode sequences\nthat did not match to one of the expected barcodes", + "help_text": "Type: `file`, default: `$id.$key.most_frequent_unmatched.tsv`, example: `most_frequent_unmatched.tsv`. It contains the (approximate) counts of the most prevelant observed barcode sequences\nthat did not match to one of the expected barcodes. Can only be created when \u0027most_unmatched_to_output\u0027\nis not set to 0.\n" + , + "default": "$id.$key.most_frequent_unmatched.tsv" + } + + + , + "sample_barcode_hop_metrics": { + "type": + "string", + "description": "Type: `file`, default: `$id.$key.sample_barcode_hop_metrics.tsv`, example: `sample_barcode_hop_metrics.tsv`. File containing the frequently observed barcodes that are unexpected\ncombinations of expected barcodes in a dual-indexed run", + "help_text": "Type: `file`, default: `$id.$key.sample_barcode_hop_metrics.tsv`, example: `sample_barcode_hop_metrics.tsv`. File containing the frequently observed barcodes that are unexpected\ncombinations of expected barcodes in a dual-indexed run.\n" + , + "default": "$id.$key.sample_barcode_hop_metrics.tsv" + } + + + , + "per_project_metrics": { + "type": + "string", + "description": "Type: `file`, default: `$id.$key.per_project_metrics.tsv`, example: `per_project_metrics.tsv`. Aggregates the metrics by project (aggregates the metrics across samples with the same project) and\nhas the same columns as `--metrics`", + "help_text": "Type: `file`, default: `$id.$key.per_project_metrics.tsv`, example: `per_project_metrics.tsv`. Aggregates the metrics by project (aggregates the metrics across samples with the same project) and\nhas the same columns as `--metrics`. In this case, sample_ID will contain the project name (or None if no project is given).\nTHe barcode will contain all Ns. The undetermined sample will not be aggregated with any other sample.\n" + , + "default": "$id.$key.per_project_metrics.tsv" + } + + + , + "per_sample_metrics": { + "type": + "string", + "description": "Type: `file`, default: `$id.$key.per_sample_metrics.tsv`, example: `per_sample_metrics.tsv`. Tab-separated file containing statistics per sample", + "help_text": "Type: `file`, default: `$id.$key.per_sample_metrics.tsv`, example: `per_sample_metrics.tsv`. Tab-separated file containing statistics per sample.\n" + , + "default": "$id.$key.per_sample_metrics.tsv" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/arguments" + }, + + { + "$ref": "#/definitions/input" + }, + + { + "$ref": "#/definitions/output" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/nextflow/snpeff/.config.vsh.yaml b/target/nextflow/snpeff/.config.vsh.yaml index d4957a63..8b52a735 100644 --- a/target/nextflow/snpeff/.config.vsh.yaml +++ b/target/nextflow/snpeff/.config.vsh.yaml @@ -628,9 +628,9 @@ build_info: output: "target/nextflow/snpeff" executable: "target/nextflow/snpeff/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/snpeff/main.nf b/target/nextflow/snpeff/main.nf index 51aa3beb..66b3b806 100644 --- a/target/nextflow/snpeff/main.nf +++ b/target/nextflow/snpeff/main.nf @@ -3555,9 +3555,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/snpeff", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/sortmerna/.config.vsh.yaml b/target/nextflow/sortmerna/.config.vsh.yaml index 41c18d1e..aa60b73b 100644 --- a/target/nextflow/sortmerna/.config.vsh.yaml +++ b/target/nextflow/sortmerna/.config.vsh.yaml @@ -594,9 +594,9 @@ build_info: output: "target/nextflow/sortmerna" executable: "target/nextflow/sortmerna/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/sortmerna/main.nf b/target/nextflow/sortmerna/main.nf index 6b74ce0e..ec34730c 100644 --- a/target/nextflow/sortmerna/main.nf +++ b/target/nextflow/sortmerna/main.nf @@ -3460,9 +3460,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/sortmerna", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/star/star_align_reads/.config.vsh.yaml b/target/nextflow/star/star_align_reads/.config.vsh.yaml index 3ad58561..6f32935e 100644 --- a/target/nextflow/star/star_align_reads/.config.vsh.yaml +++ b/target/nextflow/star/star_align_reads/.config.vsh.yaml @@ -2663,9 +2663,9 @@ build_info: output: "target/nextflow/star/star_align_reads" executable: "target/nextflow/star/star_align_reads/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/star/star_align_reads/main.nf b/target/nextflow/star/star_align_reads/main.nf index fc36f07d..616db3a0 100644 --- a/target/nextflow/star/star_align_reads/main.nf +++ b/target/nextflow/star/star_align_reads/main.nf @@ -5943,9 +5943,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/star/star_align_reads", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/star/star_genome_generate/.config.vsh.yaml b/target/nextflow/star/star_genome_generate/.config.vsh.yaml index 0536e87b..627bc7ce 100644 --- a/target/nextflow/star/star_genome_generate/.config.vsh.yaml +++ b/target/nextflow/star/star_genome_generate/.config.vsh.yaml @@ -333,9 +333,9 @@ build_info: output: "target/nextflow/star/star_genome_generate" executable: "target/nextflow/star/star_genome_generate/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/star/star_genome_generate/main.nf b/target/nextflow/star/star_genome_generate/main.nf index 33cb90a0..6f611a24 100644 --- a/target/nextflow/star/star_genome_generate/main.nf +++ b/target/nextflow/star/star_genome_generate/main.nf @@ -3195,9 +3195,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/star/star_genome_generate", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/trimgalore/.config.vsh.yaml b/target/nextflow/trimgalore/.config.vsh.yaml index f47810ef..0159a7f7 100644 --- a/target/nextflow/trimgalore/.config.vsh.yaml +++ b/target/nextflow/trimgalore/.config.vsh.yaml @@ -770,9 +770,9 @@ build_info: output: "target/nextflow/trimgalore" executable: "target/nextflow/trimgalore/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/trimgalore/main.nf b/target/nextflow/trimgalore/main.nf index e4eaea09..166f446f 100644 --- a/target/nextflow/trimgalore/main.nf +++ b/target/nextflow/trimgalore/main.nf @@ -3560,9 +3560,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/trimgalore", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml b/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml index 9aac793b..4533985c 100644 --- a/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml +++ b/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml @@ -611,9 +611,9 @@ build_info: output: "target/nextflow/umi_tools/umi_tools_dedup" executable: "target/nextflow/umi_tools/umi_tools_dedup/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/umi_tools/umi_tools_dedup/main.nf b/target/nextflow/umi_tools/umi_tools_dedup/main.nf index 86abc8f7..f08a38cb 100644 --- a/target/nextflow/umi_tools/umi_tools_dedup/main.nf +++ b/target/nextflow/umi_tools/umi_tools_dedup/main.nf @@ -3487,9 +3487,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/umi_tools/umi_tools_dedup", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml b/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml index c04a85ec..b9087e1d 100644 --- a/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml +++ b/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml @@ -434,9 +434,9 @@ build_info: output: "target/nextflow/umi_tools/umi_tools_extract" executable: "target/nextflow/umi_tools/umi_tools_extract/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/umi_tools/umi_tools_extract/main.nf b/target/nextflow/umi_tools/umi_tools_extract/main.nf index 52c67ff0..89c8780b 100644 --- a/target/nextflow/umi_tools/umi_tools_extract/main.nf +++ b/target/nextflow/umi_tools/umi_tools_extract/main.nf @@ -3299,9 +3299,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/umi_tools/umi_tools_extract", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox", diff --git a/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml b/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml index 7d207d0b..06805df1 100644 --- a/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml +++ b/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml @@ -256,9 +256,9 @@ build_info: output: "target/nextflow/umi_tools/umi_tools_prepareforrsem" executable: "target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf" viash_version: "0.9.0" - git_commit: "1d17ce01e25569c8e898b8160af1480ad22fc986" - git_remote: "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox" - git_tag: "v0.2.0-24-g1d17ce0" + git_commit: "065297be5fb2d88020fc50e042bb3f49c9254ae9" + git_remote: "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox" + git_tag: "v0.2.0-25-g065297b" package_config: name: "biobox" version: "main" diff --git a/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf b/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf index 22d0d3ce..1deda8b6 100644 --- a/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf +++ b/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf @@ -3121,9 +3121,9 @@ meta = [ "engine" : "docker|native", "output" : "target/nextflow/umi_tools/umi_tools_prepareforrsem", "viash_version" : "0.9.0", - "git_commit" : "1d17ce01e25569c8e898b8160af1480ad22fc986", - "git_remote" : "https://x-access-token:ghs_6YTGQkPF5IMZyp8fS3YMcIBjhXPmep1DKcNC@github.com/viash-hub/biobox", - "git_tag" : "v0.2.0-24-g1d17ce0" + "git_commit" : "065297be5fb2d88020fc50e042bb3f49c9254ae9", + "git_remote" : "https://x-access-token:ghs_bGw8YykA469ibXe1g5GsidZ6N0n23m22jhvl@github.com/viash-hub/biobox", + "git_tag" : "v0.2.0-25-g065297b" }, "package_config" : { "name" : "biobox",