From a7b0d33a321ac5de7907304788aad233cbf4b806 Mon Sep 17 00:00:00 2001
From: CI <toni@data-intuitive.com>
Date: Sat, 26 Oct 2024 19:02:37 +0000
Subject: [PATCH] Build branch main with version main (aa43543)

Build pipeline: viash-hub.biobox.main-2k68h

Source commit: https://github.com/viash-hub/biobox/commit/aa43543e1fb609901d09b7a9f0c5e72707cb47a4

Source message: Rseqc innerdistance (#159)

* initial commit dedup

* Revert "initial commit dedup"

This reverts commit 38f586bec0ac9e4312b016e29c3aa0bd53f292b2.

* full component with two tests

* fix default values

* adjust argument names and container image

---------

Co-authored-by: Robrecht Cannoodt <rcannood@gmail.com>
---
 CHANGELOG.md                                  |   24 +-
 .../config.vsh.yaml                           |  105 +
 .../help.txt                                  |   85 +
 .../script.sh                                 |   22 +
 .../test.sh                                   |   36 +
 .../test_data/1_truncated.gff                 |  123 +
 .../test_data/kill_list.txt                   |    3 +
 .../test_data/script.sh                       |   13 +
 .../test_data/test_output.gff                 |  113 +
 .../agat_sp_merge_annotations/config.vsh.yaml |   67 +
 src/agat/agat_sp_merge_annotations/help.txt   |   64 +
 src/agat/agat_sp_merge_annotations/script.sh  |   19 +
 src/agat/agat_sp_merge_annotations/test.sh    |   56 +
 .../test_data/agat_sp_merge_annotations_1.gff |   13 +
 .../test_data/agat_sp_merge_annotations_2.gff |    3 +
 .../test_data/file1.gff                       |   14 +
 .../test_data/file2.gff                       |   12 +
 .../test_data/fileA.gff                       |    2 +
 .../test_data/fileB.gff                       |    2 +
 .../test_data/script.sh                       |   15 +
 .../bedtools_bamtobed/config.vsh.yaml         |  118 +
 src/bedtools/bedtools_bamtobed/help.txt       |   43 +
 src/bedtools/bedtools_bamtobed/script.sh      |   39 +
 src/bedtools/bedtools_bamtobed/test.sh        |  183 +
 .../bedtools_bamtobed/test_data/example.bam   |  Bin 0 -> 334 bytes
 .../bedtools_bamtobed/test_data/example.sam   |    3 +
 src/rseqc/rseqc_bamstat/config.vsh.yaml       |   59 +
 src/rseqc/rseqc_bamstat/help.txt              |   18 +
 src/rseqc/rseqc_bamstat/script.sh             |    9 +
 src/rseqc/rseqc_bamstat/test.sh               |   49 +
 .../rseqc_bamstat/test_data/ref_output.txt    |   22 +
 .../test_data/ref_output_mapq.txt             |   22 +
 src/rseqc/rseqc_bamstat/test_data/sample.bam  |  Bin 0 -> 9240 bytes
 .../rseqc_inferexperiment/config.vsh.yaml     |   76 +
 src/rseqc/rseqc_inferexperiment/help.txt      |   21 +
 src/rseqc/rseqc_inferexperiment/script.sh     |   10 +
 src/rseqc/rseqc_inferexperiment/test.sh       |   72 +
 .../test_data/sample.bam                      |  Bin 0 -> 5595 bytes
 .../test_data/test.bed12                      |    4 +
 .../test_data/test.paired_end.sorted.bam      |  Bin 0 -> 19725 bytes
 .../rseqc_inner_distance/config.vsh.yaml      |  116 +
 src/rseqc/rseqc_inner_distance/help.txt       |   43 +
 src/rseqc/rseqc_inner_distance/script.sh      |   25 +
 src/rseqc/rseqc_inner_distance/test.sh        |   77 +
 .../rseqc_inner_distance/test_data/test.bed12 |    4 +
 .../test_data/test.paired_end.sorted.bam      |  Bin 0 -> 10205 bytes
 .../test_data/test1.inner_distance.txt        |   49 +
 .../test_data/test1.inner_distance_freq.txt   |  100 +
 .../test_data/test2.inner_distance.txt        |    4 +
 .../test_data/test2.inner_distance_freq.txt   |  100 +
 .../agat_convert_bed2gff/.config.vsh.yaml     |    6 +-
 .../agat_convert_bed2gff/agat_convert_bed2gff |    4 +-
 .../agat_convert_embl2gff/.config.vsh.yaml    |    6 +-
 .../agat_convert_embl2gff                     |    4 +-
 .../agat_convert_genscan2gff/.config.vsh.yaml |    6 +-
 .../agat_convert_genscan2gff                  |    4 +-
 .../agat_convert_sp_gff2gtf/.config.vsh.yaml  |    6 +-
 .../agat_convert_sp_gff2gtf                   |    4 +-
 .../agat_convert_sp_gff2tsv/.config.vsh.yaml  |    6 +-
 .../agat_convert_sp_gff2tsv                   |    4 +-
 .../agat_convert_sp_gxf2gxf/.config.vsh.yaml  |    6 +-
 .../agat_convert_sp_gxf2gxf                   |    4 +-
 .../agat/agat_sp_add_introns/.config.vsh.yaml |    6 +-
 .../agat_sp_add_introns/agat_sp_add_introns   |    4 +-
 .../.config.vsh.yaml                          |  263 ++
 .../agat_sp_filter_feature_from_kill_list     | 1312 ++++++
 .../.config.vsh.yaml                          |  211 +
 .../agat_sp_merge_annotations                 | 1187 ++++++
 .../agat/agat_sp_statistics/.config.vsh.yaml  |    6 +-
 .../agat_sp_statistics/agat_sp_statistics     |    4 +-
 target/executable/arriba/.config.vsh.yaml     |    6 +-
 target/executable/arriba/arriba               |    4 +-
 .../bbmap/bbmap_bbsplit/.config.vsh.yaml      |    6 +-
 .../bbmap/bbmap_bbsplit/bbmap_bbsplit         |    4 +-
 .../bcftools_annotate/.config.vsh.yaml        |    6 +-
 .../bcftools_annotate/bcftools_annotate       |    4 +-
 .../bcftools/bcftools_concat/.config.vsh.yaml |    6 +-
 .../bcftools/bcftools_concat/bcftools_concat  |    4 +-
 .../bcftools/bcftools_norm/.config.vsh.yaml   |    6 +-
 .../bcftools/bcftools_norm/bcftools_norm      |    4 +-
 .../bcftools/bcftools_sort/.config.vsh.yaml   |    6 +-
 .../bcftools/bcftools_sort/bcftools_sort      |    4 +-
 .../bcftools/bcftools_stats/.config.vsh.yaml  |    6 +-
 .../bcftools/bcftools_stats/bcftools_stats    |    4 +-
 .../executable/bcl_convert/.config.vsh.yaml   |    6 +-
 target/executable/bcl_convert/bcl_convert     |    4 +-
 .../.config.vsh.yaml                          |    6 +-
 .../bd_rhapsody_make_reference                |    4 +-
 .../.config.vsh.yaml                          |    6 +-
 .../bd_rhapsody_sequence_analysis             |    4 +-
 .../bedtools_bamtobed/.config.vsh.yaml        |  262 ++
 .../bedtools_bamtobed/bedtools_bamtobed       | 1313 ++++++
 .../bedtools_bamtofastq/.config.vsh.yaml      |    6 +-
 .../bedtools_bamtofastq/bedtools_bamtofastq   |    4 +-
 .../bedtools_bed12tobed6/.config.vsh.yaml     |    6 +-
 .../bedtools_bed12tobed6/bedtools_bed12tobed6 |    4 +-
 .../bedtools_bedtobam/.config.vsh.yaml        |    6 +-
 .../bedtools_bedtobam/bedtools_bedtobam       |    4 +-
 .../bedtools_genomecov/.config.vsh.yaml       |    6 +-
 .../bedtools_genomecov/bedtools_genomecov     |    4 +-
 .../bedtools_getfasta/.config.vsh.yaml        |    6 +-
 .../bedtools_getfasta/bedtools_getfasta       |    4 +-
 .../bedtools_groupby/.config.vsh.yaml         |    6 +-
 .../bedtools_groupby/bedtools_groupby         |    4 +-
 .../bedtools_intersect/.config.vsh.yaml       |    6 +-
 .../bedtools_intersect/bedtools_intersect     |    4 +-
 .../bedtools/bedtools_links/.config.vsh.yaml  |    6 +-
 .../bedtools/bedtools_links/bedtools_links    |    4 +-
 .../bedtools/bedtools_merge/.config.vsh.yaml  |    6 +-
 .../bedtools/bedtools_merge/bedtools_merge    |    4 +-
 .../bedtools/bedtools_sort/.config.vsh.yaml   |    6 +-
 .../bedtools/bedtools_sort/bedtools_sort      |    4 +-
 .../busco_download_datasets/.config.vsh.yaml  |    6 +-
 .../busco_download_datasets                   |    4 +-
 .../busco_list_datasets/.config.vsh.yaml      |    6 +-
 .../busco_list_datasets/busco_list_datasets   |    4 +-
 .../busco/busco_run/.config.vsh.yaml          |    6 +-
 target/executable/busco/busco_run/busco_run   |    4 +-
 target/executable/cutadapt/.config.vsh.yaml   |    6 +-
 target/executable/cutadapt/cutadapt           |    4 +-
 target/executable/falco/.config.vsh.yaml      |    6 +-
 target/executable/falco/falco                 |    4 +-
 target/executable/fastp/.config.vsh.yaml      |    6 +-
 target/executable/fastp/fastp                 |    4 +-
 target/executable/fastqc/.config.vsh.yaml     |    6 +-
 target/executable/fastqc/fastqc               |    4 +-
 .../executable/featurecounts/.config.vsh.yaml |    6 +-
 target/executable/featurecounts/featurecounts |    4 +-
 .../executable/fq_subsample/.config.vsh.yaml  |    6 +-
 target/executable/fq_subsample/fq_subsample   |    4 +-
 target/executable/gffread/.config.vsh.yaml    |    6 +-
 target/executable/gffread/gffread             |    4 +-
 .../kallisto/kallisto_index/.config.vsh.yaml  |    6 +-
 .../kallisto/kallisto_index/kallisto_index    |    4 +-
 .../kallisto/kallisto_quant/.config.vsh.yaml  |    6 +-
 .../kallisto/kallisto_quant/kallisto_quant    |    4 +-
 .../lofreq/lofreq_call/.config.vsh.yaml       |    6 +-
 .../executable/lofreq/lofreq_call/lofreq_call |    4 +-
 .../lofreq/lofreq_indelqual/.config.vsh.yaml  |    6 +-
 .../lofreq/lofreq_indelqual/lofreq_indelqual  |    4 +-
 target/executable/multiqc/.config.vsh.yaml    |    6 +-
 target/executable/multiqc/multiqc             |    4 +-
 target/executable/nanoplot/.config.vsh.yaml   |    6 +-
 target/executable/nanoplot/nanoplot           |    4 +-
 target/executable/pear/.config.vsh.yaml       |    6 +-
 target/executable/pear/pear                   |    4 +-
 .../qualimap/qualimap_rnaseq/.config.vsh.yaml |    6 +-
 .../qualimap/qualimap_rnaseq/qualimap_rnaseq  |    4 +-
 .../.config.vsh.yaml                          |    6 +-
 .../rsem_calculate_expression                 |    4 +-
 .../rsem_prepare_reference/.config.vsh.yaml   |    6 +-
 .../rsem_prepare_reference                    |    4 +-
 .../rseqc/rseqc_bamstat/.config.vsh.yaml      |  202 +
 .../rseqc/rseqc_bamstat/rseqc_bamstat         | 1119 +++++
 .../rseqc_inferexperiment/.config.vsh.yaml    |  228 +
 .../rseqc_inferexperiment                     | 1192 ++++++
 .../rseqc_inner_distance/.config.vsh.yaml     |  321 ++
 .../rseqc_inner_distance/rseqc_inner_distance | 1449 +++++++
 .../salmon/salmon_index/.config.vsh.yaml      |    6 +-
 .../salmon/salmon_index/salmon_index          |    4 +-
 .../salmon/salmon_quant/.config.vsh.yaml      |    6 +-
 .../salmon/salmon_quant/salmon_quant          |    4 +-
 .../samtools_collate/.config.vsh.yaml         |    6 +-
 .../samtools_collate/samtools_collate         |    4 +-
 .../samtools/samtools_faidx/.config.vsh.yaml  |    6 +-
 .../samtools/samtools_faidx/samtools_faidx    |    4 +-
 .../samtools/samtools_fasta/.config.vsh.yaml  |    6 +-
 .../samtools/samtools_fasta/samtools_fasta    |    4 +-
 .../samtools/samtools_fastq/.config.vsh.yaml  |    6 +-
 .../samtools/samtools_fastq/samtools_fastq    |    4 +-
 .../samtools_flagstat/.config.vsh.yaml        |    6 +-
 .../samtools_flagstat/samtools_flagstat       |    4 +-
 .../samtools_idxstats/.config.vsh.yaml        |    6 +-
 .../samtools_idxstats/samtools_idxstats       |    4 +-
 .../samtools/samtools_index/.config.vsh.yaml  |    6 +-
 .../samtools/samtools_index/samtools_index    |    4 +-
 .../samtools/samtools_sort/.config.vsh.yaml   |    6 +-
 .../samtools/samtools_sort/samtools_sort      |    4 +-
 .../samtools/samtools_stats/.config.vsh.yaml  |    6 +-
 .../samtools/samtools_stats/samtools_stats    |    4 +-
 .../samtools/samtools_view/.config.vsh.yaml   |    6 +-
 .../samtools/samtools_view/samtools_view      |    4 +-
 .../seqtk/seqtk_sample/.config.vsh.yaml       |    6 +-
 .../seqtk/seqtk_sample/seqtk_sample           |    4 +-
 .../seqtk/seqtk_subseq/.config.vsh.yaml       |    6 +-
 .../seqtk/seqtk_subseq/seqtk_subseq           |    4 +-
 target/executable/snpeff/.config.vsh.yaml     |    6 +-
 target/executable/snpeff/snpeff               |    4 +-
 target/executable/sortmerna/.config.vsh.yaml  |    6 +-
 target/executable/sortmerna/sortmerna         |    4 +-
 .../star/star_align_reads/.config.vsh.yaml    |    6 +-
 .../star/star_align_reads/star_align_reads    |    4 +-
 .../star_genome_generate/.config.vsh.yaml     |    6 +-
 .../star_genome_generate/star_genome_generate |    4 +-
 target/executable/trimgalore/.config.vsh.yaml |    6 +-
 target/executable/trimgalore/trimgalore       |    4 +-
 .../umi_tools_dedup/.config.vsh.yaml          |    6 +-
 .../umi_tools/umi_tools_dedup/umi_tools_dedup |    4 +-
 .../umi_tools_extract/.config.vsh.yaml        |    6 +-
 .../umi_tools_extract/umi_tools_extract       |    4 +-
 .../umi_tools_prepareforrsem/.config.vsh.yaml |    6 +-
 .../umi_tools_prepareforrsem                  |    4 +-
 .../agat_convert_bed2gff/.config.vsh.yaml     |    6 +-
 .../agat/agat_convert_bed2gff/main.nf         |    6 +-
 .../agat_convert_embl2gff/.config.vsh.yaml    |    6 +-
 .../agat/agat_convert_embl2gff/main.nf        |    6 +-
 .../agat_convert_genscan2gff/.config.vsh.yaml |    6 +-
 .../agat/agat_convert_genscan2gff/main.nf     |    6 +-
 .../agat_convert_sp_gff2gtf/.config.vsh.yaml  |    6 +-
 .../agat/agat_convert_sp_gff2gtf/main.nf      |    6 +-
 .../agat_convert_sp_gff2tsv/.config.vsh.yaml  |    6 +-
 .../agat/agat_convert_sp_gff2tsv/main.nf      |    6 +-
 .../agat_convert_sp_gxf2gxf/.config.vsh.yaml  |    6 +-
 .../agat/agat_convert_sp_gxf2gxf/main.nf      |    6 +-
 .../agat/agat_sp_add_introns/.config.vsh.yaml |    6 +-
 .../nextflow/agat/agat_sp_add_introns/main.nf |    6 +-
 .../.config.vsh.yaml                          |  263 ++
 .../main.nf                                   | 3669 ++++++++++++++++
 .../nextflow.config                           |  126 +
 .../nextflow_schema.json                      |  160 +
 .../.config.vsh.yaml                          |  211 +
 .../agat/agat_sp_merge_annotations/main.nf    | 3612 ++++++++++++++++
 .../agat_sp_merge_annotations/nextflow.config |  126 +
 .../nextflow_schema.json                      |  119 +
 .../agat/agat_sp_statistics/.config.vsh.yaml  |    6 +-
 .../nextflow/agat/agat_sp_statistics/main.nf  |    6 +-
 target/nextflow/arriba/.config.vsh.yaml       |    6 +-
 target/nextflow/arriba/main.nf                |    6 +-
 .../bbmap/bbmap_bbsplit/.config.vsh.yaml      |    6 +-
 target/nextflow/bbmap/bbmap_bbsplit/main.nf   |    6 +-
 .../bcftools_annotate/.config.vsh.yaml        |    6 +-
 .../bcftools/bcftools_annotate/main.nf        |    6 +-
 .../bcftools/bcftools_concat/.config.vsh.yaml |    6 +-
 .../nextflow/bcftools/bcftools_concat/main.nf |    6 +-
 .../bcftools/bcftools_norm/.config.vsh.yaml   |    6 +-
 .../nextflow/bcftools/bcftools_norm/main.nf   |    6 +-
 .../bcftools/bcftools_sort/.config.vsh.yaml   |    6 +-
 .../nextflow/bcftools/bcftools_sort/main.nf   |    6 +-
 .../bcftools/bcftools_stats/.config.vsh.yaml  |    6 +-
 .../nextflow/bcftools/bcftools_stats/main.nf  |    6 +-
 target/nextflow/bcl_convert/.config.vsh.yaml  |    6 +-
 target/nextflow/bcl_convert/main.nf           |    6 +-
 .../.config.vsh.yaml                          |    6 +-
 .../bd_rhapsody_make_reference/main.nf        |    6 +-
 .../.config.vsh.yaml                          |    6 +-
 .../bd_rhapsody_sequence_analysis/main.nf     |    6 +-
 .../bedtools_bamtobed/.config.vsh.yaml        |  262 ++
 .../bedtools/bedtools_bamtobed/main.nf        | 3694 ++++++++++++++++
 .../bedtools_bamtobed/nextflow.config         |  126 +
 .../bedtools_bamtobed/nextflow_schema.json    |  206 +
 .../bedtools_bamtofastq/.config.vsh.yaml      |    6 +-
 .../bedtools/bedtools_bamtofastq/main.nf      |    6 +-
 .../bedtools_bed12tobed6/.config.vsh.yaml     |    6 +-
 .../bedtools/bedtools_bed12tobed6/main.nf     |    6 +-
 .../bedtools_bedtobam/.config.vsh.yaml        |    6 +-
 .../bedtools/bedtools_bedtobam/main.nf        |    6 +-
 .../bedtools_genomecov/.config.vsh.yaml       |    6 +-
 .../bedtools/bedtools_genomecov/main.nf       |    6 +-
 .../bedtools_getfasta/.config.vsh.yaml        |    6 +-
 .../bedtools/bedtools_getfasta/main.nf        |    6 +-
 .../bedtools_groupby/.config.vsh.yaml         |    6 +-
 .../bedtools/bedtools_groupby/main.nf         |    6 +-
 .../bedtools_intersect/.config.vsh.yaml       |    6 +-
 .../bedtools/bedtools_intersect/main.nf       |    6 +-
 .../bedtools/bedtools_links/.config.vsh.yaml  |    6 +-
 .../nextflow/bedtools/bedtools_links/main.nf  |    6 +-
 .../bedtools/bedtools_merge/.config.vsh.yaml  |    6 +-
 .../nextflow/bedtools/bedtools_merge/main.nf  |    6 +-
 .../bedtools/bedtools_sort/.config.vsh.yaml   |    6 +-
 .../nextflow/bedtools/bedtools_sort/main.nf   |    6 +-
 .../busco_download_datasets/.config.vsh.yaml  |    6 +-
 .../busco/busco_download_datasets/main.nf     |    6 +-
 .../busco_list_datasets/.config.vsh.yaml      |    6 +-
 .../busco/busco_list_datasets/main.nf         |    6 +-
 .../nextflow/busco/busco_run/.config.vsh.yaml |    6 +-
 target/nextflow/busco/busco_run/main.nf       |    6 +-
 target/nextflow/cutadapt/.config.vsh.yaml     |    6 +-
 target/nextflow/cutadapt/main.nf              |    6 +-
 target/nextflow/falco/.config.vsh.yaml        |    6 +-
 target/nextflow/falco/main.nf                 |    6 +-
 target/nextflow/fastp/.config.vsh.yaml        |    6 +-
 target/nextflow/fastp/main.nf                 |    6 +-
 target/nextflow/fastqc/.config.vsh.yaml       |    6 +-
 target/nextflow/fastqc/main.nf                |    6 +-
 .../nextflow/featurecounts/.config.vsh.yaml   |    6 +-
 target/nextflow/featurecounts/main.nf         |    6 +-
 target/nextflow/fq_subsample/.config.vsh.yaml |    6 +-
 target/nextflow/fq_subsample/main.nf          |    6 +-
 target/nextflow/gffread/.config.vsh.yaml      |    6 +-
 target/nextflow/gffread/main.nf               |    6 +-
 .../kallisto/kallisto_index/.config.vsh.yaml  |    6 +-
 .../nextflow/kallisto/kallisto_index/main.nf  |    6 +-
 .../kallisto/kallisto_quant/.config.vsh.yaml  |    6 +-
 .../nextflow/kallisto/kallisto_quant/main.nf  |    6 +-
 .../lofreq/lofreq_call/.config.vsh.yaml       |    6 +-
 target/nextflow/lofreq/lofreq_call/main.nf    |    6 +-
 .../lofreq/lofreq_indelqual/.config.vsh.yaml  |    6 +-
 .../nextflow/lofreq/lofreq_indelqual/main.nf  |    6 +-
 target/nextflow/multiqc/.config.vsh.yaml      |    6 +-
 target/nextflow/multiqc/main.nf               |    6 +-
 target/nextflow/nanoplot/.config.vsh.yaml     |    6 +-
 target/nextflow/nanoplot/main.nf              |    6 +-
 target/nextflow/pear/.config.vsh.yaml         |    6 +-
 target/nextflow/pear/main.nf                  |    6 +-
 .../qualimap/qualimap_rnaseq/.config.vsh.yaml |    6 +-
 .../nextflow/qualimap/qualimap_rnaseq/main.nf |    6 +-
 .../.config.vsh.yaml                          |    6 +-
 .../rsem/rsem_calculate_expression/main.nf    |    6 +-
 .../rsem_prepare_reference/.config.vsh.yaml   |    6 +-
 .../rsem/rsem_prepare_reference/main.nf       |    6 +-
 .../rseqc/rseqc_bamstat/.config.vsh.yaml      |  202 +
 target/nextflow/rseqc/rseqc_bamstat/main.nf   | 3594 ++++++++++++++++
 .../rseqc/rseqc_bamstat/nextflow.config       |  126 +
 .../rseqc/rseqc_bamstat/nextflow_schema.json  |  105 +
 .../rseqc_inferexperiment/.config.vsh.yaml    |  228 +
 .../rseqc/rseqc_inferexperiment/main.nf       | 3630 ++++++++++++++++
 .../rseqc_inferexperiment/nextflow.config     |  126 +
 .../nextflow_schema.json                      |  139 +
 .../rseqc_inner_distance/.config.vsh.yaml     |  321 ++
 .../rseqc/rseqc_inner_distance/main.nf        | 3753 +++++++++++++++++
 .../rseqc_inner_distance/nextflow.config      |  126 +
 .../rseqc_inner_distance/nextflow_schema.json |  209 +
 .../salmon/salmon_index/.config.vsh.yaml      |    6 +-
 target/nextflow/salmon/salmon_index/main.nf   |    6 +-
 .../salmon/salmon_quant/.config.vsh.yaml      |    6 +-
 target/nextflow/salmon/salmon_quant/main.nf   |    6 +-
 .../samtools_collate/.config.vsh.yaml         |    6 +-
 .../samtools/samtools_collate/main.nf         |    6 +-
 .../samtools/samtools_faidx/.config.vsh.yaml  |    6 +-
 .../nextflow/samtools/samtools_faidx/main.nf  |    6 +-
 .../samtools/samtools_fasta/.config.vsh.yaml  |    6 +-
 .../nextflow/samtools/samtools_fasta/main.nf  |    6 +-
 .../samtools/samtools_fastq/.config.vsh.yaml  |    6 +-
 .../nextflow/samtools/samtools_fastq/main.nf  |    6 +-
 .../samtools_flagstat/.config.vsh.yaml        |    6 +-
 .../samtools/samtools_flagstat/main.nf        |    6 +-
 .../samtools_idxstats/.config.vsh.yaml        |    6 +-
 .../samtools/samtools_idxstats/main.nf        |    6 +-
 .../samtools/samtools_index/.config.vsh.yaml  |    6 +-
 .../nextflow/samtools/samtools_index/main.nf  |    6 +-
 .../samtools/samtools_sort/.config.vsh.yaml   |    6 +-
 .../nextflow/samtools/samtools_sort/main.nf   |    6 +-
 .../samtools/samtools_stats/.config.vsh.yaml  |    6 +-
 .../nextflow/samtools/samtools_stats/main.nf  |    6 +-
 .../samtools/samtools_view/.config.vsh.yaml   |    6 +-
 .../nextflow/samtools/samtools_view/main.nf   |    6 +-
 .../seqtk/seqtk_sample/.config.vsh.yaml       |    6 +-
 target/nextflow/seqtk/seqtk_sample/main.nf    |    6 +-
 .../seqtk/seqtk_subseq/.config.vsh.yaml       |    6 +-
 target/nextflow/seqtk/seqtk_subseq/main.nf    |    6 +-
 target/nextflow/snpeff/.config.vsh.yaml       |    6 +-
 target/nextflow/snpeff/main.nf                |    6 +-
 target/nextflow/sortmerna/.config.vsh.yaml    |    6 +-
 target/nextflow/sortmerna/main.nf             |    6 +-
 .../star/star_align_reads/.config.vsh.yaml    |    6 +-
 target/nextflow/star/star_align_reads/main.nf |    6 +-
 .../star_genome_generate/.config.vsh.yaml     |    6 +-
 .../star/star_genome_generate/main.nf         |    6 +-
 target/nextflow/trimgalore/.config.vsh.yaml   |    6 +-
 target/nextflow/trimgalore/main.nf            |    6 +-
 .../umi_tools_dedup/.config.vsh.yaml          |    6 +-
 .../umi_tools/umi_tools_dedup/main.nf         |    6 +-
 .../umi_tools_extract/.config.vsh.yaml        |    6 +-
 .../umi_tools/umi_tools_extract/main.nf       |    6 +-
 .../umi_tools_prepareforrsem/.config.vsh.yaml |    6 +-
 .../umi_tools_prepareforrsem/main.nf          |    6 +-
 366 files changed, 37009 insertions(+), 780 deletions(-)
 create mode 100644 src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml
 create mode 100644 src/agat/agat_sp_filter_feature_from_kill_list/help.txt
 create mode 100644 src/agat/agat_sp_filter_feature_from_kill_list/script.sh
 create mode 100644 src/agat/agat_sp_filter_feature_from_kill_list/test.sh
 create mode 100644 src/agat/agat_sp_filter_feature_from_kill_list/test_data/1_truncated.gff
 create mode 100644 src/agat/agat_sp_filter_feature_from_kill_list/test_data/kill_list.txt
 create mode 100755 src/agat/agat_sp_filter_feature_from_kill_list/test_data/script.sh
 create mode 100644 src/agat/agat_sp_filter_feature_from_kill_list/test_data/test_output.gff
 create mode 100644 src/agat/agat_sp_merge_annotations/config.vsh.yaml
 create mode 100644 src/agat/agat_sp_merge_annotations/help.txt
 create mode 100644 src/agat/agat_sp_merge_annotations/script.sh
 create mode 100644 src/agat/agat_sp_merge_annotations/test.sh
 create mode 100644 src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_1.gff
 create mode 100644 src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_2.gff
 create mode 100644 src/agat/agat_sp_merge_annotations/test_data/file1.gff
 create mode 100644 src/agat/agat_sp_merge_annotations/test_data/file2.gff
 create mode 100644 src/agat/agat_sp_merge_annotations/test_data/fileA.gff
 create mode 100644 src/agat/agat_sp_merge_annotations/test_data/fileB.gff
 create mode 100755 src/agat/agat_sp_merge_annotations/test_data/script.sh
 create mode 100644 src/bedtools/bedtools_bamtobed/config.vsh.yaml
 create mode 100644 src/bedtools/bedtools_bamtobed/help.txt
 create mode 100644 src/bedtools/bedtools_bamtobed/script.sh
 create mode 100644 src/bedtools/bedtools_bamtobed/test.sh
 create mode 100644 src/bedtools/bedtools_bamtobed/test_data/example.bam
 create mode 100644 src/bedtools/bedtools_bamtobed/test_data/example.sam
 create mode 100644 src/rseqc/rseqc_bamstat/config.vsh.yaml
 create mode 100644 src/rseqc/rseqc_bamstat/help.txt
 create mode 100644 src/rseqc/rseqc_bamstat/script.sh
 create mode 100644 src/rseqc/rseqc_bamstat/test.sh
 create mode 100644 src/rseqc/rseqc_bamstat/test_data/ref_output.txt
 create mode 100644 src/rseqc/rseqc_bamstat/test_data/ref_output_mapq.txt
 create mode 100644 src/rseqc/rseqc_bamstat/test_data/sample.bam
 create mode 100644 src/rseqc/rseqc_inferexperiment/config.vsh.yaml
 create mode 100644 src/rseqc/rseqc_inferexperiment/help.txt
 create mode 100644 src/rseqc/rseqc_inferexperiment/script.sh
 create mode 100644 src/rseqc/rseqc_inferexperiment/test.sh
 create mode 100644 src/rseqc/rseqc_inferexperiment/test_data/sample.bam
 create mode 100644 src/rseqc/rseqc_inferexperiment/test_data/test.bed12
 create mode 100644 src/rseqc/rseqc_inferexperiment/test_data/test.paired_end.sorted.bam
 create mode 100644 src/rseqc/rseqc_inner_distance/config.vsh.yaml
 create mode 100644 src/rseqc/rseqc_inner_distance/help.txt
 create mode 100644 src/rseqc/rseqc_inner_distance/script.sh
 create mode 100644 src/rseqc/rseqc_inner_distance/test.sh
 create mode 100644 src/rseqc/rseqc_inner_distance/test_data/test.bed12
 create mode 100644 src/rseqc/rseqc_inner_distance/test_data/test.paired_end.sorted.bam
 create mode 100644 src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance.txt
 create mode 100644 src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance_freq.txt
 create mode 100644 src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance.txt
 create mode 100644 src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance_freq.txt
 create mode 100644 target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml
 create mode 100755 target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list
 create mode 100644 target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml
 create mode 100755 target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations
 create mode 100644 target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml
 create mode 100755 target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed
 create mode 100644 target/executable/rseqc/rseqc_bamstat/.config.vsh.yaml
 create mode 100755 target/executable/rseqc/rseqc_bamstat/rseqc_bamstat
 create mode 100644 target/executable/rseqc/rseqc_inferexperiment/.config.vsh.yaml
 create mode 100755 target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment
 create mode 100644 target/executable/rseqc/rseqc_inner_distance/.config.vsh.yaml
 create mode 100755 target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance
 create mode 100644 target/nextflow/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml
 create mode 100644 target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf
 create mode 100644 target/nextflow/agat/agat_sp_filter_feature_from_kill_list/nextflow.config
 create mode 100644 target/nextflow/agat/agat_sp_filter_feature_from_kill_list/nextflow_schema.json
 create mode 100644 target/nextflow/agat/agat_sp_merge_annotations/.config.vsh.yaml
 create mode 100644 target/nextflow/agat/agat_sp_merge_annotations/main.nf
 create mode 100644 target/nextflow/agat/agat_sp_merge_annotations/nextflow.config
 create mode 100644 target/nextflow/agat/agat_sp_merge_annotations/nextflow_schema.json
 create mode 100644 target/nextflow/bedtools/bedtools_bamtobed/.config.vsh.yaml
 create mode 100644 target/nextflow/bedtools/bedtools_bamtobed/main.nf
 create mode 100644 target/nextflow/bedtools/bedtools_bamtobed/nextflow.config
 create mode 100644 target/nextflow/bedtools/bedtools_bamtobed/nextflow_schema.json
 create mode 100644 target/nextflow/rseqc/rseqc_bamstat/.config.vsh.yaml
 create mode 100644 target/nextflow/rseqc/rseqc_bamstat/main.nf
 create mode 100644 target/nextflow/rseqc/rseqc_bamstat/nextflow.config
 create mode 100644 target/nextflow/rseqc/rseqc_bamstat/nextflow_schema.json
 create mode 100644 target/nextflow/rseqc/rseqc_inferexperiment/.config.vsh.yaml
 create mode 100644 target/nextflow/rseqc/rseqc_inferexperiment/main.nf
 create mode 100644 target/nextflow/rseqc/rseqc_inferexperiment/nextflow.config
 create mode 100644 target/nextflow/rseqc/rseqc_inferexperiment/nextflow_schema.json
 create mode 100644 target/nextflow/rseqc/rseqc_inner_distance/.config.vsh.yaml
 create mode 100644 target/nextflow/rseqc/rseqc_inner_distance/main.nf
 create mode 100644 target/nextflow/rseqc/rseqc_inner_distance/nextflow.config
 create mode 100644 target/nextflow/rseqc/rseqc_inner_distance/nextflow_schema.json

diff --git a/CHANGELOG.md b/CHANGELOG.md
index a8cfc83a..0e32edb1 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -4,26 +4,30 @@
 
 * `agat`:
   - `agat/agat_convert_genscan2gff`: convert a genscan file into a GFF file (PR #100).
-  - `agat_sp_statistics`: provides exhaustive statistics of a gft/gff file (PR #107).
-
+  - `agat/agat_sp_add_introns`: add intron features to gtf/gff file without intron features (PR #104).
+  - `agat/agat_sp_filter_feature_from_kill_list`: remove features in a GFF file based on a kill list (PR #105).
+  - `agat/agat_sp_merge_annotations`: merge different gff annotation files in one (PR #106).
+  - `agat/agat_sp_statistics`: provides exhaustive statistics of a gft/gff file (PR #107).
 
 * `bd_rhapsody/bd_rhapsody_sequence_analysis`: BD Rhapsody Sequence Analysis CWL pipeline (PR #96).
 
+* `bedtools`:
+   - `bedtools/bedtools_bamtobed`: Converts BAM alignments to BED6 or BEDPE format (PR #109).
+
 * `rsem/rsem_calculate_expression`: Calculate expression levels (PR #93).
 
+* `rseqc`:
+  - `rseqc/rseqc_inner_distance`: Calculate inner distance between read pairs (PR #159).
+  - `rseqc/rseqc_inferexperiment`: Infer strandedness from sequencing reads (PR #158).
+  - `rseqc/bam_stat`: Generate statistics from a bam file (PR #155).
+
 * `nanoplot`: Plotting tool for long read sequencing data and alignments (PR #95).
 
-* `agat`:
-  - `agat/agat_sp_add_introns`: add intron features to gtf/gff file without intron features (PR #104).
-
-
-## BREAKING CHANGES
+## BUG FIXES
 
 * `falco`: Fix a typo in the `--reverse_complement` argument (PR #157).
 
-## BUG FIXES
-
-* `cutadapt`: fix the the non-functional `action` parameter (PR #161).
+* `cutadapt`: Fix the the non-functional `action` parameter (PR #161).
 
 ## MINOR CHANGES
 
diff --git a/src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml b/src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml
new file mode 100644
index 00000000..0608ad4d
--- /dev/null
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml
@@ -0,0 +1,105 @@
+name: agat_sp_filter_feature_from_kill_list
+namespace: agat
+description: |
+  Remove features based on a kill list. The default behaviour is to look at the features's ID. 
+  If the feature has an ID (case insensitive) listed among the kill list it will be removed.
+  Removing a level1 or level2 feature will automatically remove all linked subfeatures, and 
+  removing all children of a feature will automatically remove this feature too.
+keywords: [gene annotations, filtering, gff]
+links:
+  homepage: https://github.com/NBISweden/AGAT
+  documentation: https://agat.readthedocs.io/en/latest/tools/agat_sp_filter_feature_from_kill_list.html
+  issue_tracker: https://github.com/NBISweden/AGAT/issues
+  repository: https://github.com/NBISweden/AGAT
+references: 
+  doi: 10.5281/zenodo.3552717
+license: GPL-3.0
+requirements:
+  - commands: [agat]
+authors:
+  - __merge__: /src/_authors/leila_paquay.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --gff
+        alternatives: [-f, --ref, --reffile]
+        description: Input GFF3 file that will be read.
+        type: file
+        required: true
+      - name: --kill_list
+        alternatives: [--kl]
+        description: Text file containing the kill list. One value per line.
+        type: file
+        required: true
+        example: kill_list.txt
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: [-o, --out]
+        description: |
+          Path to the output GFF file that contains filtered features. 
+        type: file
+        direction: output
+        required: true
+  - name: Arguments
+    arguments:
+      - name: --type
+        alternatives: [-p, -l]
+        description: |
+          Primary tag option, case insensitive, list. Allow to specify the feature types that 
+          will be handled. 
+  
+          You can specify a specific feature by giving its primary tag name (column 3) as: 
+
+            * cds
+            * Gene
+            * mRNA
+            
+          You can specify directly all the feature of a particular
+          level: 
+
+            * level2=mRNA,ncRNA,tRNA,etc 
+            * level3=CDS,exon,UTR,etc. 
+          
+          By default all features are taken into account. Fill the option with the value "all" will 
+          have the same behaviour.
+        type: string
+        multiple: true
+      - name: --attribute
+        alternatives: [-a]
+        description: |
+          Attribute tag to specify the attribute to analyse. Case sensitive. Default: ID
+        type: string
+        example: ID
+      - name: --config
+        alternatives: [-c]
+        description: |
+          AGAT config file. By default AGAT takes the original agat_config.yaml shipped with AGAT.
+          The `--config` option gives you the possibility to use your own AGAT config file (located 
+          elsewhere or named differently).
+        type: file
+        example: custom_agat_config.yaml
+      - name: --verbose
+        alternatives: [-v]
+        description: Verbose option for debugging purpose.
+        type: boolean_true
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+engines:
+  - type: docker
+    image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
+    setup:
+      - type: docker
+        run: |
+          agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
+runners:
+  - type: executable
+  - type: nextflow
\ No newline at end of file
diff --git a/src/agat/agat_sp_filter_feature_from_kill_list/help.txt b/src/agat/agat_sp_filter_feature_from_kill_list/help.txt
new file mode 100644
index 00000000..b0087916
--- /dev/null
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/help.txt
@@ -0,0 +1,85 @@
+```sh
+agat_sp_filter_feature_from_kill_list.pl --help
+```
+
+ ------------------------------------------------------------------------------
+|   Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0                      |
+|   https://github.com/NBISweden/AGAT                                          |
+|   National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se         |
+ ------------------------------------------------------------------------------
+
+
+Name:
+    agat_sp_filter_feature_from_kill_list.pl
+
+Description:
+    The script aims to remove features based on a kill list. The default
+    behaviour is to look at the features's ID. If the feature has an ID
+    (case insensitive) listed among the kill list it will be removed. /!\
+    Removing a level1 or level2 feature will automatically remove all linked
+    subfeatures, and removing all children of a feature will automatically
+    remove this feature too.
+
+Usage:
+        agat_sp_filter_feature_from_kill_list.pl --gff infile.gff --kill_list file.txt  [ --output outfile ]
+        agat_sp_filter_feature_from_kill_list.pl --help
+
+Options:
+    -f, --reffile, --gff or -ref
+            Input GFF3 file that will be read
+
+    -p, --type or -l
+            primary tag option, case insensitive, list. Allow to specied the
+            feature types that will be handled. You can specified a specific
+            feature by given its primary tag name (column 3) as: cds, Gene,
+            MrNa You can specify directly all the feature of a particular
+            level: level2=mRNA,ncRNA,tRNA,etc level3=CDS,exon,UTR,etc By
+            default all feature are taking into account. fill the option by
+            the value "all" will have the same behaviour.
+
+    --kl or --kill_list
+            Kill list. One value per line.
+
+    -a or --attribute
+            Attribute tag to specify the attribute to analyse. Case
+            sensitive. Default: ID
+
+    -o or --output
+            Output GFF file. If no output file is specified, the output will
+            be written to STDOUT.
+
+    -v      Verbose option for debugging purpose.
+
+    -c or --config
+            String - Input agat config file. By default AGAT takes as input
+            agat_config.yaml file from the working directory if any,
+            otherwise it takes the orignal agat_config.yaml shipped with
+            AGAT. To get the agat_config.yaml locally type: "agat config
+            --expose". The --config option gives you the possibility to use
+            your own AGAT config file (located elsewhere or named
+            differently).
+
+    -h or --help
+            Display this helpful text.
+
+Feedback:
+  Did you find a bug?:
+    Do not hesitate to report bugs to help us keep track of the bugs and
+    their resolution. Please use the GitHub issue tracking system available
+    at this address:
+
+                https://github.com/NBISweden/AGAT/issues
+
+     Ensure that the bug was not already reported by searching under Issues.
+     If you're unable to find an (open) issue addressing the problem, open a new one.
+     Try as much as possible to include in the issue when relevant:
+     - a clear description,
+     - as much relevant information as possible,
+     - the command used,
+     - a data sample,
+     - an explanation of the expected behaviour that is not occurring.
+
+  Do you want to contribute?:
+    You are very welcome, visit this address for the Contributing
+    guidelines:
+    https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md
\ No newline at end of file
diff --git a/src/agat/agat_sp_filter_feature_from_kill_list/script.sh b/src/agat/agat_sp_filter_feature_from_kill_list/script.sh
new file mode 100644
index 00000000..6779b857
--- /dev/null
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/script.sh
@@ -0,0 +1,22 @@
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+## VIASH END
+
+# unset flags
+[[ "$par_verbose" == "false" ]] && unset par_verbose
+
+# convert par_type to comma separated list
+par_type=$(echo $par_type | tr ';' ',')
+
+# run agat_sp_filter_feature_from_kill_list
+agat_sp_filter_feature_from_kill_list.pl \
+  --gff "$par_gff" \
+  --kill_list "$par_kill_list" \
+  --output "$par_output" \
+  ${par_type:+--type "${par_type}"} \
+  ${par_attribute:+--attribute "${par_attribute}"} \
+  ${par_config:+--config "${par_config}"} \
+  ${par_verbose:+-v}
diff --git a/src/agat/agat_sp_filter_feature_from_kill_list/test.sh b/src/agat/agat_sp_filter_feature_from_kill_list/test.sh
new file mode 100644
index 00000000..d9d775d5
--- /dev/null
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test.sh
@@ -0,0 +1,36 @@
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+## VIASH END
+
+test_dir="${meta_resources_dir}/test_data"
+
+# create temporary directory and clean up on exit
+TMPDIR=$(mktemp -d "$meta_temp_dir/$meta_functionality_name-XXXXXX")
+function clean_up {
+ [[ -d "$TMPDIR" ]] && rm -rf "$TMPDIR"
+}
+#trap clean_up EXIT
+
+echo "> Run $meta_name with test data"
+"$meta_executable" \
+  --gff "$test_dir/1_truncated.gff" \
+  --kill_list "$test_dir/kill_list.txt" \
+  --output "$TMPDIR/output.gff" 
+
+echo ">> Checking output"
+[ ! -f "$TMPDIR/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
+
+echo ">> Check if output is empty"
+[ ! -s "$TMPDIR/output.gff" ] && echo "Output file output.gff is empty" && exit 1
+
+echo ">> Check if output matches expected output"
+diff "$TMPDIR/output.gff" "$test_dir/test_output.gff"
+if [ $? -ne 0 ]; then
+  echo "Output file output.gff does not match expected output"
+  exit 1
+fi
+
+echo "> Test successful"
\ No newline at end of file
diff --git a/src/agat/agat_sp_filter_feature_from_kill_list/test_data/1_truncated.gff b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/1_truncated.gff
new file mode 100644
index 00000000..e0fb6bce
--- /dev/null
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/1_truncated.gff
@@ -0,0 +1,123 @@
+##gff-version 3
+##sequence-region   1 1 43270923
+#!genome-build RAP-DB IRGSP-1.0
+#!genome-version IRGSP-1.0
+#!genome-date 2015-10
+#!genome-build-accession GCA_001433935.1
+1	RAP-DB	chromosome	1	43270923	.	.	.	ID=chromosome:1;Alias=Chr1,AP014957.1,NC_029256.1
+###
+1	irgsp	repeat_region	2000	2100	.	+	.	ID=fakeRepeat1
+###
+1	irgsp	gene	2983	10815	.	+	.	ID=gene:Os01g0100100;biotype=protein_coding;description=RabGAP/TBC domain containing protein. (Os01t0100100-01);gene_id=Os01g0100100;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	2983	10815	.	+	.	ID=transcript:Os01t0100100-01;Parent=gene:Os01g0100100;biotype=protein_coding;transcript_id=Os01t0100100-01
+1	irgsp	exon	2983	3268	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon1;rank=1
+1	irgsp	five_prime_UTR	2983	3268	.	+	.	Parent=transcript:Os01t0100100-01
+1	irgsp	five_prime_UTR	3354	3448	.	+	.	Parent=transcript:Os01t0100100-01
+1	irgsp	exon	3354	3616	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100100-01.exon2;rank=2
+1	irgsp	CDS	3449	3616	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	4357	4455	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon3;rank=3
+1	irgsp	CDS	4357	4455	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	5457	5560	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100100-01.exon4;rank=4
+1	irgsp	CDS	5457	5560	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	7136	7944	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100100-01.exon5;rank=5
+1	irgsp	CDS	7136	7944	.	+	1	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	8028	8150	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon6;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100100-01.exon6;rank=6
+1	irgsp	CDS	8028	8150	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	8232	8320	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon7;rank=7
+1	irgsp	CDS	8232	8320	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	8408	8608	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon8;rank=8
+1	irgsp	CDS	8408	8608	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	9210	9615	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon9;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100100-01.exon9;rank=9
+1	irgsp	CDS	9210	9615	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	10102	10187	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon10;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon10;rank=10
+1	irgsp	CDS	10102	10187	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	10274	10297	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	10274	10430	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon11;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100100-01.exon11;rank=11
+1	irgsp	three_prime_UTR	10298	10430	.	+	.	Parent=transcript:Os01t0100100-01
+1	irgsp	exon	10504	10815	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon12;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon12;rank=12
+1	irgsp	three_prime_UTR	10504	10815	.	+	.	Parent=transcript:Os01t0100100-01
+###
+1	irgsp	gene	11218	12435	.	+	.	ID=gene:Os01g0100200;biotype=protein_coding;description=Conserved hypothetical protein. (Os01t0100200-01);gene_id=Os01g0100200;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	11218	12435	.	+	.	ID=transcript:Os01t0100200-01;Parent=gene:Os01g0100200;biotype=protein_coding;transcript_id=Os01t0100200-01
+1	irgsp	five_prime_UTR	11218	11797	.	+	.	Parent=transcript:Os01t0100200-01
+1	irgsp	exon	11218	12060	.	+	.	Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100200-01.exon1;rank=1
+1	irgsp	CDS	11798	12060	.	+	0	ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
+1	irgsp	CDS	12152	12317	.	+	1	ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
+1	irgsp	exon	12152	12435	.	+	.	Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100200-01.exon2;rank=2
+1	irgsp	three_prime_UTR	12318	12435	.	+	.	Parent=transcript:Os01t0100200-01
+###
+1	irgsp	gene	11372	12284	.	-	.	ID=gene:Os01g0100300;biotype=protein_coding;description=Cytochrome P450 domain containing protein. (Os01t0100300-00);gene_id=Os01g0100300;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	11372	12284	.	-	.	ID=transcript:Os01t0100300-00;Parent=gene:Os01g0100300;biotype=protein_coding;transcript_id=Os01t0100300-00
+1	irgsp	exon	11372	12042	.	-	.	Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100300-00.exon2;rank=2
+1	irgsp	CDS	11372	12042	.	-	2	ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
+1	irgsp	exon	12146	12284	.	-	.	Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon1;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100300-00.exon1;rank=1
+1	irgsp	CDS	12146	12284	.	-	0	ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
+###
+1	irgsp	gene	12721	15685	.	+	.	ID=gene:Os01g0100400;biotype=protein_coding;description=Similar to Pectinesterase-like protein. (Os01t0100400-01);gene_id=Os01g0100400;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	12721	15685	.	+	.	ID=transcript:Os01t0100400-01;Parent=gene:Os01g0100400;biotype=protein_coding;transcript_id=Os01t0100400-01
+1	irgsp	five_prime_UTR	12721	12773	.	+	.	Parent=transcript:Os01t0100400-01
+1	irgsp	exon	12721	13813	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100400-01.exon1;rank=1
+1	irgsp	CDS	12774	13813	.	+	0	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	exon	13906	14271	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100400-01.exon2;rank=2
+1	irgsp	CDS	13906	14271	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	exon	14359	14437	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0100400-01.exon3;rank=3
+1	irgsp	CDS	14359	14437	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	exon	14969	15171	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100400-01.exon4;rank=4
+1	irgsp	CDS	14969	15171	.	+	0	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	15266	15359	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	exon	15266	15685	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon5;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100400-01.exon5;rank=5
+1	irgsp	three_prime_UTR	15360	15685	.	+	.	Parent=transcript:Os01t0100400-01
+###
+1	irgsp	gene	12808	13978	.	-	.	ID=gene:Os01g0100466;biotype=protein_coding;description=Hypothetical protein. (Os01t0100466-00);gene_id=Os01g0100466;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	12808	13978	.	-	.	ID=transcript:Os01t0100466-00;Parent=gene:Os01g0100466;biotype=protein_coding;transcript_id=Os01t0100466-00
+1	irgsp	three_prime_UTR	12808	12868	.	-	.	Parent=transcript:Os01t0100466-00
+1	irgsp	exon	12808	13782	.	-	.	Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon2;rank=2
+1	irgsp	CDS	12869	13102	.	-	0	ID=CDS:Os01t0100466-00;Parent=transcript:Os01t0100466-00;protein_id=Os01t0100466-00
+1	irgsp	five_prime_UTR	13103	13782	.	-	.	Parent=transcript:Os01t0100466-00
+1	irgsp	exon	13880	13978	.	-	.	Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon1;rank=1
+1	irgsp	five_prime_UTR	13880	13978	.	-	.	Parent=transcript:Os01t0100466-00
+###
+1	irgsp	gene	16399	20144	.	+	.	ID=gene:Os01g0100500;biotype=protein_coding;description=Immunoglobulin-like domain containing protein. (Os01t0100500-01);gene_id=Os01g0100500;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	16399	20144	.	+	.	ID=transcript:Os01t0100500-01;Parent=gene:Os01g0100500;biotype=protein_coding;transcript_id=Os01t0100500-01
+1	irgsp	five_prime_UTR	16399	16598	.	+	.	Parent=transcript:Os01t0100500-01
+1	irgsp	exon	16399	16976	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100500-01.exon1;rank=1
+1	irgsp	CDS	16599	16976	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	17383	17474	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100500-01.exon2;rank=2
+1	irgsp	CDS	17383	17474	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	17558	18258	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100500-01.exon3;rank=3
+1	irgsp	CDS	17558	18258	.	+	1	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	18501	18571	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100500-01.exon4;rank=4
+1	irgsp	CDS	18501	18571	.	+	2	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	18968	19057	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon5;rank=5
+1	irgsp	CDS	18968	19057	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	19142	19321	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon6;rank=6
+1	irgsp	CDS	19142	19321	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	19531	19593	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	19531	19629	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100500-01.exon7;rank=7
+1	irgsp	three_prime_UTR	19594	19629	.	+	.	Parent=transcript:Os01t0100500-01
+1	irgsp	exon	19734	20144	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon8;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100500-01.exon8;rank=8
+1	irgsp	three_prime_UTR	19734	20144	.	+	.	Parent=transcript:Os01t0100500-01
+###
+1	irgsp	gene	22841	26892	.	+	.	ID=gene:Os01g0100600;biotype=protein_coding;description=Single-stranded nucleic acid binding R3H domain containing protein. (Os01t0100600-01);gene_id=Os01g0100600;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	22841	26892	.	+	.	ID=transcript:Os01t0100600-01;Parent=gene:Os01g0100600;biotype=protein_coding;transcript_id=Os01t0100600-01
+1	irgsp	five_prime_UTR	22841	23231	.	+	.	Parent=transcript:Os01t0100600-01
+1	irgsp	exon	22841	23281	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100600-01.exon1;rank=1
+1	irgsp	CDS	23232	23281	.	+	0	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	23572	23847	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon2;rank=2
+1	irgsp	CDS	23572	23847	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	23962	24033	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon3;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon3;rank=3
+1	irgsp	CDS	23962	24033	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	24492	24577	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon4;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100600-01.exon4;rank=4
+1	irgsp	CDS	24492	24577	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	25445	25519	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100600-01.exon5;rank=5
+1	irgsp	CDS	25445	25519	.	+	2	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	25883	26391	.	+	2	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	25883	26892	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon6;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0100600-01.exon6;rank=6
+1	irgsp	three_prime_UTR	26392	26892	.	+	.	Parent=transcript:Os01t0100600-01
+###
+1	irgsp	gene	25861	26424	.	-	.	ID=gene:Os01g0100650;biotype=protein_coding;description=Hypothetical gene. (Os01t0100650-00);gene_id=Os01g0100650;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	25861	26424	.	-	.	ID=transcript:Os01t0100650-00;Parent=gene:Os01g0100650;biotype=protein_coding;transcript_id=Os01t0100650-00
+1	irgsp	three_prime_UTR	25861	26039	.	-	.	Parent=transcript:Os01t0100650-00
+1	irgsp	exon	25861	26424	.	-	.	Parent=transcript:Os01t0100650-00;Name=Os01t0100650-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100650-00.exon1;rank=1
+1	irgsp	CDS	26040	26423	.	-	0	ID=CDS:Os01t0100650-00;Parent=transcript:Os01t0100650-00;protein_id=Os01t0100650-00
+1	irgsp	five_prime_UTR	26424	26424	.	-	.	Parent=transcript:Os01t0100650-00
diff --git a/src/agat/agat_sp_filter_feature_from_kill_list/test_data/kill_list.txt b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/kill_list.txt
new file mode 100644
index 00000000..a9d72f89
--- /dev/null
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/kill_list.txt
@@ -0,0 +1,3 @@
+gene:Os01g0100700
+CDS:Os01t0100650-00
+transcript:Os01t0102700-01
diff --git a/src/agat/agat_sp_filter_feature_from_kill_list/test_data/script.sh b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/script.sh
new file mode 100755
index 00000000..6f9d1584
--- /dev/null
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/script.sh
@@ -0,0 +1,13 @@
+#!/bin/bash
+
+# clone repo
+if [ ! -d /tmp/agat_source ]; then
+  git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
+fi
+
+# copy test data
+cp -r /tmp/agat_source/t/scripts_output/in/1.gff src/agat/agat_sp_filter_feature_from_kill_list/test_data
+cp -r /tmp/agat_source/t/scripts_output/out/agat_sp_filter_feature_from_kill_list_1.gff src/agat/agat_sp_filter_feature_from_kill_list/test_data
+cp -r /tmp/agat_source/t/scripts_output/in/kill_list.txt src/agat/agat_sp_filter_feature_from_kill_list/test_data
+
+head -n 123 src/agat/agat_sp_filter_feature_from_kill_list/test_data/1.gff > src/agat/agat_sp_filter_feature_from_kill_list/test_data/1_truncated.gff
\ No newline at end of file
diff --git a/src/agat/agat_sp_filter_feature_from_kill_list/test_data/test_output.gff b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/test_output.gff
new file mode 100644
index 00000000..47838fe7
--- /dev/null
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/test_output.gff
@@ -0,0 +1,113 @@
+##gff-version 3
+##sequence-region   1 1 43270923
+#!genome-build RAP-DB IRGSP-1.0
+#!genome-version IRGSP-1.0
+#!genome-date 2015-10
+#!genome-build-accession GCA_001433935.1
+1	RAP-DB	chromosome	1	43270923	.	.	.	ID=chromosome:1;Alias=Chr1,AP014957.1,NC_029256.1
+1	irgsp	repeat_region	2000	2100	.	+	.	ID=fakeRepeat1
+1	irgsp	gene	2983	10815	.	+	.	ID=gene:Os01g0100100;biotype=protein_coding;description=RabGAP/TBC domain containing protein. (Os01t0100100-01);gene_id=Os01g0100100;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	2983	10815	.	+	.	ID=transcript:Os01t0100100-01;Parent=gene:Os01g0100100;biotype=protein_coding;transcript_id=Os01t0100100-01
+1	irgsp	exon	2983	3268	.	+	.	ID=Os01t0100100-01.exon1;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon1;rank=1
+1	irgsp	exon	3354	3616	.	+	.	ID=Os01t0100100-01.exon2;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100100-01.exon2;rank=2
+1	irgsp	exon	4357	4455	.	+	.	ID=Os01t0100100-01.exon3;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon3;rank=3
+1	irgsp	exon	5457	5560	.	+	.	ID=Os01t0100100-01.exon4;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100100-01.exon4;rank=4
+1	irgsp	exon	7136	7944	.	+	.	ID=Os01t0100100-01.exon5;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100100-01.exon5;rank=5
+1	irgsp	exon	8028	8150	.	+	.	ID=Os01t0100100-01.exon6;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon6;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100100-01.exon6;rank=6
+1	irgsp	exon	8232	8320	.	+	.	ID=Os01t0100100-01.exon7;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon7;rank=7
+1	irgsp	exon	8408	8608	.	+	.	ID=Os01t0100100-01.exon8;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon8;rank=8
+1	irgsp	exon	9210	9615	.	+	.	ID=Os01t0100100-01.exon9;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon9;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100100-01.exon9;rank=9
+1	irgsp	exon	10102	10187	.	+	.	ID=Os01t0100100-01.exon10;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon10;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon10;rank=10
+1	irgsp	exon	10274	10430	.	+	.	ID=Os01t0100100-01.exon11;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon11;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100100-01.exon11;rank=11
+1	irgsp	exon	10504	10815	.	+	.	ID=Os01t0100100-01.exon12;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon12;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon12;rank=12
+1	irgsp	CDS	3449	3616	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	4357	4455	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	5457	5560	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	7136	7944	.	+	1	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	8028	8150	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	8232	8320	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	8408	8608	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	9210	9615	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	10102	10187	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	10274	10297	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	five_prime_UTR	2983	3268	.	+	.	ID=agat-five_prime_utr-1;Parent=transcript:Os01t0100100-01
+1	irgsp	five_prime_UTR	3354	3448	.	+	.	ID=agat-five_prime_utr-2;Parent=transcript:Os01t0100100-01
+1	irgsp	three_prime_UTR	10298	10430	.	+	.	ID=agat-three_prime_utr-1;Parent=transcript:Os01t0100100-01
+1	irgsp	three_prime_UTR	10504	10815	.	+	.	ID=agat-three_prime_utr-2;Parent=transcript:Os01t0100100-01
+1	irgsp	gene	11218	12435	.	+	.	ID=gene:Os01g0100200;biotype=protein_coding;description=Conserved hypothetical protein. (Os01t0100200-01);gene_id=Os01g0100200;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	11218	12435	.	+	.	ID=transcript:Os01t0100200-01;Parent=gene:Os01g0100200;biotype=protein_coding;transcript_id=Os01t0100200-01
+1	irgsp	exon	11218	12060	.	+	.	ID=Os01t0100200-01.exon1;Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100200-01.exon1;rank=1
+1	irgsp	exon	12152	12435	.	+	.	ID=Os01t0100200-01.exon2;Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100200-01.exon2;rank=2
+1	irgsp	CDS	11798	12060	.	+	0	ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
+1	irgsp	CDS	12152	12317	.	+	1	ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
+1	irgsp	five_prime_UTR	11218	11797	.	+	.	ID=agat-five_prime_utr-3;Parent=transcript:Os01t0100200-01
+1	irgsp	three_prime_UTR	12318	12435	.	+	.	ID=agat-three_prime_utr-3;Parent=transcript:Os01t0100200-01
+1	irgsp	gene	11372	12284	.	-	.	ID=gene:Os01g0100300;biotype=protein_coding;description=Cytochrome P450 domain containing protein. (Os01t0100300-00);gene_id=Os01g0100300;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	11372	12284	.	-	.	ID=transcript:Os01t0100300-00;Parent=gene:Os01g0100300;biotype=protein_coding;transcript_id=Os01t0100300-00
+1	irgsp	exon	11372	12042	.	-	.	ID=Os01t0100300-00.exon2;Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100300-00.exon2;rank=2
+1	irgsp	exon	12146	12284	.	-	.	ID=Os01t0100300-00.exon1;Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon1;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100300-00.exon1;rank=1
+1	irgsp	CDS	11372	12042	.	-	2	ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
+1	irgsp	CDS	12146	12284	.	-	0	ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
+1	irgsp	gene	12721	15685	.	+	.	ID=gene:Os01g0100400;biotype=protein_coding;description=Similar to Pectinesterase-like protein. (Os01t0100400-01);gene_id=Os01g0100400;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	12721	15685	.	+	.	ID=transcript:Os01t0100400-01;Parent=gene:Os01g0100400;biotype=protein_coding;transcript_id=Os01t0100400-01
+1	irgsp	exon	12721	13813	.	+	.	ID=Os01t0100400-01.exon1;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100400-01.exon1;rank=1
+1	irgsp	exon	13906	14271	.	+	.	ID=Os01t0100400-01.exon2;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100400-01.exon2;rank=2
+1	irgsp	exon	14359	14437	.	+	.	ID=Os01t0100400-01.exon3;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0100400-01.exon3;rank=3
+1	irgsp	exon	14969	15171	.	+	.	ID=Os01t0100400-01.exon4;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100400-01.exon4;rank=4
+1	irgsp	exon	15266	15685	.	+	.	ID=Os01t0100400-01.exon5;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon5;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100400-01.exon5;rank=5
+1	irgsp	CDS	12774	13813	.	+	0	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	13906	14271	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	14359	14437	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	14969	15171	.	+	0	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	15266	15359	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	five_prime_UTR	12721	12773	.	+	.	ID=agat-five_prime_utr-4;Parent=transcript:Os01t0100400-01
+1	irgsp	three_prime_UTR	15360	15685	.	+	.	ID=agat-three_prime_utr-4;Parent=transcript:Os01t0100400-01
+1	irgsp	gene	12808	13978	.	-	.	ID=gene:Os01g0100466;biotype=protein_coding;description=Hypothetical protein. (Os01t0100466-00);gene_id=Os01g0100466;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	12808	13978	.	-	.	ID=transcript:Os01t0100466-00;Parent=gene:Os01g0100466;biotype=protein_coding;transcript_id=Os01t0100466-00
+1	irgsp	exon	12808	13782	.	-	.	ID=Os01t0100466-00.exon2;Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon2;rank=2
+1	irgsp	exon	13880	13978	.	-	.	ID=Os01t0100466-00.exon1;Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon1;rank=1
+1	irgsp	CDS	12869	13102	.	-	0	ID=CDS:Os01t0100466-00;Parent=transcript:Os01t0100466-00;protein_id=Os01t0100466-00
+1	irgsp	five_prime_UTR	13103	13782	.	-	.	ID=agat-five_prime_utr-5;Parent=transcript:Os01t0100466-00
+1	irgsp	five_prime_UTR	13880	13978	.	-	.	ID=agat-five_prime_utr-6;Parent=transcript:Os01t0100466-00
+1	irgsp	three_prime_UTR	12808	12868	.	-	.	ID=agat-three_prime_utr-5;Parent=transcript:Os01t0100466-00
+1	irgsp	gene	16399	20144	.	+	.	ID=gene:Os01g0100500;biotype=protein_coding;description=Immunoglobulin-like domain containing protein. (Os01t0100500-01);gene_id=Os01g0100500;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	16399	20144	.	+	.	ID=transcript:Os01t0100500-01;Parent=gene:Os01g0100500;biotype=protein_coding;transcript_id=Os01t0100500-01
+1	irgsp	exon	16399	16976	.	+	.	ID=Os01t0100500-01.exon1;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100500-01.exon1;rank=1
+1	irgsp	exon	17383	17474	.	+	.	ID=Os01t0100500-01.exon2;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100500-01.exon2;rank=2
+1	irgsp	exon	17558	18258	.	+	.	ID=Os01t0100500-01.exon3;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100500-01.exon3;rank=3
+1	irgsp	exon	18501	18571	.	+	.	ID=Os01t0100500-01.exon4;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100500-01.exon4;rank=4
+1	irgsp	exon	18968	19057	.	+	.	ID=Os01t0100500-01.exon5;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon5;rank=5
+1	irgsp	exon	19142	19321	.	+	.	ID=Os01t0100500-01.exon6;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon6;rank=6
+1	irgsp	exon	19531	19629	.	+	.	ID=Os01t0100500-01.exon7;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100500-01.exon7;rank=7
+1	irgsp	exon	19734	20144	.	+	.	ID=Os01t0100500-01.exon8;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon8;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100500-01.exon8;rank=8
+1	irgsp	CDS	16599	16976	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	17383	17474	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	17558	18258	.	+	1	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	18501	18571	.	+	2	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	18968	19057	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	19142	19321	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	19531	19593	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	five_prime_UTR	16399	16598	.	+	.	ID=agat-five_prime_utr-7;Parent=transcript:Os01t0100500-01
+1	irgsp	three_prime_UTR	19594	19629	.	+	.	ID=agat-three_prime_utr-6;Parent=transcript:Os01t0100500-01
+1	irgsp	three_prime_UTR	19734	20144	.	+	.	ID=agat-three_prime_utr-7;Parent=transcript:Os01t0100500-01
+1	irgsp	gene	22841	26892	.	+	.	ID=gene:Os01g0100600;biotype=protein_coding;description=Single-stranded nucleic acid binding R3H domain containing protein. (Os01t0100600-01);gene_id=Os01g0100600;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	22841	26892	.	+	.	ID=transcript:Os01t0100600-01;Parent=gene:Os01g0100600;biotype=protein_coding;transcript_id=Os01t0100600-01
+1	irgsp	exon	22841	23281	.	+	.	ID=Os01t0100600-01.exon1;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100600-01.exon1;rank=1
+1	irgsp	exon	23572	23847	.	+	.	ID=Os01t0100600-01.exon2;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon2;rank=2
+1	irgsp	exon	23962	24033	.	+	.	ID=Os01t0100600-01.exon3;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon3;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon3;rank=3
+1	irgsp	exon	24492	24577	.	+	.	ID=Os01t0100600-01.exon4;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon4;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100600-01.exon4;rank=4
+1	irgsp	exon	25445	25519	.	+	.	ID=Os01t0100600-01.exon5;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100600-01.exon5;rank=5
+1	irgsp	exon	25883	26892	.	+	.	ID=Os01t0100600-01.exon6;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon6;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0100600-01.exon6;rank=6
+1	irgsp	CDS	23232	23281	.	+	0	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	23572	23847	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	23962	24033	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	24492	24577	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	25445	25519	.	+	2	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	25883	26391	.	+	2	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	five_prime_UTR	22841	23231	.	+	.	ID=agat-five_prime_utr-8;Parent=transcript:Os01t0100600-01
+1	irgsp	three_prime_UTR	26392	26892	.	+	.	ID=agat-three_prime_utr-8;Parent=transcript:Os01t0100600-01
+1	irgsp	gene	25861	26424	.	-	.	ID=gene:Os01g0100650;biotype=protein_coding;description=Hypothetical gene. (Os01t0100650-00);gene_id=Os01g0100650;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	25861	26424	.	-	.	ID=transcript:Os01t0100650-00;Parent=gene:Os01g0100650;biotype=protein_coding;transcript_id=Os01t0100650-00
+1	irgsp	exon	25861	26424	.	-	.	ID=Os01t0100650-00.exon1;Parent=transcript:Os01t0100650-00;Name=Os01t0100650-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100650-00.exon1;rank=1
+1	irgsp	five_prime_UTR	26424	26424	.	-	.	ID=agat-five_prime_utr-9;Parent=transcript:Os01t0100650-00
+1	irgsp	three_prime_UTR	25861	26039	.	-	.	ID=agat-three_prime_utr-9;Parent=transcript:Os01t0100650-00
diff --git a/src/agat/agat_sp_merge_annotations/config.vsh.yaml b/src/agat/agat_sp_merge_annotations/config.vsh.yaml
new file mode 100644
index 00000000..bc47921a
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/config.vsh.yaml
@@ -0,0 +1,67 @@
+name: agat_sp_merge_annotations
+namespace: agat
+description: |
+  Merge different gff annotation files into one. It uses the AGAT parser that takes care of
+  duplicated names and fixes other oddities met in those files.
+keywords: [gene annotations, merge, gff]
+links:
+  homepage: https://github.com/NBISweden/AGAT
+  documentation: https://agat.readthedocs.io/en/latest/tools/agat_sp_merge_annotations.html
+  issue_tracker: https://github.com/NBISweden/AGAT/issues
+  repository: https://github.com/NBISweden/AGAT
+references: 
+  doi: 10.5281/zenodo.3552717
+license: GPL-3.0
+requirements:
+  commands: [agat]
+authors:
+  - __merge__: /src/_authors/leila_paquay.yaml
+    roles: [ author, maintainer ]
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --gff
+        alternatives: [-f]
+        description: |
+          Input GTF/GFF file(s).
+        type: file
+        multiple: true
+        required: true
+        example: input1.gff;input2.gff
+  - name: Outputs
+    arguments:       
+      - name: --output
+        alternatives: [-o, --out]
+        description: Output gff3 file where the gene incriminated will be writen.
+        type: file
+        direction: output
+        required: true
+        example: output.gff
+  - name: Arguments
+    arguments:
+      - name: --config
+        alternatives: [-c]
+        description: |
+          AGAT config file. By default AGAT takes the original agat_config.yaml shipped with AGAT. 
+          The `--config` option gives you the possibility to use your own AGAT config file (located
+          elsewhere or named differently).
+        type: file
+        example: custom_agat_config.yaml
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+engines:
+  - type: docker
+    image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
+    setup:
+      - type: docker
+        run: |
+          agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
+runners:
+  - type: executable
+  - type: nextflow
\ No newline at end of file
diff --git a/src/agat/agat_sp_merge_annotations/help.txt b/src/agat/agat_sp_merge_annotations/help.txt
new file mode 100644
index 00000000..2a17e7e4
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/help.txt
@@ -0,0 +1,64 @@
+```sh
+agat_sp_merge_annotations.pl --help
+```
+ 
+  ------------------------------------------------------------------------------
+|   Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0                      |
+|   https://github.com/NBISweden/AGAT                                          |
+|   National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se         |
+ ------------------------------------------------------------------------------
+
+
+Name:
+    agat_sp_merge_annotations.pl
+
+Description:
+    This script merge different gff annotation files in one. It uses the
+    AGAT parser that takes care of duplicated names and fixes other oddities
+    met in those files.
+
+Usage:
+        agat_sp_merge_annotations.pl --gff infile1 --gff infile2 --out outFile
+        agat_sp_merge_annotations.pl --help
+
+Options:
+    --gff or -f
+            Input GTF/GFF file(s). You can specify as much file you want
+            like so: -f file1 -f file2 -f file3
+
+    --out, --output or -o
+            Output gff3 file where the gene incriminated will be write.
+
+    -c or --config
+            String - Input agat config file. By default AGAT takes as input
+            agat_config.yaml file from the working directory if any,
+            otherwise it takes the orignal agat_config.yaml shipped with
+            AGAT. To get the agat_config.yaml locally type: "agat config
+            --expose". The --config option gives you the possibility to use
+            your own AGAT config file (located elsewhere or named
+            differently).
+
+    --help or -h
+            Display this helpful text.
+
+Feedback:
+  Did you find a bug?:
+    Do not hesitate to report bugs to help us keep track of the bugs and
+    their resolution. Please use the GitHub issue tracking system available
+    at this address:
+
+                https://github.com/NBISweden/AGAT/issues
+
+     Ensure that the bug was not already reported by searching under Issues.
+     If you're unable to find an (open) issue addressing the problem, open a new one.
+     Try as much as possible to include in the issue when relevant:
+     - a clear description,
+     - as much relevant information as possible,
+     - the command used,
+     - a data sample,
+     - an explanation of the expected behaviour that is not occurring.
+
+  Do you want to contribute?:
+    You are very welcome, visit this address for the Contributing
+    guidelines:
+    https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md
diff --git a/src/agat/agat_sp_merge_annotations/script.sh b/src/agat/agat_sp_merge_annotations/script.sh
new file mode 100644
index 00000000..5703745a
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/script.sh
@@ -0,0 +1,19 @@
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+## VIASH END
+
+# Convert a list of file names to multiple -gff arguments
+input_files=""
+IFS=";" read -ra file_names <<< "$par_gff"
+for file in "${file_names[@]}"; do
+    input_files+="--gff $file "
+done
+
+# run agat_sp_merge_annotations
+agat_sp_merge_annotations.pl \
+  $input_files \
+  -o "$par_output" \
+  ${par_config:+--config "${par_config}"}
diff --git a/src/agat/agat_sp_merge_annotations/test.sh b/src/agat/agat_sp_merge_annotations/test.sh
new file mode 100644
index 00000000..7b882717
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/test.sh
@@ -0,0 +1,56 @@
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+## VIASH END
+
+test_dir="${meta_resources_dir}/test_data"
+
+# create temporary directory and clean up on exit
+TMPDIR=$(mktemp -d "$meta_temp_dir/$meta_functionality_name-XXXXXX")
+function clean_up {
+ [[ -d "$TMPDIR" ]] && rm -rf "$TMPDIR"
+}
+trap clean_up EXIT
+
+echo "> Run $meta_name with test data 1"
+"$meta_executable" \
+  --gff "$test_dir/file1.gff;$test_dir/file2.gff" \
+  --output "$TMPDIR/output.gff"
+
+echo ">> Checking output"
+[ ! -f "$TMPDIR/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
+
+echo ">> Check if output is empty"
+[ ! -s "$TMPDIR/output.gff" ] && echo "Output file output.gff is empty" && exit 1
+
+echo ">> Check if output matches expected output"
+diff "$TMPDIR/output.gff" "$test_dir/agat_sp_merge_annotations_1.gff"
+if [ $? -ne 0 ]; then
+  echo "Output file output.gff does not match expected output"
+  exit 1
+fi
+
+echo ">> cleanup"
+rm -rf "$TMPDIR/output.gff"
+
+echo "> Run $meta_name with test data 2"
+"$meta_executable" \
+  --gff "$test_dir/fileA.gff;$test_dir/fileB.gff" \
+  --output "$TMPDIR/output.gff"
+
+echo ">> Checking output"
+[ ! -f "$TMPDIR/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
+
+echo ">> Check if output is empty"
+[ ! -s "$TMPDIR/output.gff" ] && echo "Output file output.gff is empty" && exit 1
+
+echo ">> Check if output matches expected output"
+diff "$TMPDIR/output.gff" "$test_dir/agat_sp_merge_annotations_2.gff"
+if [ $? -ne 0 ]; then
+  echo "Output file output.gff does not match expected output"
+  exit 1
+fi
+
+echo "> Test successful"
\ No newline at end of file
diff --git a/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_1.gff b/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_1.gff
new file mode 100644
index 00000000..5f68f1f3
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_1.gff
@@ -0,0 +1,13 @@
+##gff-version 3
+chr10	BestRefSeq	gene	123237824	123357992	.	-	.	ID=gene-FGFR2;ontology=G0222
+chr10	BestRefSeq	mRNA	123237824	123357992	.	-	.	ID=rna-NM_022970.3;Parent=gene-FGFR2;ontology=G0222;merged_ID=IDmodified-mrna-1;merged_Ontology=G0333;merged_Parent=IDmodified-gene-1
+chr10	BestRefSeq	exon	123237824	123239535	.	-	.	ID=exon-NM_022970.3-18;Parent=rna-NM_022970.3
+chr10	BestRefSeq	exon	123243212	123243317	.	-	.	ID=exon-NM_022970.3-17;Parent=rna-NM_022970.3
+chr10	BestRefSeq	exon	123353223	123353481	.	-	.	ID=exon-NM_022970.3-2;Parent=rna-NM_022970.3
+chr10	BestRefSeq	exon	123357476	123357992	.	-	.	ID=exon-NM_022970.3-1;Parent=rna-NM_022970.3
+chr10	BestRefSeq	CDS	123239371	123239535	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3
+chr10	BestRefSeq	CDS	123243212	123243317	.	-	1	ID=cds-NP_075259.4;Parent=rna-NM_022970.3
+chr10	BestRefSeq	CDS	123353223	123353331	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3
+chr10	BestRefSeq	five_prime_UTR	123353332	123353481	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3
+chr10	BestRefSeq	five_prime_UTR	123357476	123357992	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3
+chr10	BestRefSeq	three_prime_UTR	123237824	123239370	.	-	.	ID=agat-three_prime_utr-54427;Parent=rna-NM_022970.3
diff --git a/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_2.gff b/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_2.gff
new file mode 100644
index 00000000..1c3846b2
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_2.gff
@@ -0,0 +1,3 @@
+##gff-version 3
+chr1	AUGUSTUS	gene	1000424	1039237	.	+	.	ID=A
+chr1	AUGUSTUS	mRNA	1000424	1039237	.	+	.	ID=A.t1;Parent=A;merged_ID=B.t1;merged_Parent=B
diff --git a/src/agat/agat_sp_merge_annotations/test_data/file1.gff b/src/agat/agat_sp_merge_annotations/test_data/file1.gff
new file mode 100644
index 00000000..d822ebfa
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/test_data/file1.gff
@@ -0,0 +1,14 @@
+chr10	BestRefSeq	gene	123237824	123357992	.	-	.	ID=gene-FGFR2;Ontology=G0222;
+chr10	BestRefSeq	mRNA	123237824	123357992	.	-	.	ID=rna-NM_022970.3;Parent=gene-FGFR2;Ontology=G0222;
+chr10	BestRefSeq	exon	123237824	123239535	.	-	.	ID=exon-NM_022970.3-18;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123243212	123243317	.	-	.	ID=exon-NM_022970.3-17;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123353223	123353481	.	-	.	ID=exon-NM_022970.3-2;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123357476	123357992	.	-	.	ID=exon-NM_022970.3-1;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123239371	123239535	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123243212	123243317	.	-	1	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123353223	123353331	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	five_prime_UTR	123353332	123353481	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	five_prime_UTR	123357476	123357992	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	three_prime_UTR	123237824	123239370	.	-	.	ID=agat-three_prime_utr-54427;Parent=rna-NM_022970.3;
+
+	
\ No newline at end of file
diff --git a/src/agat/agat_sp_merge_annotations/test_data/file2.gff b/src/agat/agat_sp_merge_annotations/test_data/file2.gff
new file mode 100644
index 00000000..f072e1b3
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/test_data/file2.gff
@@ -0,0 +1,12 @@
+chr10	BestRefSeq	gene	123237824	123357992	.	-	.	ID=gene-FGFR2;Ontology=G0222;
+chr10	BestRefSeq	mRNA	123237824	123357992	.	-	.	ID=rna-NM_022970.3;Parent=gene-FGFR2;Ontology=G0333;
+chr10	BestRefSeq	exon	123237824	123239535	.	-	.	ID=exon-NM_022970.3-18;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123243212	123243317	.	-	.	ID=exon-NM_022970.3-17;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123353223	123353481	.	-	.	ID=exon-NM_022970.3-2;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123357476	123357992	.	-	.	ID=exon-NM_022970.3-1;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123239371	123239535	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123243212	123243317	.	-	1	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123353223	123353331	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	five_prime_UTR	123353332	123353481	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	five_prime_UTR	123357476	123357992	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	three_prime_UTR	123237824	123239370	.	-	.	ID=agat-three_prime_utr-54427;Parent=rna-NM_022970.3;
\ No newline at end of file
diff --git a/src/agat/agat_sp_merge_annotations/test_data/fileA.gff b/src/agat/agat_sp_merge_annotations/test_data/fileA.gff
new file mode 100644
index 00000000..03b2d16d
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/test_data/fileA.gff
@@ -0,0 +1,2 @@
+chr1	AUGUSTUS	gene	1000424	1039237	.	+	.	ID=A;
+chr1	AUGUSTUS	mRNA	1000424	1039237	.	+	.	ID=A.t1;Parent=A;
diff --git a/src/agat/agat_sp_merge_annotations/test_data/fileB.gff b/src/agat/agat_sp_merge_annotations/test_data/fileB.gff
new file mode 100644
index 00000000..e796e5f0
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/test_data/fileB.gff
@@ -0,0 +1,2 @@
+chr1	AUGUSTUS	gene	1000424	1039237	.	+	.	ID=B;
+chr1	AUGUSTUS	mRNA	1000424	1039237	.	+	.	ID=B.t1;Parent=B;
diff --git a/src/agat/agat_sp_merge_annotations/test_data/script.sh b/src/agat/agat_sp_merge_annotations/test_data/script.sh
new file mode 100755
index 00000000..0d3acae7
--- /dev/null
+++ b/src/agat/agat_sp_merge_annotations/test_data/script.sh
@@ -0,0 +1,15 @@
+#!/bin/bash
+
+# clone repo
+if [ ! -d /tmp/agat_source ]; then
+  git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
+fi
+
+# copy test data
+cp -r /tmp/agat_source/t/scripts_output/in/agat_sp_merge_annotations/file1.gff src/agat/agat_sp_merge_annotations/test_data
+cp -r /tmp/agat_source/t/scripts_output/in/agat_sp_merge_annotations/file2.gff src/agat/agat_sp_merge_annotations/test_data
+cp -r /tmp/agat_source/t/scripts_output/out/agat_sp_merge_annotations_1.gff src/agat/agat_sp_merge_annotations/test_data
+
+cp -r /tmp/agat_source/t/scripts_output/in/agat_sp_merge_annotations/fileA.gff src/agat/agat_sp_merge_annotations/test_data
+cp -r /tmp/agat_source/t/scripts_output/in/agat_sp_merge_annotations/fileB.gff src/agat/agat_sp_merge_annotations/test_data
+cp -r /tmp/agat_source/t/scripts_output/out/agat_sp_merge_annotations_2.gff src/agat/agat_sp_merge_annotations/test_data
\ No newline at end of file
diff --git a/src/bedtools/bedtools_bamtobed/config.vsh.yaml b/src/bedtools/bedtools_bamtobed/config.vsh.yaml
new file mode 100644
index 00000000..22ef8b44
--- /dev/null
+++ b/src/bedtools/bedtools_bamtobed/config.vsh.yaml
@@ -0,0 +1,118 @@
+name: bedtools_bamtobed
+namespace: bedtools
+description: Converts BAM alignments to BED6 or BEDPE format.
+keywords: [Converts, BAM, BED, BED6, BEDPE]
+links:
+  documentation: https://bedtools.readthedocs.io/en/latest/content/tools/bamtobed.html
+  repository: https://github.com/arq5x/bedtools2
+  homepage: https://bedtools.readthedocs.io/en/latest/#
+  issue_tracker: https://github.com/arq5x/bedtools2/issues
+references:
+  doi: 10.1093/bioinformatics/btq033
+license: MIT
+requirements:
+  commands: [bedtools]
+authors:
+  - __merge__: /src/_authors/theodoro_gasperin.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --input
+        alternatives: -i
+        type: file
+        description: Input BAM file.
+        required: true
+    
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: -o
+        required: true
+        type: file
+        direction: output
+        description: Output BED file.
+
+  - name: Options
+    arguments:
+      - name: --bedpe
+        type: boolean_true
+        description: | 
+          Write BEDPE format. Requires BAM to be grouped or sorted by query.
+      
+      - name: --mate1
+        type: boolean_true
+        description: | 
+          When writing BEDPE (-bedpe) format, always report mate one as the first BEDPE "block".
+      
+      - name: --bed12
+        type: boolean_true
+        description: | 
+          Write "blocked" BED format (aka "BED12"). Forces -split.
+          See http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1
+
+      - name: --split
+        type: boolean_true
+        description: | 
+          Report "split" BAM alignments as separate BED entries.
+          Splits only on N CIGAR operations.
+
+      - name: --splitD
+        type: boolean_true
+        description: | 
+          Split alignments based on N and D CIGAR operators.
+          Forces -split.
+
+      - name: --edit_distance
+        alternatives: -ed
+        type: boolean_true
+        description: | 
+          Use BAM edit distance (NM tag) for BED score.
+          - Default for BED is to use mapping quality.
+          - Default for BEDPE is to use the minimum of
+            the two mapping qualities for the pair.
+          - When -ed is used with -bedpe, the total edit
+            distance from the two mates is reported.
+
+      - name: --tag
+        type: string
+        description: | 
+          Use other NUMERIC BAM alignment tag for BED score.
+          Default for BED is to use mapping quality. Disallowed with BEDPE output.
+        example: "SM"
+      
+      - name: --color
+        type: string
+        description: | 
+          An R,G,B string for the color used with BED12 format.
+          Default is (255,0,0).
+        example: "250,250,250"
+
+      - name: --cigar
+        type: boolean_true
+        description: | 
+          Add the CIGAR string to the BED entry as a 7th column.
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - path: test_data
+
+engines:
+  - type: docker
+    image: debian:stable-slim
+    setup:
+      - type: apt
+        packages: [bedtools, procps]
+      - type: docker
+        run: |
+          echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
+
+runners:
+  - type: executable
+  - type: nextflow
\ No newline at end of file
diff --git a/src/bedtools/bedtools_bamtobed/help.txt b/src/bedtools/bedtools_bamtobed/help.txt
new file mode 100644
index 00000000..0cfc23a2
--- /dev/null
+++ b/src/bedtools/bedtools_bamtobed/help.txt
@@ -0,0 +1,43 @@
+```bash
+bedtools bamtobed
+```
+
+Tool:    bedtools bamtobed (aka bamToBed)
+Version: v2.30.0
+Summary: Converts BAM alignments to BED6 or BEDPE format.
+
+Usage:   bedtools bamtobed [OPTIONS] -i <bam> 
+
+Options: 
+	-bedpe	Write BEDPE format.
+		- Requires BAM to be grouped or sorted by query.
+
+	-mate1	When writing BEDPE (-bedpe) format, 
+		always report mate one as the first BEDPE "block".
+
+	-bed12	Write "blocked" BED format (aka "BED12"). Forces -split.
+
+		http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1
+
+	-split	Report "split" BAM alignments as separate BED entries.
+		Splits only on N CIGAR operations.
+
+	-splitD	Split alignments based on N and D CIGAR operators.
+		Forces -split.
+
+	-ed	Use BAM edit distance (NM tag) for BED score.
+		- Default for BED is to use mapping quality.
+		- Default for BEDPE is to use the minimum of
+		  the two mapping qualities for the pair.
+		- When -ed is used with -bedpe, the total edit
+		  distance from the two mates is reported.
+
+	-tag	Use other NUMERIC BAM alignment tag for BED score.
+		- Default for BED is to use mapping quality.
+		  Disallowed with BEDPE output.
+
+	-color	An R,G,B string for the color used with BED12 format.
+		Default is (255,0,0).
+
+	-cigar	Add the CIGAR string to the BED entry as a 7th column.
+
diff --git a/src/bedtools/bedtools_bamtobed/script.sh b/src/bedtools/bedtools_bamtobed/script.sh
new file mode 100644
index 00000000..10c4cef4
--- /dev/null
+++ b/src/bedtools/bedtools_bamtobed/script.sh
@@ -0,0 +1,39 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+set -eo pipefail
+
+# Unset parameters
+unset_if_false=( 
+  par_bedpe
+  par_mate1
+  par_bed12
+  par_split
+  par_splitD
+  par_edit_distance
+  par_tag
+  par_color
+  par_cigar
+)
+
+for par in ${unset_if_false[@]}; do
+    test_val="${!par}"
+    [[ "$test_val" == "false" ]] && unset $par
+done
+
+# Execute bedtools sort with the provided arguments
+bedtools bamtobed \
+    ${par_bedpe:+-bedpe} \
+    ${par_mate1:+-mate1} \
+    ${par_bed12:+-bed12} \
+    ${par_split:+-split} \
+    ${par_splitD:+-splitD} \
+    ${par_edit_distance:+-ed} \
+    ${par_tag:+-tag "$par_tag"} \
+    ${par_cigar:+-cigar} \
+    ${par_color:+-color "$par_color"} \
+    -i "$par_input" \
+    > "$par_output"
+
diff --git a/src/bedtools/bedtools_bamtobed/test.sh b/src/bedtools/bedtools_bamtobed/test.sh
new file mode 100644
index 00000000..3ea8b59d
--- /dev/null
+++ b/src/bedtools/bedtools_bamtobed/test.sh
@@ -0,0 +1,183 @@
+#!/bin/bash
+
+# exit on error
+set -eo pipefail
+
+# directory of the bam file
+test_data="$meta_resources_dir/test_data"
+
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
+}
+assert_identical_content() {
+  diff -a "$2" "$1" \
+    || (echo "Files are not identical!" && exit 1)
+}
+#############################################
+
+echo "Creating Test Data..."
+TMPDIR=$(mktemp -d "$meta_temp_dir/XXXXXX")
+function clean_up {
+  [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
+}
+trap clean_up EXIT
+
+# Generate expected files for comparison
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t60\t+\nchr2:172936693-172938111\t428\t528\tmy_read/2\t60\t-\n" > "$TMPDIR/expected.bed"
+printf "chr2:172936693-172938111\t128\t228\tchr2:172936693-172938111\t428\t528\tmy_read\t60\t+\t-\n" > "$TMPDIR/expected.bedpe"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t60\t+\t128\t228\t255,0,0\t1\t100\t0\nchr2:172936693-172938111\t428\t528\tmy_read/2\t60\t-\t428\t528\t255,0,0\t1\t100\t0\n" > "$TMPDIR/expected.bed12"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t0\t+\nchr2:172936693-172938111\t428\t528\tmy_read/2\t0\t-\n" > "$TMPDIR/expected_ed.bed"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t60\t+\t128\t228\t250,250,250\t1\t100\t0\nchr2:172936693-172938111\t428\t528\tmy_read/2\t60\t-\t428\t528\t250,250,250\t1\t100\t0\n" > "$TMPDIR/expected_color.bed12"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t60\t+\t100M\nchr2:172936693-172938111\t428\t528\tmy_read/2\t60\t-\t100M\n" > "$TMPDIR/expected_cigar.bed"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t85\t+\nchr2:172936693-172938111\t428\t528\tmy_read/2\t85\t-\n" > "$TMPDIR/expected_tag.bed"
+
+
+# Test 1: 
+mkdir "$TMPDIR/test1" && pushd "$TMPDIR/test1" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output.bed" \
+
+# checks
+assert_file_exists "output.bed"
+assert_file_not_empty "output.bed"
+assert_identical_content "output.bed" "../expected.bed"
+echo "- test1 succeeded -"
+
+popd > /dev/null
+
+# Test 2:
+mkdir "$TMPDIR/test2" && pushd "$TMPDIR/test2" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -bedpe"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output.bedpe" \
+  --bedpe
+
+# checks
+assert_file_exists "output.bedpe"
+assert_file_not_empty "output.bedpe"
+assert_identical_content "output.bedpe" "../expected.bedpe"
+echo "- test2 succeeded -"
+
+popd > /dev/null
+
+# Test 3:
+mkdir "$TMPDIR/test3" && pushd "$TMPDIR/test3" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -bed12"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output.bed12" \
+  --bed12
+
+# checks
+assert_file_exists "output.bed12"
+assert_file_not_empty "output.bed12"
+assert_identical_content "output.bed12" "../expected.bed12"
+echo "- test3 succeeded -"
+
+popd > /dev/null
+
+# Test 4:
+mkdir "$TMPDIR/test4" && pushd "$TMPDIR/test4" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -ed"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output_ed.bed" \
+  --edit_distance
+
+# checks
+assert_file_exists "output_ed.bed"
+assert_file_not_empty "output_ed.bed"
+assert_identical_content "output_ed.bed" "../expected_ed.bed"
+echo "- test4 succeeded -"
+
+popd > /dev/null
+
+# Test 5:
+mkdir "$TMPDIR/test5" && pushd "$TMPDIR/test5" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -color"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output_color.bed12" \
+  --bed12 \
+  --color "250,250,250" \
+  
+# checks
+assert_file_exists "output_color.bed12"
+assert_file_not_empty "output_color.bed12"
+assert_identical_content "output_color.bed12" "../expected_color.bed12"
+echo "- test5 succeeded -"
+
+popd > /dev/null
+
+# Test 6:
+mkdir "$TMPDIR/test6" && pushd "$TMPDIR/test6" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -cigar"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output_cigar.bed" \
+  --cigar
+
+# checks
+assert_file_exists "output_cigar.bed"
+assert_file_not_empty "output_cigar.bed"
+assert_identical_content "output_cigar.bed" "../expected_cigar.bed"
+echo "- test6 succeeded -"
+
+popd > /dev/null
+
+# Test 7:
+mkdir "$TMPDIR/test7" && pushd "$TMPDIR/test7" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -tag"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output_tag.bed" \
+  --tag "XT"
+
+# checks
+assert_file_exists "output_tag.bed"
+assert_file_not_empty "output_tag.bed"
+assert_identical_content "output_tag.bed" "../expected_tag.bed"
+echo "- test7 succeeded -"
+
+popd > /dev/null
+
+# Test 8: 
+mkdir "$TMPDIR/test8" && pushd "$TMPDIR/test8" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with other options"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output.bed" \
+  --bedpe \
+  --mate1 \
+  --split \
+  --splitD \
+
+# checks
+assert_file_exists "output.bed"
+assert_file_not_empty "output.bed"
+assert_identical_content "output.bed" "../expected.bedpe"
+echo "- test8 succeeded -"
+
+popd > /dev/null
+
+echo "---- All tests succeeded! ----"
+exit 0
diff --git a/src/bedtools/bedtools_bamtobed/test_data/example.bam b/src/bedtools/bedtools_bamtobed/test_data/example.bam
new file mode 100644
index 0000000000000000000000000000000000000000..ffc075ab83a83a98ed1edbf88b26cc27ad8946c6
GIT binary patch
literal 334
zcmb2|=3rp}f&Xj_PR>jWAq>SuUsA6mBqS7Y@IB%Aw%O~PhS4S?6Z1_bX2zRMuCZ>`
z;o;@Ato^fw$CpQUheTtRYNNz-r#8JXHa3Ry>s4lk0?m>~GxQF_-U<7&m>dP#pU;|5
z)~CHK)-&PMX8(zQnRkjz7tzu&Q_9lpm^;_nXXDZb**~)OH9hZA+GbYw!F2!1eU^u&
z=6?J8db>^n+vnS58VqGOpQde!^LhT^FPno$sK1R;RVb&i_o5|>-LG;Kg??MHCx&;~
ziZww?R#r16X1LX_ZFYQZ=WBLl9Y-y@V*W$>-;Wo3eOwoN_@m-GsXhDI<L7O#D!rR*
zAbon#WHIeSf_p=Iw@vX;QcA7~nW$-K`s?tN6@ejF_co|EotL|LtN#%rrst#?n85)E
FA^@Dlf^q-=

literal 0
HcmV?d00001

diff --git a/src/bedtools/bedtools_bamtobed/test_data/example.sam b/src/bedtools/bedtools_bamtobed/test_data/example.sam
new file mode 100644
index 00000000..4afb0aef
--- /dev/null
+++ b/src/bedtools/bedtools_bamtobed/test_data/example.sam
@@ -0,0 +1,3 @@
+@SQ	SN:chr2:172936693-172938111	LN:1418
+my_read	99	chr2:172936693-172938111	129	60	100M	=	429	400	CTAACTAGCCTGGGAAAAAAGGATAGTGTCTCTCTGTTCTTTCATAGGAAATGTTGAATCAGACCCCTACTGGGAAAAGAAATTTAATGCATATCTCACT	*	XT:A:U	NM:i:0	SM:i:37	AM:i:37	X0:i:1	X1:i:0	XM:i:0	XO:i:0	XG:i:0	MD:Z:100
+my_read	147	chr2:172936693-172938111	429	60	100M	=	129	-400	TCGAGCTCTGCATTCATGGCTGTGTCTAAAGGGCATGTCAGCCTTTGATTCTCTCTGAGAGGTAATTATCCTTTTCCTGTCACGGAACAACAAATGATAG	*	XT:A:U	NM:i:0	SM:i:37	AM:i:37	X0:i:1	X1:i:0	XM:i:0	XO:i:0	XG:i:0	MD:Z:100
diff --git a/src/rseqc/rseqc_bamstat/config.vsh.yaml b/src/rseqc/rseqc_bamstat/config.vsh.yaml
new file mode 100644
index 00000000..6d607e2f
--- /dev/null
+++ b/src/rseqc/rseqc_bamstat/config.vsh.yaml
@@ -0,0 +1,59 @@
+name: rseqc_bamstat
+namespace: rseqc
+keywords: [ rnaseq, genomics ]
+description: Generate statistics from a bam file.
+links:
+  homepage: https://rseqc.sourceforge.net/
+  documentation: https://rseqc.sourceforge.net/#bam-stat-py
+  issue_tracker: https://github.com/MonashBioinformaticsPlatform/RSeQC/issues
+  repository: https://github.com/MonashBioinformaticsPlatform/RSeQC
+references:
+  doi: 10.1093/bioinformatics/bts356
+license: GPL-3.0
+authors:
+  - __merge__: /src/_authors/emma_rousseau.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+- name: "Input"
+  arguments: 
+  - name: "--input_file"
+    alternatives: -i
+    type: file 
+    required: true
+    description: Input alignment file in BAM or SAM format.
+  - name: "--mapq"
+    alternatives: -q
+    type: integer
+    example: 30 
+    description: |
+      Minimum mapping quality (phred scaled) to determine uniquely mapped reads. Default: '30'.
+    
+- name: "Output"
+  arguments: 
+  - name: "--output"
+    type: file
+    direction: output
+    description: Output file (txt) with mapping quality statistics.
+
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+  
+engines:
+- type: docker
+  image: python:3.10
+  setup:
+    - type: python
+      packages: [ RSeQC ]
+    - type: docker
+      run: |
+        echo "RSeQC bam_stat.py: $(bam_stat.py --version | cut -d' ' -f2-)" > /var/software_versions.txt
+runners: 
+- type: executable
+- type: nextflow
diff --git a/src/rseqc/rseqc_bamstat/help.txt b/src/rseqc/rseqc_bamstat/help.txt
new file mode 100644
index 00000000..b4e9c1d9
--- /dev/null
+++ b/src/rseqc/rseqc_bamstat/help.txt
@@ -0,0 +1,18 @@
+```
+bam_stat.py -h
+```
+
+Usage: bam_stat.py [options]
+
+Summarizing mapping statistics of a BAM or SAM file. 
+
+
+
+Options:
+  --version             show program's version number and exit
+  -h, --help            show this help message and exit
+  -i INPUT_FILE, --input-file=INPUT_FILE
+                        Alignment file in BAM or SAM format.
+  -q MAP_QUAL, --mapq=MAP_QUAL
+                        Minimum mapping quality (phred scaled) to determine
+                        "uniquely mapped" reads. default=30
\ No newline at end of file
diff --git a/src/rseqc/rseqc_bamstat/script.sh b/src/rseqc/rseqc_bamstat/script.sh
new file mode 100644
index 00000000..32927bb6
--- /dev/null
+++ b/src/rseqc/rseqc_bamstat/script.sh
@@ -0,0 +1,9 @@
+#!/bin/bash
+
+
+set -eo pipefail 
+
+bam_stat.py \
+    --input-file "${par_input_file}" \
+    ${par_mapq:+--mapq "${par_mapq}"} \
+> $par_output
diff --git a/src/rseqc/rseqc_bamstat/test.sh b/src/rseqc/rseqc_bamstat/test.sh
new file mode 100644
index 00000000..f9180da8
--- /dev/null
+++ b/src/rseqc/rseqc_bamstat/test.sh
@@ -0,0 +1,49 @@
+#!/bin/bash
+
+# define input and output for script
+
+input_bam="sample.bam"
+output_summary="mapping_quality.txt"
+
+# run executable and tests
+echo "> Running $meta_functionality_name."
+
+"$meta_executable" \
+    --input_file "$meta_resources_dir/test_data/$input_bam" \
+    --output "$output_summary"
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Checking whether output is present"
+[ ! -f "$output_summary" ] && echo "$output_summary file missing" && exit 1
+[ ! -s "$output_summary" ] && echo "$output_summary file is empty" && exit 1
+
+echo ">> Checking whether output is correct"
+diff "$meta_resources_dir/test_data/ref_output.txt" "$meta_resources_dir/$output_summary" || { echo "Output is not correct"; exit 1; }
+
+#############################################################################
+
+echo ">>> Test 2: Test with non-default mapping quality threshold"
+
+output_summary="mapping_quality_mapq_50.txt"
+
+# run executable and tests
+echo "> Running $meta_functionality_name."
+
+"$meta_executable" \
+    --input_file "$meta_resources_dir/test_data/$input_bam" \
+    --output "$output_summary" \
+    --mapq 50
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Checking whether output is present"
+[ ! -f "$output_summary" ] && echo "$output_summary file missing" && exit 1
+[ ! -s "$output_summary" ] && echo "$output_summary file is empty" && exit 1
+
+echo ">> Checking whether output is correct"
+diff "$meta_resources_dir/test_data/ref_output_mapq.txt" "$meta_resources_dir/$output_summary" || { echo "Output is not correct"; exit 1; }
+
+exit 0
\ No newline at end of file
diff --git a/src/rseqc/rseqc_bamstat/test_data/ref_output.txt b/src/rseqc/rseqc_bamstat/test_data/ref_output.txt
new file mode 100644
index 00000000..6b939096
--- /dev/null
+++ b/src/rseqc/rseqc_bamstat/test_data/ref_output.txt
@@ -0,0 +1,22 @@
+
+#==================================================
+#All numbers are READ count
+#==================================================
+
+Total records:                          90
+
+QC failed:                              0
+Optical/PCR duplicate:                  0
+Non primary hits                        0
+Unmapped reads:                         1
+mapq < mapq_cut (non-unique):           0
+
+mapq >= mapq_cut (unique):              89
+Read-1:                                 45
+Read-2:                                 44
+Reads map to '+':                       44
+Reads map to '-':                       45
+Non-splice reads:                       89
+Splice reads:                           0
+Reads mapped in proper pairs:           88
+Proper-paired reads map to different chrom:0
diff --git a/src/rseqc/rseqc_bamstat/test_data/ref_output_mapq.txt b/src/rseqc/rseqc_bamstat/test_data/ref_output_mapq.txt
new file mode 100644
index 00000000..be8af62f
--- /dev/null
+++ b/src/rseqc/rseqc_bamstat/test_data/ref_output_mapq.txt
@@ -0,0 +1,22 @@
+
+#==================================================
+#All numbers are READ count
+#==================================================
+
+Total records:                          90
+
+QC failed:                              0
+Optical/PCR duplicate:                  0
+Non primary hits                        0
+Unmapped reads:                         1
+mapq < mapq_cut (non-unique):           6
+
+mapq >= mapq_cut (unique):              83
+Read-1:                                 42
+Read-2:                                 41
+Reads map to '+':                       44
+Reads map to '-':                       39
+Non-splice reads:                       83
+Splice reads:                           0
+Reads mapped in proper pairs:           83
+Proper-paired reads map to different chrom:0
diff --git a/src/rseqc/rseqc_bamstat/test_data/sample.bam b/src/rseqc/rseqc_bamstat/test_data/sample.bam
new file mode 100644
index 0000000000000000000000000000000000000000..ed1e24333ba1df0efa75401d7928b790038b762a
GIT binary patch
literal 9240
zcmV+zB<I^7iwFb&00000{{{d;LjnM80fmy^PQox0#*25wm)Hxe<5ULHs|`qyWSi3o
zw@dd2T*6jd8#LbgV7{4Qz@|9#?rYEK@9TGR#<tt}yh6yjo8qO%fDCYO&tf6UBrCW|
zyH@ak1CO~+FrveONdP+@qoZ3o>ROL8JfAYa&X{eo2(a(4x#KL{xo6|RWh#{l`wJHF
zG8Rb+UCXZ?<XMsBd`q$KHG1hWN?@p$qdwq?Qx`OyziG16_AqHATybN?rQ(L<rHsXn
z8ncNV_5jSjY4%M5p&hu#(+<LQT8KQ0$*SPzh!-O%8cYbJx+LrOe;R4scnTzWu7udg
zeV|7BKf(clD%Yv5?XvV$(}PH>!F*E?$@6n6fpc!H+qhDcO4CJy-SVtVlLK9pDosel
z^VV|IVoooa6FAt@UQ4X!YKCDo!o4C#m$XQ}ed3qd%|$c%r<opgI|!j`giy1n=tCj&
z1x#_s3g7|&03VA81ONa4009360763o0F5HGeGRN7Np)Vo{qyd!bY9o=U5af5cXwL2
zSfknZ{{w4lx?dw2JJ@JPvW>+O@P<S|Kv1xg7-4CuQ-Kmj5e{px94T36?F5Th%8z0b
z$tYL>;z%eEf)+$#Wrc{9c#{alYg<Cr;_uW?cXi+U?tSm=`0mV``>OlCnfm%W=X~d!
zs@iTVGOxdj-^rtIU|Z4C(Z?hEx*yk`!=JBv?6Je0qtnxa)9ZVuM@J{o+wO}ZDY@i{
zNHkM@r&wASRVrEE2`+k7w4%|h)x9peP8ChXi#{!iUbb3yW!rUiStqSbd7GxC&htF3
z;>y4B;a!~3IId*$CC@8+UmVjLb8AdD+xK*dhUq)HKgMktE@zqfNpyFPvAl{G=1+P@
ze^*9d@g76;ag5*%?tS0x*>AjW?<{)k^*^~A{m2{7w(6TV%dNlqj=%OVe*V9`_HVuG
zEPCSIXD@xvd(NVtesBGzcfSwUo(piZSl*1@9F6!czWd$pE@Ao6yQ8QCD5BLY5oyAT
zqUsCQr&^UtYnFC>Q&&n<vQmv!^$q%$#tRDsO)R5tX^Qm9fMtgN7Bo4`5K}dH`rj6^
zyvp47vHft4(WMFBS>HT+67#+DzWaZ`&G(*hzGqLq!BMBbBZ`=r?h^xbp2OI8r_|Zq
zJvceuG2BVgx=~$Q@)RVg%DR_HS7^m_+SFAlRKpZ6HLp{y`=m~osu`0>A)8cnoh&Pr
zh(c8=6_Vxjialon>P)^Hm_`4s9M3aiLY@yJD{k{w^34BrS(aNYX`J5Y^t-A6<+np9
zBXH-{#2v!MVYvvn^Xjc1c3}R>0Or%tCmfg`zcY$%ZcV{FI6gf+iQWq^xk%EU>srXR
zWObw4Le#yGDyg+D(j*aWQiz1{wCGx;S=rUB=S_z@ld5jpLKdPDysLOpZ0F`xEgXP`
zWck9rH;gi-X3f=s?(H@+w}VF+Yz@D2e2MX0j)B;H+TWg=5p$DaZRKDzhMg_wQf|4N
z(<m|XYjabq2+l9JU-zbXEr7Gy^4xrGfb(MmH;J!XQ&SANc_E~j7T~X_RU=CwRH_P{
zq)ha(VI8QQqynELs^l4Q#9AZ0H?Nq;f?syxG;>QS`aZJ&Iaic>kOwkmBQbO15<M4J
zQZ^obgt>)Y7vW|y;pQI(JhWimjNTfJeEp3VreIobJ`2aDrLI9ffTyGsjUq^S-S9fm
zAgU~?nsvQOlDYw3bz^2%#b)w`AOw?hR@uUFGPnLZvs|Pv3r|%?uzUtXUipcCZ8q_<
z-=5C<C4qnYZO@_qGE936jW1yAKg|5w;o<4Qf#FccSesN@)Jd8OUUOB{MX5Drop9A8
zX##V_K*8HKQGJmhC~{p2ndp)y@OXmvNtv`Akg@J<@JZo=9pBC$yQ4xJQllElM3*uO
zd6s#`iJ428wKw+xTo~d-wa8-6QVavi-?|)!JeV&89P(fiz&|iE$PrAHZ~)U52m}Zb
zu(3q7HSbD*sHE;0FzpM;i<C)Sup(`NGu$4+2ycbvZI>px;sU~?#01E}<fH&dOf2FB
zoQ-wahB&xjJ>U=vtXWw?#_mZNX9h?dnjZhy15ZDDu^1mpHZ{$~_>?>^e`}M_xPKxv
ze6V=MU1Q|+!Q%JtvH~Oo^W@<0V9x}L8F=Lsyks4Csct%f57xX%@JDyUA!Qjjc=tT8
zMS{$IYeR<>bYM_y@9?2B_M|h9g5rn$u@oANz#((bO-!+1n!r(+`;2ajP0*n`2+n^L
z!g&Yae8>iipLo>4`9J{YLtEc=(7hpm^DV*HTV{rSbb7eEAAJ`7ZDy=>k~A7IK}*%j
zn)h|Ddf6A9s(Mx=Y6R@|y<*2F%=#^J=l1FIo!h4;bKbE5GMw|T&g}83b3Xr{{i2ZY
zhLdB?Z&@?vJHt8ur@%zKC}^V5l>T@Y$E?}pba&T4O?5J93ZW|U*QBy)Qe7~YR+UD_
z!0;E&j~Zo7QG8)Ng;6~2-@PzSV?pn2cqZ|^L|b@)vkzc0@4D}2J!|g`Ci8*UI3KY6
zk}*1c#7!o_*hglG+u`xa-fr~Sd!wikoTVDt1_8KEWuj7Dl}gc^Y9+ctLNjXEcq$Q^
zHPeh0qHVb1I^}iOrV^s3kQXL%ew*&8mIJ&09I*S@c{t*0!V%v(-5QZ%yEYvCd^95Z
z)3a2~qW3R>UMVHWortPqY0|+RB0m#Ia#fS^M)f>Nm{y2G9Tzp1LKY=cZJ}!|Yskd9
zgI{HQo8k{;993@9&)kI8+=i3PIKV7+j?SgO14wa*f^n3YduJoj;u3gT;t_Z|A$SkY
zz}pJIdvNP7JMjMI1Iyv(+DoJ8HPi63zjJ!9yJNynogyn~iARd3eNrT%Qyt<?T_LqY
z34uc>F-hKqCAw3{eUq|Jbc#YjLQtl<>nT*#sj|6>OGp+r0gHoTzz}8wt_1vX?*>0K
zYJeeN=f<Y}{WkiWFy$Ve2~Tkr+pIFS<AC!f+nST{`V7wp13a&9{m|Bk-8@+#jK47T
zOAb%cMw)9Fs}w-4;|w|}A*l&VPU=)3jCTp#G_o1EF5aYNqO?TFXDGYW$Z#5@;Sim&
zYNSX^fX2Tc<Rj7<>$YDg8Os(lRZ8V@r?9gT#60xpappBS?zA~w7H9Dw%wwmfyl5JW
zIaVYr7C!H^UU7!zDsjXn;^@D6CdNQBdIO81UyI%mj73w&xW9LBa&#C$)*zcp;MfQZ
zRhK;yI@B0CP_D+?sxAsClt>usdtE5rS+{NJXPvtFM>{=3zTfH=%Ot}fnyX2R4O@)F
zq&rE6=N5D;m~3&%pl0Sx^YjAROsgW2ym>UbbEic{C&;xorR1G7nMcZCU!sRY>KYVT
zFeJHXSe<IY;P(s7;rK->wN}Vw896*H=x*KJFlx&%ou(1nIoJmln;B;|L9p4GsQ}QN
zt$=fOWWmS`2wo@JpF)UQikSkJ7lBT4$M&Pv3h5J>F*xVLjzX5aq`rCf1(4+X`7ip?
z)m=gG{DK$I_iitHu*bKTs-FADkUyse%m#8<%C7Bdpb8~~TBeo^VYAho2?h&nMT-I!
zY%)<Itstd!4Na|Jhp<w77SR+XthP^Y++IDHZ@x7B3+I(EbIl6qXD{c#?sjm#Zh-UY
z=$+9x_RblcM@Of}htX5_fSYhqR0=EvL!Q^jriPkS$UwTLU@3wC=Sc|(f|_yBcF0yx
zC1n@IEx*E*=?hT2ZLX@nIz{5XfLC9g0P$KYD?%VXK9v<O7Kn?^X|eLIEU)qlVBrmH
z6A+<+ebsxb$G4Y58X4VU281;*Q-8bY<dv-36vY&lDg?2l>*#j)DL5;JPJ`ycQrc)M
z#~4>#t87s&cg1px#>JpqgVW{<9?EAo)lUAxq;}%<){n7eZ}km~Jv7x@2S<kohc?}3
zf)u?hnvN%`lReZt96z{Ll&B9gcz)#jB^StQ(0>q8l0567zZ86xVAPQ4I7$ErhBt1T
z)p@NDpZ^*AnDU`?nNx_h?=pLXuQb3!Z{EFix#F<bTi;;I<RpxLf2y|}o<z<8jT-ui
z6X`fdRXCNrlqJGyQ9|W+h@>3lJ;f5bvjE~f*o<tUZlPU~E`p?N1|~v3B?Cb(V;z`7
zDo|A`tAkg0Idaa>T*c076Lxwu|N6D%GU**@6z$H~d3<`Zb8O3`=y(-fiZ2>6zbL8#
zVyk7mD|lT<P!MUVLaj<j^t}{XMo=)|u1uIf&8kNwnFMa3HHop?Us@SoS?D!=em??d
zE2kuEhZ}8e4`}j@Xr?RCB;@9GQbPDkGj5J(LbU=mAsCX;w9&fmm@LVJ>t3W<3)J#D
z!nQ%0&{IDxL7Ko>$r2<7EkukKxPn}@mR_Md1GK^*cFl%($PB6p1k2xD`hlDqjyyLv
zqxrIxRp&oQm$`X;5k=2Tg~{O#`anlEvtntAS~9d;(m?eKtrT=yuhUYBE|G{jvPIz}
zB^?OUW>iICx<e6_Hw9HndPwP{?u1Hi3pZE%fDJ#^6|FOy_nLfT?1dO<^QBE-vI&@H
zTO)9un*T5w0e*NI(;b*OtrfT^RLHj|jtgaspNauUS0S-eJOo%da~Ua3ZxL8!=4U*Z
zW$cG85ATH^m5=62FjiaV7G80!b1?q<0mdhyUvw}&kFhV#IJv)fdVCta2{0Bg&O#te
zs|2{A@`^|TYb|vLn{Q=Oq=Lac_OgRZZPT8CwMg((pB5z(O`qa}LZ*f4w$I~ad^;kE
zP2~*TY&z&dH|4ka&>OIf%!3<%<>%&DKD;LOJUrO<?<|(>`=JM;=>N^IJlHwhvoiCx
zLCN@SiakCZ%O_-9LCnnc;RbJ+Pd%so*8t3KUM`UPr1<#(%#RH+lgN57vu{gGl9`o4
z%bO)A3n!dI4Z(Knjyj&5R1|R-<fcGHv_`Y8;V3(62@@A6`9VCjlFKs1PbdUW*tTf~
zWu_Kl+I5-3#AYit;m@pjXKv!L9nbPn#1En<4iKI-9W2)uffCKDRrL3E{<%#_acJk)
z2RkPodUxsV-0*b<r{yNu`Bkw)mLz&ectooXJ!e^0H*()mv#V45QmBRN<T}@BhATH@
zTEm`co>}>drg{J*esH)3XA#_!`|6JElsYWGxyjDASK9fF2bY%`eF9_uXJ+Te`^P&r
zj(6-r!0{PysEkqVKIzInP4FirMdshWsBYIQUOl`a5-lzB0GQ9LY<K?P|9bPIEA0HC
zfta6oaI|wzOaeHa5z~T6#6<9>wsFH#)+#}*p(O1^QFHv+l~S{oce)2$bpq)Q?TJ1J
z)OyhYOX}fscv(~t(KtZ>%0_D){248g3G}wFKnK)XkIvPDmnY^kn~3?+2{FInaQn3Z
z%cr9^24ioW6Z2^Q<RtnsT8b9~@s=l@?@|O+JIlr4`$gq%u~k+J<pdSX?+52qoL`<!
zFIZ@B_REvm?O7KV&hFpLnR40L`30QW<Vj?!pV07?Jj_(6P<bG~!0fid*_F-?-t_YE
z+5KEJj{V&9*&Xff?(XeJU;dsbLKzn&r!p-P$y1F?3fTfm!Ma7hm2xCvNEsyRQw4{B
zKzoKuSPq6!$P%f0rokheJ*Abe?EIl~tzrmkE_E}e1eAVej?#CgD8&Iv-<hDaV>u9_
z^!KJ5xP2(iCX;6)xmV0~r8mv5;t#wh*aJ#Gvj(MmLzKKv{o-F7xit9HS47bZGcFzO
z?(d%%pNd)=HCvz~(RV?Ll+>z9Q{+de1QTj0D|mwPlBmlRr8`;l9eSq<SmIXX?IlP3
z4tA!v6ZJL_$3sKYMQ#g3(0QwTwiLU1n)!%r-{roi?0e1GaJ%Vwl8eq<#lx6zZkFfJ
z?`)ATVz>B={5p{QAM^5DK5O8G!9L%rw?^Cu%R9ihe-MrM-Z5jG#j?fKr|!ik`WY^0
z-ifwHf=ObZdSCS7G%mnBR7mSaa#|vbZZlVKQRtHL)GiTU*mdK6wUYH!rbI`JIOE(2
zCkv6yul-W>CG}~0S*D3>7QQ-uI^>7Ge&E!6@x{<_3B>ye#P9sy=T@ynzkd+(ul(NS
z^~6tMY<p`;$djX;Q`e*K(*{iJP&(EvQLREfvq{ltRv=lU8OlWrKAaa!>!gzCD%VKa
z3v@<hrwWD+bSi4<B&K1Sc}YWDl0m~jyy`~tH7v_56{v#y2+lv<B<8b;nD+wosqbAb
z%MrxieqqW<3#UmmCx|3U^+Y=khu2GVD>O37rf+H4qS7^TP&mW{T;v_TrMnW{q4S*d
zit%}JIGKG`g+<AHCJ5HR99PR2U-0F*`KOyY^w%aGdSB!GkL7aK{-M7VML#~}<}n)C
zN4EanaCpFyTG2XHMTe}j=-~<(8a}iR0vFI1GV5=6(P*@0DaHUsw2<IR(F^JEk*4U_
zZ2eMxvB|ILSOh6k?%&LQcy9X`uD4;odjINwGHRULm#i53?hqm8sp&195dQTkH65B{
z=?Mz(O{oAMa!n+eD6%)yIP1~k5NHvh9D)iv08UdvnrRSJ0AeNEqG}ML>IBXLrMa%V
zWtL>ybt86m9tby4JJUQQaK4#zSMweI#{=w@c&=||dsF}W-?v<!yGumTgHv{%9Pga&
z+4QJj$Sfsmd(ckTigk$J0{x4+P>NPq2tjKv8l99PvAbJX&-*UvMACC=D<Mg3DK+i9
zL=1z$42gJpp>p9iSR9u5J9GaKsuif`!H_K(=RWM1ggy4r$&mA&txfq+2<F3EH)mkp
z8MH2+!Px(freGc(9qt`R+xO7YohW+SomT)=ib7X1?IlN(NDEZxsIiXVRcv3SQWq{8
zb5SM_3vTgn#TKYyw}6EzDfHf~m8snNAgXH7?lYs1OdW>Mg$MooN{Mt%2QwdFeP)1l
zEY%UzFPlmv2WzxtVSO*jq!JYn+9Pxx1$#uHu9LcjVv-7lJ*6P$Q~ZMdWNDeeMbz*S
zsk}v6iB{AvvSBe-W&|SSQ)Xo$Z6L6u%)Qvjja14)O5+2roEMwuWfwmZtL<%}O_1E0
z7x~=-ajpG1tak#|2ME^x`SxE~wGjM)t>1GH{!w81KkCLRnEv0MvGwHe^yn!1HuBv$
ze!A<?Rd46`-OAlcV6%m4_+@l<Y=?52yxU8$UrT3b=oXGyg>P=g6n|`1{5ktDX88Z>
zFZmhX9i%BA_OXKe*u2C`y!nG^tZ=@~E+QN4i1kn_94#7j4AHqkoTU;Q8a29>1zI{F
z1w$g&aRivIZ)mM}S{Jp@x&Wh^TQ*Ih#bS8gM3SK;VAsK#ydt*$+1$j5<;-s895dh8
zN^V;z9#$4E2XrUA{WrmDVMZ3Nzj)6jW5qK8IlLXdE+El|XLe`_^DNw2Np^_en{X7#
zjfLfh-3yyrc-)e^$}KpzgO)c=(k(m=X7PExiYd1+wU7MJJ6A3*f6OuE-->0&{nl3@
zIh#ho)BWRvy}js7cOyN!BQk5|H4@jZk?2L2FbuQs0Y(A!i{uQxyF(7!B7s1)Rr5B%
z-AvWEp-~M(`kN*#I?}j8otImeb==E0+j3)E`CW`5QS6G<*wq-an3kZDpRy$fvs210
z%(Tn;Ghd)uUM-Q=H_!ff>bPGPp!!X(Exsw1mG50Z_1{e$%<1mw(ebWPzUYH0po88N
z+WWNRkR#G5hIFFW$Q%#>p=njkk&cNr1;7FgE~LD)L;`7ss;Q%(V8Y2ome1vRHD6XT
z&8C7sgRFHiemu~__R<hEX>YP`LXUfX$d!G1lknv$`&9(oT=){eub&#91Ji7oy)t%b
zQ6OJ~FKlUL1((H*05UhF#Z+76PL$=<nml8CAgha?)kWzaY%2ToCSP{n#FzQl@YYu?
z#|H8OpPj}AXYmB*dW29e0ACvzd&iKCb?5}Bx-MF<SQNa12rdv&KyRkac5b5<oDR)w
zinPf6E6a!NdIn3gjn-+j2`lX@j=hDC3VLKexq-zRAU$EvTNkxHHpC9kPdz-^`g<Lo
zUwqhl{}9jP{nP!ODEc0<bqHPb|4=4Crx_tr=rW;vm-glr9JK;j(6*8e-0dl~twj%C
znJy&_S9`_hjOU|RvwsUX_KtZe`Pp;3C1=n6UNC##PVn-IQ2OZ1U@amfubA%9i)&IU
z<FTY?ZAUr3pnVOZKm#A#DPXBLve;=Rzc<4#Oken;A?)>h!&FBjddCKN6?POp{Bpm^
zb$H}YM1RLk@UMJ-6#dEUk)IqL9Ka*tkx%D=vQJm0DaJVEJsQdheK&;)9H=4j8(|e1
zlPiG=kz1G<PHD_ZmS36M!ZJS9nQI}yOw3!@<@SF2rjy&W<e#==W&r1R=Ns0(1#rIa
zsrw#Xu{Qc!KK2n1^HrAw*nP97Z^5D1$J>rensbkik}5ciL-pv|qOD5>Apw<1?eY?D
z70d#@hPE^SIw=*J=c%UE`W5i1i+nMz_s!e}dbj=Atwu3fNjxl3G0QT?9l`^!@v!M<
za{R>TgY3K6$rQ`c)bs3jH^sgOS1uF$&j9n<tRYTgAD?Ym-Pt`jI^DM&alv^b8q{i0
z-EDv@DvM~!aD1sHzyiwf*R*}87VtgbUD2n4<QkLaRF0y75h{$^j=1wU3%kw3ZH%^{
z*hXC(`$~B3>FLo3iRyolJC|j~UUz^*Y*ub(_Fxyc_bYQT&ul=kN<v?5W!nVJohdbG
z?47gCumPIwZA8-@Qe$Rl>S>sonXTDuV*^?4uwBHCU%qjZhwD@qS?*aL1iqo85E}c^
zyL@;+o|^^G)M0T#%*wlW255?{S2#4kJaF^r=>5?+_Wn6H_jZntkE5sH2457ImrD}z
zOI{A_c)pF0FnZ5C5I%qIivF|bCkVMf7$Wq+Ip1y*LgpW9#MFW^NqXng9=8G`b0u28
zlq$}r{ljpBW$;>rmpthfcG$Cs5PH=bgu+Pr{OcV;-K$6c_A!Uh*D&_Vtr>@oj`j{u
zqaBkeg+^5?<e)7I*hsUf0jPR9k)+a4p`8YNC};?sLQ|C-EyJ#Ddd-ubnhH7}0_$or
ztW1qO5ME+Vx8ArY66aw+$YW=m*-%#;zUE<9(C#i>u4lh;O@H8(gRcLluO7|O>-x`N
z>|f8#@n{cCd?W1Fp(7H(NSvm0Y*kk%D3qqCsq#hZ@o5b@LN>aoTA(l{+FSW$bNH*i
z{NIxW?HwB-7R!G<5%ZsK()DcRZrxuG@btmr>lpj|5}wC9`>uVZW!<Cy1U0KvE6}jw
zP%l#Sl0oaWN_G-e5M=pUx6pqb2de1Ipc9C<rQoP97Lwtq$YO+Zu~@kM-|;9s#$uOC
zIb(OykR@C`ax@!g=Z@vD>j7M;*0s2egwE^%9Con|YQ35JH{d=xg^c>*K=V_ZLhts<
z?$u`oG{+>K82cl0S2(isMPn%XRN>?BrniP#gg3OQ#}5dzB0tY(x8>o&9<R0Y>T=}w
zZgV3$@1C&pja#FWyf(|?$(erRg*l$aahekEi-J(&u3o1NZ5x($6LXM|8;&jfAqROr
z^qQQ$F%`COWsfCnyvD~)9zcHnr74~lXa}Y%&Hd{ELA|+?3wZ4kK?ifctdC4MV^kvN
zv~yU~T|%~i8-){Nx;9vwGyg1CArMVT*dKf75hsiEi*D`7Y`K%??$n}uvRE)5<ar#A
zhe^1{Fpc!%@*+piPi<=b-!p0b`y}wkua9xvH&;J|u`kS>=gG<O$)WA8c4@C!-=|1_
z6Y4>vvgQTaEYw<Qkt%n{nQ74}BvB70(jp4lh7Fai5;_Y3sWs{ds5!fg*`EGr`zo1>
z%x(?zK*YEjf)?e4057u(d}4Q$k^gN{6N_aweAM1%ma?0y*>83qmRVzT5!=!-f%%&&
z+f~2w$zOeR#lFx725Nrj`e^H(ngsA`=G3%c+Rb9?K}#)Y%7F&vHWakb(Q0VLp4lLQ
z{(qX7Q|>G}u9;`35gd7y<$)_TQ?{686Z2eOl5x&rX$k-Q6O**%H#bG1cx5Ci9$D5&
z4`b|~%#X9&-`hXjw~>gYZNY>DC_F8}Oq6i?5{e0B<)Wc-jc9s0k^|ikv<EvSfGn-0
zpz};LxT%3;CuqUXxXt$b+SK~jN|BX?S7&#alPiZh_3WD4^hbC;xyf-ZRyxjyA6a&s
zgz?+wM=)AE%^vU)4zrQ65k=kURF|TMq4NfuQ-Uc`q-c}zx<Nw{*m9&oy-H9GHT%F7
zfbPLwr5c&^OMJ;D5quCu`80;)vp-i{y69_GVfO5NauYl6UdhhKSFrOlk1UlIcXtnW
zkN0is_EP+7;ThmFbzP!nh9;ycSO-i|dFHLC&u_%d2hV5WIhnQRW#&s6fqw9n|M3Tm
z+RPkAvT8@k^))*~$8N`G9$D6%gz<fIc8++i!3W|V89AMf$I%ICp!VrhqZHl&7&A%j
zP&x$!E};<knr{0X)3zjsI<B?SEI7b%y8V4#PF(#YvMT7}h0<z%cRYCr=j_nAzUDx!
zQFrQ{Wqv-s8%6J$CG2~LCx<)s0NajyWsP#KED_+7f(|NT)Fti;S*A=%Mmw7zjygb2
z`|)UN4%Id2prbnJ;e9&<B_Jy=bEL{t$e%AD?Ufa4&h5#VW9{9AJO6Vtca^?}?tEaQ
z?z}bu^g9l`&kuk;5&cv!_EU3%KRMky+>3HLON1vyA>j*Ur4;RaVra5y)XIy7qJF~5
zqyV}p94b#Gl)#Hj&F2WMxC}!5#JocGx$}=F{M=;r2UgmIv;W6)^L!Drzk*M{_{*CU
z%|2T*`#ZwfdzHMiyR4Gmjj?|=d-h0)Pj>8f0`v%VN@pjaOC}QZU3m+u;z}|E&!lY%
zgi6sB3BFGxLa0uA!~=-Dx~NebgS;zSWGyUV#@D;#!iZLTn3u2F+fu?}VTWRS1Y2z7
zu{$fx+(0Y2+&cN#AM)wWcCx2r(NZ6?-!pSv8Dl%9zF-c*%3aMr^QU`$5Kum{P9@(x
zQOUlPcoKm5qyzIYjQy)Qm<LCP`zO&2+V4g{^7TOKH9$%Oq!OyQt;MfZKPjK|{Nm~D
ztGmL0@{@C)B-Z#OF$B%Wc9)9_1n-Z|tkOYgg64}sPt*z-N`>?UV@W>LzJ?X8c80;q
z%(=q-b9n{Hi?i}iZu0T>tPGlu?=FiF3ZzfIFvD{Unz}=vM5Vti6D=CFL%A$!6b=AU
zS3(stS+Nw|VWmV<bxamTA{q?S86jvKpht=^+M$`WH>})<o!k!^M!tsN7T5WS<|{E+
zhfj5ZPfUKQE7m-4$zqK^f9u@=LH|ZHI@6z=6Vy7+k0NYb1<38p9@1xXe{y1(+e5YR
zXVsa#LN4zg7Gk^8-The=);EqRhr5`&T1{;K-wYp|$Iq{vTUR~%inr8yZ&{B0(%#a+
z2*|xoc2BIl#T?N%FVH`!Sy3WTqP>o9i=vdY4LV7YYH`gO3RFp2>x3n^AW_wVHq$K%
zfvISUqGO$4lLgmaWX`1P+)`I6){z!tX(kkAc`y>&nzXG_TS1%I2;%E!7m~NvR;CNT
zw6|=jgfW{DE5I{pIm#u7A)HF7@M?6Xq=bWGsjPac8MG*%CPkg9Qh|ghz0%=jT69!7
zAYqGsAM#z6q}!F{mizxD*ew>Oupj%VoG-FL&1bV6E+eeN@Z_|q3ng~Tk0ieWo{#vm
z^#?qkh*UI=sX0IQcTY}EqZ{|q`URGlg~-tTbmAMu5>!{Y>@{trM1_E~9a3CaaFNus
znN*~zZNXD$A_)yR9Nf8Ts_UGa1vv{BcjVRVK;GcP=PsnmOz?gG9I|`Y__lkekhw()
zA!HwzQ}FgeHU%V~OlI9H`2R7))kR|QDnfdeJp{<!zYelHCy@CSqF>otZq@zp{?aDM
z-TmV|pk_)?morQtDbWLI+qz%{FQ6B@PSPGeg?Mp}_Pd%WSz4@RU)gBk@gUA^#nm-G
zJ&w*PP;}kexYO+AlNyv)(*Hex(<|w3?JZYG_YZask(7~=zCB3NxgG13^a_*9SG-#d
zZCLgT?#*Vm1;@O(7nu1AS5wm8S`kkO-nY+<*+OaJ$!&pAw0+ua`-9v}o7cb^hZ9|X
z7aR$*;dS0R<_)9X(tqJ<N}8;Cjwf0FY=5q|baO@~`8S==id$M$ioPa(6>Whs0(1|u
zVR%d4a@3rAp<C58yuz&lca<H2I8V`pLbeU(S>FoEKZD6FPtwJiO%SdQA4@@M{mU!q
ut*y&d@Ba*Ga5RY+ZU6uuiwFb&00000{{{d;LjnLB00RI30000000006cpcXO

literal 0
HcmV?d00001

diff --git a/src/rseqc/rseqc_inferexperiment/config.vsh.yaml b/src/rseqc/rseqc_inferexperiment/config.vsh.yaml
new file mode 100644
index 00000000..184f2c10
--- /dev/null
+++ b/src/rseqc/rseqc_inferexperiment/config.vsh.yaml
@@ -0,0 +1,76 @@
+name: "rseqc_inferexperiment"
+namespace: "rseqc"
+description: |
+  Infer strandedness from sequencing reads
+links:
+  homepage: https://rseqc.sourceforge.net/
+  documentation: https://rseqc.sourceforge.net/#infer-experiment-py
+  issue_tracker: https://github.com/MonashBioinformaticsPlatform/RSeQC/issues
+  repository: https://github.com/MonashBioinformaticsPlatform/RSeQC
+references:
+  doi: 10.1093/bioinformatics/bts356
+license: GPL-3.0
+authors:
+  - __merge__: /src/_authors/emma_rousseau.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+- name: "Input"
+  arguments: 
+  - name: "--input_file"
+    alternatives: ["-i"]
+    type: file 
+    required: true
+    description: input alignment file in BAM or SAM format
+  - name: "--refgene"
+    alternatives: ["-r"]
+    type: file 
+    required: true
+    description: Reference gene model in bed format
+  
+- name: "Output"
+  arguments: 
+  - name: "--output"
+    type: file
+    direction: output
+    required: true
+    description: Output file (txt) of strandness report.
+    example: $id.strandedness.txt
+
+- name: "Options"
+  arguments:
+    - name: "--sample_size"
+      alternatives: ["-s"]
+      type: integer
+      description: |
+        Number of reads sampled from SAM/BAM file. Default: 200000
+      example: 200000
+    - name: "--mapq"
+      alternatives: ["-q"]
+      type: integer
+      description: |
+        Minimum mapping quality (phred scaled) to determine uniquely mapped reads. Default: 30
+      example: 30
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - path: test_data
+
+engines:
+- type: docker
+  image: python:3.10
+  setup:
+    - type: python
+      packages: [ RSeQC ]
+    - type: docker
+      run: |
+        echo "RSeQC - infer_experiment.py: $(infer_experiment.py --version | cut -d' ' -f2)" > /var/software_versions.txt
+        
+runners: 
+- type: executable
+- type: nextflow
diff --git a/src/rseqc/rseqc_inferexperiment/help.txt b/src/rseqc/rseqc_inferexperiment/help.txt
new file mode 100644
index 00000000..f19aa318
--- /dev/null
+++ b/src/rseqc/rseqc_inferexperiment/help.txt
@@ -0,0 +1,21 @@
+```
+infer_eperiment.py --help
+```
+
+Usage: infer_experiment.py [options]
+
+
+Options:
+  --version             show program's version number and exit
+  -h, --help            show this help message and exit
+  -i INPUT_FILE, --input-file=INPUT_FILE
+                        Input alignment file in SAM or BAM format
+  -r REFGENE_BED, --refgene=REFGENE_BED
+                        Reference gene model in bed fomat.
+  -s SAMPLE_SIZE, --sample-size=SAMPLE_SIZE
+                        Number of reads sampled from SAM/BAM file.
+                        default=200000
+  -q MAP_QUAL, --mapq=MAP_QUAL
+                        Minimum mapping quality (phred scaled) for an
+                        alignment to be considered as "uniquely mapped".
+                        default=30
\ No newline at end of file
diff --git a/src/rseqc/rseqc_inferexperiment/script.sh b/src/rseqc/rseqc_inferexperiment/script.sh
new file mode 100644
index 00000000..c425b6f3
--- /dev/null
+++ b/src/rseqc/rseqc_inferexperiment/script.sh
@@ -0,0 +1,10 @@
+#!/bin/bash
+
+set -eo pipefail 
+
+infer_experiment.py \
+    -i $par_input_file \
+    -r $par_refgene \
+    ${par_sample_size:+-s "${par_sample_size}"} \
+    ${par_mapq:+-q "${par_mapq}"} \
+> $par_output
diff --git a/src/rseqc/rseqc_inferexperiment/test.sh b/src/rseqc/rseqc_inferexperiment/test.sh
new file mode 100644
index 00000000..ff2e870c
--- /dev/null
+++ b/src/rseqc/rseqc_inferexperiment/test.sh
@@ -0,0 +1,72 @@
+#!/bin/bash
+
+# define input and output for script
+input_bam="$meta_resources_dir/test_data/sample.bam"
+input_bed="$meta_resources_dir/test_data/test.bed12"
+output="strandedness.txt"
+
+echo ">>> Prepare test output data"
+
+cat > "$meta_resources_dir/test_data/strandedness.txt" <<EOF
+
+
+This is PairEnd Data
+Fraction of reads failed to determine: 0.0000
+Fraction of reads explained by "1++,1--,2+-,2-+": 1.0000
+Fraction of reads explained by "1+-,1-+,2++,2--": 0.0000
+EOF
+
+cat > "$meta_resources_dir/test_data/strandedness2.txt" <<EOF
+Unknown Data type
+EOF
+
+################################################################################
+# run executable and tests
+
+echo ">>> Test 1: Test with default parameters"
+
+"$meta_executable" \
+    --input_file "$input_bam" \
+    --refgene "$input_bed" \
+    --output "$output"
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Checking whether output can be found and has content"
+
+[ ! -f "$output" ] && echo "$output is missing" && exit 1
+[ ! -s "$output" ] && echo "$output is empty" && exit 1
+
+
+echo ">> Checking whether output is correct"
+diff "$output" "$meta_resources_dir/test_data/strandedness.txt" || { echo "Output is not correct"; exit 1; }
+
+rm "$output"
+
+################################################################################
+
+echo ">>> Test 2: Test with non-default sample size and map quality"
+
+"$meta_executable" \
+    --input_file "$input_bam" \
+    --refgene "$input_bed" \
+    --output "$output" \
+    --sample_size 150000 \
+    --mapq 90
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Checking whether output can be found and has content"
+
+[ ! -f "$output" ] && echo "$output is missing" && exit 1
+[ ! -s "$output" ] && echo "$output is empty" && exit 1
+
+echo ">> Checking whether output is correct"
+diff "$output" "$meta_resources_dir/test_data/strandedness2.txt" || { echo "Output is not correct"; exit 1; }
+
+
+echo "All tests passed"
+
+exit 0
\ No newline at end of file
diff --git a/src/rseqc/rseqc_inferexperiment/test_data/sample.bam b/src/rseqc/rseqc_inferexperiment/test_data/sample.bam
new file mode 100644
index 0000000000000000000000000000000000000000..9b8d417c8cc1651725269c13a1c915b08b2e4d38
GIT binary patch
literal 5595
zcmV<16(s5(iwFb&00000{{{d;LjnM80fmy^PQox0#*25wm)Hxe<5ULHs|`qyWSi3o
zw@dd2T*6jd8#LbgV7{4Qz@|9#?rYEK@9TGR#<tt}yh6yjo8qO%fDCYO&tf6UBrCW|
zyH@ak1CO~+FrveONdP+@qoZ3o>ROL8JfAYa&X{eo2(a(4x#KL{xo6|RWh#{l`wJHF
zG8Rb+UCXZ?<XMsBd`q$KHG1hWN?@p$qdwq?Qx`OyziG16_AqHATybN?rQ(L<rHsXn
z8ncNV_5jSjY4%M5p&hu#(+<LQT8KQ0$*SPzh!-O%8cYbJx+LrOe;R4scnTzWu7udg
zeV|7BKf(clD%Yv5?XvV$(}PH>!F*E?$@6n6fpc!H+qhDcO4CJy-SVtVlLK9pDosel
z^VV|IVoooa6FAt@UQ4X!YKCDo!o4C#m$XQ}ed3qd%|$c%r<opgI|!j`giy1n=tCj&
z1x#_s3g7|&03VA81ONa4009360763o08kXITW_c>*HxdBm&7DZ#=Cd+dEI8Pof!w+
z#1ig(@BVGm@@DP?C)H@kgK8v|NUTC=YcQ=?Xd!#t;wB9uwoRaZNs0X+SP=ZsekfS6
zMub8lhF6J*p<vNQC1~|SD2czd|IC@0bKbl6y}o(xo;zpHo^$X1&2O#sTWjsxEfRP9
z4!+pE_wz;aLh@|lkK1tVb$q|?p@;Ui_m7TtkM22lw7-9tJbG)AXf3s5idk;@&Tvr|
zmC(HJlvKSbTGd$I+TNC3XNsnhMK6k?*R8c(*>+uB)~wY+wnCIP&-1iOt9azYS(?!}
zu4MF*=arwArgY+_rZm}~(<K_FcQil6v<#QC%zYBg&M}r(>C%0tGx}K>z2Y20bUQ|H
zg1Jxb9Dn7>bH~X;Kl95w$<IG<yr?f;EEm7_kzfC_&;HZ<e(R&h$zvZozT@K`KTbaJ
zME&5$p2W4+N4R+`FD4HsD}0x4zy0<amVbCtl9T{NwU#p_7%z&dFL*DkDUG#UbbV7-
zMpe2pjWzWJ`c2cN2Z9!s(OX&~9T~99@NY?r!wRufhiClqkmXet-lzWN9HVOsK2u*j
z{yf%u=GNQZAJ%*GYQ4vwzdul?zadGuTkc~6bzaBV+f(Z7?Cc&MY&-5SQ8%V*ODRB-
zs;qm>y22W6MN?NonT8u#T3HKedsZ`UYR)w)bR$gH>9R6R6{a#mX`a)OM$U|=GkG^K
zi~emK&og2|o)04%ro}6H7Jpop<sM5Kr}Lb?stQoPF@`b$ciuzXA#4Jc%Mo|pv-sHn
z=9dOAUr3${U_N^$NiHs?VD26q9UUf508FWv=%uZdZcAP_wk=fMD{WY9Z6O#_Eh`k`
zQWRZlEHAs7_p<3QlT~%w7P?TCl3gWPv6Z`{S_S|e$?~N?cZ_nT=FK&L9_==B)4`(*
zwuY}9FDc&T7)Zn2aeD4X+$6`^D!}LrJ6qDF+;cgnQDWw|=cZT@oG-Wk7)|lc5uDW`
za`W{8&d&|pB)%@Dra0#2sgUAUfxoIYjV_fk!W5PXu6o_@4%B8s;ZCATo)Jg9HPX2|
zQX&if`-RiWJ*DV<<^c+>D32fyWXx8?%$-Y&T--?6bodB2g^ts3lTEn!KO-J`FfS&*
zlC1dpmA9r~dTzc3$7Z#yK|X+Iv{sEFNM+r~npqH47gf!>-Y`}-;Hz!i>Z;T&-Vuag
z3eGB922SSQUuT|+^s<ap4Ft<)FyvKS__t>ZKmPi3-R~Irx35PI{r#})RcL$*V}CvK
zZ+m-3ySt7<9p^2ptg4w1O4ia8bx~T2RWoTCCK${W1BGl`X8M95C`wx@&1@+dJf4z0
zD_PqC8SmZ(pEQ23tJC>o4^&9U)TmZuqDvWtJkLDm#N4IK+grE+7lwFIEwePT6vKe>
zt5?UN2<BTO4n;5t;P=lAas{Sg62P<t0s%q<Y>b(<mR$)DjkY}prhTDhA-J{$FGLHR
z;r0+lWUH)fJHc!v6@*EN1(1WuNdb_USf)!j8}G6mad5$Vz#$fRv+{&Y!;^5%43Gpg
zBmQXwo<4iITs@R*YMRT{Q;NL&>PbT5wu#V)!Qx#vt|D&?7T>+m3y?9Ghr4^b=UlLu
zfmcq!V^;!C*rrpsv6c<Px9&nf$}@2A?)k_T39|6khYm03z@XI6h@mr$q;rpg;)nlO
z3Jp%+kh$kBrg$)2;Hca@r`u8&bZ7>_`Nv~8ZvdQk`C#!&_Xap`AHjLo;*9{^{UbOZ
z8I3(MGxYtVy`A&PH{jo9##%GhSi}UYO{;6!*S+a=Uv#GGdBMyIu<LiEflpZVBXj5W
zwaYuVuT9px?E~a^&3`hp$7@~l<$vuT3W;bqIoABh71n%ayym|fnMf1`O|mkj|C_}z
zZ#Fs2?i#46PP3*^rXqh$Dyt^d1#@Xl>2wSXe;NF!Q`Qv4m)=u2#S?z-rE?lfI``q3
z#P=F);RTLAjm3QQ)=x#&-ZEOur{5cVz}7of(dn767>2QDW{KP0!Qr``<QumnNuwke
z7TN{@xE7ijVXM*@T2pOQS7>NP3mX?2q1kfFd7;`y8fk^ByH;q3o<g6R%=vYiQ>_Q~
zcptF))I1!?D}*DtI9jZb;yXSZeKuJk`iWVp=F$6epjT=Qax+zRT(A!A5c!!xl4}|v
z8`De1xHX7Fom92dN*5(JZDDJxYskd9gJ0!xi{cMu998bq&)kL9+=r9QIlwFpjxMCX
z14!u@1?MQUaONY?@+$E3#3S&w$KaivfwvfecXsh}0leS5eLei#c}J4GcN%`qZy)XM
zY`gGN3uGlN@yJNgvx2G4bcj23h13ou1PP(UHF+1#Y-f=Bva)AZpisaFN@2U6LRBq{
z&s9P~vh)d9Iw}SXVRpoo5r4wj;D=TkU<lZ`v*|eBM}HTl!ozdnDa}%!Ri=I%a9-q#
zIT`Pn;dyq1=RJ!LE>_shlNG}F#i?Hkc#<}<(!yA^0&<<?&`FG>CM=oNLLrQI3~n0P
z3|yCNM9GZR2>Bdkml_#PgESnXQ&){v%mrxt{vaQb&RMsAp=2yu(o!jv%Y(wsRv_kM
zf1YMhlVhgO>9RCS2VtHDH5EnEs+i+N!g3k&PVW_GXl@cmd?JqiAu=%qn#uh<NxqzX
zWHgpc9pm|PyNCOG31khjIR?i@V3@k>k<g*W(1CI_POG{ov@(iu-uJdJvh!}+)6Y9~
z_e%#oL%!eZ7SANdAX=+Siyd2>#H5*|!*dV17fil5<xq3$rgcUE?Uq#$NgiGq-DQ_W
zMyJTNH>H-HcA1CZurJlaA$1LkEEv*KHM|y9arphhN;rPiYHJO0SxyemDw=J(3r=l0
zrqeP~zXt!nQn%vFCkQ?}a}@wuvlno|jyxEd10m`}|0#s1r<f~nMG+Vzcj|BTR!Dbb
z&ftO%+aI&!9reZI7eSJrmS2das~bnb^TjBjZ`oS+U?1LEt9qV4fc!afU^bA;T6b+%
z163#?)H1E+2%D{yTya=nt6CJWV3W)!Q9(-E8k*X`4q>IZ7ts_YthN^yuCE@<Prfw$
zf%8h3yXFP-YggyMZVGVTH^BKq@_4cudwd4x{{GRyUh@3S;3k|Dl>!UJk>@qKsi7tf
zGLWt*xIhq)l9iAks2LY+hinB^Qhr+8@@u#<Jpjd{b5;Gy6p33$yn1B<#QVIg7z6R_
zR95`3K%90>%Z;<Lyvk33MKrLJfEXLtE74nhcxyeRk<l$@KzIXl^|#Y5-srj&D5h{>
z5X4y5(RBDJI4h1$gO$ot+G(r6m{47-d{HhB#d43v>7cv<PA6Z8P`-9j?c_%%wUel~
zKE&6()vFl0YpS<)_xE=9e7esSDSBNron)rdJ=8oLKe$$us1I{^e&qY5RLE-3e^6SJ
zJnNyq41AU1)R5>TN&pCk7p|MtMXiut{vQ9B@}YE@Q;79vnV%3V4KUG*H!ZHNI2`rX
zt9+fDgz<N$dMn^b<Q&kbp`Rp?PD)gTg_fl*5mt*5D!)S{l_>8S&S+)<#CxzA*+Shy
zyCPi#N%;&+gnmi}M!k$HfjOiCRkg7?cr8aD=M2qF?7VZr&WPr3+__#Ry+I_&&WxQ0
zM~B-7zD$aaSJ4T)SjhaMs0xU!mdmb?b)i8)q^SnADy7l)GH4k=!GOD(afO;yk4iEL
z+`?KCW7og5vO2P{*Npl73OHXmC1E>E^tC;pDNjUGY($fgo7YJR;g@FIT%ifo3fPq5
zNJd3tZQXHQk_p$n64olz@;bt{L7LE0KaC+xki6s!$w3PdV->C-SFLqa=)nNJFi1nQ
zAssS<Y68LfyQ_X6mkmden<u0B&W%;)?}>G8-m^@SOH*O8w~ao~zR#?<5U3?X%drNk
zUs+?I+j=WXtvaR=b##lui69*a)8<q~;kH8&RW=1xN_t3XR(Hy<>%z?qA8^9QhN5-m
z^In&4ta>3%+PriUn0x}}@nQvBq~;$bD}e8w#`FMYPJ0DT3l;J$isQ;S<ELT((p5-o
zfrkJq=OH7d<t;~6nZ*?kW|_vJtB3d0k19s<H5jYKWecyk)&&^<a)9x%<O>1D?_=y+
zGftjAcXV)+JO~&I7-yjnrVRsbsJtSQz*<Y&!RA}d3ZXdMW3M~7)K>HytVM!ndQp^I
zHNC)%N{hmDTbJWxdOaeEPvsold^#9HH|4ka&>QfK%tsS|<u~V8-hGAGbN681f3;k<
z@4L<>$$!nT+}++g=Vj(~gObbZ6nkPimQTpIftXq7!wudtpL$OJ+W^e(TwNfKN%8jw
zFh4iQOd{*<%)UJ_NoH0CEpN_H7G_dH4Z(Knjyj&5HWYC<<fcMJv_`Y8ktjP`4HH)=
z`9VCjTIy2Z6AC36-*U~M%+*3%yDkfu_-w@|{FyiJEG#_r<5|8E@q;KzM+ncF4xa1F
zkrK_TP4tg;{>_t;;<26IGuS!tFuKcV=Z>#4I6XJX&aV|aWJ#)rgh#aM&~w&xbs>)(
zHNQJ0ZiQNgPHu3WZnz3Vt~DH)7MYcAXsVBZ#0QV};4DXT@>t#Rozj5icTTeNt&Mhm
z;q3ZWqvtU8A2T~YIDfG1<9NqU1)Q7#hsqe$?pas%g5f(QMecWBR@duDHxHi>iPpAx
z0L)7p+npcyw}<cDVCQ!Y#C-1T%FZJ(31BfJrU#RViQr9b<3<YJ8bz%kCVExW65qR0
zTi(jf_JFHqknYf)=z~D57ag#q9=?Q^MHLZ^69k}aWvzohqb)Kcy&WsiBWhh4oof$X
zk(ifGBIX?vV!j%1`|^P03&{hcu?ObF+&_PKn7oXZ;^{zqDv~aCDMnR0&&A>WvWioD
zmDNKzK?Upkz`Tm{#p&`!8x4-XI9c5}@508b`-?eKu6A{C17|jQ64~Y_G`y0BnF<vu
z59Fs<-D14DGT6a`Kel>ypGj6@pP4?p{hghibLW$ne<Vpz#zo1g6a~{#SY%Sj7ElVd
zE%GfPk%%E>(5O!p5&{D48L4487)BvWiSSHEk8t*sHXhmKhc0UsLs$!`n=>V#^vO9&
zZ%$E4M<~5HL227_V2sl5PC0P>P?{|!&sOB#u-c8@G`|*q5Iw;;p!CTrpmfU^rRY<?
z_2Vlp4L<c<N%Gc=OM5%#&mTIUidq{rTc9J+cR`B8YEub;{0Nm`LQU{OGL)B8T?&-$
zbkTR{of=??smR+)iTWMv%*Y_>eIQPUhGvM|9*9xrt%})F8tQ587T><hV^2BunzLcL
z>v@uk&O*h*nQ-p5=g?QS%$I4{d`5m9NdC*bJeSWJc;jH7FY3h#H^TA;FzyeM6}~sj
z80WEUarOCIa7RDG1<gCv_DC>E>{IWH4oTw*+(U)5ZnUH=vgkHT0~duZsT6*T_|oqi
zkGqw;uW}_i+QgaWK{$Dce109bs;{X}-^+4MWVi7(@G~Gk^z}zhEf!xK9oIm-jX-?!
zKVRRp7yY(D%>U%O*Y^`YkFl-Al#qw}+ee{C--`xJ>`*$kEm5sPJ+l#LG#iktu^i<h
z4j(QHZY`@cy2>?D_5z(z-I;=;11(fdokTHCGq2JR*JRKzkZzjjUdLs*wF1>>9>Mv8
zlf-;B5%W=iKL76ZvK&GD##>WPdN^I8IYERO(-Z9^9A2-{t+2=_o4%!Oi^kT-LE#V?
zxF|ckrCH2&=sdIDa5+y7C#%n@aZxg#34$xYoL1`?pYn*@{J}{b`a35b`dH)q+j2c?
z|NWmxl3$#1^8k(PeP4fXBs^eAt!OJu(IM+BdbmQ4h7aw7zy<V$-2NL`G#0H{iZOr@
zEhM;7^g?>v(i9z^?O)1IxA-e`EJi6)9#3W;p8GyV=xzAd=wIU}qsF;)l@;UI9U|l+
zHKU~y!hbrYW<ZlHouL5Vlm_r2*F=(uB6~xPvmPxDg%%OYA*iqeU?B);Zb485h>dQG
zszHdV8Jq=5b6xk8+mh|~jri3?Ai_fZO7k&+^OH$;ZN4LZJiy+F=ark;(bRwMr`GFp
zH>xB#J7wqL!S>NPpB@z)nWg4!58Bz<@DA}?p?^^q#?TH6rD*R(V_B(~|LYds%f4fs
zV!foc5|Y%GQqwL<#Bnf~A(2imR3Y4sHiu<#W*#3xwE^{fG~`Rhc?>%)VNYXpa^$>u
zaZ-LX2J`O4#Tl4qMy<<B82k5R3g+Ja-noNh>t@=zlO&Ixxdu?RDr}`iuO*s9R-r;i
zjdcXCV(VHeb>nSgA<E?Af?GOV@dc_hY+#{E3Z1*XGF8|gL{%;N>ocd2Tpfncg$Mnc
zjS}fH9n5@y_0j<As#Hf%zjG>)0<6ix!}<itq!JYn`WvCkQLsl8>N;&(C?;)C*fR!l
zUf@6UCl@7yi>Tovgno*&678s8X2WK#%n3xur_9Sj`U3(_$~=ml+)1TuOljN@%6X}a
zUVif<vD!}?+XTt2d67RnkkHzn!+Hj=-cGRo>#u%k(?;;y7yld}{NIu3|3Vn6VEVs3
zW9#AG(f)q&2J+oGezxn;Rd46`J(Y)@!0u0|hW}1yr+z5+$-BRl#=UfohGFBFSNLu+
zmiVDr@#pwytnk0<m*NU<8l@>u$5=srY+m9e-h6KwD}rzHo5)sn#Cxa}i53kyhUnZN
z&QggDjT&3)0xcbof+LaZBmzv=H?&t=)J3hVEx@SeDW9g$W-&Z(BFWGa@cUq0UXl8L
zJ~s(sIrD$axypP~FS&iCc-UFE9?*mEj&DZC(v2)bfAQw4j1`wg<cM~7--tv{&+O0>
z<~6vrlI##)C*i2rg{9|*|6ADH!xOgLRbj)qAN0Hll5QDsaGTHbO-y+TOMB*nk8j*w
p{{Oo8K`a<N001A02m}BC000301^_}s0stET0{{R300000003G?*<k<x

literal 0
HcmV?d00001

diff --git a/src/rseqc/rseqc_inferexperiment/test_data/test.bed12 b/src/rseqc/rseqc_inferexperiment/test_data/test.bed12
new file mode 100644
index 00000000..33a46951
--- /dev/null
+++ b/src/rseqc/rseqc_inferexperiment/test_data/test.bed12
@@ -0,0 +1,4 @@
+MT192765.1	1242	1264	nCoV-2019_5_LEFT	1	+	1242	1264	0	2	10,12,	0,10,
+MT192765.1	1573	1595	nCoV-2019_6_LEFT	2	+	1573	1595	0	2	7,15,	0,7,
+MT192765.1	1623	1651	nCoV-2019_5_RIGHT	1	-	1623	1651	0	2	14,14,	0,14,
+MT192765.1	1942	1964	nCoV-2019_6_RIGHT	2	-	1942	1964	0	2	11,11	0,11,
diff --git a/src/rseqc/rseqc_inferexperiment/test_data/test.paired_end.sorted.bam b/src/rseqc/rseqc_inferexperiment/test_data/test.paired_end.sorted.bam
new file mode 100644
index 0000000000000000000000000000000000000000..85cccf14b05a885509f1a1a2945ead6370bff9d5
GIT binary patch
literal 19725
zcmV)uK$gEBiwFb&00000{{{d;LjnNsOtrlWxGhI@Ce}wUbS3%Btx|2d;4pYsPa_wy
ze0BCdZy}speHtivBrJ0=0}QXr(Ul{DB%&?A<B!CuN_kv1cm|I#&PNiDFgC-CJ&yD6
zD}fA7usz{(VqPEEco_3B_z^Rck4eB`Fot|<t*Y+cz4v+DdtK7qrysTZocepcYSmh+
zYIFa}nQMyTylu|B^hI}1&TXH$@I7}QJoeb*4?g_p#V0P^bpFEkp1JU%yYGL=WN*5&
zy>)JK=Dru*J>A=#?%j0$#V<T_Z*%wL%zgFUZ+Q51lQR$8clW*b-S>U>-}@qS=ED7V
zKXGaH#F+=a@9x)KeEi_C2QN)-I{yHE;gN?QefW`!Z=9Za;6>f>OJ8*N^xS0UJ0IWM
zoSfOeue~w;&Wk@Vo;^N>ht2MK@Zu8}?|SIs?1_ta%`QGZJ9zBP)4N`{Z(g%LnQU!t
zZEbFyo4m$cxIdk}dGea?zx3#1k34*E?x9C74j=KK-u2+4-D6%eIfoa|eg6+0({b8%
z%mbQTeB_D89(%(K2GkutFgLi#xe1Od-ygsE;Y)8Bf9HkQjoSxbe8Z#XW)~kBKK0yW
z_}un**>h))J^sY_J0I&F`^Jk8KYr;!dirCJKXK{7bFaJj$kN-dyZFdWD@9S<Togt3
z!iyh%q9`m}FN)#^ilSim+{;&r_ZIJ>O9g!Ai$zg9|HUufTHoH=+uS=h-P_*YEna)3
zD4df{GR-0n-Ucp=s)Xa-YN>rtjjkhaqK~DuLDiL1UMS^V6QeB~YfWib<AiL4DC2lM
zUaeNE+{W$E>Ka^Mt*SNn7>_IJx4H@k*mV^;(=ptF%Www$S65f7wQ*Igt>KfP_jq-6
zbzH5E@FyI>?^=V;F?5GN1Fo#XZyL`g`~Q44Jt$uM!dFa+7u|obVlK?el?N|9^owu%
z!{<K!hJ)hZk%Mn}^wERji8q=D9+}O`l`r;iBP=fzFE2WLN8kMBHy5yc$Mr=~MqBD8
za;632N>yHQFJdS|j9ge>n=0taRiTc-oQJ=3bwohGz}Dath6rtKJRYx&*Ty3l-0HX*
zjd6_aKZ0yrAsp#TBSdC#z}K1!`|o`4(nHstx#@Xnyf<{?-GAr3iFEumMZs~n2QBG*
z@tUIe<~-?4CY!rE>qt9Hm^#>|lp^w`Dvfu{su*|_wW)*-H4n0k(g+znGmHnrxns)J
zB3SFnDln}=6@+$t42{Ov4w0y#f0i1Ie7yYncnv6FoNsk_4I6wP$O@0w*2aV-T!-T^
z{Hv<jWdBQjC<}98b|=sdV3V*M^=RkLmA{?9d`}DJdyAh=V7}|xqPVa!59a31-rjEU
z#xq4BH4|P&qg_*SQ^!VW<FyOS#Ha*gx?xH)E`_p9h`h9hds$mkM^>4pQBLVfOIt~%
z&LW!Q3dt$4R5c#aF;Wz=8nJ5vJ@f4vb|0^f*H+i6wbiw81%x?X8;{pkkrau==>d2J
zJ0aB~bnpP+;I$Fl8WSzUYgq-#{Pd6&D}eK(&F^PcytM~swUTM`i!Gc#+0rJ^>&iSU
z_G$A(Nb#s`Q)&}xS85$ZP>~6)y{oycgJnW{Sp%tz*MLTd8{rt+DiBMxHl~5Y$cd!j
z9I0u%nnV#&6WnNt5jv+sAUF7*PL`4^KBeuC?Ig6x=4kW(?a?8Dd7*f9(b4Na|HeF+
zM4O+xz9^!LMrmf6COD_-0FX*kOT%Iv8>cG6tq+Wu+65MC99;#n83}F;1$YuxYokPy
z$n8j7X@H4bljtW!G1rhS#|u<cm<#(Km>>7eJ^A*5OhX@Qhux{hZ(Lgx|Jy*mZEfvs
zZXyj?&Kp)mZI}>R8X1&PWsHVJCPU2xlMyZ`*)%M8#bUHFmfEpcO6Hl-(zB8^HZVrw
zEe&J-#de3o*PcjWwNDyJ{1GREJ_MRX%0nTBw}4skdDw3aH7DtdYP7bRsdQ}(<lC>E
zj)pRr-{{d$1`_~&-hd%HFawj0#YQp1V&GhR78)aM$z%*JdLEhd%1I@-i;64JM8gDQ
zLI>ICC>twStfaPDmeqI-1k4yL05B#-tE16s64^*NtD__VTU|hGMFdH7nM7e#jS`v}
zf8tocbzF@{bQc?<)}4;Jx0LDf*N!tZZkjVRva)#Ab)DwT%HmJ1BLk!l=I-X!<`k91
z0K9S@Ja!a#BGy)yOd46Ul1Y0$Aw?9}O80S(7Xh+#N~(hlx(aL-?2%O`Y7;^U<slFo
zesLA35H$qq5>hPqR^TG`L%VGil@9a(IRC3YoY$BOvuBX9c-cJ(&RcqLK4axe3A%fG
zaK5s44UYS8ZtrbPHi{2jUlapoHH_8KggUy=I3vCB!8@;Ps61CJbbwvGwwmZ^HaU3Z
zP`Lg2;ll0L=f=EF3bH@upBwPw<&OFAKl_T1NQ`qZo=p#4dBm8n?T`6?@3BZW3hJU`
zrN0>HF=CrB^tQE$(K=Qu9V(F5U}YJwx|m>1DAA6oR>z|xN71qdEj}Viffi5tyFrnS
zS4VJ6>KTmh1+rZ+7Y^R~;H8J&aOUr2s=cur%)wjlPBP%^&7F37dm0S8xxnN8WMgY*
zcRDFPbYoG}T5=H$_l;9VI2J^#$`D{oCTOc1V>;HX6wU`0dE{K_rj|iQA&qT>3$;`3
z#Ke4(PABO@Y(Ka_KW3AIzc(QMnLI)r$(6m84k<n%b@aBPL-dKkRE^O4<r|BlbWYj8
zbY;0<mPuoMt*s5A7P1arGR9+2Tv@4&blRzshekycoe3fsD;v$_S<pW)<EX&MLHh(~
z26Z-wJP>Rs1JQD%>2C{CR_k;EA1FpqqQWhh&-HqofQtaU^*(sF4ZvIJfp^==eF?nB
zZdp`6w|+}e0BQEX+gRV*oUEhzF@l-c038J>JX1{DU=?Skszne+No5pwAYC|%HVErk
z=~)y)HVmK?(Rxr-Mg*FxqzMU#Ku``DkX9`A2RlbU<AEINY=Bl_gI1xZp&5kQAJtTP
zd8nRN!I($?0bL)@CNsV=B*t?CJa6mad2Z#qS32ynT*|f)VEo(jaw*{nwo#OkG3~Tb
z(n>BJV_<4V+b|<EW5P04GG&`+ovcO4LUd(hTsFcqA=bjw+A&wvPBT={V=xDi=#abV
z114i@;BZ)jsT>kyn)N0SQOCE460sr?g4YFgH|lA^9}uLMM%_DS4jBm}wDZvzL*g8u
zxy(4?bH>ppG9|7S1uyR9Me*~+rQS7YeKe<=yW3lZG*X+uoN@q0Fr|-7geq7Ot%*!j
zMk%L*W}JH;Rgjj%HjZROLLL9;WY2)?C%c6x2`LE1iqm4G7Bn%TC)nXQM}&^3I?y?V
zsNuL_oY{cJVO2mRFYlP{&|v}7X%Ovo>7;cy^AKEmrhRnA)=?TJqm#PkMnuhH%~X`m
z2i>?BgRKJxffqIOjuxCxNE0wQ!|6Sl$><Nj5d&GE`~o1*0{~+t11|9qfdQ5veHBF-
z9s;67V(8$?Mqo0z$yJc#9DHL987|4N?LL*<Y%c8o_Jfxm`VRS1*>!bY&l33UY(U?5
zc2R=8>g<Bob7N<FZ)*?1ti5v1*~Xd>t!JjOHaZ@(ZKC9wJH{H_gqk~TSkR(kLPukm
z2qjZSN#`6_+Lcw~MbCh~8tsTD<y-T=FirZ}hWE&T{@m#V*!2m{=eKaaw|ITgU3>ii
z&h72Jovq@j8;Syi6u1JF=7GuD)rQqE2*zx!xZo^G$x0r1*;v)s$Yc{a`TY8S`62D_
zJ}3D$wAtj~wF4;jKRJ)YnI2tzat?^+l3CFQ;$8D*#gzha(lL#e_Cnvv@mORAI}V6G
zgMBhfD`2LfN&}`FxWW^Iq5tiqgAdL$qGp1NpdDk@LU$cOSaIcDl$uByZL35v$-4%V
zN}A}Svz*ZA54m@I;&$kl#zQC<*=y)K`5SY-lWcFjlrKuF&+wvn#=O0?xxKZyMbmw*
z!J>Dnwvq+weB@F4s2NjbV1`TZ&#_W!rGsvwb`H!lucZ%0NzGwF!b-uSkL>(a<GO4s
ztRDUydQHhOgNLK^yXg&*TE$1qCbR2TPUjrX_7-3_Bu>EiPv-5dgeMSZi-s{xkU(@&
zI;Dk^r7OAgs&pn;BcfDg44gqvrG4}<2*IprxQna_(J2sOG`2iKaLKLp)-vdFzt7_3
zY;hdk^W-fN=K#%R)Y(V#&KAw@zqJ$o8O>`%QA`HZxwE&szC&)($eFT&GZk6sm8z78
zw&Bt$X_N~_aS?+pnRYRlVCo>P(~LRBwQ|yPX~4i$F@iC6GUB|vmP7;{=lOkm1#Z%d
zYZr!4w<4PISTw~_Gy%DxpA-=Oy#Z}@XlfRuQCf3rgQ#OPmb(&I*mx~s)QuGuu&t$I
z9@f*CZJ6XGXV%FkIv%xjEHuivY@sIxB*TDKMbTDEGlQ<pL*E18bnQ@elxg#LG{1GJ
z*ZI%IB5j@<6~(9K4U?_)$>#1h&8)Z(N`NiL>Y$m9At>#96s6OaIl+Z%f`|g_Kp_|h
zFA9$~DlTgUo)RBx#*EbgUHD5!b(*&10mnQxIjzyJfKya*C=iyoMEQHif!Uu}-MO;A
z(gBxA^B)x*z<12+^aSP@Vg*hLRTV7gaUGEP!5L6S)>tc89ip_H#*CvL^|&(WZkk?V
z!+FSI)U>4a`knMEtu|kPv06FQ@j9zka>T{IXkk1kek#HE<xx@m?tmsYrh7Yk#RF%G
zLWM>t9bs)($;b?75@lQ&Ew{FDObN{ybKY6bR3kjsF+^#C7pmmC_QD0GolwD&^JK}G
zh(xZufy)4AfH)mYsvG9F=sqCnl6+rXhuLKR!$U0ZI70W_(en3iju!d*8MhV1|2@ER
zbA4+{X699clFP%eJY~z%vDWCplm2n~iFQI?TBdKdVi&(Oo9uu7bc#Grih&5TS(MF8
zAlA(Re-mMXnOTKk8E3UqOiC@B;=)*1@w6_0#^I_AT3Km$WVLLZicW{1MG#Ku#z|L-
z5UkRY@w2!Xw1&PAT&_zNJ1*^@9{`MYV(;WKMT(*xiR)W2Knr!bWy7;Ot-4qT>YhKA
z@%e|3n-ur?{9McDK!;geW<E!H9l%Mn34DIJ*h$H>cg!#ytqjVU>OA=-(bbHuyd)Y&
zX(cy_PP|O=bd8pVsbwD@K4pMQ?-XBDYq!E;aj#E`ry`lqV)^;w`26frK0klkVyMwi
z-&Pd=cEIO58$0Wy$1Oh*aB={gtt0sEnJv9wPBEAi;oqKzcI7P--JmUD__^B&)3(hf
z`=466-1%L9_VRm{@cA=Z!UW(lpJ&1ZfW?3?2}~eN0c#sB)>7~$XjmFz!fRzDXTp{)
z@<!U|9W2#z5jkgyE62F94yKl|kxhs;!otZ}h%{)qwUuWOB9j=K07&}2J@2)-lVh$P
z-!fr->Nvvehy2~K@|lF&&$n2<x46G|4UXrq+}_yTEk1f(QJf6KCo|E}xJck-G>{hC
z^HE=hp>MXuH}wE_)^`oPIPabxUN6vK|J`$=o016YkM4gMQp#yZmjgJvzZ7Ypch<Y!
zeu9J{;hh_}2gWBDU2h$0|J`Ncg9o18y}SRc=&r$WZ*<#}$z-}weDrBWA)V8Xl|nHm
zMRbfsE|_UzQ*th(W}yz+1!t7>&T6Nn6O3yXSd?0%cbfk0b_jFhS!_!%SzGqC{z<FW
z($o!EX*M}{(-5Vv&7-v1L+NXCC}E($g*lY|i+LKjdMFJBgH(}-ySunB*16X4%IPJ+
z!E`n~c+(Lm^;YBezm{d{@BYn>mRgzmtfKhFfR?r<8ymYQQ>72E*kZYi(peLj36&5$
zTBSLlCb*JJmQI^e_^6%oHb@a77l9es#8Q?L_$<g|)RQ8ns4cQ_2sIpBvb<@a>6BJ#
z(pPBtj!cFWztcq>;)D{-GYC{n9uH(;Sh#}an6>fRXgtD2tQ06ao9zG5&^<REEa3H(
z{dmP>W&bR~@|xm8@ehg)-)jaGM_4vRQ9N~HQE)%NB{HEK&zJ#YAJ)F0Nw}_^QCu5S
zI|(7O!g?7>7g>l>P>A@5;>L5d63Hrb(LoUBD%n$s5!YybokP_T-~m-)fGj`=fv<@^
z6Y})Rx|f4T<DOz#0P!XO@oWF?i_2osZ)%PC+rO<N$ZX6%^=(CQcHS$uy}P}>m)7XL
zsHL-3n-CiywaSQCi^y1rLDrF5C%KJYDjp-NT*-oAOe@B@vqABojL-&F5=DQS*^TQ&
zZM;nIV;f-FyW4lmb-$QS`~3jUuODa3ugw|r*#Ld&+ZNq&0P&aR-Es*|oM_G=!b0#s
zcG7C+osKSgp=#ei*kXt#DifSxnh9w`G|-DhtCV9taM>G2Zr!NRYHzU_4-A6CTK>-X
z_^wM@rp>P(w?f}HK+D$0`8#Dtn;Fa>`CCQtcjjqxXLoyRoBZ#!jM|m36dgrSHdv;7
zh@5lfAr8VB%Xz@~8>#AOZ3G=-q~$C|$4t;ZSXL{`2k}eDXh)BAKzhU8<6(IA+T5-5
z57sf#+6H}Q`I?_Ro6OFh(qo)ghXA=unwir9;eR?$nh8zdbY>&3%fLCeE(EQD2{kO7
zc^189s&r*E!g}!90n$816Sc8CxJFeqkJd2b!8K>?lNgdsaU(Rk3`80zjkIUWXAHXY
zB`w`Ms>`7b?B?-OJda+?&aD2!-`>qNvnsz%7sYM!)VaH}zBi@mk>XBi#~U95ghX;H
zqSLlyMuh+o7Ft8>MIBkG8D+O{FTG_}GcRFTsd1`-sj1B-;`neR=6n{3y6^?0^Ns?O
zDbUhf?%sVbUm}+=O)>G6QD86LrlqzUR*st=^})Pj<-!2WYkNzVpZfNq_`l}uqTQ|S
zt?5p2_67*uDT>!#dl{fQtzzYbcTzbSb+8;3)>()ty(JI)gssCTfrjZEEmNoWK&KeH
zlLA=4lLE&WD}#nUhW%jd`6^mS=!XGxXOsQkT52L4vVu8oVf|DKYv-y1sK0gIL`tw0
zD+KEs!AvTh#2lf+NYFFQtaY*B(z~FT48dt9v=cT+E=uM#GpcmLJqflFMAVOHxCjy&
zh@;gtv=c$*jgpm=L>>qVFqJxI6I{b-9cB1YNFN4^qg9%SvZY)ww-SZ-X&Jpy)P}HL
zYc9-g0a*X|;(L|_g5R?8*#zNNdaVCF=~|_W;>`nU-QC*T-Y&j$T~Q42i`Gl6njwC`
z*BA+mDOBzMXlDbrVSrf5Qltz<0ED2x>y*5Kga$oklY^HIoIm?N_TZ(5{vY#ud4$*Z
zrYS#`bp^;V8sI$L{Q11DNV1KB$T~jaUNlh#qoS5IW6@f0u|?KI<5aC==>+GRS;=g)
zzJ^$FVU*D^Dr;Sh!VSZ@AgU0Eq+JrAI9QxltkQopH%Z3w8YOeKl8wSYaTx&;JCgj$
zlrUZ}ys5PZRW_0+?PIBUJ6czKsz)4|51-#7q8}UZArZ{yt}TiZ_^^No&ZBYE>^z3T
zVRS1B5Q;&ikUNkoG*lcskr9oMtUqv-U{v8UN_q0ZOAo#MyI;RFy!^$9Qhr4*3hq}w
zrzp<PYr(yZoz3aAc;Nb?xaOJyW9B1Q($+4Bx@6H~;DhzjYglYnAy^S&6C+d3MA@*&
z6%WRGS%;bn9tCS0k5M+T^3wB|oUAQ&CU+yoB4S`+pHL`b74w^r+#m!M<P^CaFjI;G
zGbyY;<>=u&Vh}AcHW&8)VqS3f7Nqw-pKXiJ>qX1=y5|(dZ_Epry~*D8&IB#rGO}R3
zw2iYiK**sK(ghxZ_c4aZWz8XELb{UaMnn~Kqm<DOLL_u_!N7__;G$+H37?~|b3AG<
z<%8Za85HeDqB;C}?vhy*<9A4gLuORAZ(6+xO7Pc@GkoQo;hU$p0Nl{<1%O{T&wL3?
zOqsoG?1WN6)xq)xA}gd*=hOJezm`n=_8JY8EU5m!h1R{04A`L^j&2#-WpEB<Sub>P
zcCMXAy!ttdx&frXhvs!d;&_1bXoRejHo7`C(efIi(HslLs3zE`m8@jsN^u`q;1Scg
z(OO7$D8xl$7JF_OwucZBrkF-cgKmM%Kgn5@IJ~`_C=c&~<nKDqx0b9AkBd55H>@T+
zf8maf*FoY#``tT8`uFkN+1T4yFN&uDuSbY31~)<Ng|$w{lEHiza`Ti_qHzk+N^FSS
z!_?Mj&tnt|lZMM{Su_qCzK(nd|Ia1|mj;;Zf9}xLlKszpwm15`oRG~cK<OO=h9yM6
zyyDR-W@`a%JkC6CEX?^e<TYreB$N(NI=b^1l#cH;<!0o-^ieJiLHEbU47Gjh^8;LB
zUiDWLe(dS#m4Bms<p;%E(g0uc9Yyi~4PN=~_U7iKc;nNGVtyP}J6j6jw30CIi8{s@
zTwpAe5i&Sp4as&<1}&{lftmdwb#s!%2F4N=(nxJ#WfuTLoj0Oz`<%X+%xwtyhm_2<
z*<}A;4rVR;UwH7+L*M??nR}MRMt>peJ^&)imo}aHj-og-c>4qn=sww4>0r!0=opkV
zAqLO5WVHl`khamna(NlG4kZt+j*!wI8}D2wgBB5@^(z;pQQ&`};etItOCl-#IYp!3
ztc1o)Gh)ikK#`LWqT`(OGgp2h9kfTiTixf}K@!&g@;Kdh+tM(>|MNSF;?_iI8BDka
z$2~A7>yypxy$xCs*HYHHb~ZFY))q9OY+@rNn4Mb0;K9Ct^dY0Ib-@MYg$8qtJFLo~
zYG!x{F3^g2k~m<9=J^VF5)cE*<4ER2GEFlm*~my|=|QP3ON$V-R6t@CBe!98Noy9c
zghml=XyxL3U^dy0r;BWxLo+4A_R)O(AQ`rYW^)zMOhsyNgy>Hj!R#4>U?_DcMR5SO
zI8&xs06BQ*ZbEB>G(A*&saLv{zQ1skCzzcKRI}-R?6LVw58S)GEZdo0c~(O6qb+T|
zxA?)Ly9UQ|XinF6c6N%Vo>mlB1ZE<}6SiY|F5J#2&I3p|%_awr4k&K_%ZEnv?|*p?
zp`-}=2>tyby<H`Q@Q+1fY6LS$ILgzW6oG*<5&t7Q6lXm&$UNjsc>R{FsB|$A-H0w{
zDguO_a|A+tP5R{*CWP#roqYSrgwUt&EQ;F)6%N+7x2Ics#X8QE`b=eltz9DoM3lk;
zVDM0pq>9cl8>It>hK@oiQOa0K+tfZv=3!9*%2FlC-;O=Ec|_WSwj~Cdw=c7NOQ_~+
zsEhIU<aoBkru2p0svu>TF8Z@?KVp60_SUZd*%r!fCGdlH7R7%*WXJ94_Jrn1N1>yc
z=3tx(C|hM!h%wa4faeS1@gWA?#kzDcYA=~?XbMk*{_Ab|_hb>67#5cU7CX--`~T!P
zyPhx2*8QhFJhQU+{X2`|w-)f+S>H&@SJ4^IY8AZ-q0!noskL?5JMOe<g0oKX;H8bR
zDTS~y#OOi@(O4NuEu)Xh@nD%#9h{>PxmHQ{676*CnWvsmO(`uB=AawuNxGB{DMu6j
zQ506Y#Em92rb>b3hrbmnanRqe2DO^t6#S9<zi^!DJ-c-E>Vqws-6S3;_C-Tc*iq*d
zW2n6d&dJ)r@)e1>Eb9_#bkc9x_cM2`{b<j-z@BVtrx$bLmJP#Wsk7(cot;~`f29+W
zw+?3UAWT0qsBw`5C%SmA2*M~s^ikB1HtZ;gIS&{J4>8F_4p6MpT2r!b(8Jc7l_Y{C
z;g_Cqcsl~y@c_>gEC-6E?Ed>b0?q6WBH+0T1lqFuX=NmnoP&#8LgsLUUfMNU#%MXR
zE-7oQ`A4+623470C57g;tziNjnS*YTm#HubayJUWOrAu!^k7sr)SaG&EzN{FI7w`*
zX7c=n<Cgw=B?D(=ySVyy&UJb{FRuQ`xuW>(q43<@-Pzru)m1Be<lc)2N$T7S;fz#X
zYFJunw361A7<3vS#wQ90qJT7PS;oMi7D7~-N8iMlX3RJeSf)mwZo&#RM@NXbn3O=R
zRsp;<3h=?~{46cW;Q(tBC=c7OQa21`$5}IBNo#*N$6kXaFLEsdn7_Jox#~CH|8w^&
z$qT)uB~1V>^Li#t0Ql}9X%d)}EOs<#f<Oxiv=CzrN=r4ihKM~(kcid@hE?teowS&T
zq>;=?yhA)s)PqAN%*dP2qbzE3<ksFKVS#tMuPlBe)AJ&l%QVsIQca}pTC|hyxT`4s
z@vxlb#&lzAgESErjpEuVp`|Fj5Ybs*#!@O5R1NMLU3)0W;et?&wn4LCA(jH_nMB4!
zG=f<T0Y6=u?NT64&@#QwwYC1;K@Y54NgUC=s<u1%hXBua9w#_QO9dxjHx!(J@x@^Y
zM#2+wz{?2PB(B!V*eGJDz4B7lLdT$a&`L0<Tv3ZU#M;RwNFSID5%a(UGs4HfLZ}_{
z3-r>i-lXv*qbRv}+UtX#OKzRC^=1Hl>U`&M)Or0<>U`A_>ipnc3$De<WNWgsK})x%
zqQ6EnC|ndxX-!bI3W{51gJD88+8n+RH@vvC*MQ}7*Zi5xcD#V=Z@B|Wlq_01(SlzB
zb9Pxq$+;skL%Y?E5B8|DtpIY@f;X~{=MngLR=dEVI-X=))XsRQY9vIXn26lLawt>*
zsbf@H)-eT0qMpdQCW$aq@7erGObADL>9O}YXx+uMj?zlb-1?Fwi<<U<nLdxjlP$G7
z<N6|fzG_kwZx~G2r(3&Q>r}wjf~+)LGFN)Y2!}#N99D^~a;4zTamZ|9l3Qy6<l{kV
z4)`^o(2-$YabbfqK^fOc&*NJ{GPOg$lpeRb*pn(_w(l%`wpkZQ$W*}=BByRS*6!?w
z_?%n$S_1F4T0jqq*Y&Q!@f?Bf?oGF*#TaUdNT!r?jJYZV$b8~5@+fPmYS8*jmP|F#
z3Rw#&9FtdCm~e>DlH0S%!OMmovJW4cJ-7eixzTTuY11G5&kWh~3P#_5r&qltcEZuG
z9WnZA`lHWQ^7>@aN`7Qg6z?0n`|0*%cb(D+tYJ|=?F8nzX3^EMDSec|aiJq?Y9&3?
z_+yR>=A@~k@Y)8YxltzgXzNfm3@U$cl=W$HfkrD8^Gfd-!y>@>K$l>Gfu1Zha#O7|
z>;REmDNY_{cqqJ6Z6~Ud1))Be?}<JKV#_s%C4*TE<_we1AKecing0H4dT`fKR&rl+
z-m;QiiMu^8-<iOC@uVpJyCImH+glsE#d*kg10dzmK*l40bO>b7f!sC6kjjbMvL~e(
zOS&^ZXKUAJ=G$zt|Nfy&LeKsoGD){e6JQ%U7XaSx8E|ES5|!qapr=jXEL2fwr#aPA
z=zD8O2%|3{4U}$l2rP{Ks<iI0S!uriI2nJ#Ql$wBa%hBrB7Nt;S<_RR(K1y>Cz_H)
zT?fykQ${kViEqmgYwjv8q=k&vy0Y9U#dIB^us+xy*42?a1sR&GIZx&WIS>%NJgDqL
zNWpb^pyQ<&EVkwM4*SO3Qwh%#D9w3iO|HN7NRL1tE;?cQiXnlL;C#moMR7Smo&|3x
zO=dBbnhFpDUNEaC!H7#KBtqLj>{Q)7acK%y$m3659{3{pYQTYz#NM3#{P>}M)%}lW
zPBqg-bL_vIE)+(XY)p42yJX&4?!0r#z^)6bj8@oaoia+54$`2R2+YbTd32Ep6B%cv
zW6m@#SRNZ^qtLZdmRrr|0<N=>Ii7#p?Lj(QYO&_K{m6yBVV0gr)Ji^S@=}vQ3pMvs
zWGR}sCoym5t+9+JU^nDcz<7|%-^Y_R(lNy~li*5ioQ9f`t_~#^uJYhBXq>E>G9r|r
zWKr<|#ml0$;5h)pR@aWzkVtzLd2y8YOP~}BbnK@>r4VzSN@LLq$PnfP>v&<ID&1Uc
zOE30rpLDt~kLO(p&yTfu9u%SIuEFsfo*R?h-M!-cjS#=UA?1Vx1qFC(4Z4JBE1i#!
zN*RL&+b(D(Ac5aNGN~4!X*esH=T3&u7VaF5rTyq%=rsa4%}@zEIBHpUIVmsRSwn;P
z2ZxZ|c!X@baUQZ1q|k@#twR#Lx{#$YwS(&q=BP%CoB6Q+%|qHUg3MO*GiK9+A3O@O
zek8(;ZG`B@dr~mFp#Jv8LK5U;V`sXtK`}?CV@&D1tDS8cqqvevLoBz09KPVxVYc6r
zODAZ9C#??C&S*8c7pO-zQFb3BKMKVzuN<3c_VhU)RJNr5RS(W=Nq=Fw=po(MT;JN7
zq9uKGkc7G&hoCvYqt|+*+8!-!JtKL}88{&D?A`9Q*<}AGF3*zw!V-M~@D81$2};x_
zR|Q7hcu}8C1vbENNu<>Su%|rQqc)(ZyK+c7EROk@t687?#N}Diz|})Mf%^yfxtY_k
zMkdI&$ROetqDpzNJXqBz$&_`fY*?+NY@`y*>(~Ta%PK^xEf1v)CB)$?uOJ&rm?wMg
zpO)no2RU9Kv6Iqr_vMqeY)LQj`pLZa7dI9~r{5@w|8c<Uo0IA829?&jQWRsfMms28
zj%6JO{_{gxM&$6`NVRjagJz55RZf~5rDG0XOfn(Wc28%tQun^omDYN}N{3t~&m7JK
z2;Vng_k<>dGeMbOBTD9i@eCI;Z4;EYHu&IlUBy}{XS^(-NCazS41q@mo9nsY6mz9h
zJlfjH^E5*yia-k)7v3?kXsxH8J2B82l83Zb_4h$Ns`WV_Gy40Ei)OlMX*AQ>&CYPl
zjQ;%1qJTX<=8%M%G-QZ7X-aJy8zG^TF{Oa~DjzB<ZNr3hp$^W5AQksj#Yz>l7hY%+
zl#&%BkXKC%m9;Fb(k*Au+~zSM`dZRDDUmy*=$!Vroh#zzMXjqRy{(q2;b=D5|G?>H
z%vq-cc6r8}bvj_YGo(zy6LfkAhBZ+(8f)Zxrpwy!Qr1yfRR>vf=536OH#XKya3ZL>
zw6KeVtsA8pD4VNI@K$mf1=!WeGS7LAxQ$^RJPncH%KJJlwuBDmSrRJkw@%b>H^dQ=
z<_C_`={GIa>3_1-iOfuzU)?H-_YX*OYh!nBo4h%yl8rJY?4Aiuom$3##ciWCN=4XY
z$LZj?#9c8Us8PD;85Eo6!Ag*rg0WH==VCkO&aSZbAK(RHAi(qkj!o4Xmo)0v&2ZX-
z{)H5;Ow-bA9YK(CFEnK~*?;#iRs>nSmn+u~w7b1kL4X}ic)A5-!1!guEyD;;3~#t%
z7<p|auN9A!L5cP4a8pCT5B7V=oHtq>rFFVYkIC7Su)&|{BuUkTA>ouh(zRjBZ>2}Z
zc`o#v*>wNiN2#DQOJm&MvfT;JjOItSi{j6R)VVdC>=Bw$x~g)nf=bK{6lsOS8Y<{8
zE*!XWgRE7kn5+W?i!}juB#8p|vh$t=%XH&{jMaRd=96jm%WZ2zSi9r?)kK?re7d3=
zd4=YEEt*}ur(&llzBEL0dotPBp%og?Jy4NETN6rI!#)uZ5*DoGflFs#J2nZaKM-Rl
zP4rEWQ8~p*UaQ90M#M6}0@mTH@r!M-Uy21C_8Xk%zWG+qM(79mP_QyA;w;oET2>^Y
z59S@M-~=+vIw%WHAlKW5j83G95z3bdosZH*h1=q2DIM1Vln`wy0>h*IP1aJ3Jf#HT
zc(b4+ZYIMJLz(apx1>w+!_2x@(6Wv6$H(dPzp>PI2SUu&W@dFD*t0`Ci8#@AKP70Y
zsbTvQWvo&GBI}KIoQX1WN!gp^>85gFsI`+vD3cAf1*{I$+`XQQcbD{Eg61C`$Lim*
zRB+z7x40Pl{=K5u9ypP9);G6ysUVDTtWui8^juk?YaY4dEJQemfKXOemO&0YGuk^S
zT%@hltg#Um$ymdn_>Ped%Hrmk(2||4GJ`_vN=4Eo$Yn=$lvGgLH7jO3#whT1{fq(>
zDKfXcKua0qEuh_vFsxy8Y(bd*yz-9LB?rjeI@}m!uP8n;n5ZW-QK_p&f*&bpscI9Y
z(cF0p@!wo=7DAAD`><#sqAA)SnT5)DA#xLJ10GLVJFcL*8;+WMIfN_)v}2tXC}W4!
zg!8IQl7G~j))86)O?etEnq+A8T6=xr68%8SHf?sb2<Oog%jYCGpM7_yhg{KJgX4KP
z_cpe7inBKsMFZ2F$bx1iv&zFZY^8&^0il~1OBosL24GpE1+4W*6O}a91p)I=r?8gE
zP^&Cb<`P<+YYB-#OOG8qeQ>%^$`UeAzxv>%hpM0c=5v>%U43;9tdw@u2kVCha`Ebd
z)rmbcDJcy%PsfSRNQ<P1+1~mAeK(i4LmEuqUV=*3h&nrq5x~0R2(bDYSYORz@2&SN
zaRA*@6hAYhtexG-28C~ilEWIQtQ{1pgjyBRDxs~aY9&E?Kw%HfAvlLK*!Ed6D{Wab
z*cSzgf4Crm_s*GRdnYW{3x~B{*ZiQ?dz)4Y$;U%p^JLeg9{H6~Nul&S+B@NGr{mL?
zWCswSxen!2I{zdf{JJ6O5t^`h0#s~z0Jf^UN{~7s&$k#7?X`&XTE4U}HAzG_xK5AA
zC@r>uOk8N0Mt5e@{kI*pmCsE}xAJ+)0F{3C9F=~;6vamdRJymjzBQrj49f)g#~L9V
zY}NxA0!BkDaScVPc_kp!5b77ht|(9m(?y6&;ZiB5EDNOsmqrQO|16=>D{sqSr=x^r
zhj`wOk(PJxHkB3o&C}&UXG8oGEt(yb0>aw^Doto&@{onSB@Kkz!A_m9)47EhWAI06
zqhQi4oUB!3w&og2h1N<5p|rFP_DOBDbEV?kGxy}epfm6F<1O<i{Uhz1e$toPpLE<m
zJ9W#Z<8K~kh~Kibl;HnVchs3p$KS0NJVMj;jg9Sf%60+wIWty4@OErUS9|X?FQcw~
zEg|Ph)v@+o)|Iy4YjYt8)_{}4#ZWqD919M1@6Kg`=f*!ilsDVs;a9rYJ-XfdR>%9j
z5+M*7llEssw`HCzrmxK=`%fKbIrhu_+|jZ+0C(#;5ocy~0C?aI%3xw5)|Fz&b<J(<
ztp!#GHIdm3H~1W5jAJ_?B#lB)&51o!;Nu>a`9(l4>e-1AI%vD3lR;bU1ZO#$?mu-D
ztM?bo?ray#KGTwB=SP3jeo?H?&uXUYu+J0~2)-IHf)X>1&DoG?W6w-uu<2|XH`Rp0
zKD1>YI(L#QJaIj}0D2Y_Sj5nuHWmhJ3XQ7~l%}8;hasi3*)38!)>2E4f{D$yteh^P
zpe^my12psc+I~^|(va7;H}@v%$m=HtQymFrRC$xW)&Y^`c=!(|aD8(d<JB^k(hEo#
zmza8q;ks}i!i_Ne7axknVQ{k$gt7G;W05qR<YUMi){lXh-Bt7m{rGVu!2615-10gA
zm%+@u9`}plD+4em)2*#NQtQ$h0|l&^l(E)QNG2_03OZK?RRvuIXP_{!WYR+{8*D@6
z3>PkVNVE)&1r=*;Om&h%Y5mr9C0;(N$J}X4q21X~^`YN{+{m-Z{=Yk&v+`T}Xrko&
z$>L2#N3Jg(O3p-@P{ZFEdkQpphvt)zO-=#aNIRI3nv+<mA!VTq!}!uH@@N7CB~oFZ
zpVS){Dq(t_D3$i@K}1@SN@WgjpH26FykD{DQx9Hx=>E~$my|i&|5PTlH?@S;?S%rO
z@uTzZh%5$iGn6A~N5CqA4IWk?SoAE^N<n?v7(|Fx$y%AnZSBAUIzJvkg(?{H8vMlS
zm>`<Ev|dcaU!?^VQZ2OaI4<X)(*i+CCJ@%c>}ZH$^66IZ^U&FMPVQYI1COruyS37>
zXht*kWZ=yMLQ8D><c*NsE3J+JHrJE23}q19s9H!VA|$2-CZm!~3D$U!(ZKRI3#E{*
z3Ywvqbc(WVDTz6i4}~fxWQm|MPGOR%q1(1a=_Cw$MAvykae+h69>Jk!+xURLYJq!i
z8z1mwQxs5GY!0~Ht;uA9@c~3a)^ZtYQ$n6!1kIo-rDE;46R^>lU`jCOJcIOdD>!WX
z&7Et!GAhK<H%zA@o2l4nR;2hZEn9(=LuJ5l0|*fJ#KdWr1gZ_ON;OY#%8d0Ss9*%;
zIAbYf#2l+6BjZBd2y~jmRno_6P}~=O>uj?B)#2tw9FY9ckH7k!C0V?@)f`W2IwZ5^
zxU(sW|9Pl6wkEqNUH^CxOTl2l@CXonQ$<@26RMW8S+AX@FSYjZ^t1Qd$fra|<|}|G
zP6&UkpF4AkoakoJN_?~_ihnaib7y;FopPeD3_xvQiI(#aM40n5&i}}*)g8SnUF*xj
zVZ+O5&6>(h<JI&VvroKzO8N?Qnoaiq;PQ$|043%LcBW3C*yj%gWJjI6<`Om{Wlhbw
zGh7)7BGHQw9BysGv=p`!Tw1Ry!=tTg8@#RqlejWtjjdy_Q5y6Uv|~vIF`d)c7iS}<
zYV$hg_(o_a>O95DOs-M9pU{LF#Tm_CZi?dCfz+I?Z%wCr#XF$<IaJyL!oF;xj7@Yw
zGOUOW8+0J5nL0BQ_vtay=&=dnb3aD76hrcL&|0@$`+K|Aa{sd3Ii7Vy*u}F}{wN`M
zZ;$66=v{m9kmt7{I<+XShrIohL5Z`3Z1<62l1vyVkKYc0>Yh_AnS>}6^rRZ<lyn0}
zv&q5p2c)zA)S<KA{ii<PAL0(#DKG9_`=ucp(h$d|7-ETkBbHOkR$K}n>4FK<v<&P%
zTAw4Ye^Qz-Ff5iaf)|VtNsFWWxkJO>_kS+$*ZZ2DD*TBw$`3U~@#VpboKChk)_01t
zn38=gBbX(Oz-lg;;7qF8L*+1b7L%9A9%xAz-6X3cN{u3)Nvb?SvredMGair7^iTHv
zDwaE>a;_t=I{+|Bt%8l1&_|EU%UH=BrVg~)j8jycd902qcq;J2XNLSBfgdhC{qxUV
zq61|svq9fwqqePM(G<ns91;uZK&)eNVv+156n-Z`f~!hUB)~DKoa{ssqHO)0<Wb9f
zkCi*Xf<iXI5~k!2PCe#+%wHT_%d-hO9rhU?YU%#L<*lYaxkLkk_4}uT30Jao(P4ig
z5Zw_Vs!9cEqw>Up<Upc8*wxk18Z657hDUXj(tIoVh+2fuJA(V_5oMC^32Vcn9|ZWA
zv@BWAw8)E-vEEA|ok1aHh~`(1E2q@2o>s1W?@FibNCS4$SI~-oH9#|Izz?O3K;H2*
z*lc!=1cw~VLW~l&;C7zZP<hu&U9-p(&c#G+8z%&dW#s%kE}Q2`Ln0@fOVVhQ(-db3
zSSyKqP}I9^)H#>nZRsvOqwTsnw92v!>AJThx}X4`IRLf4R`<+yGWMY!iRQ@|$kJN|
z44>pCOvaAq<CX-2lFke83b>{MU%!F95me=P8FYY+d&zTxJL=KW&MG(nh)Br|x(2!N
zc{^k*iHp-KB36Q-JEn*S^ef;o%*9aaj_^`)<F!bFOPi!Gd1nyG&n!jqM?e0rm#nwX
zp4mE?*Pq{Mptfku^NZqd4Gpx-jrA!_9~KZXh6!zTlu?yYvZ$1ib$}8<%*5Cj2m<kp
z<0fjJiw5=_l}1ae4h@qV7+xoCb41x|q~ntFzeku|S9n_~aul7+Y~^(Gha5cv;0>iG
zfc)7ZzZ0N1e{jJ|=>a394O6w}K3WzWQzklTgN7ZEg<`@r%IR237JQIGa18}jMZ~pa
z;iF;XjibdLs)k0xOH-#T;0O%j@)m)9Yl*b~<8oSJ^d)c}?HJAUIeEb%eg5hTisG3=
z`rKJx-=V<61yEwit$+ebio+#sn6yka+{4Cm(F!Ll^E@<>%hEykJA9U2gj|m9WbLH=
zQd>a2wGQZF5}D~er8k-4OJ<YVtt*$8CjHzOEcy%H{DPwR*wEzM+S%HrRi&$grBRxl
zDlT@|T3F`JdlwG5OI$FFsZA9Di3d)!hy3zdvu}REqU{M7-!)W4geTgbP;0|z9hs29
zS=KnIbYq?Jnsb3`@LVek^I2Rv;(>u74-mRC)RJq~aA{!uZb&&TxO6%gbJvz#yDBX!
z_75M&?l&)GcVO)-Ju`KJ2>8NKdiL1;<Y)=*rPk5}*xd+sGgbmN?{TGODntjhW^oW$
z+94gKhE7l{v`d93QKge&rcOP#O;2ABTIzIq`FZOp*F3X2dgO(j{LJL}#TOQZ7|73!
z>F&<@CX%NLCN|oe;7!v6FKed-Y$X{RS2Eb+!l~Ld5w;3%LS&`0L0hglq-nwSSf!K9
zDHEf=;@UcW$6nXEw={PtQG2K3@@vQ!@*AB^W;d=}Uii(wdf}q<tZY&I>w)y#*qrWc
zQ*N7TqJ(|<xMogrA!96sh$3jlRaxssNF^f!8g?a*upz22+UsDX6`^t{RymW_iICz&
zPSujpbNZI`4jtv$5GkRAWeTSNe*g68v{5EcAjQn@nLL4H|LuU^`{dc9FJqx_A1irP
z24g&nj;Yd14)x@nVhxXFY+zNswi1P{Vj(g}If67pm}_?Sc=|~i1E-j6)xXYAM@2%t
z(ihtA(X8moTITlS$#Z$m%YW#RXP#_6V2k35L-O37Z0~MRApBLp(fh!KAl;s#3_4RL
z#ir*h_Brv0SJEPJo`vEK4F8_%*0)`8?w-ymmZZ&+$5rUGK!9;3v&sIyIb9rl*6hI7
zL(LBSUk)^T;&qH>IvF2x4tc;*Yi*RVm5aeg+0<M%IvN|e)Y4?X4=%lRGxhc}Bh#Ms
zFQ2Flzc4<TX8-i*s>tUo)(3iM<}6kq*U=D7B2CC*y)4`W#DW?og(-um6r{&!IbMTG
zcWI#$Rd*f{h0ws*!Iz7~3;x}X-;p-a)r&+5`^D1!rnsRanV0mqv@n_*8JzHIR_9Go
zLUJi#>LUty>Q-p}d<$i_sB+)EMe$t&oxVBQ+MSTltYZ+-DDSXBR0xc@hHF#TT-)GX
z2vTqe`wTjIrR%70OO7(cMtSL7Y-EI>2rZev936B@d#K0xb3d{I>V2XkhIZe$=2)RQ
zTI%ooXG`Gxx-E)78w$<ct*r#-k;G<=GZhq0sADWSWU6y0a;a^oCF~~}Obin0OF3EE
zNWP>|Z%{|Hya)=8O#Bj%D_&@~D^KCZ?H4+kORp_es3-8Kynkxos>;s6*<}BBE^phb
z-(P~}{r48d%?rf2v%XFKkIR8g8rX;rl8dlvK;yXPOtc2)5+sM05^J}2@_ZZ%F=Pmr
zJSQQSrT{r+f-ciPJSG<@z7=5gubeI^A*1=(C1_rMZ&7@3fi`#dc8NAm$<7rl5e3*(
zTFIt~kqgU8r&!HO+C(f3C}B0<x|`jl@zMA5)i!Rlcdh*m$x)Y&(+3LbHK5J+9ET=b
zissjsXmsFyIn+TNr(ZTDauuYuGI(Z7%#GtI#*WeeP;-!(LcYh$kaHtWV73u>>6~yG
zUdcz@mDEVMEH<>(hMc}^W#i1!jUs>!Gn(1h1bW?HKoe;bH;TACIy62wNUHG)E2XL6
z>L*c)Vsapjm`D{O6T7L(cpeYT63o-|1Rwmv0+HFv-u6zdJs;i}w5-$Lb6hxWzXa~M
z4V1X&-o-$Pm)*Ni%xAi}0l9C*ld$t<Q52uMt|(4If*o*JMx|z68ZE5VLfew#LQ`b*
zd<}q8w#)rqYNUgR&{Ng|Tug<9-#H956BH=%vSr(Eh}NBSUynrdbRDdx|8+3EOqLRD
z7;!8kODi<gRS8O}z+Dr(tAke+thiezst}ECxQmd>mFJ5+MKd?6zFgdT-x^=W1asb2
zT9(Xpc4;!#{XIb2owaOHd}RU9R=Y3d=W58$N0OxtJQyuQw|GPQpyt^ngk#X=c}ZB3
z9W%%O8Kv~|B)~840MQXcrvJ*2JTY$JyZ-Fu_bfqEwkd}%Yni?yPY?uynp2tSKXeT-
z{V(586j#LN8BgZCmMPPNG*gy}G=px(*$sFAOaFLTTRo<4|9-D!To>5>wgKDsh3RcA
zmA?JHOr@PL{rC43#a|AD>DF|T_chV5n!zJ(Y62VZ)KRh!EsLx%3Zk41>?9MI<;q4a
zRb-C)5TWL<h$dJYB&2@Wh>5Wj8$^37;vmyfI;MG~Y81KTPsRXenHXWzi*=wo6lB%n
zm#UoNZap~)9}BnRuSKs1t>05#39eFu)%4%?(Y(%Fm|X{Ge&shlbI+0l&g)t<|NVW7
zJP!z8KcLbcno?;SJ%=q{WD}wZ&d30XoQ}aJ5nRL0<FI86#3<EHR1mGtN&(B9FrR{4
zLm3-u8xC<E5H5}}G|4efu^Y6+4p}cL^?*{4AOtN%=wsA5S_!m>4$n&IZ*U1s^c25F
zShYzDxN1-DgkDrftC=<z(7b7YW<OTxrj;h4`N@}bwE2$`nxB2iLWR!h_WIUjYYWqi
zt&dzsFy*C%8pU1(ExEK>H>PC4awmk11{UMJ<|;baTGK*)r}j!4BfNtxJj7K>hV7n^
z5XmiDVkDVU=ka{SAKW1r&0yRfZP{)+sEH1l8FiWnFdI@OU^^(!nQ=t#oR6_&utR1O
zOIbUog7=}}P?Sb9(?G6Fscq??XaEwfgUz){9$*U|rkrG^(T$9;Nko%J)#?+%H;q0y
zhkAIVUiovO9dh{utuHa3b@E)pysqJ2)-4ldP4p`-Td3JL-QHT?-Jv}RrDU;$2~jM0
zj10E4HP-6VX-vzOTG!EO2GdbxqKd&uXBw#b<spix(k1M@qZ@WqwWPywN_PC|TK5{}
zuceyg!@puS+5gaS>l$a5t_lNo!*vb7cu=!1;|bL1ATir`*hrl_3FYR5^b%AM$i%>`
zg0Q99tEOf=7-nJ}q;t|a7P&G(f=Qrj>s+1KFv-bwl<kOVy1AsK&U3vFyK*_y`JvNA
zB<66hm%O5rnK|6+;a3#JFAS-3dv|wt9mBnBv<=sc3GXzE0V{j45IiJ&X{dV!adHY4
zFtyVLxSKH>b**E`l#GosM#VaC+H2*?Mt>^!s9*s0r*!7_x3|SbfG&ULbUO`ax_s3u
z7MFwH`--CY%n-?)&FLOV%@THQ(;W0MRFz}WS|y|6kn|ND#48938Y+OAfep)iD5F=L
z#ZU_YnGr@o`HMOXUB}~-I4Kr;X4W6~2$mr0i(<Ocx;Il+Y<oY=5fYjoJKb_yMiXdo
zsDpr3zi-IpM3)rnbro=|f-Jcp4_c>NFxim6=xd?$GoR&??!0}%mA1^~3$%H(4$3P;
zK!;go<`p8K*V~6^5^drN(WwCAJQ@=<l%rFnv_3+$W2>xnjt>#a0dw@3Czdov%9GI4
ztNn2m0nJc;?6?)8zLBX{U<C-;pZ?vB&Hq8sU4!F3lsg;i8@toubC7o9r8L$;(2R;r
zP>pk;(jrP_v@)7SUHYbKROKwVKRknd9|P1_kyhzoYr!D%f|zZw4NS#ljkd8$C;j<O
z*OFMoJVf}J*MKofb~Nf1L8y2TAovf52tM-&)_&$Zf~k~6AHl~5#Q4{MAeMV0!h^{h
zu{h}hQUOVB4XExApmVswVKh0soX@GS5@fcl&!+qT@F)cP?%`*)?%}Tif-8XF_qOig
zzx=yJ@rDHiH#c|4J<Ll9Fjy(;+F9oX_kug=y{_t}=2oC%L&;J?E;om`Sq?}WCcTJt
z<laf9wG8E1D(XdpNahZGrga2V4&!;c!f24J7-%9$6T%*-?NKuB(}ng)ZJUoDqriyS
z<lyevbUz*yi_njYyQ7tjf7vqhds^8D0K@STFhMq65fKLMv<4T4i#0B)^%2N*4%6W1
zN7n(aWG7rYnOh7`Yh}Gmczh%gDo*q<#~$Ocu{b4VX5mz71b#l4zt1N7@i^Jo=WN~X
z+W1#J+4#ENwbv~|xx2H0`xc%W$-|`J)oZiK!7B&jAMRUtX4$Tdf7O#~{m~D0ZM>q<
zANRMXb{IhI_0^?!lT>>8Y<lp@BSwE+fAnqH)mL@zJ{xTNuPTZ^9KQRV>FyqtUDdIQ
zHFKdBF~SZV;HR=!0i+CD^I6qMp>1GFaK<<<nSmZk2@l3y<cz73LwCr52sXOGa_S-N
zNIUpMZShy6;OESFog{>Ik_EuN3#M${*MJ<kue)GfK=|21S|T)yR59<3P%+Oaz()yY
zW2`x|iYbUOXPm2&L0~j&rVt~G;6{{?{{T{-aV3-xRz(+$kg)$b>!wG;k+rRp^GVR3
zs<kpa{XG74W$W#Cj;pHPpYD!VZb-O(>#Muz?(2*08XV8zy1TQrwOu@QLs8U0Lpn$m
zLqLzT<4qYk><teE^t4h?ro+VAGpDo<N?TVqC!)t;TW)n6)iAa5;6(#0_CNCArH9^h
z%`=wxp7%d8hs2a7SbZekHKedBM50ePq?Nh=#5pauczp7fCD(CC^lN>7<nFvw^qP()
z-d1$i;JA;(?#6U`XS?`i*jh|+#bB=oNOMz_4zMAhcC}Z)Ts3$?tc~ERlV$YW>cC+w
zqtQkL#iDUdG`_2DJU5i%Fu<bx)T!-DpKa@|ryHr#L#D};pwY=I;HWUv`M4kiU@QsS
zzHMa=y;NSQkKUUGbaeI6%aMU&tYMb-4X1&oNe<XJJqxvOVbT(KK1a(xopdeV9<(`n
zO*!h%o=x||QRppSPWzSDE^1A2u_*pxNPD}xJ9`v1<4e$lj2Rx4;z5_8gtDkXHjLGr
zN3W~E8mPe(J(CS?d=-P^5Hu@el!hzCymXo`S+rPc7aY?TaXSV`49mflvy{b7S5xc`
z(Bhw-Zi}|;Y6s*9%}#3q!Z!_Rk<i3_uwc_B*j84thQ;UtgA88<`@|Z>q2R35P**=l
z8=Mpd)`Fq7EQHjQF(|H$bVjSF#CfVglZMj{wxhp{_V_5cyPGFz$MnwH@=s6aYR@qq
z#X%<-GoC+iP!zWe0uJ}KHug3sq0QEw34?naO9u(T71Iu)x}X*>^HC`o3=fXSz-rb6
zCY3NjbFV!ZCb6nC4~iRCnk#n?FZ(jF{*sp7#To|Lli)}@N5L0xk8i5eG@HzdV^fCu
z5uE4R70T~DSgdsQO9u<vkWBY>rm(3Cc-wU}Lcz+dXAR^Fl@anYw6ANYYgS2KNzQ7m
zbg5lsU~xUTriwL>5Sb98GIbqGmWt_TebCLj=hr3joP2d{G+M**6RC(kR8vcf<LN7y
zl8tNQR23D9xKW)FL=D!8!BvEl($!UPAYr9>$buh_M(rBq+;&6Pr}EtI+Q0dEOA6P0
z)vk0zIE;7)V*T<URwfZ9%-ILT<&-Er_hs~rY&7hqQNvE$KGq>dFGQuiVp2I?dd7s1
zjpDB6-Ye0}<Cb_k@!H(Id2Y`?(-A4C`A2lOmbBHQd3*^?4kzvXKrX%Vyp@jrve5kT
zqNCHn{v(+tKZ-l6E&)s)3Rs9rM;mLV0~Aa~acd)gas<H_7$iW&QJ~&Q8s!M`#i>{h
zIw%q)5?N8bHF9iFy_B^SVwe#{!ozrk1YJ5vF-E}Q6nC)Nmy#bChQ!<g06y!V{Kw0}
z4sKbwF#-4=J=96b|0Dr;{-FYodjM{%Pj+^vyBK05O<<*|IBe!n+geA<z#IzFSZ*-G
z#Y=BvWrX0ua_gjsxom9TKXh4bjw%-#-Iz@dUOONstSGtMo3{U{Jgb0lXKOIeDgd9K
znkS}=1<WdfG`!-b;!cYylrcap6WD)FIMf|Zt5`+fFk@8Xs>qymk~R`Z(mcQY^!KmL
z`Ml>$kG%YsdmP@zy;;SxXVZh%_L2DH;q`|;nHN@PJ*vo}9<IUh91_#%bc2c-9`Wv7
zZF$r&>Y!s4tn?AQxJrvs!W691-b8C_%Y&|&JGJIq?0dww53!0{8J5qwb2wPGd%*2S
zB$3>{GKXZMsXmgA3~B1G1If;!qaVr7lT6hGl;-+g2}dsXRrSkWzwIa_`^$j0xBl6$
ze?QUWHN`>kn%=dS4ry|0XMMU}y!LwXf-9_oTPrS%6gEZ+@hQwY8NJqxhAkwOWjYES
zY;g2Pju-#-r6W3ZLyyM`hqCDx=ZD`n8h&wZ^cyhxpPU>0KO54~m5u(m0bG8|Zy!dl
zju`zl{n1yMiyrPw&;LAg(ZfaYLxXoenNIh1){D<U8Ds^?SEXYH>Q2PkDbEeBBkYK!
zSZqukD^*)7R1>%tHU?cwE`04&BSW3YAX9Q5m;p$6HKPq>OT7|bz>id+8%u4&V=*kb
zS2Yj6z6OQR*2Z8*08VciQpwj3&1BjC`t5z3k{2Ja$=BR~N)k?Ax^kSLTpVt=h9Q_V
z=<LJ5ZJByQY*)~*7w(Ii@8pYkno8BsGv{SVQk!&48!#Pg&ZY-%=_B=x!`C~$k$o4x
z^!i2L#iw6i6#rsKQM;SlIZV)bCp>o$_UD+3T1jUDGc_w&FeaMFxZ%<;=^!XGHcA`E
zxv!lLLFg!z=1PbV;_`sYJ_d_zby16D%A;@LI@nz7K?`-#13-2(lZW{atQwPp2|{6E
zDQz~{|BcH_l?3Fn8J^Jugw2rdIy9vb5TY&{A%ldOwhD|z=|Q>GJV>T=rFpcbj?Qye
zGGncExLb*EIyxp;8EYSP1A*1m2%TxL3<x&)2)7YH3}6NbV{Lc*>{$RQOgaS+cOlma
zwcI-2+;J^^KilNTqS+JmvpZKt3C+Dni{jSXi8h}|Xnx|+qWIGRZB94$wx`qLJaTd1
z7Iv79QOKyg0YD*k4GKcBV9Js)FJZe+UREmdCN{y8x->CGrPJIQcke~)fUB|A7*%^r
zGaVcsI1*BkXt+w(=?Hs+n4{YF6rN2tXvG{SO{3Z5;No!R{HqUMdg!SiU4PyZv-DU0
zum{4e&n7avzv#ev`hd(5Fdx0HC@KjtRgG`T63V}n5TLJX3(?ZN(pqW7WuwmGpNK{7
zu=XShs`N6`EG$(p?Y(G<+iztOek*Iax#3-FE*!k|!AlRl<$w9MCBr*->nGAszTUp~
zdkfpU25oM5J9}G`4b1flm5+@r%i2SkFcoUnFjGb*ed$fZSyS1v6*kG=k%p0C*J0ZY
zEE5hT>(Y!PjWmbF)6ij9)8Vk5c<|Cg|M>s7<9Umg+rbk*+aFf(-MlD%xM+?a7WjUJ
zDy3+cErs-<E`=>!<E&(oD<82`caG?3JrQXNo#w=t1_b5sQYlEJM5s@i2@(eZe{~jN
z&v<N6A^gx|Me!dN{>qK@b*k^Y1nmfml&WN|7G9aaL4#`UN+X2k%2W)@_9pPgF==3@
zUE!6Gjcec0p(=p{cuSR3Xg9Z>fTD#3>YOP#$u<=JXm${#lLVw)P|>T9(oF#~+{Sx0
z+5h6{@{`}5ko%6u@;m?eVyky;;hk^oZfxxql84H(CaSXLM93vTs~jW8A9+sj<)J*z
zQ)bG;pe-L0iLXL}P5XAUa~=O4EF1jt)){=n-viEI7E4_T*qOw7B^~EV3I!BtN+v_?
zG_RPcAv?%OZ<}C^wop6@cC)pmGr`ITuiiBb|44AlVtPInbi^!`?AW1e=xWUA<CxEa
zA}Q5b#u5~C6%QzeDen)HpdniTott>p%IsE)C7QypBjD)mVYbQ*@P2>fwm-OM$z<$?
zcCq4>k1aaa|C`5(;(ZI;va`9lMdcw+%nT7WE7HR7(3DVM%4lD@U~AZ>mP3XxL~$)+
zm!1vTe)KPNt)-Z3BjtRlj*#*h)x9P|3+;pyc$fO6UieCe8>TPwt@jP6b8Q?KNSbUw
zWuGueq^Auv8%ZDV2^-lU)m1&JV=dJ|?dPUeMrbI~1DoVQD7&d@sa$BlooO0V>%g2U
zaUUR{s#MxJZA}NYODphd;^G$2XWAPKt2z^Cz=??>DMpJbk7hZP8-bOu>g03_dA||E
z4@J+lc^irK``&lYl4O3q^35I@-nvH~mrF%QuCG{t5=rv`@Mz9s=NeWacGaQSou^%x
zXul=cwglxXE+$YNaOCb3vz9C)!YRe^qfW&=bA}+Kk{=0#IeNM#*-8KP#?Rif%udR>
z>@OZ))MYo%isBas+_|x_JKdrRMGBHf0{2lvon~cXfXoqHGR|VnAhgodB50!(_oCK}
zdsz#vloGX&P3@dxRg9I6zQ2}mHCleuv5!m^Kx*_?&<qDYXOsQ+Uf#kiAeVVF%Q`^#
zB?E#=Xo9ROgRX^)4Q$Qr6;m=O&b$gj!FH6MY1NdDX%&<yIcJSBq0v$@Zli}XCpL29
zoU@wyTzilPMH3Y|&U0&GuA|!_J%||R@1w!goi1saHW%<5%DR5oz`2$GAHlAj58(I!
g03VA81ONa4009360763o02=@U00000000000J~&Q761SM

literal 0
HcmV?d00001

diff --git a/src/rseqc/rseqc_inner_distance/config.vsh.yaml b/src/rseqc/rseqc_inner_distance/config.vsh.yaml
new file mode 100644
index 00000000..e050bb24
--- /dev/null
+++ b/src/rseqc/rseqc_inner_distance/config.vsh.yaml
@@ -0,0 +1,116 @@
+name: "rseqc_inner_distance"
+namespace: "rseqc"
+description: |
+  Calculate inner distance between read pairs.
+links:
+  homepage: https://rseqc.sourceforge.net/
+  documentation: https://rseqc.sourceforge.net/#inner-distance-py
+  issue_tracker: https://github.com/MonashBioinformaticsPlatform/RSeQC/issues
+  repository: https://github.com/MonashBioinformaticsPlatform/RSeQC
+references:
+  doi: 10.1093/bioinformatics/bts356
+license: GPL-3.0
+authors:
+  - __merge__: /src/_authors/emma_rousseau.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+- name: "Input"
+  arguments: 
+  - name: "--input_file"
+    alternatives: ["-i"]
+    type: file 
+    required: true
+    description: input alignment file in BAM or SAM format
+
+  - name: "--refgene"
+    alternatives: ["-r"]
+    type: file 
+    required: true
+    description: Reference gene model in bed format
+
+  - name: "--sample_size"
+    alternatives: ["-k"]
+    type: integer
+    example: 1000000
+    description: Numer of reads sampled from SAM/BAM file, default = 1000000.
+  
+  - name: "--mapq"
+    alternatives: ["-q"]
+    type: integer
+    example: 30 
+    description: Minimum mapping quality (phred scaled) to determine uniquely mapped reads, default=30.
+
+  - name: "--lower_bound"
+    alternatives: ["-l"]
+    type: integer
+    example: -250 
+    description: Lower bound of inner distance (bp). This option is used for ploting histograme, default=-250.
+
+  - name: "--upper_bound"
+    alternatives: ["-u"]
+    type: integer
+    example: 250 
+    description: Upper bound of inner distance (bp). This option is used for ploting histograme, default=250.
+
+  - name: "--step"
+    alternatives: ["-s"]
+    type: integer
+    example: 5 
+    description: Step size (bp) of histograme. This option is used for plotting histogram, default=5.
+
+- name: "Output"
+  arguments: 
+  - name: "--output_prefix"
+    alternatives: ["-o"]
+    type: string
+    required: true
+    description: Rrefix of output files.
+
+  - name: "--output_stats"
+    type: file
+    direction: output
+    description: output file (txt) with summary statistics of inner distances of paired reads
+
+  - name: "--output_dist"
+    type: file
+    direction: output
+    description: output file (txt) with inner distances of all paired reads
+
+  - name: "--output_freq"
+    type: file
+    direction: output
+    description: output file (txt) with frequencies of inner distances of all paired reads
+
+  - name: "--output_plot"
+    type: file
+    direction: output
+    description: output file (pdf) with histogram plot of of inner distances of all paired reads
+
+  - name: "--output_plot_r"
+    type: file
+    direction: output
+    description: output file (R) with script of histogram plot of of inner distances of all paired reads
+    
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - path: test_data
+  
+engines:
+- type: docker
+  image: python:3.10
+  setup:   
+    - type: apt
+      packages: [r-base]
+    - type: python
+      packages: [ RSeQC ]
+    - type: docker
+      run: |
+        echo "RSeQC - inner_distance.py: $(inner_distance.py --version | cut -d' ' -f2)" > /var/software_versions.txt
+runners: 
+- type: executable
+- type: nextflow
\ No newline at end of file
diff --git a/src/rseqc/rseqc_inner_distance/help.txt b/src/rseqc/rseqc_inner_distance/help.txt
new file mode 100644
index 00000000..18f97bb6
--- /dev/null
+++ b/src/rseqc/rseqc_inner_distance/help.txt
@@ -0,0 +1,43 @@
+```
+inner_distance.py --help
+```
+
+Usage: inner_distance.py [options]
+
+Calculate the inner distance (insert size)  of RNA-seq fragments. 
+
+               RNA fragment
+ _________________||_________________
+|                                    |
+|                                    |
+||||||||||------------------||||||||||
+  read_1      insert_size     read_2
+
+fragment size = read_1 + insert_size + read_2
+
+
+
+Options:
+  --version             show program's version number and exit
+  -h, --help            show this help message and exit
+  -i INPUT_FILE, --input-file=INPUT_FILE
+                        Alignment file in BAM or SAM format.
+  -o OUTPUT_PREFIX, --out-prefix=OUTPUT_PREFIX
+                        Prefix of output files(s)
+  -r REF_GENE, --refgene=REF_GENE
+                        Reference gene model in BED format.
+  -k SAMPLESIZE, --sample-size=SAMPLESIZE
+                        Number of read-pairs used to estimate inner distance.
+                        default=1000000
+  -l LOWER_BOUND_SIZE, --lower-bound=LOWER_BOUND_SIZE
+                        Lower bound of inner distance (bp). This option is
+                        used for ploting histograme. default=-250
+  -u UPPER_BOUND_SIZE, --upper-bound=UPPER_BOUND_SIZE
+                        Upper bound of inner distance (bp). This option is
+                        used for plotting histogram. default=250
+  -s STEP_SIZE, --step=STEP_SIZE
+                        Step size (bp) of histograme. This option is used for
+                        plotting histogram. default=5
+  -q MAP_QUAL, --mapq=MAP_QUAL
+                        Minimum mapping quality (phred scaled) for an
+                        alignment to be called "uniquely mapped". default=30
\ No newline at end of file
diff --git a/src/rseqc/rseqc_inner_distance/script.sh b/src/rseqc/rseqc_inner_distance/script.sh
new file mode 100644
index 00000000..fe00c590
--- /dev/null
+++ b/src/rseqc/rseqc_inner_distance/script.sh
@@ -0,0 +1,25 @@
+#!/bin/bash
+
+set -exo pipefail 
+
+
+inner_distance.py \
+    -i $par_input_file \
+    -r $par_refgene \
+    -o $par_output_prefix \
+    ${par_sample_size:+-k "${par_sample_size}"} \
+    ${par_lower_bound:+-l "${par_lower_bound}"} \
+    ${par_upper_bound:+-u "${par_upper_bound}"} \
+    ${par_step:+-s "${par_step}"} \
+    ${par_mapq:+-q "${par_mapq}"} \
+> stdout.txt
+
+if [[ -n $par_output_stats ]]; then head -n 2 stdout.txt > $par_output_stats; fi
+
+
+[[ -n "$par_output_dist" && -f "$par_output_prefix.inner_distance.txt" ]] && mv $par_output_prefix.inner_distance.txt $par_output_dist
+[[ -n "$par_output_plot" && -f "$par_output_prefix.inner_distance_plot.pdf" ]] && mv $par_output_prefix.inner_distance_plot.pdf $par_output_plot
+[[ -n "$par_output_plot_r" && -f "$par_output_prefix.inner_distance_plot.r" ]] && mv $par_output_prefix.inner_distance_plot.r $par_output_plot_r
+[[ -n "$par_output_freq" && -f "$par_output_prefix.inner_distance_freq.txt" ]] && mv $par_output_prefix.inner_distance_freq.txt $par_output_freq
+
+exit 0
\ No newline at end of file
diff --git a/src/rseqc/rseqc_inner_distance/test.sh b/src/rseqc/rseqc_inner_distance/test.sh
new file mode 100644
index 00000000..927a69a9
--- /dev/null
+++ b/src/rseqc/rseqc_inner_distance/test.sh
@@ -0,0 +1,77 @@
+#!/bin/bash
+
+
+# define input and output for script
+input_bam="$meta_resources_dir/test_data/test.paired_end.sorted.bam"
+input_bed="$meta_resources_dir/test_data/test.bed12"
+
+output_stats="inner_distance_stats.txt"
+output_dist="inner_distance.txt"
+output_plot="inner_distance_plot.pdf"
+output_plot_r="inner_distance_plot.r"
+output_freq="inner_distance_freq.txt"
+
+# Run executable
+echo "> Running $meta_functionality_name"
+
+"$meta_executable" \
+    --input_file $input_bam \
+    --refgene $input_bed \
+    --output_prefix "test" \
+    --output_stats $output_stats \
+    --output_dist $output_dist \
+    --output_plot $output_plot \
+    --output_plot_r $output_plot_r \
+    --output_freq $output_freq
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Check whether output is present and not empty"
+
+[[ -f "$output_stats" ]] || { echo "$output_stats was not created"; exit 1; }
+[[ -s "$output_stats" ]] || { echo "$output_stats is empty"; exit 1; }
+[[ -f "$output_dist" ]] || { echo "$output_dist was not created"; exit 1; }
+[[ -s "$output_dist" ]] || { echo "$output_dist is empty"; exit 1; }
+[[ -f "$output_plot" ]] || { echo "$output_plot was not created"; exit 1; }
+[[ -s "$output_plot" ]] || { echo "$output_plot is empty"; exit 1; }
+[[ -f "$output_plot_r" ]] || { echo "$output_plot_r was not created"; exit 1; }
+[[ -s "$output_plot_r" ]] || { echo "$output_plot_r is empty"; exit 1; }
+[[ -f "$output_freq" ]] || { echo "$output_freq was created"; exit 1; }
+[[ -s "$output_freq" ]] || { echo "$output_freq is empty"; exit 1; }
+
+echo ">> Check whether output is correct"
+diff "$output_freq" "$meta_resources_dir/test_data/test1.inner_distance_freq.txt" || { echo "Output is not correct"; exit 1; }
+diff "$output_dist" "$meta_resources_dir/test_data/test1.inner_distance.txt" || { echo "Output is not correct"; exit 1; }
+
+# clean up
+rm "$output_stats" "$output_dist" "$output_plot" "$output_plot_r" "$output_freq"
+################################################################################
+
+echo "> Running $meta_functionality_name with non-default parameters and default output file names"
+"$meta_executable" \
+    --input_file $input_bam \
+    --refgene $input_bed \
+    --output_prefix "test" \
+    --sample_size 4 \
+    --mapq 10
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Check whether output is present and not empty"
+
+[[ -f "test.inner_distance.txt" ]] || { echo "test.inner_distance.txt was not created"; exit 1; }
+[[ -s "test.inner_distance.txt" ]] || { echo "test.inner_distance.txt is empty"; exit 1; }
+[[ -f "test.inner_distance_plot.pdf" ]] || { echo "test.inner_distance_plot.pdf was not created"; exit 1; }
+[[ -s "test.inner_distance_plot.pdf" ]] || { echo "test.inner_distance_plot.pdf is empty"; exit 1; }
+[[ -f "test.inner_distance_plot.r" ]] || { echo "test.inner_distance_plot.r was not created"; exit 1; }
+[[ -s "test.inner_distance_plot.r" ]] || { echo "test.inner_distance_plot.r is empty"; exit 1; }
+[[ -f "test.inner_distance_freq.txt" ]] || { echo "test.inner_distance_freq.txt was created"; exit 1; }
+[[ -s "test.inner_distance_freq.txt" ]] || { echo "test.inner_distance_freq.txt is empty"; exit 1; }
+
+echo ">> Check whether output is correct"
+diff "test.inner_distance_freq.txt" "$meta_resources_dir/test_data/test2.inner_distance_freq.txt" || { echo "Output is not correct"; exit 1; }
+diff "test.inner_distance.txt" "$meta_resources_dir/test_data/test2.inner_distance.txt" || { echo "Output is not correct"; exit 1; }
+
+exit 0
\ No newline at end of file
diff --git a/src/rseqc/rseqc_inner_distance/test_data/test.bed12 b/src/rseqc/rseqc_inner_distance/test_data/test.bed12
new file mode 100644
index 00000000..33a46951
--- /dev/null
+++ b/src/rseqc/rseqc_inner_distance/test_data/test.bed12
@@ -0,0 +1,4 @@
+MT192765.1	1242	1264	nCoV-2019_5_LEFT	1	+	1242	1264	0	2	10,12,	0,10,
+MT192765.1	1573	1595	nCoV-2019_6_LEFT	2	+	1573	1595	0	2	7,15,	0,7,
+MT192765.1	1623	1651	nCoV-2019_5_RIGHT	1	-	1623	1651	0	2	14,14,	0,14,
+MT192765.1	1942	1964	nCoV-2019_6_RIGHT	2	-	1942	1964	0	2	11,11	0,11,
diff --git a/src/rseqc/rseqc_inner_distance/test_data/test.paired_end.sorted.bam b/src/rseqc/rseqc_inner_distance/test_data/test.paired_end.sorted.bam
new file mode 100644
index 0000000000000000000000000000000000000000..8b215e12d1a932f1619cf7ded7e172141f45d479
GIT binary patch
literal 10205
zcmV<3CnDG%iwFb&00000{{{d;LjnMD0fmy^PQox0hpTtRm)Hxe<5ULHD+VM;vd!s)
z+ok&hE@3OK4I1x#Sl_~Iz@|9l?zE@<zWz=+ww$Z4YlKGkQ@nH;kUsVwSR_Odr#V+i
zXXHO(-(}7-4C$b662P|0=<tpXJENx=o=+KId(1Xz2-vgP+_o3a+_kXpFqKG!y#)(-
z5s5f~&d94SWNDsed`q$CHuchFl)ykQhCRR&yKZPYf7fK8l`v_<TybN?rQ(L<g^a|G
z8ncNNbOFqsY4%J4f#o}g)eeGnl8Y>j$SUWjh*u-d8%zMC+9d0b3kPX^@EAz)ObM}(
zWuT_^euV=9Rjy-S+oj2yru(5*gZU;Wl4qw>0;k-%ZsST(C`}g)cFWTuiT89-s3ayK
z&sy7Ii=3X56WHr%w<Xp~HN&79VOf!bCCTF-kN6|IJu9RC%5=SqbWvFj_X;6&gAi&y
zH2PEseFL0k-#`ch001A02m}BC000301^_}s0su`WwS5b$EmwKo9KT{4GdZ(7+bldP
znKd0b3kTWf{QxJrGk08uBqYdJN+7}%;?k-JC@M+QAR>89S7C{uiWCPTDz#3XP$C+s
z&xA^#5*26?p+YG#h&GCa0JXTSQ0t}<icG$LJ?6Fd+54PxZ|2@}&faTg?{n5S-~ayC
z+U-_kkH3qr<e^uwt>~%fLy<e~#JOkj^WjGxIovrqJv}&mVDI$k=p=gM9Z{qdS3Hr4
zVY+KIODj>Pigm5zveTlGwPB6vOwqPl)Fl^PDnzFmW7?u=+p4INMy0$-)57F=9+z<$
zj=X;qXEcs88GXz1(p?wF^uS&k)5Y#FouXlSM%Tx<EW_z6v+qP#=NQY&cwv9iBl=w#
zeaB-A(aSM{2e|f~yH|hvoqJcKM_&0eyU|a)`s!A7?OL(**WUcs|M@Tf*H`@Qw_c4N
zd)w6)zWwc2qn~?6^_sW66X%{C;pVWs7QHSS@LhcGd*55a@&mU<Q2|h7V^|{7gb7i0
zf_16Ug*JwzZC6*NmZd6nZFF^o{?d5ifS`$G^pvJZM+Pi2{9DlEFhfk$;u*diWO<qS
z=dpWnj?twF-&|e0`UK{C^Bs5ou%GX3!+ftk@hVT9?xrYWcDj%C)Oi+T-<wirclY4r
zc*k-lNvm47O~F%;q%5jVC9N=;nY6CTRO*^(UKn1b+;mBmFkLaG5~1o;x2-Blok*ce
zol3=WI^w{Y5p^cddS=nTmE(CvOvv+oWW{CSOrC{bmu0!blE&$APG4mSD8Dm?G6HvA
zM%*E6JeG?QcV4#jV;;<3@4<X3`mhJ{LpMj!wXG?b2gj$UC(%0qCYMRtaZ^dv6s)RE
zBV^S{rIX4SktT_35+M`DQ_(isu%fM4$LkhXCS}z$LJ3()-j+NO+qpf;g$K}*EMK_C
zmQhyJoVa?>gWP8Ja_}gFtl=xiw;0cI48;D`;qu&$*o!P{OAn(J>})}&a>wPIMv0kU
znTujcaDK7*Y7oV{M{t%~ft%0vaDK4oCh>J^DvD!no(m~vB={>UU8_P$ooZo{l*vxj
ztOd1`RN|FHl{_PkIBBHE_K1lr`0pl8Gk27t=a~b@tD-!B+><dIh?!fJ7`V8SvT^?w
z_7XbI!_8#E&Hp>%p#$?;^oD5Q>u*0l1=Df!87MZROa<}*Jgt<hH9^X&npcSdQI#kw
z)^<8csv3MXwVhoV+sRvk5KLZKWed;A-0ADgagn|)0#!Z1@)-<y87BUf*~G7Yaysu9
zjP%<l1Bd=|KkdOZK98~gFw<{`ho=VzmP0LLO;Q?JC21;o#kHtJVGL%Sa9t;90&&HF
z;7yb0P9!jj+!RtJrr-%Qp5$FpBuxusoO<hZ()h*>59hbtQz0Hxqa4UYr!q2mj(Jvz
z*;AR5H~#{h=<P+h$l}0K3<JvFy%>iAn9q+m6u=~ae|RR41DHDD0HzTz1TYbhu|zi&
zZwr8^mFXBT?S$eYWy%O9(grv~?ZJ%jMjGC<X<|w);g}Sd04bQ9JOFYg7V!eg#;I&e
z9Gq|(u(t(HtQ;X@e<!Rm10){JfPWl-r}thghMSU2MRPISrNGPI-Q;N8IdL?Cv3SWX
zgXImz;#;>k2V@N9$-&{lo;4OT@QNvT$vW^-Q@0W?tazQ^M|;I1<rvs&_k1La1et&8
zOowymz@XS&5lm+sNM~;a*$?-&WE!l4L*kxWo8rK<hNHCCS-&l|Mu)B-IRDWY&YJ+|
zz0O#?_8|}FT_ZT}-TID)?o}f=Uq2dq{Y=o0P7inYqfbM>&4jf|lG?x~7^NFk@viE0
zr#jK<vST9A17J7qh&`V$>(|ef+b7OeZl9RUdB+*Z@tl8SCXbh$^Vxs)bs-T1C&!#$
zzh=%ikLUacBM}KsK^+aE^d~br=ENqatJ@mhRI8F&NL`Y?CNHZZuM6VR=)(Fj5d4ML
zqt>$~E52}=!g@UZ?_OA?v7pD!Jd^XiL|bTqtMA5S-g?I`2G-s_n#{Xj?sdTS3kK`-
zem|K6WAC2@ZimMwd%Mx6Z;zr{a+VtSHZZ_dsuG==ve265RB71?1)tGC##05;Y?xt8
z$fo9+o0L~=lPWkpLY<q;`3<_JTsG|Cb-?Zy=jMp7F-LssbZbD0?K*Sx%h7=7&&@(L
zhu*&cdWBLTcOuJ{rAZ5Qi1<t*$klbqYu)iAVMfCawOm$QNhJ!V8(}J=D!7SN3%$zt
zHrXGFILh3GpSd-yxicr3Re)LS6`c=%dywKW3RY2O{*kjpiwofCh)3Y<jKRBS2Hw^P
zynD8O+=KVG?piiKcfT--UOqKH`#YxxyF1qWR4Jm8hIpiT+9e{9t!`m=suH0cQV1N5
z5>upISYld@*f%M<#H2_RBm`w@+Kx<Bm1-BO_<&^L0<d_L4Cu}5h$|!h_(#1S8hn7>
zVCPn*!}ZSkTQlWvo;6Q#7Q3i2cH@Ba8rzza@qrnh_l)p-VCzS>2JGg+3Ss=Ysb2DU
zl5b?Vfv_qG<XX<)Cne-+LXwjzl`!LN0yT|j2C9qKX_087VDcH#E)^o28euq`PF2=Q
zCe}dX?+5vabXL0EHwwnG1x=Mgx!il$*#Kfb*5`2+d~#grV!ABO;@&Zjy*Cw{rXiW*
zoP@<9#GOtn&d^-t9I=UW^j`uKW1tzmibc_HMsFUCMN`GNzjttQbQr;{K{S^@u@M-$
zDmnyo$T75_T!n{aC4`b%CX98R5t_G7Z9DoorEdRd@6V9#cYcdwl4TIh)rQ5EE!M@P
zE6ESf9q7(sa>*%+nw>YzGdR$8S|yR>b%W5IIV}=8Nvgdr6mOM{JW>Yvk{uLMTO-MW
zA;o3Qs?<mZy)O)h;+KswMkAJGr0|TSt4({wdRvz1G>zEJ!QHUf&Ny=cf{V^<27u=5
z95^pW4vfr#5d1{<E`+F~m`!j6C(ygxv3seLLV87J1<vcRqcKZfP+hzFIgsRs_^*c4
z)h#3A`MKag-@d)9!5-aS%6je}!~Hq6VAgP#m1>)|0;=$YkjpfR!E82$Gsz%<jcky>
zf=nh_rX^fyQ^BX!kV8l*UJGlA6jsxvS8l97m~TEc{e|;Pm_6ql=w~jbz;5+$KHS6k
zRP>f;7<<bM&ZDE#<HP95+rUjIDM|$j$q?t&s;=NoYD6GyEm#U8z<E-@1wqbOG%cbP
zWJ%e1amz1pW_kdMH_pB4FHe!UW5la3Pk?xZb1TL`d}!)cTrUvkozr6FRasu<=fENe
z*d`#x0`}#gtsdQ8Hfbbuiy073z-<2Qypz|eYEmRqSgK*flD4JGp{Jm%7%B~hOGjzz
zTY1L#>{{uPa=A~IJ2cJ*<r<tep9oMsvnhA-{gd2D@V9=7Eo-Z<VeH<izjbhQcyQ>#
zeJ07HSE6otqFdF$n}^~D*F=H*FoWhtykBsMs0Q^1sT8?q9sDm1T_qV6BwCIX0F2?4
z8zyzZSBTGkjk`^GpSsM+#JWeByC7s5Afnf9-MUzEIQUy%W6R_ujK4MYw>+Li&K`{l
z{u3wCagMBTs(7Iam{n20%Wq*xInsNYC3K|#;vLwGXrXH0yCPf!N!bicn0^WdMzxG}
zVD_OvS+2|uUgq%RoT0gjop(>z8PNP2cQ2<&Z%U(RcgD`+)03TJmnKEUOSCDz8MygE
zlmgCH!+0xrB@`%#FjXU0B^Byk8YLrmFyO9Am_*L1LnfIVTwx43V>dpvG91}hYlirK
z0M2Dj$+7J(bh$mC$v2{zu0)fNo99Uh;V;a%IiLxz6|hOk5R9g^F;&Y{K_XmrGBrjb
zm)8=uHNu3B>S+nW1kMVUAUJ5?#2AS)h*c{UJajLB&M}C6u_5jwgK`4F^0N!ykTcCu
z;O1sDU$ipo{Oxp^n-46a=;^6ra=3#!(2<L*Sehc23|}s(;q^<SHT<^Dq=k}gqF{AY
zgTzTnejr4fQ5J=n7D-fI3(AyqaHW%~l{&d0++6Vn8{XC@tuq(*+IVBAg;>|-3!A`X
z6ELrC4ZsCz{=;Yh`2ML)_h9DKD{x+@5O0wkm)Z(HB?Azy!o^N;6CmZxN2D~p#Yif%
zFyme<<1ln_c+Y*Sf;C@)vD`W{@rrY;hw<O{Fg_Ojs)zA8jD3E_$^E_4<J0IhfKfm=
zg@l>b32;N^6_y0jT9_6x->5{Sl0iLos)b5z(vE?(2=H{5ih{|yOYuUfQlZ=Jvp5;w
z2utEZIZHPe4tmo~@onDM1{@>v(FMTrGjlBOUt@dj@8$dV7R&N|?>$lUzh_t;>>Tbn
zH}i%;$@mSjJs}*+CuCef%*@x}dTp6cHK+S)0Or>(X2?TO{9F&_2YWY@$a*l7Z%0gW
zGfRz<H%pKfPB@1*1lg@xs(7|alf_|hHzhKn6^eB=N7~sah`2<`56)AgxGGY-gOEI7
z+qM{#*<6S%*JU0P7p=H}KXc-p`H9DFJj(|szITe^5yG>ggX8*Q<ca3xD*6XG|IDVK
zcr51+^m0x-4C*q-x#jB&PRC7>^UGp~C`op3;bE;>)SOjSUdcm6&2^`QR;Y!q<a*U<
zhf6<XOT&R_fm!*AqWTC(yz#gPXEC}a57`}8DfL)>eUqGTuaxsE_bj&>eHdf^b0+7<
z`^P)Zj<@Vw!0{Py$c$0$K52_CP4JU~BKx;5${TgWtA{sOqNO$ufcf;wa_5iy_t!nN
zLeB5)iTUAs200JJB!JTyF&&shOc-w}8`nH#jh0jzO43e>isNTnD8m}wnhtPP30!yh
zo~VPsTNf>`q#8blmPHm3g%cQ{Y>?JopHYj<$lneb=n=KnqjP!V6^QxtCStyDLd>su
z+<vpi@~P<6qp?@diFvetauR(JCB^fB_;?^)s8Wowc8-hv^F<jhaamRe<pdSX??>iY
zoR3VWH)=Gv`jN@(_M8eE&+cE(nR3zDg$B-SawoFYcc}kP8fNOKP<kLg$LzMovn#wD
zyynHjz5AtT82hE^y*t|7-QC-dzW9AngfuQvPDLsb#Z!Yw3ef^m!KOjHm2w1P2pJUe
zQ-Z^RKzW8MNDhXP$dakQr=wdqyGtvN?Cha4rJ^@$K6JC91eAV$j?#ChD8(a`zB@r_
z$8lhc(%+kM;Krden@pY!<X$n`mD)7Fj6MjOU=Jw${2G*QAEOj>>gWH`z@=WNz9fpC
zpK<AMcYpuH>Qv;~sMrEO5_K1ZNJ*v3G(~)bOfaFAGQkt1mt<9>NZl#XwWytHV2Mi+
zw-+4wJII;l-l=znIPMFY-f}x2MwPcRL`$*Hr`ead@?9Qk%AwYr^_Sb4C#mSnXFRM3
z=e9kEzOqHWh<)=J>2)Ca$Mf`DJ}cmjjeWjVZ4I~)mN$WM{~#Lhy=lfchh>AaPu`AK
zbTeE~ypv6b0F#`3s(sPHX<UMP$dFdG;?yFGYBSeRQK*vg)U}8&T;F);R&u(^rs$}N
zGtRx^<REhKb!b&z@;+TH%NCJs<E!VVN4~G?kCa+SzF0agfp{l@_}%~Y?5bY$J9}sT
zz8_fbCw>xR+gnpYo*eC*`Wk(g)?i|b)Uj!ZY9;cSb&5i>2FYr}kS=1-;ao6dl2W0n
zTp?r^sEn#s3x*1GDl4iarsFX4f`Yi@2K58+stfJ+aawLEK{dLL;QX^q&U`j;=7R(J
z<PR*T<p|>MJU`{6gVP3@6GRfNJE9$j!s`^O6$TMy-8Iy<s7-|!6bdl`7kP`PbX8(n
zRGyPgGd>RvC$rDWaZ)m$IRtB9j>~0?&v^uH{@JDq{oRuaeaLbC$6`5ZfA3$8qMx2}
z^B9HfBbR@#IW%BFrD&6C(IV;;9aJGh!H4=FZ~}E9+keAFZBUve8v__oLV_wqEu_Os
zYSFS;|5ARw$*-wcj6$Y7Jea+C?&=u6w&A`9{TkjGInM11W{g91h>#1^43bU=|JIb6
z9!-+;1PS=M(0~uICW1^P*=s7CbtrL2l!%ZHL53Xwrzs)L3<xR#u~v;JYnZ4ifwDkq
zu5BN;E!nPb#LX@M;V0^5nvV&bZzkR4bVqo5fV~pW^~LNU>VN+Sm-BPC$SAsJ%FdJH
zozp!R9tnoXQn983?M$Uv3;Qimzo>-P)L|hd^<LB_DP-bSx3G?PZPLo5<5X5cklIja
z+6EVKYz$^d#M2X{H@Bnauq<4ehnrBYKs_G~xs-7p%#ID%<6xaEId9wA6d#SjynpN3
z49uHHrOT%=_CKO2n1@G)d&klCZPdCGMQ^<M5}+z6OsUdNaTJM+M23zE>o8to`!boj
zaod=;GWj^+7WZddf-3e6ER;#1$F^6d^!-7U)uPpB)<d#+7(y2s^s_5nq%$g*c@OK;
zJ*-2jj-Y<g)J5{JMq3WncaWP@AOk{cgwCR12P@RJ$~5qpltyAtYq;|%{=@%dX^}uh
zRL~KrdYpVE>Zo62eKS{P9YnZKnR5$i0f8fB9-N)rx=PuY(s+SS=f&1~x#mY=wYzLA
z6Xb5qll=aM_|pCy)|&zAT?Fel-}LLN8o}?{`XdkF{~L+^Px`SEqW^bhY&|(VJvxfM
zgLrq2pJ_W()tfnfkLSJ<*e;>!|64yhc0;)f-rcD<^wL=x`o=Nm;oFNb#h;obf3Cg{
zGyFf*7s3p09fc|H3$}vv*gVBcy!rOjR(Rd!n#cw@Vja8{juH(jhN#@Y&QgjEg&I>S
zfszhL!4Sx`90sQCYU&kFD^W>f1Q=C6?!pvm7Q_7}lJq43*9U9kirD>gv59w<Gq;#?
zh<sz`a=T1%-&we9(7odwo{Wx#9a;GL;%yhS6;F@I5#;dU5sBV6lS4<CXQ0*!l0$rL
z!city7LFfoEo|=K@hx|yZ#Z{@jyK+=TLc_z^Lf6CDUV}n@Bh)atZXlT#53jJ%4Nm<
zhL<8Zn_9us{o{kZz34T!B0Re(vOV(#fooeU)S?RrhHZR+P{8{|a0cDoB8F`cKp@*{
zc$462rYl@f>zX0_O_K%{X`G?T%i|YS+{+icbYonGRg7bzxQ^A>=NPh>T2M((xs-!l
zDdie7U0Z(^5>(6G5_xs)>Yq#%_lriTem(dWUzf|C?=3*}-%S<F>F(*#@vilJQ3usP
z2em1b_o?NO!_sMnaH2Da9AE+A)9Q*N9Ft87fF%lC2zjYR0%3-(sG^`D!pV8s=kmOq
zx0OtzsnO3-)Vdg6KJtg%sorSP+T>7#9@hMjD*MDH$Ct0HR}pY?$Cm(p<y81Qn0CqR
zrLjweK)eQB*idH$SK`VDGC!ro)VIpLQ<j%&;*8;jtWJKG=cWH>QQ0Rp>9RW}x-8g+
zH@tM&Hjozh^wc(Zi6=PMBZPDT_*z5QTZU+?MI}I2m1w|XDR>DdSiquy-pttL+}2z0
zerV=Gq(vT%Ebo`=SuE``TJNJxSm};94iY|i&;$EP4J_6G83=n;U(|Zr5PLj7e*Ylr
z@9=nj{(h(Z$9Nv^pYHEO(f5(8!_h_k4`~8anqe}fDH4izX>Fe1$Q39-%Su{sx1-Ru
zk{xtqx)d~A?ugGA&j)AC{T6WS&GS_9GiO#yu0HcequGaYLU6ALr4P&m)*(Xf6*C=b
zadk>*JeG8<X({HHw5~x46!5_v0ZF}*#olKMYcoP)`XX!%;m+q9raB1Gn>V;u<BG!j
zUK|#=_P6}8=okD1|LPA#(f^;_@{^;3185}N^65N~_GybW#Tci!$G~$!-Ay9{2WlvM
z!K}i^<XR#_<Qp@`QyOBD<s<V;ScbbgQ!NCTwRsEIZXcF!dUu;z{%J{O25^3VzF_Se
z0OtpvyyKx2z0uzYwvT|AcU=--cg*g-1BYxMZ(6Qs&K)XBT5t%5?ohQwS(g$*5?&^i
z%L_cz5DVxUTG9aMl+q}kr-r)qOW;+Bd@=O<W_|&^U;ga7QEXHa_bn>6Epu2Q+yfi;
zi+(2CPYgQ9J(}%Iv20BP&whWC?Yn1Xo8W%}n0L<#;xzW5*^<?r-GigkeOD2eoY%5O
zt`^zd8ptBEh@uR~w@LvlpbULY%ZDln-2>i<E|ui2F=cn<5H*BQW8785y~bI%WgdQE
zv;)Nz>f$(L!t+4SfX0}p;f?&hEHn1{4J2aQxt+O<UHsaw%-cM>0L6I{=3<>~6Et_G
z)TFVu%of9r&}?oXntqcSJ42gK!_@3-?P42e$a0VEBKG_Wg`0fbr@F}U!19sd>njRl
zVPATb_cthTQvgjfPEN>KdiUlLnsVzU9?dWI+<Yo}S2T>hYtGHRo#W%<=t-!->jLv)
zK|+4P(<3>aFC!$3-aa>k&z;%PfAzTuLf#OL5qi&@Z#M`b`^Q>mYC(}CJqlru@4(1>
ziZ--T#rd>;I9^~mIu_$ofpiNu99TpMy>tyiV@vwnD?LK(%Le`SL66W^Fm~V8j6+99
zdxxjdj*XPYLRD$RpbZk(2(zgGs5{z`q%`nCTLbuz(2ypDPgQV~4BMve3{N^LDww=C
ztgFeeGBgT61Q&C<^u}9}I3F8?Jodtw^?Akqdp@oTy49u2`Rx1F)CcbC{rZ3UvOye!
zU;inL{j0e+9_^usZyoz}=*UDea!ym)wyG5x9!f1L%6w5jKJ}o(WTTpDBobq?c|5;p
z41d`p{GM!7-f<RUvHa_anEz~(U(Z&q*8Qy!p21jr6=R=W!t;1%-<Pk9syfu4;LU2?
zNEEC%ycZ=q#o+5TTD1yU5JdULH1Pjg4pdQ@K_w6m3(1jR6pG=lC^5jfSS<Yd?|5)L
zhGdryIb*-mkRx0^a5U>_=eOl>{Qy2y>r33$h0fdt9Ijahx!%nG4Y-bWA)~rD(ERu&
z)4RR0diALu%^`><#{R@y6%OpYZVY9YYP=lU^zl9y5d>|j@kfMN5ufL?%kpt!Pw=(#
z@?zu<YI7qyZ=JC7)mwv-yn7bKlQR9<^K(3{;<PE=>w?hWs?MY}EgM#D5%VY@w;Wr9
zO%C$BuQhr9#%9>Yojs1Q@fsaFxdHjvr>1zGqa2v76!))=2pYtlRKP2i2-=JLMRjDt
z8KV?Ar<KEou9B(&+(?{Q(RIe!?)m4q3J1}qgu}Ln0dbPZ&~)o|X3M>M?sqN9C(VL+
z@1Do;u$hFv4O2@$v=@1Letc8u|F%i#KLmk4{lH+?Lvi)J82j8@d7hjcpB%dCYMXY3
zbzO?^H=!Ctswyr}W}(tbgHX9e%uG$EaEUrFk(wxI88*CZozPwg2(6JvK+f4m%x?Eb
zS69irW%fPLJrU!wH(C@I0=&#M_{4rIqwr-z6NhEiztml3TiI>Y92UFxZPplF#4fc=
zVE)d^a@FsB>^B}-u`cwko|^A{V374dO#=Akb80#;-D0uzprsBp?Lh-`Ycg7>Xw}rQ
zXBSAI{+}jxmpg}!FXmZljJCYW@{uaFQ+AkT6Y*T1lJUx7sfB<3ib>e=JDV&~ywVbh
z2bcY%`!V)U=G$5B@9iJ%J4?jUMlh)W3Qr3#6DgdofX9TivZyItBkPW~<Uln9<-t}<
zAWOXzw4aFqHw}<%B{lpE%WTiiO|3sxI$7EH?Cc7=b7h~Wo}KfH{s_+}HYv`<O2v8q
zgUgDOFn-f~3r2^hT?1Y~Vb)63QdF%;O(8o7I<LVwEt!@gMVX9OH42izmLnAEbb@TC
zT?eiKbO-ioU8|&9;!8HM;Js6nPi;s(`?=!Od5>9!Ik5AIP3*jNB|9Ho!Ol-TxRhGl
z-96kr-gl+j3-PakW`NE#Re_utijZ2c7MLRQ%o|yqU5J|xp3TBDBJ04*ETl3<{zJ(8
z4{tE|W_B}@RVzv!ShF&8sCInn!DYXbFur5X&H>Lg_`tbGL{7Woaa2NTc>A=gQ3~w<
zjG3ZxDD46Ql^`U(r`sXMbS23?kL#o~8*Sh?UH(2#C$7E|SvjiWja{qx)$!yeoUuaZ
zfi)Xy4SuKDS?1@XyHWJkS-`$`cyhSoHn43;S5`>pssaW+5wuYeqbhMLRFN{J7_DrA
zbJPNIT8~Fdb11Jt8y!_i2kqO!C;?e@ku6oGj{MmUq&u^s=iKd#Ipp5GxeM=``LpyK
ze&<~q{m#25fPUA5_t_rM$D*Gdjs5Ig;7?BX4)>y*_7dTV5DL0bm0HuvCx#-ML9SfX
zWc3qXBm(HBP^dgr@C2?iG@m21;xq{L+IfcTGiPs4_?gM<51eZ=p8Y?bi|2LB{t`O<
z{6`Qcntirr_BV}ZAH3w9-DNNNZ5aFL?A{|JKG|{02~Z<6DeawrDw#}BcjXPFifhGS
zJd>stFqN_u37#hkCe)-I>;as-N>s>=!M!UQL@g{~R@eLB!aA*PGp~@dcd3NM!VSf4
z3%1y~$9}IgdjWNF`9AqLZ1U;%c5=I9QLB$#@0t0kjFlamU$7ft<v!=1h21^h11KL{
z=Oy1d@sdL-@ni(%6CTV*F!nF!U>+PD?w>?gXuTT&$=3sE)&Qw2kXmYSLz7>t-YK8d
z{Nm~5tE<9*@?&$IB-iL9*&EGAc9)Y21n*DIq|!rajpp^BCo7Ezr9^mwu_W(vUwucb
zo8hQ4bME2(g&d>c#Y_3eHtG1=RvOJmcbA<IGNeyDKf`k{nx=)JM5ezf5+iGrL%9+a
z5(j{&E#MV1Rk9S-VXb9dwoD0;$Qr}6M+gcBsF7lfR%j;873Xfm-rXM+j6x2<H`j%U
z<|{E+hfjHqS4`g3Cu{DyV6rCczxB2eLH}knDAS*r6Vxfr55R0(2FUHqZPMpre^O$Z
zUqiJBd)3*sLO$;A8?pWF?qRPAryGZm!=KE3t|oS$&G4SN{ru9IdDW|53X)pwExTjC
zwzsq~0%EU|-4o~DVvZ=B3)D|4CJGozl-Kc8h(gga=p;p`#SLdjP$g+)5|-eELRJgD
znQ4#+Ol2)Z%Ua1M4cEcRoVl)ZNnPo&4zw6jGh@drAC1H=C+)J-&Y{hm1qu1HbGf&7
zuM8J{ZEsmp31c=R)(Fp};YgRjhHy%yLaWi9k_rlrrK;>GXV4&lnusdZg$4<cdZo?F
zjBF`$K#ncyeTa8il5UrdTmJJB+!70$*pGu%&KFtl&1bU}E(5In@MO2Ca|L$Gw<Ny=
zo)3n-^?N)Yi*z)M={Z05cTY}Eqbs*l{{l;FBQpGc+VPES39_qPb%vHwB11sF9YS14
zut+LeOe#~|G~g+GA_X6?-?($tRM#mt2XZ!U?#Rp8hP<N}pV>&2S>yYzIb^r5(QUU+
zA@fZNW60h;r{Il+Yzjy|nasLl^mz<%c^+H5ijaY2_X4tat%L0531p!|^h<lorMe&6
zUs?pYyMMd~)NBgsVuA@I6>1<&Qwb)xfWO$biq`OH*o!lKzsor#OU+vD$OZ|Id*|F`
zTz&B~;OLbCS=X(NE6rX!$w38A`oE3f44(8i_LeiG`v*IR2+GKlzA;GBz8&j5=@lZE
zuXwZ?+Hu-%bZs`fY_!drKfugixtu5cjTQEU;C<6vm>rbXp4<=^Wz(hgcG$?xmU%6#
z@pz)kk49U<Y&g#9W8N?tB>h(|=Sh=P&+#PbpRLagl5Y3NB>iR*>bRw@Qq(o^Uo-+~
z1o%COhM_Ha!;y3Dq-k_p^AeXzTvfC%;ygtW3eh%{XZ83f{nLxw@+7^T*#zNg^RZ;4
z)*r!>-rBlc_Wn)#%c`@(*uR;{`oZqr$^L2h^qcEK5%tarnfw%a)%@H$?gT^@Yp<B<
z4&V3bIi35Wb6$q_#gGtnd%Fh>Vd?qNi*2p-SGES^0zE@J6CwQLGjaE5?%0h8S&4F7
zf>Z=j_*Ben8zetbJnl5o`lW%hjXX25TAUnoZnS1d={E|=3m9`%Ak0HNt@sreA%_qy
zvpc=JB4lXxDtq3>Wx2Z8HbFES0ePNdECE5#Kf0-#>CTniOxp*8;}`_}VT}F3oR_pG
zjdR42XDDRbw1yUxCP)$z{mM?4Ey^CCo6^vs(2yL(<+4l)p=FnLDUuID@RAmgmyN;I
z;HAqm$LE`@f0nPiY^+k_ksgji%`^6O>8wxn_`5Yp@Bq(GUMyk`HvQoq&ky!CoiIM0
zGt=QoHeI9Y(HN9H>>l}WD2uvc1<D$t6}9FyOS;w|J_O=*qg9G>Nzu}$IJ9*mpc-VV
zfNj@u=4O%EQjVveoA|=T!SS?{)tBwg*d{3USGbPZ3$KT;pN6=w)coWon||j?oBplC
z<(T_VG4`?f=Y{Q`oF2JsjwpE}s)9Z}lae|$q}Xn53tWYOG*=12#*T6OsTkDM$d&05
z+H4+LmXpRz6A-pi%Jeb!Xpyq}%6yl0o|SVK%J0^=3QothGs5*=t-6>fb9$wZjuxZV
z6yW)hd9TQQvqjEqBI>~e5q2)%84AdR@oVQF8Rqb`?G4urBdfv78miN+ptSqj#eTI>
zwg~%ClX;34zE0P#x3}Lym>maB4%_W`470(MpQ#;2OAdP9)GN-H0?m)CGeLK(>~a5v
zqvaI?e~7VfFMXQb-tMVGlXF#;N|m$|b3>c7(!-i|&_R(?Q7RYGE_9h7hNNaO2)nF=
zN$qFZbscKW2|P~CO*!4C`Nr*~x9Z5|u$~zR5Srh-*rpqyLi5q1LDoZsCOU?{IY;wo
z7e1$}(2(t+9Z4k0nNXMXIT6$nrr~~S##Kch$Hr;tk8-T+8bBvt%L@<^3AQFRNK7JP
zzsR!K<?FJQe*EgU8w&R$A7R|&<C>MJh_kd;(W*@%#$evxE6zVWS}rRPUGG`?Y(Ps*
z+o60(=unGLM%a(Vk)St|nz;{Pu>zj^&o{|@kGxwFWak?crITjo7}{1Q`!IGN9GK<T
z(Z4gk8D7-Cxyhz~|4QGTh&b=OA;NCY@pR<0zWW716ActCZE(~Ip{cVTo;$+N!Z7Yu
zZ~D(Mb=yGXp(kM;94%pWrsbYDd(B^U4mAIGlc>LNBI<t*BU)<_B6|P;ABzYC00000
X0RIL6LPG)o8vp|U0000000000Q5X>i

literal 0
HcmV?d00001

diff --git a/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance.txt b/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance.txt
new file mode 100644
index 00000000..e5f09f8f
--- /dev/null
+++ b/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance.txt
@@ -0,0 +1,49 @@
+ERR5069949.29668	-4	sameTranscript=No,dist=genomic
+ERR5069949.114870	-45	sameTranscript=No,dist=genomic
+ERR5069949.147998	94	sameTranscript=No,dist=genomic
+ERR5069949.155944	-105	sameTranscript=No,dist=genomic
+ERR5069949.184542	49	sameTranscript=No,dist=genomic
+ERR5069949.169513	-92	sameTranscript=No,dist=genomic
+ERR5069949.257821	-139	sameTranscript=No,dist=genomic
+ERR5069949.309410	13	sameTranscript=No,dist=genomic
+ERR5069949.376959	-66	sameTranscript=No,dist=genomic
+ERR5069949.366975	-106	sameTranscript=No,dist=genomic
+ERR5069949.465452	-19	sameTranscript=No,dist=genomic
+ERR5069949.479807	5	sameTranscript=No,dist=genomic
+ERR5069949.501486	-82	sameTranscript=No,dist=genomic
+ERR5069949.532979	-96	sameTranscript=No,dist=genomic
+ERR5069949.540529	-61	sameTranscript=No,dist=genomic
+ERR5069949.573706	-63	sameTranscript=No,dist=genomic
+ERR5069949.576388	-77	sameTranscript=No,dist=genomic
+ERR5069949.611123	-125	sameTranscript=No,dist=genomic
+ERR5069949.651338	-33	sameTranscript=No,dist=genomic
+ERR5069949.686090	-29	sameTranscript=No,dist=genomic
+ERR5069949.786562	42	sameTranscript=No,dist=genomic
+ERR5069949.870926	-22	sameTranscript=No,dist=genomic
+ERR5069949.856527	-69	sameTranscript=No,dist=genomic
+ERR5069949.885966	-32	sameTranscript=No,dist=genomic
+ERR5069949.937422	18	sameTranscript=No,dist=genomic
+ERR5069949.919671	-116	sameTranscript=No,dist=genomic
+ERR5069949.973930	-79	sameTranscript=No,dist=genomic
+ERR5069949.986441	-22	sameTranscript=No,dist=genomic
+ERR5069949.1014693	-150	sameTranscript=No,dist=genomic
+ERR5069949.1020777	-122	sameTranscript=No,dist=genomic
+ERR5069949.1066259	-4	sameTranscript=No,dist=genomic
+ERR5069949.1062611	-124	sameTranscript=No,dist=genomic
+ERR5069949.1067032	-103	sameTranscript=No,dist=genomic
+ERR5069949.1088785	-101	sameTranscript=No,dist=genomic
+ERR5069949.1132353	-142	sameTranscript=No,dist=genomic
+ERR5069949.1151736	-55	sameTranscript=No,dist=genomic
+ERR5069949.1258508	62	sameTranscript=No,dist=genomic
+ERR5069949.1189252	-98	sameTranscript=No,dist=genomic
+ERR5069949.1261808	-88	sameTranscript=No,dist=genomic
+ERR5069949.1246538	-122	sameTranscript=No,dist=genomic
+ERR5069949.1328186	-64	sameTranscript=No,dist=genomic
+ERR5069949.1331889	-132	sameTranscript=No,dist=genomic
+ERR5069949.1372331	-29	sameTranscript=No,dist=genomic
+ERR5069949.1340552	-140	sameTranscript=No,dist=genomic
+ERR5069949.1412839	-117	sameTranscript=No,dist=genomic
+ERR5069949.1476386	-98	sameTranscript=No,dist=genomic
+ERR5069949.1538968	-133	sameTranscript=No,dist=genomic
+ERR5069949.1552198	-67	sameTranscript=No,dist=genomic
+ERR5069949.1561137	-59	sameTranscript=No,dist=genomic
diff --git a/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance_freq.txt b/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance_freq.txt
new file mode 100644
index 00000000..908326ff
--- /dev/null
+++ b/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance_freq.txt
@@ -0,0 +1,100 @@
+-250	-245	0
+-245	-240	0
+-240	-235	0
+-235	-230	0
+-230	-225	0
+-225	-220	0
+-220	-215	0
+-215	-210	0
+-210	-205	0
+-205	-200	0
+-200	-195	0
+-195	-190	0
+-190	-185	0
+-185	-180	0
+-180	-175	0
+-175	-170	0
+-170	-165	0
+-165	-160	0
+-160	-155	0
+-155	-150	1
+-150	-145	0
+-145	-140	2
+-140	-135	1
+-135	-130	2
+-130	-125	1
+-125	-120	3
+-120	-115	2
+-115	-110	0
+-110	-105	2
+-105	-100	2
+-100	-95	3
+-95	-90	1
+-90	-85	1
+-85	-80	1
+-80	-75	2
+-75	-70	0
+-70	-65	3
+-65	-60	3
+-60	-55	2
+-55	-50	0
+-50	-45	1
+-45	-40	0
+-40	-35	0
+-35	-30	2
+-30	-25	2
+-25	-20	2
+-20	-15	1
+-15	-10	0
+-10	-5	0
+-5	0	2
+0	5	1
+5	10	0
+10	15	1
+15	20	1
+20	25	0
+25	30	0
+30	35	0
+35	40	0
+40	45	1
+45	50	1
+50	55	0
+55	60	0
+60	65	1
+65	70	0
+70	75	0
+75	80	0
+80	85	0
+85	90	0
+90	95	1
+95	100	0
+100	105	0
+105	110	0
+110	115	0
+115	120	0
+120	125	0
+125	130	0
+130	135	0
+135	140	0
+140	145	0
+145	150	0
+150	155	0
+155	160	0
+160	165	0
+165	170	0
+170	175	0
+175	180	0
+180	185	0
+185	190	0
+190	195	0
+195	200	0
+200	205	0
+205	210	0
+210	215	0
+215	220	0
+220	225	0
+225	230	0
+230	235	0
+235	240	0
+240	245	0
+245	250	0
diff --git a/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance.txt b/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance.txt
new file mode 100644
index 00000000..a1930c9e
--- /dev/null
+++ b/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance.txt
@@ -0,0 +1,4 @@
+ERR5069949.29668	-4	sameTranscript=No,dist=genomic
+ERR5069949.114870	-45	sameTranscript=No,dist=genomic
+ERR5069949.147998	94	sameTranscript=No,dist=genomic
+ERR5069949.155944	-105	sameTranscript=No,dist=genomic
diff --git a/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance_freq.txt b/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance_freq.txt
new file mode 100644
index 00000000..021311a2
--- /dev/null
+++ b/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance_freq.txt
@@ -0,0 +1,100 @@
+-250	-245	0
+-245	-240	0
+-240	-235	0
+-235	-230	0
+-230	-225	0
+-225	-220	0
+-220	-215	0
+-215	-210	0
+-210	-205	0
+-205	-200	0
+-200	-195	0
+-195	-190	0
+-190	-185	0
+-185	-180	0
+-180	-175	0
+-175	-170	0
+-170	-165	0
+-165	-160	0
+-160	-155	0
+-155	-150	0
+-150	-145	0
+-145	-140	0
+-140	-135	0
+-135	-130	0
+-130	-125	0
+-125	-120	0
+-120	-115	0
+-115	-110	0
+-110	-105	1
+-105	-100	0
+-100	-95	0
+-95	-90	0
+-90	-85	0
+-85	-80	0
+-80	-75	0
+-75	-70	0
+-70	-65	0
+-65	-60	0
+-60	-55	0
+-55	-50	0
+-50	-45	1
+-45	-40	0
+-40	-35	0
+-35	-30	0
+-30	-25	0
+-25	-20	0
+-20	-15	0
+-15	-10	0
+-10	-5	0
+-5	0	1
+0	5	0
+5	10	0
+10	15	0
+15	20	0
+20	25	0
+25	30	0
+30	35	0
+35	40	0
+40	45	0
+45	50	0
+50	55	0
+55	60	0
+60	65	0
+65	70	0
+70	75	0
+75	80	0
+80	85	0
+85	90	0
+90	95	1
+95	100	0
+100	105	0
+105	110	0
+110	115	0
+115	120	0
+120	125	0
+125	130	0
+130	135	0
+135	140	0
+140	145	0
+145	150	0
+150	155	0
+155	160	0
+160	165	0
+165	170	0
+170	175	0
+175	180	0
+180	185	0
+185	190	0
+190	195	0
+195	200	0
+200	205	0
+205	210	0
+210	215	0
+215	220	0
+220	225	0
+225	230	0
+230	235	0
+235	240	0
+240	245	0
+245	250	0
diff --git a/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml
index 306ee9a1..4540e724 100644
--- a/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml
@@ -235,9 +235,9 @@ build_info:
   output: "target/executable/agat/agat_convert_bed2gff"
   executable: "target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff b/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff
index fb78ac59..76c95753 100755
--- a/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff
+++ b/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff
@@ -515,9 +515,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_bed2gff"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:10Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml
index 5202afa3..b0ee8c35 100644
--- a/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml
@@ -225,9 +225,9 @@ build_info:
   output: "target/executable/agat/agat_convert_embl2gff"
   executable: "target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff b/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff
index b049fdca..87ddfc02 100755
--- a/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff
+++ b/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff
@@ -505,9 +505,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_embl2gff"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml b/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml
index a75c4832..41b019a6 100644
--- a/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml
@@ -230,9 +230,9 @@ build_info:
   output: "target/executable/agat/agat_convert_genscan2gff"
   executable: "target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff b/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff
index 90ae4d54..a87f36f8 100755
--- a/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff
+++ b/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff
@@ -514,9 +514,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_genscan2gff"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:19Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml b/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml
index 3c3b21b5..05425917 100644
--- a/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml
@@ -228,9 +228,9 @@ build_info:
   output: "target/executable/agat/agat_convert_sp_gff2gtf"
   executable: "target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf b/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf
index b5b5c2cc..71c963e9 100755
--- a/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf
+++ b/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf
@@ -519,9 +519,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2gtf"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml b/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml
index 10eaf2ea..df3445ed 100644
--- a/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml
@@ -188,9 +188,9 @@ build_info:
   output: "target/executable/agat/agat_convert_sp_gff2tsv"
   executable: "target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv b/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv
index 0ac462fa..0749315f 100755
--- a/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv
+++ b/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv
@@ -484,9 +484,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2tsv"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml b/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml
index ce34425f..ddb3ec05 100644
--- a/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml
@@ -195,9 +195,9 @@ build_info:
   output: "target/executable/agat/agat_convert_sp_gxf2gxf"
   executable: "target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf b/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf
index 14f0a337..62a728fd 100755
--- a/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf
+++ b/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf
@@ -493,9 +493,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gxf2gxf"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:19Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml b/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml
index 8b19da23..1bb83d2d 100644
--- a/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml
+++ b/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml
@@ -186,9 +186,9 @@ build_info:
   output: "target/executable/agat/agat_sp_add_introns"
   executable: "target/executable/agat/agat_sp_add_introns/agat_sp_add_introns"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns b/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns
index 5a030580..9acefe5b 100755
--- a/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns
+++ b/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns
@@ -479,9 +479,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_add_introns"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml b/target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml
new file mode 100644
index 00000000..f248e314
--- /dev/null
+++ b/target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml
@@ -0,0 +1,263 @@
+name: "agat_sp_filter_feature_from_kill_list"
+namespace: "agat"
+version: "main"
+authors:
+- name: "Leïla Paquay"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "leila@data-intuitive.com"
+      github: "Leila011"
+      linkedin: "leilapaquay"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Software Developer"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--gff"
+    alternatives:
+    - "-f"
+    - "--ref"
+    - "--reffile"
+    description: "Input GFF3 file that will be read."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--kill_list"
+    alternatives:
+    - "--kl"
+    description: "Text file containing the kill list. One value per line."
+    info: null
+    example:
+    - "kill_list.txt"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    - "--out"
+    description: "Path to the output GFF file that contains filtered features. \n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Arguments"
+  arguments:
+  - type: "string"
+    name: "--type"
+    alternatives:
+    - "-p"
+    - "-l"
+    description: "Primary tag option, case insensitive, list. Allow to specify the\
+      \ feature types that \nwill be handled. \n\nYou can specify a specific feature\
+      \ by giving its primary tag name (column 3) as: \n\n  * cds\n  * Gene\n  * mRNA\n\
+      \  \nYou can specify directly all the feature of a particular\nlevel: \n\n \
+      \ * level2=mRNA,ncRNA,tRNA,etc \n  * level3=CDS,exon,UTR,etc. \n\nBy default\
+      \ all features are taken into account. Fill the option with the value \"all\"\
+      \ will \nhave the same behaviour.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: true
+    multiple_sep: ";"
+  - type: "string"
+    name: "--attribute"
+    alternatives:
+    - "-a"
+    description: "Attribute tag to specify the attribute to analyse. Case sensitive.\
+      \ Default: ID\n"
+    info: null
+    example:
+    - "ID"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--config"
+    alternatives:
+    - "-c"
+    description: "AGAT config file. By default AGAT takes the original agat_config.yaml\
+      \ shipped with AGAT.\nThe `--config` option gives you the possibility to use\
+      \ your own AGAT config file (located \nelsewhere or named differently).\n"
+    info: null
+    example:
+    - "custom_agat_config.yaml"
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--verbose"
+    alternatives:
+    - "-v"
+    description: "Verbose option for debugging purpose."
+    info: null
+    direction: "input"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Remove features based on a kill list. The default behaviour is to look\
+  \ at the features's ID. \nIf the feature has an ID (case insensitive) listed among\
+  \ the kill list it will be removed.\nRemoving a level1 or level2 feature will automatically\
+  \ remove all linked subfeatures, and \nremoving all children of a feature will automatically\
+  \ remove this feature too.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "gene annotations"
+- "filtering"
+- "gff"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.5281/zenodo.3552717"
+links:
+  repository: "https://github.com/NBISweden/AGAT"
+  homepage: "https://github.com/NBISweden/AGAT"
+  documentation: "https://agat.readthedocs.io/en/latest/tools/agat_sp_filter_feature_from_kill_list.html"
+  issue_tracker: "https://github.com/NBISweden/AGAT/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "docker"
+    run:
+    - "agat --version | sed 's/AGAT\\s\\(.*\\)/agat: \"\\1\"/' > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/agat/agat_sp_filter_feature_from_kill_list"
+  executable: "target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list b/target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list
new file mode 100755
index 00000000..2cfc8821
--- /dev/null
+++ b/target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list
@@ -0,0 +1,1312 @@
+#!/usr/bin/env bash
+
+# agat_sp_filter_feature_from_kill_list main
+# 
+# This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+# work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+# Intuitive.
+# 
+# The component may contain files which fall under a different license. The
+# authors of this component should specify the license in the header of such
+# files, or include a separate license file detailing the licenses of all included
+# files.
+# 
+# Component authors:
+#  * Leïla Paquay (author, maintainer)
+
+set -e
+
+if [ -z "$VIASH_TEMP" ]; then
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMP}
+  VIASH_TEMP=${VIASH_TEMP:-/tmp}
+fi
+
+# define helper functions
+# ViashQuote: put quotes around non flag values
+# $1     : unquoted string
+# return : possibly quoted string
+# examples:
+#   ViashQuote --foo      # returns --foo
+#   ViashQuote bar        # returns 'bar'
+#   Viashquote --foo=bar  # returns --foo='bar'
+function ViashQuote {
+  if [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+=.+$ ]]; then
+    echo "$1" | sed "s#=\(.*\)#='\1'#"
+  elif [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+$ ]]; then
+    echo "$1"
+  else
+    echo "'$1'"
+  fi
+}
+# ViashRemoveFlags: Remove leading flag
+# $1     : string with a possible leading flag
+# return : string without possible leading flag
+# examples:
+#   ViashRemoveFlags --foo=bar  # returns bar
+function ViashRemoveFlags {
+  echo "$1" | sed 's/^--*[a-zA-Z0-9_\-]*=//'
+}
+# ViashSourceDir: return the path of a bash file, following symlinks
+# usage   : ViashSourceDir ${BASH_SOURCE[0]}
+# $1      : Should always be set to ${BASH_SOURCE[0]}
+# returns : The absolute path of the bash file
+function ViashSourceDir {
+  local source="$1"
+  while [ -h "$source" ]; do
+    local dir="$( cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd )"
+    source="$(readlink "$source")"
+    [[ $source != /* ]] && source="$dir/$source"
+  done
+  cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd
+}
+# ViashFindTargetDir: return the path of the '.build.yaml' file, following symlinks
+# usage   : ViashFindTargetDir 'ScriptPath'
+# $1      : The location from where to start the upward search
+# returns : The absolute path of the '.build.yaml' file
+function ViashFindTargetDir {
+  local source="$1"
+  while [[ "$source" != "" && ! -e "$source/.build.yaml" ]]; do
+    source=${source%/*}
+  done
+  echo $source
+}
+# see https://en.wikipedia.org/wiki/Syslog#Severity_level
+VIASH_LOGCODE_EMERGENCY=0
+VIASH_LOGCODE_ALERT=1
+VIASH_LOGCODE_CRITICAL=2
+VIASH_LOGCODE_ERROR=3
+VIASH_LOGCODE_WARNING=4
+VIASH_LOGCODE_NOTICE=5
+VIASH_LOGCODE_INFO=6
+VIASH_LOGCODE_DEBUG=7
+VIASH_VERBOSITY=$VIASH_LOGCODE_NOTICE
+
+# ViashLog: Log events depending on the verbosity level
+# usage: ViashLog 1 alert Oh no something went wrong!
+# $1: required verbosity level
+# $2: display tag
+# $3+: messages to display
+# stdout: Your input, prepended by '[$2] '.
+function ViashLog {
+  local required_level="$1"
+  local display_tag="$2"
+  shift 2
+  if [ $VIASH_VERBOSITY -ge $required_level ]; then
+    >&2 echo "[$display_tag]" "$@"
+  fi
+}
+
+# ViashEmergency: log events when the system is unstable
+# usage: ViashEmergency Oh no something went wrong.
+# stdout: Your input, prepended by '[emergency] '.
+function ViashEmergency {
+  ViashLog $VIASH_LOGCODE_EMERGENCY emergency "$@"
+}
+
+# ViashAlert: log events when actions must be taken immediately (e.g. corrupted system database)
+# usage: ViashAlert Oh no something went wrong.
+# stdout: Your input, prepended by '[alert] '.
+function ViashAlert {
+  ViashLog $VIASH_LOGCODE_ALERT alert "$@"
+}
+
+# ViashCritical: log events when a critical condition occurs
+# usage: ViashCritical Oh no something went wrong.
+# stdout: Your input, prepended by '[critical] '.
+function ViashCritical {
+  ViashLog $VIASH_LOGCODE_CRITICAL critical "$@"
+}
+
+# ViashError: log events when an error condition occurs
+# usage: ViashError Oh no something went wrong.
+# stdout: Your input, prepended by '[error] '.
+function ViashError {
+  ViashLog $VIASH_LOGCODE_ERROR error "$@"
+}
+
+# ViashWarning: log potentially abnormal events
+# usage: ViashWarning Something may have gone wrong.
+# stdout: Your input, prepended by '[warning] '.
+function ViashWarning {
+  ViashLog $VIASH_LOGCODE_WARNING warning "$@"
+}
+
+# ViashNotice: log significant but normal events
+# usage: ViashNotice This just happened.
+# stdout: Your input, prepended by '[notice] '.
+function ViashNotice {
+  ViashLog $VIASH_LOGCODE_NOTICE notice "$@"
+}
+
+# ViashInfo: log normal events
+# usage: ViashInfo This just happened.
+# stdout: Your input, prepended by '[info] '.
+function ViashInfo {
+  ViashLog $VIASH_LOGCODE_INFO info "$@"
+}
+
+# ViashDebug: log all events, for debugging purposes
+# usage: ViashDebug This just happened.
+# stdout: Your input, prepended by '[debug] '.
+function ViashDebug {
+  ViashLog $VIASH_LOGCODE_DEBUG debug "$@"
+}
+
+# find source folder of this component
+VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}`
+
+# find the root of the built components & dependencies
+VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR`
+
+# define meta fields
+VIASH_META_NAME="agat_sp_filter_feature_from_kill_list"
+VIASH_META_FUNCTIONALITY_NAME="agat_sp_filter_feature_from_kill_list"
+VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME"
+VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+VIASH_META_TEMP_DIR="$VIASH_TEMP"
+
+
+# ViashHelp: Display helpful explanation about this executable
+function ViashHelp {
+  echo "agat_sp_filter_feature_from_kill_list main"
+  echo ""
+  echo "Remove features based on a kill list. The default behaviour is to look at the"
+  echo "features's ID."
+  echo "If the feature has an ID (case insensitive) listed among the kill list it will"
+  echo "be removed."
+  echo "Removing a level1 or level2 feature will automatically remove all linked"
+  echo "subfeatures, and"
+  echo "removing all children of a feature will automatically remove this feature too."
+  echo ""
+  echo "Inputs:"
+  echo "    -f, --ref, --reffile, --gff"
+  echo "        type: file, required parameter, file must exist"
+  echo "        Input GFF3 file that will be read."
+  echo ""
+  echo "    --kl, --kill_list"
+  echo "        type: file, required parameter, file must exist"
+  echo "        example: kill_list.txt"
+  echo "        Text file containing the kill list. One value per line."
+  echo ""
+  echo "Outputs:"
+  echo "    -o, --out, --output"
+  echo "        type: file, required parameter, output, file must exist"
+  echo "        Path to the output GFF file that contains filtered features."
+  echo ""
+  echo "Arguments:"
+  echo "    -p, -l, --type"
+  echo "        type: string, multiple values allowed"
+  echo "        Primary tag option, case insensitive, list. Allow to specify the feature"
+  echo "        types that"
+  echo "        will be handled."
+  echo "        You can specify a specific feature by giving its primary tag name"
+  echo "        (column 3) as:"
+  echo "          * cds"
+  echo "          * Gene"
+  echo "          * mRNA"
+  echo "        You can specify directly all the feature of a particular"
+  echo "        level:"
+  echo "          * level2=mRNA,ncRNA,tRNA,etc"
+  echo "          * level3=CDS,exon,UTR,etc."
+  echo "        By default all features are taken into account. Fill the option with the"
+  echo "        value \"all\" will"
+  echo "        have the same behaviour."
+  echo ""
+  echo "    -a, --attribute"
+  echo "        type: string"
+  echo "        example: ID"
+  echo "        Attribute tag to specify the attribute to analyse. Case sensitive."
+  echo "        Default: ID"
+  echo ""
+  echo "    -c, --config"
+  echo "        type: file, file must exist"
+  echo "        example: custom_agat_config.yaml"
+  echo "        AGAT config file. By default AGAT takes the original agat_config.yaml"
+  echo "        shipped with AGAT."
+  echo "        The \`--config\` option gives you the possibility to use your own AGAT"
+  echo "        config file (located"
+  echo "        elsewhere or named differently)."
+  echo ""
+  echo "    -v, --verbose"
+  echo "        type: boolean_true"
+  echo "        Verbose option for debugging purpose."
+}
+
+# initialise variables
+VIASH_MODE='run'
+VIASH_ENGINE_ID='docker'
+
+######## Helper functions for setting up Docker images for viash ########
+# expects: ViashDockerBuild
+
+# ViashDockerInstallationCheck: check whether Docker is installed correctly
+#
+# examples:
+#   ViashDockerInstallationCheck
+function ViashDockerInstallationCheck {
+  ViashDebug "Checking whether Docker is installed"
+  if [ ! command -v docker &> /dev/null ]; then
+    ViashCritical "Docker doesn't seem to be installed. See 'https://docs.docker.com/get-docker/' for instructions."
+    exit 1
+  fi
+
+  ViashDebug "Checking whether the Docker daemon is running"
+  local save=$-; set +e
+  local docker_version=$(docker version --format '{{.Client.APIVersion}}' 2> /dev/null)
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashCritical "Docker daemon does not seem to be running. Try one of the following:"
+    ViashCritical "- Try running 'dockerd' in the command line"
+    ViashCritical "- See https://docs.docker.com/config/daemon/"
+    exit 1
+  fi
+}
+
+# ViashDockerRemoteTagCheck: check whether a Docker image is available 
+# on a remote. Assumes `docker login` has been performed, if relevant.
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerRemoteTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerRemoteTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerRemoteTagCheck {
+  docker manifest inspect $1 > /dev/null 2> /dev/null
+}
+
+# ViashDockerLocalTagCheck: check whether a Docker image is available locally
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   docker pull python:latest
+#   ViashDockerLocalTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerLocalTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerLocalTagCheck {
+  [ -n "$(docker images -q $1)" ]
+}
+
+# ViashDockerPull: pull a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPull python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPull sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPull {
+  ViashNotice "Checking if Docker image is available at '$1'"
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker pull $1 && return 0 || return 1
+  else
+    local save=$-; set +e
+    docker pull $1 2> /dev/null > /dev/null
+    local out=$?
+    [[ $save =~ e ]] && set -e
+    if [ $out -ne 0 ]; then
+      ViashWarning "Could not pull from '$1'. Docker image doesn't exist or is not accessible."
+    fi
+    return $out
+  fi
+}
+
+# ViashDockerPush: push a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPush python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPush sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPush {
+  ViashNotice "Pushing image to '$1'"
+  local save=$-; set +e
+  local out
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker push $1
+    out=$?
+  else
+    docker push $1 2> /dev/null > /dev/null
+    out=$?
+  fi
+  [[ $save =~ e ]] && set -e
+  if [ $out -eq 0 ]; then
+    ViashNotice "Container '$1' push succeeded."
+  else
+    ViashError "Container '$1' push errored. You might not be logged in or have the necessary permissions."
+  fi
+  return $out
+}
+
+# ViashDockerPullElseBuild: pull a Docker image, else build it
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# ViashDockerBuild    : a Bash function which builds a docker image, takes image identifier as argument.
+# examples:
+#   ViashDockerPullElseBuild mynewcomponent
+function ViashDockerPullElseBuild {
+  local save=$-; set +e
+  ViashDockerPull $1
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashDockerBuild $@
+  fi
+}
+
+# ViashDockerSetup: create a Docker image, according to specified docker setup strategy
+#
+# $1          : image identifier with format `[registry/]image[:tag]`
+# $2          : docker setup strategy, see DockerSetupStrategy.scala
+# examples:
+#   ViashDockerSetup mynewcomponent alwaysbuild
+function ViashDockerSetup {
+  local image_id="$1"
+  local setup_strategy="$2"
+  if [ "$setup_strategy" == "alwaysbuild" -o "$setup_strategy" == "build" -o "$setup_strategy" == "b" ]; then
+    ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspull" -o "$setup_strategy" == "pull" -o "$setup_strategy" == "p" ]; then
+    ViashDockerPull $image_id
+  elif [ "$setup_strategy" == "alwayspullelsebuild" -o "$setup_strategy" == "pullelsebuild" ]; then
+    ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspullelsecachedbuild" -o "$setup_strategy" == "pullelsecachedbuild" ]; then
+    ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayscachedbuild" -o "$setup_strategy" == "cachedbuild" -o "$setup_strategy" == "cb" ]; then
+    ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [[ "$setup_strategy" =~ ^ifneedbe ]]; then
+    local save=$-; set +e
+    ViashDockerLocalTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashInfo "Image $image_id already exists"
+    elif [ "$setup_strategy" == "ifneedbebuild" ]; then
+      ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbecachedbuild" ]; then
+      ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepull" ]; then
+      ViashDockerPull $image_id
+    elif [ "$setup_strategy" == "ifneedbepullelsebuild" ]; then
+      ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepullelsecachedbuild" ]; then
+      ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    else
+      ViashError "Unrecognised Docker strategy: $setup_strategy"
+      exit 1
+    fi
+  elif [ "$setup_strategy" == "push" -o "$setup_strategy" == "forcepush" -o "$setup_strategy" == "alwayspush" ]; then
+    ViashDockerPush "$image_id"
+  elif [ "$setup_strategy" == "pushifnotpresent" -o "$setup_strategy" == "gentlepush" -o "$setup_strategy" == "maybepush" ]; then
+    local save=$-; set +e
+    ViashDockerRemoteTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashNotice "Container '$image_id' exists, doing nothing."
+    else
+      ViashNotice "Container '$image_id' does not yet exist."
+      ViashDockerPush "$image_id"
+    fi
+  elif [ "$setup_strategy" == "donothing" -o "$setup_strategy" == "meh" ]; then
+    ViashNotice "Skipping setup."
+  else
+    ViashError "Unrecognised Docker strategy: $setup_strategy"
+    exit 1
+  fi
+}
+
+# ViashDockerCheckCommands: Check whether a docker container has the required commands
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# $@                  : commands to verify being present
+# examples:
+#   ViashDockerCheckCommands bash:4.0 bash ps foo
+function ViashDockerCheckCommands {
+  local image_id="$1"
+  shift 1
+  local commands="$@"
+  local save=$-; set +e
+  local missing # mark 'missing' as local in advance, otherwise the exit code of the command will be missing and always be '0'
+  missing=$(docker run --rm --entrypoint=sh "$image_id" -c "for command in $commands; do command -v \$command >/dev/null 2>&1; if [ \$? -ne 0 ]; then echo \$command; exit 1; fi; done")
+  local outCheck=$?
+  [[ $save =~ e ]] && set -e
+  if [ $outCheck -ne 0 ]; then
+  	ViashError "Docker container '$image_id' does not contain command '$missing'."
+  	exit 1
+  fi
+}
+
+# ViashDockerBuild: build a docker image
+# $1                               : image identifier with format `[registry/]image[:tag]`
+# $...                             : additional arguments to pass to docker build
+# $VIASH_META_TEMP_DIR             : temporary directory to store dockerfile & optional resources in
+# $VIASH_META_NAME                 : name of the component
+# $VIASH_META_RESOURCES_DIR        : directory containing the resources
+# $VIASH_VERBOSITY                 : verbosity level
+# exit code $?                     : whether or not the image was built successfully
+function ViashDockerBuild {
+  local image_id="$1"
+  shift 1
+
+  # create temporary directory to store dockerfile & optional resources in
+  local tmpdir=$(mktemp -d "$VIASH_META_TEMP_DIR/dockerbuild-$VIASH_META_NAME-XXXXXX")
+  local dockerfile="$tmpdir/Dockerfile"
+  function clean_up {
+    rm -rf "$tmpdir"
+  }
+  trap clean_up EXIT
+
+  # store dockerfile and resources
+  ViashDockerfile "$VIASH_ENGINE_ID" > "$dockerfile"
+
+  # generate the build command
+  local docker_build_cmd="docker build -t '$image_id' $@ '$VIASH_META_RESOURCES_DIR' -f '$dockerfile'"
+
+  # build the container
+  ViashNotice "Building container '$image_id' with Dockerfile"
+  ViashInfo "$docker_build_cmd"
+  local save=$-; set +e
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    eval $docker_build_cmd
+  else
+    eval $docker_build_cmd &> "$tmpdir/docker_build.log"
+  fi
+
+  # check exit code
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashError "Error occurred while building container '$image_id'"
+    if [ $VIASH_VERBOSITY -lt $VIASH_LOGCODE_INFO ]; then
+      ViashError "Transcript: --------------------------------"
+      cat "$tmpdir/docker_build.log"
+      ViashError "End of transcript --------------------------"
+    fi
+    exit 1
+  fi
+}
+
+######## End of helper functions for setting up Docker images for viash ########
+
+# ViashDockerFile: print the dockerfile to stdout
+# $1    : engine identifier
+# return : dockerfile required to run this component
+# examples:
+#   ViashDockerFile
+function ViashDockerfile {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    cat << 'VIASHDOCKER'
+FROM quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
+ENTRYPOINT []
+RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
+
+LABEL org.opencontainers.image.authors="Leïla Paquay"
+LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_filter_feature_from_kill_list"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
+LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+LABEL org.opencontainers.image.version="main"
+
+VIASHDOCKER
+  fi
+}
+
+# ViashDockerBuildArgs: return the arguments to pass to docker build
+# $1    : engine identifier
+# return : arguments to pass to docker build
+function ViashDockerBuildArgs {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    echo ""
+  fi
+}
+
+# ViashAbsolutePath: generate absolute path from relative path
+# borrowed from https://stackoverflow.com/a/21951256
+# $1     : relative filename
+# return : absolute path
+# examples:
+#   ViashAbsolutePath some_file.txt   # returns /path/to/some_file.txt
+#   ViashAbsolutePath /foo/bar/..     # returns /foo
+function ViashAbsolutePath {
+  local thePath
+  local parr
+  local outp
+  local len
+  if [[ ! "$1" =~ ^/ ]]; then
+    thePath="$PWD/$1"
+  else
+    thePath="$1"
+  fi
+  echo "$thePath" | (
+    IFS=/
+    read -a parr
+    declare -a outp
+    for i in "${parr[@]}"; do
+      case "$i" in
+      ''|.) continue ;;
+      ..)
+        len=${#outp[@]}
+        if ((len==0)); then
+          continue
+        else
+          unset outp[$((len-1))]
+        fi
+        ;;
+      *)
+        len=${#outp[@]}
+        outp[$len]="$i"
+      ;;
+      esac
+    done
+    echo /"${outp[*]}"
+  )
+}
+# ViashDockerAutodetectMount: auto configuring docker mounts from parameters
+# $1                             : The parameter value
+# returns                        : New parameter
+# $VIASH_DIRECTORY_MOUNTS        : Added another parameter to be passed to docker
+# $VIASH_DOCKER_AUTOMOUNT_PREFIX : The prefix to be used for the automounts
+# examples:
+#   ViashDockerAutodetectMount /path/to/bar      # returns '/viash_automount/path/to/bar'
+#   ViashDockerAutodetectMountArg /path/to/bar   # returns '--volume="/path/to:/viash_automount/path/to"'
+function ViashDockerAutodetectMount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  if [ -z "$base_name" ]; then
+    echo "$mount_target"
+  else
+    echo "$mount_target/$base_name"
+  fi
+}
+function ViashDockerAutodetectMountArg {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  ViashDebug "ViashDockerAutodetectMountArg $1 -> $mount_source -> $mount_target"
+  echo "--volume=\"$mount_source:$mount_target\""
+}
+function ViashDockerStripAutomount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  echo "${abs_path#$VIASH_DOCKER_AUTOMOUNT_PREFIX}"
+}
+# initialise variables
+VIASH_DIRECTORY_MOUNTS=()
+
+# configure default docker automount prefix if it is unset
+if [ -z "${VIASH_DOCKER_AUTOMOUNT_PREFIX+x}" ]; then
+  VIASH_DOCKER_AUTOMOUNT_PREFIX="/viash_automount"
+fi
+
+# initialise docker variables
+VIASH_DOCKER_RUN_ARGS=(-i --rm)
+
+# initialise array
+VIASH_POSITIONAL_ARGS=''
+
+while [[ $# -gt 0 ]]; do
+    case "$1" in
+        -h|--help)
+            ViashHelp
+            exit
+            ;;
+        ---v|---verbose)
+            let "VIASH_VERBOSITY=VIASH_VERBOSITY+1"
+            shift 1
+            ;;
+        ---verbosity)
+            VIASH_VERBOSITY="$2"
+            shift 2
+            ;;
+        ---verbosity=*)
+            VIASH_VERBOSITY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        --version)
+            echo "agat_sp_filter_feature_from_kill_list main"
+            exit
+            ;;
+        --gff)
+            [ -n "$VIASH_PAR_GFF" ] && ViashError Bad arguments for option \'--gff\': \'$VIASH_PAR_GFF\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_GFF="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --gff. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --gff=*)
+            [ -n "$VIASH_PAR_GFF" ] && ViashError Bad arguments for option \'--gff=*\': \'$VIASH_PAR_GFF\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_GFF=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -f)
+            [ -n "$VIASH_PAR_GFF" ] && ViashError Bad arguments for option \'-f\': \'$VIASH_PAR_GFF\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_GFF="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -f. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --ref)
+            [ -n "$VIASH_PAR_GFF" ] && ViashError Bad arguments for option \'--ref\': \'$VIASH_PAR_GFF\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_GFF="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --ref. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --reffile)
+            [ -n "$VIASH_PAR_GFF" ] && ViashError Bad arguments for option \'--reffile\': \'$VIASH_PAR_GFF\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_GFF="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --reffile. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --kill_list)
+            [ -n "$VIASH_PAR_KILL_LIST" ] && ViashError Bad arguments for option \'--kill_list\': \'$VIASH_PAR_KILL_LIST\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_KILL_LIST="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --kill_list. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --kill_list=*)
+            [ -n "$VIASH_PAR_KILL_LIST" ] && ViashError Bad arguments for option \'--kill_list=*\': \'$VIASH_PAR_KILL_LIST\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_KILL_LIST=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        --kl)
+            [ -n "$VIASH_PAR_KILL_LIST" ] && ViashError Bad arguments for option \'--kl\': \'$VIASH_PAR_KILL_LIST\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_KILL_LIST="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --kl. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output=*)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output=*\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -o)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'-o\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -o. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --out)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--out\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --out. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --type)
+            if [ -z "$VIASH_PAR_TYPE" ]; then
+              VIASH_PAR_TYPE="$2"
+            else
+              VIASH_PAR_TYPE="$VIASH_PAR_TYPE;""$2"
+            fi
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --type. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --type=*)
+            if [ -z "$VIASH_PAR_TYPE" ]; then
+              VIASH_PAR_TYPE=$(ViashRemoveFlags "$1")
+            else
+              VIASH_PAR_TYPE="$VIASH_PAR_TYPE;"$(ViashRemoveFlags "$1")
+            fi
+            shift 1
+            ;;
+        -p)
+            if [ -z "$VIASH_PAR_TYPE" ]; then
+              VIASH_PAR_TYPE="$2"
+            else
+              VIASH_PAR_TYPE="$VIASH_PAR_TYPE;""$2"
+            fi
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -p. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        -l)
+            if [ -z "$VIASH_PAR_TYPE" ]; then
+              VIASH_PAR_TYPE="$2"
+            else
+              VIASH_PAR_TYPE="$VIASH_PAR_TYPE;""$2"
+            fi
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -l. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --attribute)
+            [ -n "$VIASH_PAR_ATTRIBUTE" ] && ViashError Bad arguments for option \'--attribute\': \'$VIASH_PAR_ATTRIBUTE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_ATTRIBUTE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --attribute. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --attribute=*)
+            [ -n "$VIASH_PAR_ATTRIBUTE" ] && ViashError Bad arguments for option \'--attribute=*\': \'$VIASH_PAR_ATTRIBUTE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_ATTRIBUTE=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -a)
+            [ -n "$VIASH_PAR_ATTRIBUTE" ] && ViashError Bad arguments for option \'-a\': \'$VIASH_PAR_ATTRIBUTE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_ATTRIBUTE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -a. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --config)
+            [ -n "$VIASH_PAR_CONFIG" ] && ViashError Bad arguments for option \'--config\': \'$VIASH_PAR_CONFIG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_CONFIG="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --config. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --config=*)
+            [ -n "$VIASH_PAR_CONFIG" ] && ViashError Bad arguments for option \'--config=*\': \'$VIASH_PAR_CONFIG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_CONFIG=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -c)
+            [ -n "$VIASH_PAR_CONFIG" ] && ViashError Bad arguments for option \'-c\': \'$VIASH_PAR_CONFIG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_CONFIG="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -c. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --verbose)
+            [ -n "$VIASH_PAR_VERBOSE" ] && ViashError Bad arguments for option \'--verbose\': \'$VIASH_PAR_VERBOSE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_VERBOSE=true
+            shift 1
+            ;;
+        -v)
+            [ -n "$VIASH_PAR_VERBOSE" ] && ViashError Bad arguments for option \'-v\': \'$VIASH_PAR_VERBOSE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_VERBOSE=true
+            shift 1
+            ;;
+        ---engine)
+            VIASH_ENGINE_ID="$2"
+            shift 2
+            ;;
+        ---engine=*)
+            VIASH_ENGINE_ID="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---setup)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$2"
+            shift 2
+            ;;
+        ---setup=*)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---dockerfile)
+            VIASH_MODE='dockerfile'
+            shift 1
+            ;;
+        ---docker_run_args)
+            VIASH_DOCKER_RUN_ARGS+=("$2")
+            shift 2
+            ;;
+        ---docker_run_args=*)
+            VIASH_DOCKER_RUN_ARGS+=("$(ViashRemoveFlags "$1")")
+            shift 1
+            ;;
+        ---docker_image_id)
+            VIASH_MODE='docker_image_id'
+            shift 1
+            ;;
+        ---debug)
+            VIASH_MODE='debug'
+            shift 1
+            ;;
+        ---cpus)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---cpus. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---cpus=*)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus=*\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        ---memory)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---memory. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---memory=*)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory=*\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        *)  # positional arg or unknown option
+            # since the positional args will be eval'd, can we always quote, instead of using ViashQuote
+            VIASH_POSITIONAL_ARGS="$VIASH_POSITIONAL_ARGS '$1'"
+            [[ $1 == -* ]] && ViashWarning $1 looks like a parameter but is not a defined parameter and will instead be treated as a positional argument. Use "--help" to get more information on the parameters.
+            shift # past argument
+            ;;
+    esac
+done
+
+# parse positional parameters
+eval set -- $VIASH_POSITIONAL_ARGS
+
+
+if   [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  VIASH_ENGINE_TYPE='native'
+elif   [ "$VIASH_ENGINE_ID" == "docker" ]  ; then
+  VIASH_ENGINE_TYPE='docker'
+else
+  ViashError "Engine '$VIASH_ENGINE_ID' is not recognized. Options are: docker, native."
+  exit 1
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # check if docker is installed properly
+  ViashDockerInstallationCheck
+
+  # determine docker image id
+  if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
+    VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/agat/agat_sp_filter_feature_from_kill_list:main'
+  fi
+
+  # print dockerfile
+  if [ "$VIASH_MODE" == "dockerfile" ]; then
+    ViashDockerfile "$VIASH_ENGINE_ID"
+    exit 0
+
+  elif [ "$VIASH_MODE" == "docker_image_id" ]; then
+    echo "$VIASH_DOCKER_IMAGE_ID"
+    exit 0
+  
+  # enter docker container
+  elif [[ "$VIASH_MODE" == "debug" ]]; then
+    VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} -v '$(pwd)':/pwd --workdir /pwd -t $VIASH_DOCKER_IMAGE_ID"
+    ViashNotice "+ $VIASH_CMD"
+    eval $VIASH_CMD
+    exit 
+
+  # build docker image
+  elif [ "$VIASH_MODE" == "setup" ]; then
+    ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" "$VIASH_SETUP_STRATEGY"
+    ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+    exit 0
+  fi
+
+  # check if docker image exists
+  ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" ifneedbepullelsecachedbuild
+  ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+fi
+
+# setting computational defaults
+
+# helper function for parsing memory strings
+function ViashMemoryAsBytes {
+  local memory=`echo "$1" | tr '[:upper:]' '[:lower:]' | tr -d '[:space:]'`
+  local memory_regex='^([0-9]+)([kmgtp]i?b?|b)$'
+  if [[ $memory =~ $memory_regex ]]; then
+    local number=${memory/[^0-9]*/}
+    local symbol=${memory/*[0-9]/}
+    
+    case $symbol in
+      b)      memory_b=$number ;;
+      kb|k)   memory_b=$(( $number * 1000 )) ;;
+      mb|m)   memory_b=$(( $number * 1000 * 1000 )) ;;
+      gb|g)   memory_b=$(( $number * 1000 * 1000 * 1000 )) ;;
+      tb|t)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 )) ;;
+      pb|p)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 * 1000 )) ;;
+      kib|ki)   memory_b=$(( $number * 1024 )) ;;
+      mib|mi)   memory_b=$(( $number * 1024 * 1024 )) ;;
+      gib|gi)   memory_b=$(( $number * 1024 * 1024 * 1024 )) ;;
+      tib|ti)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 )) ;;
+      pib|pi)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 * 1024 )) ;;
+    esac
+    echo "$memory_b"
+  fi
+}
+# compute memory in different units
+if [ ! -z ${VIASH_META_MEMORY+x} ]; then
+  VIASH_META_MEMORY_B=`ViashMemoryAsBytes $VIASH_META_MEMORY`
+  # do not define other variables if memory_b is an empty string
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_META_MEMORY_KB=$(( ($VIASH_META_MEMORY_B+999) / 1000 ))
+    VIASH_META_MEMORY_MB=$(( ($VIASH_META_MEMORY_KB+999) / 1000 ))
+    VIASH_META_MEMORY_GB=$(( ($VIASH_META_MEMORY_MB+999) / 1000 ))
+    VIASH_META_MEMORY_TB=$(( ($VIASH_META_MEMORY_GB+999) / 1000 ))
+    VIASH_META_MEMORY_PB=$(( ($VIASH_META_MEMORY_TB+999) / 1000 ))
+    VIASH_META_MEMORY_KIB=$(( ($VIASH_META_MEMORY_B+1023) / 1024 ))
+    VIASH_META_MEMORY_MIB=$(( ($VIASH_META_MEMORY_KIB+1023) / 1024 ))
+    VIASH_META_MEMORY_GIB=$(( ($VIASH_META_MEMORY_MIB+1023) / 1024 ))
+    VIASH_META_MEMORY_TIB=$(( ($VIASH_META_MEMORY_GIB+1023) / 1024 ))
+    VIASH_META_MEMORY_PIB=$(( ($VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  else
+    # unset memory if string is empty
+    unset $VIASH_META_MEMORY_B
+  fi
+fi
+# unset nproc if string is empty
+if [ -z "$VIASH_META_CPUS" ]; then
+  unset $VIASH_META_CPUS
+fi
+
+
+# check whether required parameters exist
+if [ -z ${VIASH_PAR_GFF+x} ]; then
+  ViashError '--gff' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_PAR_KILL_LIST+x} ]; then
+  ViashError '--kill_list' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_PAR_OUTPUT+x} ]; then
+  ViashError '--output' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_NAME+x} ]; then
+  ViashError 'name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then
+  ViashError 'functionality_name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_RESOURCES_DIR+x} ]; then
+  ViashError 'resources_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_EXECUTABLE+x} ]; then
+  ViashError 'executable' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_CONFIG+x} ]; then
+  ViashError 'config' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_TEMP_DIR+x} ]; then
+  ViashError 'temp_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+
+# filling in defaults
+if [ -z ${VIASH_PAR_VERBOSE+x} ]; then
+  VIASH_PAR_VERBOSE="false"
+fi
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_GFF" ] && [ ! -e "$VIASH_PAR_GFF" ]; then
+  ViashError "Input file '$VIASH_PAR_GFF' does not exist."
+  exit 1
+fi
+if [ ! -z "$VIASH_PAR_KILL_LIST" ] && [ ! -e "$VIASH_PAR_KILL_LIST" ]; then
+  ViashError "Input file '$VIASH_PAR_KILL_LIST' does not exist."
+  exit 1
+fi
+if [ ! -z "$VIASH_PAR_CONFIG" ] && [ ! -e "$VIASH_PAR_CONFIG" ]; then
+  ViashError "Input file '$VIASH_PAR_CONFIG' does not exist."
+  exit 1
+fi
+
+# check whether parameters values are of the right type
+if [[ -n "$VIASH_PAR_VERBOSE" ]]; then
+  if ! [[ "$VIASH_PAR_VERBOSE" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
+    ViashError '--verbose' has to be a boolean_true. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_CPUS" ]]; then
+  if ! [[ "$VIASH_META_CPUS" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'cpus' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_B" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_B" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_b' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+
+# create parent directories of output files, if so desired
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT")"
+fi
+
+if  [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  if [ "$VIASH_MODE" == "run" ]; then
+    VIASH_CMD="bash"
+  else
+    ViashError "Engine '$VIASH_ENGINE_ID' does not support mode '$VIASH_MODE'."
+    exit 1
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # detect volumes from file arguments
+  VIASH_CHOWN_VARS=()
+if [ ! -z "$VIASH_PAR_GFF" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_GFF")" )
+  VIASH_PAR_GFF=$(ViashDockerAutodetectMount "$VIASH_PAR_GFF")
+fi
+if [ ! -z "$VIASH_PAR_KILL_LIST" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_KILL_LIST")" )
+  VIASH_PAR_KILL_LIST=$(ViashDockerAutodetectMount "$VIASH_PAR_KILL_LIST")
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT")" )
+  VIASH_PAR_OUTPUT=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT" )
+fi
+if [ ! -z "$VIASH_PAR_CONFIG" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_CONFIG")" )
+  VIASH_PAR_CONFIG=$(ViashDockerAutodetectMount "$VIASH_PAR_CONFIG")
+fi
+if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" )
+  VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR")
+fi
+if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_EXECUTABLE")" )
+  VIASH_META_EXECUTABLE=$(ViashDockerAutodetectMount "$VIASH_META_EXECUTABLE")
+fi
+if [ ! -z "$VIASH_META_CONFIG" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_CONFIG")" )
+  VIASH_META_CONFIG=$(ViashDockerAutodetectMount "$VIASH_META_CONFIG")
+fi
+if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_TEMP_DIR")" )
+  VIASH_META_TEMP_DIR=$(ViashDockerAutodetectMount "$VIASH_META_TEMP_DIR")
+fi
+  
+  # get unique mounts
+  VIASH_UNIQUE_MOUNTS=($(for val in "${VIASH_DIRECTORY_MOUNTS[@]}"; do echo "$val"; done | sort -u))
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # change file ownership
+  function ViashPerformChown {
+    if (( ${#VIASH_CHOWN_VARS[@]} )); then
+      set +e
+      VIASH_CMD="docker run --entrypoint=bash --rm ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID -c 'chown $(id -u):$(id -g) --silent --recursive ${VIASH_CHOWN_VARS[@]}'"
+      ViashDebug "+ $VIASH_CMD"
+      eval $VIASH_CMD
+      set -e
+    fi
+  }
+  trap ViashPerformChown EXIT
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # helper function for filling in extra docker args
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--memory=${VIASH_META_MEMORY_B}")
+  fi
+  if [ ! -z "$VIASH_META_CPUS" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--cpus=${VIASH_META_CPUS}")
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID"
+fi
+
+
+# set dependency paths
+
+
+ViashDebug "Running command: $(echo $VIASH_CMD)"
+cat << VIASHEOF | eval $VIASH_CMD
+set -e
+tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-agat_sp_filter_feature_from_kill_list-XXXXXX").sh
+function clean_up {
+  rm "\$tempscript"
+}
+function interrupt {
+  echo -e "\nCTRL-C Pressed..."
+  exit 1
+}
+trap clean_up EXIT
+trap interrupt INT SIGINT
+cat > "\$tempscript" << 'VIASHMAIN'
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_GFF+x} ]; then echo "${VIASH_PAR_GFF}" | sed "s#'#'\"'\"'#g;s#.*#par_gff='&'#" ; else echo "# par_gff="; fi )
+$( if [ ! -z ${VIASH_PAR_KILL_LIST+x} ]; then echo "${VIASH_PAR_KILL_LIST}" | sed "s#'#'\"'\"'#g;s#.*#par_kill_list='&'#" ; else echo "# par_kill_list="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_PAR_TYPE+x} ]; then echo "${VIASH_PAR_TYPE}" | sed "s#'#'\"'\"'#g;s#.*#par_type='&'#" ; else echo "# par_type="; fi )
+$( if [ ! -z ${VIASH_PAR_ATTRIBUTE+x} ]; then echo "${VIASH_PAR_ATTRIBUTE}" | sed "s#'#'\"'\"'#g;s#.*#par_attribute='&'#" ; else echo "# par_attribute="; fi )
+$( if [ ! -z ${VIASH_PAR_CONFIG+x} ]; then echo "${VIASH_PAR_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#par_config='&'#" ; else echo "# par_config="; fi )
+$( if [ ! -z ${VIASH_PAR_VERBOSE+x} ]; then echo "${VIASH_PAR_VERBOSE}" | sed "s#'#'\"'\"'#g;s#.*#par_verbose='&'#" ; else echo "# par_verbose="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\"'\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\"'\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+
+# unset flags
+[[ "\$par_verbose" == "false" ]] && unset par_verbose
+
+# convert par_type to comma separated list
+par_type=\$(echo \$par_type | tr ';' ',')
+
+# run agat_sp_filter_feature_from_kill_list
+agat_sp_filter_feature_from_kill_list.pl \\
+  --gff "\$par_gff" \\
+  --kill_list "\$par_kill_list" \\
+  --output "\$par_output" \\
+  \${par_type:+--type "\${par_type}"} \\
+  \${par_attribute:+--attribute "\${par_attribute}"} \\
+  \${par_config:+--config "\${par_config}"} \\
+  \${par_verbose:+-v}
+VIASHMAIN
+bash "\$tempscript" &
+wait "\$!"
+
+VIASHEOF
+
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # strip viash automount from file paths
+  
+  if [ ! -z "$VIASH_PAR_GFF" ]; then
+    VIASH_PAR_GFF=$(ViashDockerStripAutomount "$VIASH_PAR_GFF")
+  fi
+  if [ ! -z "$VIASH_PAR_KILL_LIST" ]; then
+    VIASH_PAR_KILL_LIST=$(ViashDockerStripAutomount "$VIASH_PAR_KILL_LIST")
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+    VIASH_PAR_OUTPUT=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT")
+  fi
+  if [ ! -z "$VIASH_PAR_CONFIG" ]; then
+    VIASH_PAR_CONFIG=$(ViashDockerStripAutomount "$VIASH_PAR_CONFIG")
+  fi
+  if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+    VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR")
+  fi
+  if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+    VIASH_META_EXECUTABLE=$(ViashDockerStripAutomount "$VIASH_META_EXECUTABLE")
+  fi
+  if [ ! -z "$VIASH_META_CONFIG" ]; then
+    VIASH_META_CONFIG=$(ViashDockerStripAutomount "$VIASH_META_CONFIG")
+  fi
+  if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+    VIASH_META_TEMP_DIR=$(ViashDockerStripAutomount "$VIASH_META_TEMP_DIR")
+  fi
+fi
+
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -e "$VIASH_PAR_OUTPUT" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT' does not exist."
+  exit 1
+fi
+
+
+exit 0
diff --git a/target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml b/target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml
new file mode 100644
index 00000000..b460de98
--- /dev/null
+++ b/target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml
@@ -0,0 +1,211 @@
+name: "agat_sp_merge_annotations"
+namespace: "agat"
+version: "main"
+authors:
+- name: "Leïla Paquay"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "leila@data-intuitive.com"
+      github: "Leila011"
+      linkedin: "leilapaquay"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Software Developer"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--gff"
+    alternatives:
+    - "-f"
+    description: "Input GTF/GFF file(s).\n"
+    info: null
+    example:
+    - "input1.gff;input2.gff"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: true
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    - "--out"
+    description: "Output gff3 file where the gene incriminated will be writen."
+    info: null
+    example:
+    - "output.gff"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Arguments"
+  arguments:
+  - type: "file"
+    name: "--config"
+    alternatives:
+    - "-c"
+    description: "AGAT config file. By default AGAT takes the original agat_config.yaml\
+      \ shipped with AGAT. \nThe `--config` option gives you the possibility to use\
+      \ your own AGAT config file (located\nelsewhere or named differently).\n"
+    info: null
+    example:
+    - "custom_agat_config.yaml"
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Merge different gff annotation files into one. It uses the AGAT parser\
+  \ that takes care of\nduplicated names and fixes other oddities met in those files.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "gene annotations"
+- "merge"
+- "gff"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.5281/zenodo.3552717"
+links:
+  repository: "https://github.com/NBISweden/AGAT"
+  homepage: "https://github.com/NBISweden/AGAT"
+  documentation: "https://agat.readthedocs.io/en/latest/tools/agat_sp_merge_annotations.html"
+  issue_tracker: "https://github.com/NBISweden/AGAT/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "docker"
+    run:
+    - "agat --version | sed 's/AGAT\\s\\(.*\\)/agat: \"\\1\"/' > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/agat/agat_sp_merge_annotations/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/agat/agat_sp_merge_annotations"
+  executable: "target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations b/target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations
new file mode 100755
index 00000000..c0e43395
--- /dev/null
+++ b/target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations
@@ -0,0 +1,1187 @@
+#!/usr/bin/env bash
+
+# agat_sp_merge_annotations main
+# 
+# This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+# work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+# Intuitive.
+# 
+# The component may contain files which fall under a different license. The
+# authors of this component should specify the license in the header of such
+# files, or include a separate license file detailing the licenses of all included
+# files.
+# 
+# Component authors:
+#  * Leïla Paquay (author, maintainer)
+
+set -e
+
+if [ -z "$VIASH_TEMP" ]; then
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMP}
+  VIASH_TEMP=${VIASH_TEMP:-/tmp}
+fi
+
+# define helper functions
+# ViashQuote: put quotes around non flag values
+# $1     : unquoted string
+# return : possibly quoted string
+# examples:
+#   ViashQuote --foo      # returns --foo
+#   ViashQuote bar        # returns 'bar'
+#   Viashquote --foo=bar  # returns --foo='bar'
+function ViashQuote {
+  if [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+=.+$ ]]; then
+    echo "$1" | sed "s#=\(.*\)#='\1'#"
+  elif [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+$ ]]; then
+    echo "$1"
+  else
+    echo "'$1'"
+  fi
+}
+# ViashRemoveFlags: Remove leading flag
+# $1     : string with a possible leading flag
+# return : string without possible leading flag
+# examples:
+#   ViashRemoveFlags --foo=bar  # returns bar
+function ViashRemoveFlags {
+  echo "$1" | sed 's/^--*[a-zA-Z0-9_\-]*=//'
+}
+# ViashSourceDir: return the path of a bash file, following symlinks
+# usage   : ViashSourceDir ${BASH_SOURCE[0]}
+# $1      : Should always be set to ${BASH_SOURCE[0]}
+# returns : The absolute path of the bash file
+function ViashSourceDir {
+  local source="$1"
+  while [ -h "$source" ]; do
+    local dir="$( cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd )"
+    source="$(readlink "$source")"
+    [[ $source != /* ]] && source="$dir/$source"
+  done
+  cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd
+}
+# ViashFindTargetDir: return the path of the '.build.yaml' file, following symlinks
+# usage   : ViashFindTargetDir 'ScriptPath'
+# $1      : The location from where to start the upward search
+# returns : The absolute path of the '.build.yaml' file
+function ViashFindTargetDir {
+  local source="$1"
+  while [[ "$source" != "" && ! -e "$source/.build.yaml" ]]; do
+    source=${source%/*}
+  done
+  echo $source
+}
+# see https://en.wikipedia.org/wiki/Syslog#Severity_level
+VIASH_LOGCODE_EMERGENCY=0
+VIASH_LOGCODE_ALERT=1
+VIASH_LOGCODE_CRITICAL=2
+VIASH_LOGCODE_ERROR=3
+VIASH_LOGCODE_WARNING=4
+VIASH_LOGCODE_NOTICE=5
+VIASH_LOGCODE_INFO=6
+VIASH_LOGCODE_DEBUG=7
+VIASH_VERBOSITY=$VIASH_LOGCODE_NOTICE
+
+# ViashLog: Log events depending on the verbosity level
+# usage: ViashLog 1 alert Oh no something went wrong!
+# $1: required verbosity level
+# $2: display tag
+# $3+: messages to display
+# stdout: Your input, prepended by '[$2] '.
+function ViashLog {
+  local required_level="$1"
+  local display_tag="$2"
+  shift 2
+  if [ $VIASH_VERBOSITY -ge $required_level ]; then
+    >&2 echo "[$display_tag]" "$@"
+  fi
+}
+
+# ViashEmergency: log events when the system is unstable
+# usage: ViashEmergency Oh no something went wrong.
+# stdout: Your input, prepended by '[emergency] '.
+function ViashEmergency {
+  ViashLog $VIASH_LOGCODE_EMERGENCY emergency "$@"
+}
+
+# ViashAlert: log events when actions must be taken immediately (e.g. corrupted system database)
+# usage: ViashAlert Oh no something went wrong.
+# stdout: Your input, prepended by '[alert] '.
+function ViashAlert {
+  ViashLog $VIASH_LOGCODE_ALERT alert "$@"
+}
+
+# ViashCritical: log events when a critical condition occurs
+# usage: ViashCritical Oh no something went wrong.
+# stdout: Your input, prepended by '[critical] '.
+function ViashCritical {
+  ViashLog $VIASH_LOGCODE_CRITICAL critical "$@"
+}
+
+# ViashError: log events when an error condition occurs
+# usage: ViashError Oh no something went wrong.
+# stdout: Your input, prepended by '[error] '.
+function ViashError {
+  ViashLog $VIASH_LOGCODE_ERROR error "$@"
+}
+
+# ViashWarning: log potentially abnormal events
+# usage: ViashWarning Something may have gone wrong.
+# stdout: Your input, prepended by '[warning] '.
+function ViashWarning {
+  ViashLog $VIASH_LOGCODE_WARNING warning "$@"
+}
+
+# ViashNotice: log significant but normal events
+# usage: ViashNotice This just happened.
+# stdout: Your input, prepended by '[notice] '.
+function ViashNotice {
+  ViashLog $VIASH_LOGCODE_NOTICE notice "$@"
+}
+
+# ViashInfo: log normal events
+# usage: ViashInfo This just happened.
+# stdout: Your input, prepended by '[info] '.
+function ViashInfo {
+  ViashLog $VIASH_LOGCODE_INFO info "$@"
+}
+
+# ViashDebug: log all events, for debugging purposes
+# usage: ViashDebug This just happened.
+# stdout: Your input, prepended by '[debug] '.
+function ViashDebug {
+  ViashLog $VIASH_LOGCODE_DEBUG debug "$@"
+}
+
+# find source folder of this component
+VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}`
+
+# find the root of the built components & dependencies
+VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR`
+
+# define meta fields
+VIASH_META_NAME="agat_sp_merge_annotations"
+VIASH_META_FUNCTIONALITY_NAME="agat_sp_merge_annotations"
+VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME"
+VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+VIASH_META_TEMP_DIR="$VIASH_TEMP"
+
+
+# ViashHelp: Display helpful explanation about this executable
+function ViashHelp {
+  echo "agat_sp_merge_annotations main"
+  echo ""
+  echo "Merge different gff annotation files into one. It uses the AGAT parser that"
+  echo "takes care of"
+  echo "duplicated names and fixes other oddities met in those files."
+  echo ""
+  echo "Inputs:"
+  echo "    -f, --gff"
+  echo "        type: file, required parameter, multiple values allowed, file must exist"
+  echo "        example: input1.gff;input2.gff"
+  echo "        Input GTF/GFF file(s)."
+  echo ""
+  echo "Outputs:"
+  echo "    -o, --out, --output"
+  echo "        type: file, required parameter, output, file must exist"
+  echo "        example: output.gff"
+  echo "        Output gff3 file where the gene incriminated will be writen."
+  echo ""
+  echo "Arguments:"
+  echo "    -c, --config"
+  echo "        type: file, file must exist"
+  echo "        example: custom_agat_config.yaml"
+  echo "        AGAT config file. By default AGAT takes the original agat_config.yaml"
+  echo "        shipped with AGAT."
+  echo "        The \`--config\` option gives you the possibility to use your own AGAT"
+  echo "        config file (located"
+  echo "        elsewhere or named differently)."
+}
+
+# initialise variables
+VIASH_MODE='run'
+VIASH_ENGINE_ID='docker'
+
+######## Helper functions for setting up Docker images for viash ########
+# expects: ViashDockerBuild
+
+# ViashDockerInstallationCheck: check whether Docker is installed correctly
+#
+# examples:
+#   ViashDockerInstallationCheck
+function ViashDockerInstallationCheck {
+  ViashDebug "Checking whether Docker is installed"
+  if [ ! command -v docker &> /dev/null ]; then
+    ViashCritical "Docker doesn't seem to be installed. See 'https://docs.docker.com/get-docker/' for instructions."
+    exit 1
+  fi
+
+  ViashDebug "Checking whether the Docker daemon is running"
+  local save=$-; set +e
+  local docker_version=$(docker version --format '{{.Client.APIVersion}}' 2> /dev/null)
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashCritical "Docker daemon does not seem to be running. Try one of the following:"
+    ViashCritical "- Try running 'dockerd' in the command line"
+    ViashCritical "- See https://docs.docker.com/config/daemon/"
+    exit 1
+  fi
+}
+
+# ViashDockerRemoteTagCheck: check whether a Docker image is available 
+# on a remote. Assumes `docker login` has been performed, if relevant.
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerRemoteTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerRemoteTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerRemoteTagCheck {
+  docker manifest inspect $1 > /dev/null 2> /dev/null
+}
+
+# ViashDockerLocalTagCheck: check whether a Docker image is available locally
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   docker pull python:latest
+#   ViashDockerLocalTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerLocalTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerLocalTagCheck {
+  [ -n "$(docker images -q $1)" ]
+}
+
+# ViashDockerPull: pull a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPull python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPull sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPull {
+  ViashNotice "Checking if Docker image is available at '$1'"
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker pull $1 && return 0 || return 1
+  else
+    local save=$-; set +e
+    docker pull $1 2> /dev/null > /dev/null
+    local out=$?
+    [[ $save =~ e ]] && set -e
+    if [ $out -ne 0 ]; then
+      ViashWarning "Could not pull from '$1'. Docker image doesn't exist or is not accessible."
+    fi
+    return $out
+  fi
+}
+
+# ViashDockerPush: push a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPush python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPush sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPush {
+  ViashNotice "Pushing image to '$1'"
+  local save=$-; set +e
+  local out
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker push $1
+    out=$?
+  else
+    docker push $1 2> /dev/null > /dev/null
+    out=$?
+  fi
+  [[ $save =~ e ]] && set -e
+  if [ $out -eq 0 ]; then
+    ViashNotice "Container '$1' push succeeded."
+  else
+    ViashError "Container '$1' push errored. You might not be logged in or have the necessary permissions."
+  fi
+  return $out
+}
+
+# ViashDockerPullElseBuild: pull a Docker image, else build it
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# ViashDockerBuild    : a Bash function which builds a docker image, takes image identifier as argument.
+# examples:
+#   ViashDockerPullElseBuild mynewcomponent
+function ViashDockerPullElseBuild {
+  local save=$-; set +e
+  ViashDockerPull $1
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashDockerBuild $@
+  fi
+}
+
+# ViashDockerSetup: create a Docker image, according to specified docker setup strategy
+#
+# $1          : image identifier with format `[registry/]image[:tag]`
+# $2          : docker setup strategy, see DockerSetupStrategy.scala
+# examples:
+#   ViashDockerSetup mynewcomponent alwaysbuild
+function ViashDockerSetup {
+  local image_id="$1"
+  local setup_strategy="$2"
+  if [ "$setup_strategy" == "alwaysbuild" -o "$setup_strategy" == "build" -o "$setup_strategy" == "b" ]; then
+    ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspull" -o "$setup_strategy" == "pull" -o "$setup_strategy" == "p" ]; then
+    ViashDockerPull $image_id
+  elif [ "$setup_strategy" == "alwayspullelsebuild" -o "$setup_strategy" == "pullelsebuild" ]; then
+    ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspullelsecachedbuild" -o "$setup_strategy" == "pullelsecachedbuild" ]; then
+    ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayscachedbuild" -o "$setup_strategy" == "cachedbuild" -o "$setup_strategy" == "cb" ]; then
+    ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [[ "$setup_strategy" =~ ^ifneedbe ]]; then
+    local save=$-; set +e
+    ViashDockerLocalTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashInfo "Image $image_id already exists"
+    elif [ "$setup_strategy" == "ifneedbebuild" ]; then
+      ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbecachedbuild" ]; then
+      ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepull" ]; then
+      ViashDockerPull $image_id
+    elif [ "$setup_strategy" == "ifneedbepullelsebuild" ]; then
+      ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepullelsecachedbuild" ]; then
+      ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    else
+      ViashError "Unrecognised Docker strategy: $setup_strategy"
+      exit 1
+    fi
+  elif [ "$setup_strategy" == "push" -o "$setup_strategy" == "forcepush" -o "$setup_strategy" == "alwayspush" ]; then
+    ViashDockerPush "$image_id"
+  elif [ "$setup_strategy" == "pushifnotpresent" -o "$setup_strategy" == "gentlepush" -o "$setup_strategy" == "maybepush" ]; then
+    local save=$-; set +e
+    ViashDockerRemoteTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashNotice "Container '$image_id' exists, doing nothing."
+    else
+      ViashNotice "Container '$image_id' does not yet exist."
+      ViashDockerPush "$image_id"
+    fi
+  elif [ "$setup_strategy" == "donothing" -o "$setup_strategy" == "meh" ]; then
+    ViashNotice "Skipping setup."
+  else
+    ViashError "Unrecognised Docker strategy: $setup_strategy"
+    exit 1
+  fi
+}
+
+# ViashDockerCheckCommands: Check whether a docker container has the required commands
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# $@                  : commands to verify being present
+# examples:
+#   ViashDockerCheckCommands bash:4.0 bash ps foo
+function ViashDockerCheckCommands {
+  local image_id="$1"
+  shift 1
+  local commands="$@"
+  local save=$-; set +e
+  local missing # mark 'missing' as local in advance, otherwise the exit code of the command will be missing and always be '0'
+  missing=$(docker run --rm --entrypoint=sh "$image_id" -c "for command in $commands; do command -v \$command >/dev/null 2>&1; if [ \$? -ne 0 ]; then echo \$command; exit 1; fi; done")
+  local outCheck=$?
+  [[ $save =~ e ]] && set -e
+  if [ $outCheck -ne 0 ]; then
+  	ViashError "Docker container '$image_id' does not contain command '$missing'."
+  	exit 1
+  fi
+}
+
+# ViashDockerBuild: build a docker image
+# $1                               : image identifier with format `[registry/]image[:tag]`
+# $...                             : additional arguments to pass to docker build
+# $VIASH_META_TEMP_DIR             : temporary directory to store dockerfile & optional resources in
+# $VIASH_META_NAME                 : name of the component
+# $VIASH_META_RESOURCES_DIR        : directory containing the resources
+# $VIASH_VERBOSITY                 : verbosity level
+# exit code $?                     : whether or not the image was built successfully
+function ViashDockerBuild {
+  local image_id="$1"
+  shift 1
+
+  # create temporary directory to store dockerfile & optional resources in
+  local tmpdir=$(mktemp -d "$VIASH_META_TEMP_DIR/dockerbuild-$VIASH_META_NAME-XXXXXX")
+  local dockerfile="$tmpdir/Dockerfile"
+  function clean_up {
+    rm -rf "$tmpdir"
+  }
+  trap clean_up EXIT
+
+  # store dockerfile and resources
+  ViashDockerfile "$VIASH_ENGINE_ID" > "$dockerfile"
+
+  # generate the build command
+  local docker_build_cmd="docker build -t '$image_id' $@ '$VIASH_META_RESOURCES_DIR' -f '$dockerfile'"
+
+  # build the container
+  ViashNotice "Building container '$image_id' with Dockerfile"
+  ViashInfo "$docker_build_cmd"
+  local save=$-; set +e
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    eval $docker_build_cmd
+  else
+    eval $docker_build_cmd &> "$tmpdir/docker_build.log"
+  fi
+
+  # check exit code
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashError "Error occurred while building container '$image_id'"
+    if [ $VIASH_VERBOSITY -lt $VIASH_LOGCODE_INFO ]; then
+      ViashError "Transcript: --------------------------------"
+      cat "$tmpdir/docker_build.log"
+      ViashError "End of transcript --------------------------"
+    fi
+    exit 1
+  fi
+}
+
+######## End of helper functions for setting up Docker images for viash ########
+
+# ViashDockerFile: print the dockerfile to stdout
+# $1    : engine identifier
+# return : dockerfile required to run this component
+# examples:
+#   ViashDockerFile
+function ViashDockerfile {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    cat << 'VIASHDOCKER'
+FROM quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
+ENTRYPOINT []
+RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
+
+LABEL org.opencontainers.image.authors="Leïla Paquay"
+LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_merge_annotations"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
+LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+LABEL org.opencontainers.image.version="main"
+
+VIASHDOCKER
+  fi
+}
+
+# ViashDockerBuildArgs: return the arguments to pass to docker build
+# $1    : engine identifier
+# return : arguments to pass to docker build
+function ViashDockerBuildArgs {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    echo ""
+  fi
+}
+
+# ViashAbsolutePath: generate absolute path from relative path
+# borrowed from https://stackoverflow.com/a/21951256
+# $1     : relative filename
+# return : absolute path
+# examples:
+#   ViashAbsolutePath some_file.txt   # returns /path/to/some_file.txt
+#   ViashAbsolutePath /foo/bar/..     # returns /foo
+function ViashAbsolutePath {
+  local thePath
+  local parr
+  local outp
+  local len
+  if [[ ! "$1" =~ ^/ ]]; then
+    thePath="$PWD/$1"
+  else
+    thePath="$1"
+  fi
+  echo "$thePath" | (
+    IFS=/
+    read -a parr
+    declare -a outp
+    for i in "${parr[@]}"; do
+      case "$i" in
+      ''|.) continue ;;
+      ..)
+        len=${#outp[@]}
+        if ((len==0)); then
+          continue
+        else
+          unset outp[$((len-1))]
+        fi
+        ;;
+      *)
+        len=${#outp[@]}
+        outp[$len]="$i"
+      ;;
+      esac
+    done
+    echo /"${outp[*]}"
+  )
+}
+# ViashDockerAutodetectMount: auto configuring docker mounts from parameters
+# $1                             : The parameter value
+# returns                        : New parameter
+# $VIASH_DIRECTORY_MOUNTS        : Added another parameter to be passed to docker
+# $VIASH_DOCKER_AUTOMOUNT_PREFIX : The prefix to be used for the automounts
+# examples:
+#   ViashDockerAutodetectMount /path/to/bar      # returns '/viash_automount/path/to/bar'
+#   ViashDockerAutodetectMountArg /path/to/bar   # returns '--volume="/path/to:/viash_automount/path/to"'
+function ViashDockerAutodetectMount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  if [ -z "$base_name" ]; then
+    echo "$mount_target"
+  else
+    echo "$mount_target/$base_name"
+  fi
+}
+function ViashDockerAutodetectMountArg {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  ViashDebug "ViashDockerAutodetectMountArg $1 -> $mount_source -> $mount_target"
+  echo "--volume=\"$mount_source:$mount_target\""
+}
+function ViashDockerStripAutomount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  echo "${abs_path#$VIASH_DOCKER_AUTOMOUNT_PREFIX}"
+}
+# initialise variables
+VIASH_DIRECTORY_MOUNTS=()
+
+# configure default docker automount prefix if it is unset
+if [ -z "${VIASH_DOCKER_AUTOMOUNT_PREFIX+x}" ]; then
+  VIASH_DOCKER_AUTOMOUNT_PREFIX="/viash_automount"
+fi
+
+# initialise docker variables
+VIASH_DOCKER_RUN_ARGS=(-i --rm)
+
+# initialise array
+VIASH_POSITIONAL_ARGS=''
+
+while [[ $# -gt 0 ]]; do
+    case "$1" in
+        -h|--help)
+            ViashHelp
+            exit
+            ;;
+        ---v|---verbose)
+            let "VIASH_VERBOSITY=VIASH_VERBOSITY+1"
+            shift 1
+            ;;
+        ---verbosity)
+            VIASH_VERBOSITY="$2"
+            shift 2
+            ;;
+        ---verbosity=*)
+            VIASH_VERBOSITY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        --version)
+            echo "agat_sp_merge_annotations main"
+            exit
+            ;;
+        --gff)
+            if [ -z "$VIASH_PAR_GFF" ]; then
+              VIASH_PAR_GFF="$2"
+            else
+              VIASH_PAR_GFF="$VIASH_PAR_GFF;""$2"
+            fi
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --gff. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --gff=*)
+            if [ -z "$VIASH_PAR_GFF" ]; then
+              VIASH_PAR_GFF=$(ViashRemoveFlags "$1")
+            else
+              VIASH_PAR_GFF="$VIASH_PAR_GFF;"$(ViashRemoveFlags "$1")
+            fi
+            shift 1
+            ;;
+        -f)
+            if [ -z "$VIASH_PAR_GFF" ]; then
+              VIASH_PAR_GFF="$2"
+            else
+              VIASH_PAR_GFF="$VIASH_PAR_GFF;""$2"
+            fi
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -f. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output=*)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output=*\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -o)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'-o\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -o. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --out)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--out\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --out. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --config)
+            [ -n "$VIASH_PAR_CONFIG" ] && ViashError Bad arguments for option \'--config\': \'$VIASH_PAR_CONFIG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_CONFIG="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --config. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --config=*)
+            [ -n "$VIASH_PAR_CONFIG" ] && ViashError Bad arguments for option \'--config=*\': \'$VIASH_PAR_CONFIG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_CONFIG=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -c)
+            [ -n "$VIASH_PAR_CONFIG" ] && ViashError Bad arguments for option \'-c\': \'$VIASH_PAR_CONFIG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_CONFIG="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -c. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---engine)
+            VIASH_ENGINE_ID="$2"
+            shift 2
+            ;;
+        ---engine=*)
+            VIASH_ENGINE_ID="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---setup)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$2"
+            shift 2
+            ;;
+        ---setup=*)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---dockerfile)
+            VIASH_MODE='dockerfile'
+            shift 1
+            ;;
+        ---docker_run_args)
+            VIASH_DOCKER_RUN_ARGS+=("$2")
+            shift 2
+            ;;
+        ---docker_run_args=*)
+            VIASH_DOCKER_RUN_ARGS+=("$(ViashRemoveFlags "$1")")
+            shift 1
+            ;;
+        ---docker_image_id)
+            VIASH_MODE='docker_image_id'
+            shift 1
+            ;;
+        ---debug)
+            VIASH_MODE='debug'
+            shift 1
+            ;;
+        ---cpus)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---cpus. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---cpus=*)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus=*\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        ---memory)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---memory. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---memory=*)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory=*\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        *)  # positional arg or unknown option
+            # since the positional args will be eval'd, can we always quote, instead of using ViashQuote
+            VIASH_POSITIONAL_ARGS="$VIASH_POSITIONAL_ARGS '$1'"
+            [[ $1 == -* ]] && ViashWarning $1 looks like a parameter but is not a defined parameter and will instead be treated as a positional argument. Use "--help" to get more information on the parameters.
+            shift # past argument
+            ;;
+    esac
+done
+
+# parse positional parameters
+eval set -- $VIASH_POSITIONAL_ARGS
+
+
+if   [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  VIASH_ENGINE_TYPE='native'
+elif   [ "$VIASH_ENGINE_ID" == "docker" ]  ; then
+  VIASH_ENGINE_TYPE='docker'
+else
+  ViashError "Engine '$VIASH_ENGINE_ID' is not recognized. Options are: docker, native."
+  exit 1
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # check if docker is installed properly
+  ViashDockerInstallationCheck
+
+  # determine docker image id
+  if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
+    VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/agat/agat_sp_merge_annotations:main'
+  fi
+
+  # print dockerfile
+  if [ "$VIASH_MODE" == "dockerfile" ]; then
+    ViashDockerfile "$VIASH_ENGINE_ID"
+    exit 0
+
+  elif [ "$VIASH_MODE" == "docker_image_id" ]; then
+    echo "$VIASH_DOCKER_IMAGE_ID"
+    exit 0
+  
+  # enter docker container
+  elif [[ "$VIASH_MODE" == "debug" ]]; then
+    VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} -v '$(pwd)':/pwd --workdir /pwd -t $VIASH_DOCKER_IMAGE_ID"
+    ViashNotice "+ $VIASH_CMD"
+    eval $VIASH_CMD
+    exit 
+
+  # build docker image
+  elif [ "$VIASH_MODE" == "setup" ]; then
+    ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" "$VIASH_SETUP_STRATEGY"
+    ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+    exit 0
+  fi
+
+  # check if docker image exists
+  ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" ifneedbepullelsecachedbuild
+  ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+fi
+
+# setting computational defaults
+
+# helper function for parsing memory strings
+function ViashMemoryAsBytes {
+  local memory=`echo "$1" | tr '[:upper:]' '[:lower:]' | tr -d '[:space:]'`
+  local memory_regex='^([0-9]+)([kmgtp]i?b?|b)$'
+  if [[ $memory =~ $memory_regex ]]; then
+    local number=${memory/[^0-9]*/}
+    local symbol=${memory/*[0-9]/}
+    
+    case $symbol in
+      b)      memory_b=$number ;;
+      kb|k)   memory_b=$(( $number * 1000 )) ;;
+      mb|m)   memory_b=$(( $number * 1000 * 1000 )) ;;
+      gb|g)   memory_b=$(( $number * 1000 * 1000 * 1000 )) ;;
+      tb|t)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 )) ;;
+      pb|p)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 * 1000 )) ;;
+      kib|ki)   memory_b=$(( $number * 1024 )) ;;
+      mib|mi)   memory_b=$(( $number * 1024 * 1024 )) ;;
+      gib|gi)   memory_b=$(( $number * 1024 * 1024 * 1024 )) ;;
+      tib|ti)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 )) ;;
+      pib|pi)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 * 1024 )) ;;
+    esac
+    echo "$memory_b"
+  fi
+}
+# compute memory in different units
+if [ ! -z ${VIASH_META_MEMORY+x} ]; then
+  VIASH_META_MEMORY_B=`ViashMemoryAsBytes $VIASH_META_MEMORY`
+  # do not define other variables if memory_b is an empty string
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_META_MEMORY_KB=$(( ($VIASH_META_MEMORY_B+999) / 1000 ))
+    VIASH_META_MEMORY_MB=$(( ($VIASH_META_MEMORY_KB+999) / 1000 ))
+    VIASH_META_MEMORY_GB=$(( ($VIASH_META_MEMORY_MB+999) / 1000 ))
+    VIASH_META_MEMORY_TB=$(( ($VIASH_META_MEMORY_GB+999) / 1000 ))
+    VIASH_META_MEMORY_PB=$(( ($VIASH_META_MEMORY_TB+999) / 1000 ))
+    VIASH_META_MEMORY_KIB=$(( ($VIASH_META_MEMORY_B+1023) / 1024 ))
+    VIASH_META_MEMORY_MIB=$(( ($VIASH_META_MEMORY_KIB+1023) / 1024 ))
+    VIASH_META_MEMORY_GIB=$(( ($VIASH_META_MEMORY_MIB+1023) / 1024 ))
+    VIASH_META_MEMORY_TIB=$(( ($VIASH_META_MEMORY_GIB+1023) / 1024 ))
+    VIASH_META_MEMORY_PIB=$(( ($VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  else
+    # unset memory if string is empty
+    unset $VIASH_META_MEMORY_B
+  fi
+fi
+# unset nproc if string is empty
+if [ -z "$VIASH_META_CPUS" ]; then
+  unset $VIASH_META_CPUS
+fi
+
+
+# check whether required parameters exist
+if [ -z ${VIASH_PAR_GFF+x} ]; then
+  ViashError '--gff' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_PAR_OUTPUT+x} ]; then
+  ViashError '--output' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_NAME+x} ]; then
+  ViashError 'name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then
+  ViashError 'functionality_name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_RESOURCES_DIR+x} ]; then
+  ViashError 'resources_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_EXECUTABLE+x} ]; then
+  ViashError 'executable' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_CONFIG+x} ]; then
+  ViashError 'config' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_TEMP_DIR+x} ]; then
+  ViashError 'temp_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_GFF" ]; then
+  IFS=';'
+  set -f
+  for file in $VIASH_PAR_GFF; do
+    unset IFS
+    if [ ! -e "$file" ]; then
+      ViashError "Input file '$file' does not exist."
+      exit 1
+    fi
+  done
+  set +f
+fi
+if [ ! -z "$VIASH_PAR_CONFIG" ] && [ ! -e "$VIASH_PAR_CONFIG" ]; then
+  ViashError "Input file '$VIASH_PAR_CONFIG' does not exist."
+  exit 1
+fi
+
+# check whether parameters values are of the right type
+if [[ -n "$VIASH_META_CPUS" ]]; then
+  if ! [[ "$VIASH_META_CPUS" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'cpus' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_B" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_B" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_b' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+
+# create parent directories of output files, if so desired
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT")"
+fi
+
+if  [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  if [ "$VIASH_MODE" == "run" ]; then
+    VIASH_CMD="bash"
+  else
+    ViashError "Engine '$VIASH_ENGINE_ID' does not support mode '$VIASH_MODE'."
+    exit 1
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # detect volumes from file arguments
+  VIASH_CHOWN_VARS=()
+if [ ! -z "$VIASH_PAR_GFF" ]; then
+  VIASH_TEST_GFF=()
+  IFS=';'
+  for var in $VIASH_PAR_GFF; do
+    unset IFS
+    VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" )
+    var=$(ViashDockerAutodetectMount "$var")
+    VIASH_TEST_GFF+=( "$var" )
+  done
+  VIASH_PAR_GFF=$(IFS=';' ; echo "${VIASH_TEST_GFF[*]}")
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT")" )
+  VIASH_PAR_OUTPUT=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT" )
+fi
+if [ ! -z "$VIASH_PAR_CONFIG" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_CONFIG")" )
+  VIASH_PAR_CONFIG=$(ViashDockerAutodetectMount "$VIASH_PAR_CONFIG")
+fi
+if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" )
+  VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR")
+fi
+if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_EXECUTABLE")" )
+  VIASH_META_EXECUTABLE=$(ViashDockerAutodetectMount "$VIASH_META_EXECUTABLE")
+fi
+if [ ! -z "$VIASH_META_CONFIG" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_CONFIG")" )
+  VIASH_META_CONFIG=$(ViashDockerAutodetectMount "$VIASH_META_CONFIG")
+fi
+if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_TEMP_DIR")" )
+  VIASH_META_TEMP_DIR=$(ViashDockerAutodetectMount "$VIASH_META_TEMP_DIR")
+fi
+  
+  # get unique mounts
+  VIASH_UNIQUE_MOUNTS=($(for val in "${VIASH_DIRECTORY_MOUNTS[@]}"; do echo "$val"; done | sort -u))
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # change file ownership
+  function ViashPerformChown {
+    if (( ${#VIASH_CHOWN_VARS[@]} )); then
+      set +e
+      VIASH_CMD="docker run --entrypoint=bash --rm ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID -c 'chown $(id -u):$(id -g) --silent --recursive ${VIASH_CHOWN_VARS[@]}'"
+      ViashDebug "+ $VIASH_CMD"
+      eval $VIASH_CMD
+      set -e
+    fi
+  }
+  trap ViashPerformChown EXIT
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # helper function for filling in extra docker args
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--memory=${VIASH_META_MEMORY_B}")
+  fi
+  if [ ! -z "$VIASH_META_CPUS" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--cpus=${VIASH_META_CPUS}")
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID"
+fi
+
+
+# set dependency paths
+
+
+ViashDebug "Running command: $(echo $VIASH_CMD)"
+cat << VIASHEOF | eval $VIASH_CMD
+set -e
+tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-agat_sp_merge_annotations-XXXXXX").sh
+function clean_up {
+  rm "\$tempscript"
+}
+function interrupt {
+  echo -e "\nCTRL-C Pressed..."
+  exit 1
+}
+trap clean_up EXIT
+trap interrupt INT SIGINT
+cat > "\$tempscript" << 'VIASHMAIN'
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_GFF+x} ]; then echo "${VIASH_PAR_GFF}" | sed "s#'#'\"'\"'#g;s#.*#par_gff='&'#" ; else echo "# par_gff="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_PAR_CONFIG+x} ]; then echo "${VIASH_PAR_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#par_config='&'#" ; else echo "# par_config="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\"'\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\"'\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+
+# Convert a list of file names to multiple -gff arguments
+input_files=""
+IFS=";" read -ra file_names <<< "\$par_gff"
+for file in "\${file_names[@]}"; do
+    input_files+="--gff \$file "
+done
+
+# run agat_sp_merge_annotations
+agat_sp_merge_annotations.pl \\
+  \$input_files \\
+  -o "\$par_output" \\
+  \${par_config:+--config "\${par_config}"}
+VIASHMAIN
+bash "\$tempscript" &
+wait "\$!"
+
+VIASHEOF
+
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # strip viash automount from file paths
+  
+  if [ ! -z "$VIASH_PAR_GFF" ]; then
+    unset VIASH_TEST_GFF
+    IFS=';'
+    for var in $VIASH_PAR_GFF; do
+      unset IFS
+      if [ -z "$VIASH_TEST_GFF" ]; then
+      VIASH_TEST_GFF="$(ViashDockerStripAutomount "$var")"
+    else
+      VIASH_TEST_GFF="$VIASH_TEST_GFF;""$(ViashDockerStripAutomount "$var")"
+    fi
+    done
+    VIASH_PAR_GFF="$VIASH_TEST_GFF"
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+    VIASH_PAR_OUTPUT=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT")
+  fi
+  if [ ! -z "$VIASH_PAR_CONFIG" ]; then
+    VIASH_PAR_CONFIG=$(ViashDockerStripAutomount "$VIASH_PAR_CONFIG")
+  fi
+  if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+    VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR")
+  fi
+  if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+    VIASH_META_EXECUTABLE=$(ViashDockerStripAutomount "$VIASH_META_EXECUTABLE")
+  fi
+  if [ ! -z "$VIASH_META_CONFIG" ]; then
+    VIASH_META_CONFIG=$(ViashDockerStripAutomount "$VIASH_META_CONFIG")
+  fi
+  if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+    VIASH_META_TEMP_DIR=$(ViashDockerStripAutomount "$VIASH_META_TEMP_DIR")
+  fi
+fi
+
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -e "$VIASH_PAR_OUTPUT" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT' does not exist."
+  exit 1
+fi
+
+
+exit 0
diff --git a/target/executable/agat/agat_sp_statistics/.config.vsh.yaml b/target/executable/agat/agat_sp_statistics/.config.vsh.yaml
index d0a5e433..349b3d36 100644
--- a/target/executable/agat/agat_sp_statistics/.config.vsh.yaml
+++ b/target/executable/agat/agat_sp_statistics/.config.vsh.yaml
@@ -231,9 +231,9 @@ build_info:
   output: "target/executable/agat/agat_sp_statistics"
   executable: "target/executable/agat/agat_sp_statistics/agat_sp_statistics"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/agat/agat_sp_statistics/agat_sp_statistics b/target/executable/agat/agat_sp_statistics/agat_sp_statistics
index b8c0572e..eeac3fca 100755
--- a/target/executable/agat/agat_sp_statistics/agat_sp_statistics
+++ b/target/executable/agat/agat_sp_statistics/agat_sp_statistics
@@ -507,9 +507,9 @@ RUN agat --version | sed 's/.*v\.//; s/\s.*//' | sed 's/^/AGAT: /' > /var/softwa
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_statistics"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/arriba/.config.vsh.yaml b/target/executable/arriba/.config.vsh.yaml
index 4c6038ff..a034357e 100644
--- a/target/executable/arriba/.config.vsh.yaml
+++ b/target/executable/arriba/.config.vsh.yaml
@@ -706,9 +706,9 @@ build_info:
   output: "target/executable/arriba"
   executable: "target/executable/arriba/arriba"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/arriba/arriba b/target/executable/arriba/arriba
index 2bfca067..b957fcd6 100755
--- a/target/executable/arriba/arriba
+++ b/target/executable/arriba/arriba
@@ -754,9 +754,9 @@ RUN arriba -h | grep 'Version:' 2>&1 |  sed 's/Version:\s\(.*\)/arriba: "\1"/' >
 
 LABEL org.opencontainers.image.authors="Robrecht Cannoodt"
 LABEL org.opencontainers.image.description="Companion container for running component arriba"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:10Z"
 LABEL org.opencontainers.image.source="https://github.com/suhrig/arriba"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml b/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml
index 6a2c5c50..6586c1e4 100644
--- a/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml
+++ b/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml
@@ -359,9 +359,9 @@ build_info:
   output: "target/executable/bbmap/bbmap_bbsplit"
   executable: "target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit b/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit
index 52083431..fc42d009 100755
--- a/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit
+++ b/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit
@@ -600,9 +600,9 @@ cp -r bbmap/* /usr/local/bin
 RUN bbsplit.sh --version 2>&1 | awk '/BBMap version/{print "BBMAP:", $NF}' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.description="Companion container for running component bbmap bbmap_bbsplit"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:24Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:12Z"
 LABEL org.opencontainers.image.source="https://github.com/BioInfoTools/BBMap/blob/master/sh/bbsplit.sh"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml b/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml
index 5dcd2f17..5228e868 100644
--- a/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml
@@ -469,9 +469,9 @@ build_info:
   output: "target/executable/bcftools/bcftools_annotate"
   executable: "target/executable/bcftools/bcftools_annotate/bcftools_annotate"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bcftools/bcftools_annotate/bcftools_annotate b/target/executable/bcftools/bcftools_annotate/bcftools_annotate
index 8d54a340..1158f3e3 100755
--- a/target/executable/bcftools/bcftools_annotate/bcftools_annotate
+++ b/target/executable/bcftools/bcftools_annotate/bcftools_annotate
@@ -650,9 +650,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_annotate"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:12Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:00Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bcftools/bcftools_concat/.config.vsh.yaml b/target/executable/bcftools/bcftools_concat/.config.vsh.yaml
index 39aaf690..ade51af9 100644
--- a/target/executable/bcftools/bcftools_concat/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_concat/.config.vsh.yaml
@@ -335,9 +335,9 @@ build_info:
   output: "target/executable/bcftools/bcftools_concat"
   executable: "target/executable/bcftools/bcftools_concat/bcftools_concat"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bcftools/bcftools_concat/bcftools_concat b/target/executable/bcftools/bcftools_concat/bcftools_concat
index 63ae35cb..b49da971 100755
--- a/target/executable/bcftools/bcftools_concat/bcftools_concat
+++ b/target/executable/bcftools/bcftools_concat/bcftools_concat
@@ -566,9 +566,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_concat"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:13Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:01Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bcftools/bcftools_norm/.config.vsh.yaml b/target/executable/bcftools/bcftools_norm/.config.vsh.yaml
index e1b53f7e..b71f853d 100644
--- a/target/executable/bcftools/bcftools_norm/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_norm/.config.vsh.yaml
@@ -416,9 +416,9 @@ build_info:
   output: "target/executable/bcftools/bcftools_norm"
   executable: "target/executable/bcftools/bcftools_norm/bcftools_norm"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bcftools/bcftools_norm/bcftools_norm b/target/executable/bcftools/bcftools_norm/bcftools_norm
index 8f1661d2..7544eb41 100755
--- a/target/executable/bcftools/bcftools_norm/bcftools_norm
+++ b/target/executable/bcftools/bcftools_norm/bcftools_norm
@@ -589,9 +589,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_norm"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:14Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:02Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bcftools/bcftools_sort/.config.vsh.yaml b/target/executable/bcftools/bcftools_sort/.config.vsh.yaml
index 95bb973f..388a563e 100644
--- a/target/executable/bcftools/bcftools_sort/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_sort/.config.vsh.yaml
@@ -185,9 +185,9 @@ build_info:
   output: "target/executable/bcftools/bcftools_sort"
   executable: "target/executable/bcftools/bcftools_sort/bcftools_sort"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bcftools/bcftools_sort/bcftools_sort b/target/executable/bcftools/bcftools_sort/bcftools_sort
index 54c82d1e..9b2f72e5 100755
--- a/target/executable/bcftools/bcftools_sort/bcftools_sort
+++ b/target/executable/bcftools/bcftools_sort/bcftools_sort
@@ -483,9 +483,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_sort"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:14Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:02Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bcftools/bcftools_stats/.config.vsh.yaml b/target/executable/bcftools/bcftools_stats/.config.vsh.yaml
index cf6ffceb..7216a9f9 100644
--- a/target/executable/bcftools/bcftools_stats/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_stats/.config.vsh.yaml
@@ -458,9 +458,9 @@ build_info:
   output: "target/executable/bcftools/bcftools_stats"
   executable: "target/executable/bcftools/bcftools_stats/bcftools_stats"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bcftools/bcftools_stats/bcftools_stats b/target/executable/bcftools/bcftools_stats/bcftools_stats
index d9e1da31..d9ebd0d9 100755
--- a/target/executable/bcftools/bcftools_stats/bcftools_stats
+++ b/target/executable/bcftools/bcftools_stats/bcftools_stats
@@ -626,9 +626,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_stats"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:13Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:01Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bcl_convert/.config.vsh.yaml b/target/executable/bcl_convert/.config.vsh.yaml
index dbefed7e..b31b4646 100644
--- a/target/executable/bcl_convert/.config.vsh.yaml
+++ b/target/executable/bcl_convert/.config.vsh.yaml
@@ -418,9 +418,9 @@ build_info:
   output: "target/executable/bcl_convert"
   executable: "target/executable/bcl_convert/bcl_convert"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bcl_convert/bcl_convert b/target/executable/bcl_convert/bcl_convert
index b262e57b..6eddf272 100755
--- a/target/executable/bcl_convert/bcl_convert
+++ b/target/executable/bcl_convert/bcl_convert
@@ -599,9 +599,9 @@ RUN echo "bcl-convert: \"$(bcl-convert -V 2>&1 >/dev/null | sed -n '/Version/ s/
 
 LABEL org.opencontainers.image.authors="Toni Verbeiren, Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component bcl_convert"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:19Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml
index 8bcf1fcb..d501da67 100644
--- a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml
+++ b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml
@@ -274,9 +274,9 @@ build_info:
   output: "target/executable/bd_rhapsody/bd_rhapsody_make_reference"
   executable: "target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference
index 732fa212..5cb72ebb 100755
--- a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference
+++ b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference
@@ -554,9 +554,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1)
 RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt
 LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz"
 LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_make_reference"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:16Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:03Z"
 LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1/Extra_Utilities/"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml
index fa967a06..75eb0e02 100644
--- a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml
+++ b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml
@@ -1115,9 +1115,9 @@ build_info:
   output: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis"
   executable: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis
index b3228441..a91508ab 100755
--- a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis
+++ b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis
@@ -954,9 +954,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1)
 RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt
 LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz"
 LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_sequence_analysis"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:16Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:03Z"
 LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml b/target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml
new file mode 100644
index 00000000..c495fa2f
--- /dev/null
+++ b/target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml
@@ -0,0 +1,262 @@
+name: "bedtools_bamtobed"
+namespace: "bedtools"
+version: "main"
+authors:
+- name: "Theodoro Gasperin Terra Camargo"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "theodorogtc@gmail.com"
+      github: "tgaspe"
+      linkedin: "theodoro-gasperin-terra-camargo"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--input"
+    alternatives:
+    - "-i"
+    description: "Input BAM file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    description: "Output BED file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Options"
+  arguments:
+  - type: "boolean_true"
+    name: "--bedpe"
+    description: "Write BEDPE format. Requires BAM to be grouped or sorted by query.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--mate1"
+    description: "When writing BEDPE (-bedpe) format, always report mate one as the\
+      \ first BEDPE \"block\".\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--bed12"
+    description: "Write \"blocked\" BED format (aka \"BED12\"). Forces -split.\nSee\
+      \ http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--split"
+    description: "Report \"split\" BAM alignments as separate BED entries.\nSplits\
+      \ only on N CIGAR operations.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--splitD"
+    description: "Split alignments based on N and D CIGAR operators.\nForces -split.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--edit_distance"
+    alternatives:
+    - "-ed"
+    description: "Use BAM edit distance (NM tag) for BED score.\n- Default for BED\
+      \ is to use mapping quality.\n- Default for BEDPE is to use the minimum of\n\
+      \  the two mapping qualities for the pair.\n- When -ed is used with -bedpe,\
+      \ the total edit\n  distance from the two mates is reported.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--tag"
+    description: "Use other NUMERIC BAM alignment tag for BED score.\nDefault for\
+      \ BED is to use mapping quality. Disallowed with BEDPE output.\n"
+    info: null
+    example:
+    - "SM"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--color"
+    description: "An R,G,B string for the color used with BED12 format.\nDefault is\
+      \ (255,0,0).\n"
+    info: null
+    example:
+    - "250,250,250"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--cigar"
+    description: "Add the CIGAR string to the BED entry as a 7th column.\n"
+    info: null
+    direction: "input"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Converts BAM alignments to BED6 or BEDPE format."
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "Converts"
+- "BAM"
+- "BED"
+- "BED6"
+- "BEDPE"
+license: "MIT"
+references:
+  doi:
+  - "10.1093/bioinformatics/btq033"
+links:
+  repository: "https://github.com/arq5x/bedtools2"
+  homepage: "https://bedtools.readthedocs.io/en/latest/#"
+  documentation: "https://bedtools.readthedocs.io/en/latest/content/tools/bamtobed.html"
+  issue_tracker: "https://github.com/arq5x/bedtools2/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "debian:stable-slim"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "apt"
+    packages:
+    - "bedtools"
+    - "procps"
+    interactive: false
+  - type: "docker"
+    run:
+    - "echo \"bedtools: \\\"$(bedtools --version | sed -n 's/^bedtools //p')\\\"\"\
+      \ > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/bedtools/bedtools_bamtobed/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/bedtools/bedtools_bamtobed"
+  executable: "target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed b/target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed
new file mode 100755
index 00000000..8ddc020e
--- /dev/null
+++ b/target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed
@@ -0,0 +1,1313 @@
+#!/usr/bin/env bash
+
+# bedtools_bamtobed main
+# 
+# This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+# work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+# Intuitive.
+# 
+# The component may contain files which fall under a different license. The
+# authors of this component should specify the license in the header of such
+# files, or include a separate license file detailing the licenses of all included
+# files.
+# 
+# Component authors:
+#  * Theodoro Gasperin Terra Camargo (author, maintainer)
+
+set -e
+
+if [ -z "$VIASH_TEMP" ]; then
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMP}
+  VIASH_TEMP=${VIASH_TEMP:-/tmp}
+fi
+
+# define helper functions
+# ViashQuote: put quotes around non flag values
+# $1     : unquoted string
+# return : possibly quoted string
+# examples:
+#   ViashQuote --foo      # returns --foo
+#   ViashQuote bar        # returns 'bar'
+#   Viashquote --foo=bar  # returns --foo='bar'
+function ViashQuote {
+  if [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+=.+$ ]]; then
+    echo "$1" | sed "s#=\(.*\)#='\1'#"
+  elif [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+$ ]]; then
+    echo "$1"
+  else
+    echo "'$1'"
+  fi
+}
+# ViashRemoveFlags: Remove leading flag
+# $1     : string with a possible leading flag
+# return : string without possible leading flag
+# examples:
+#   ViashRemoveFlags --foo=bar  # returns bar
+function ViashRemoveFlags {
+  echo "$1" | sed 's/^--*[a-zA-Z0-9_\-]*=//'
+}
+# ViashSourceDir: return the path of a bash file, following symlinks
+# usage   : ViashSourceDir ${BASH_SOURCE[0]}
+# $1      : Should always be set to ${BASH_SOURCE[0]}
+# returns : The absolute path of the bash file
+function ViashSourceDir {
+  local source="$1"
+  while [ -h "$source" ]; do
+    local dir="$( cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd )"
+    source="$(readlink "$source")"
+    [[ $source != /* ]] && source="$dir/$source"
+  done
+  cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd
+}
+# ViashFindTargetDir: return the path of the '.build.yaml' file, following symlinks
+# usage   : ViashFindTargetDir 'ScriptPath'
+# $1      : The location from where to start the upward search
+# returns : The absolute path of the '.build.yaml' file
+function ViashFindTargetDir {
+  local source="$1"
+  while [[ "$source" != "" && ! -e "$source/.build.yaml" ]]; do
+    source=${source%/*}
+  done
+  echo $source
+}
+# see https://en.wikipedia.org/wiki/Syslog#Severity_level
+VIASH_LOGCODE_EMERGENCY=0
+VIASH_LOGCODE_ALERT=1
+VIASH_LOGCODE_CRITICAL=2
+VIASH_LOGCODE_ERROR=3
+VIASH_LOGCODE_WARNING=4
+VIASH_LOGCODE_NOTICE=5
+VIASH_LOGCODE_INFO=6
+VIASH_LOGCODE_DEBUG=7
+VIASH_VERBOSITY=$VIASH_LOGCODE_NOTICE
+
+# ViashLog: Log events depending on the verbosity level
+# usage: ViashLog 1 alert Oh no something went wrong!
+# $1: required verbosity level
+# $2: display tag
+# $3+: messages to display
+# stdout: Your input, prepended by '[$2] '.
+function ViashLog {
+  local required_level="$1"
+  local display_tag="$2"
+  shift 2
+  if [ $VIASH_VERBOSITY -ge $required_level ]; then
+    >&2 echo "[$display_tag]" "$@"
+  fi
+}
+
+# ViashEmergency: log events when the system is unstable
+# usage: ViashEmergency Oh no something went wrong.
+# stdout: Your input, prepended by '[emergency] '.
+function ViashEmergency {
+  ViashLog $VIASH_LOGCODE_EMERGENCY emergency "$@"
+}
+
+# ViashAlert: log events when actions must be taken immediately (e.g. corrupted system database)
+# usage: ViashAlert Oh no something went wrong.
+# stdout: Your input, prepended by '[alert] '.
+function ViashAlert {
+  ViashLog $VIASH_LOGCODE_ALERT alert "$@"
+}
+
+# ViashCritical: log events when a critical condition occurs
+# usage: ViashCritical Oh no something went wrong.
+# stdout: Your input, prepended by '[critical] '.
+function ViashCritical {
+  ViashLog $VIASH_LOGCODE_CRITICAL critical "$@"
+}
+
+# ViashError: log events when an error condition occurs
+# usage: ViashError Oh no something went wrong.
+# stdout: Your input, prepended by '[error] '.
+function ViashError {
+  ViashLog $VIASH_LOGCODE_ERROR error "$@"
+}
+
+# ViashWarning: log potentially abnormal events
+# usage: ViashWarning Something may have gone wrong.
+# stdout: Your input, prepended by '[warning] '.
+function ViashWarning {
+  ViashLog $VIASH_LOGCODE_WARNING warning "$@"
+}
+
+# ViashNotice: log significant but normal events
+# usage: ViashNotice This just happened.
+# stdout: Your input, prepended by '[notice] '.
+function ViashNotice {
+  ViashLog $VIASH_LOGCODE_NOTICE notice "$@"
+}
+
+# ViashInfo: log normal events
+# usage: ViashInfo This just happened.
+# stdout: Your input, prepended by '[info] '.
+function ViashInfo {
+  ViashLog $VIASH_LOGCODE_INFO info "$@"
+}
+
+# ViashDebug: log all events, for debugging purposes
+# usage: ViashDebug This just happened.
+# stdout: Your input, prepended by '[debug] '.
+function ViashDebug {
+  ViashLog $VIASH_LOGCODE_DEBUG debug "$@"
+}
+
+# find source folder of this component
+VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}`
+
+# find the root of the built components & dependencies
+VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR`
+
+# define meta fields
+VIASH_META_NAME="bedtools_bamtobed"
+VIASH_META_FUNCTIONALITY_NAME="bedtools_bamtobed"
+VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME"
+VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+VIASH_META_TEMP_DIR="$VIASH_TEMP"
+
+
+# ViashHelp: Display helpful explanation about this executable
+function ViashHelp {
+  echo "bedtools_bamtobed main"
+  echo ""
+  echo "Converts BAM alignments to BED6 or BEDPE format."
+  echo ""
+  echo "Inputs:"
+  echo "    -i, --input"
+  echo "        type: file, required parameter, file must exist"
+  echo "        Input BAM file."
+  echo ""
+  echo "Outputs:"
+  echo "    -o, --output"
+  echo "        type: file, required parameter, output, file must exist"
+  echo "        Output BED file."
+  echo ""
+  echo "Options:"
+  echo "    --bedpe"
+  echo "        type: boolean_true"
+  echo "        Write BEDPE format. Requires BAM to be grouped or sorted by query."
+  echo ""
+  echo "    --mate1"
+  echo "        type: boolean_true"
+  echo "        When writing BEDPE (-bedpe) format, always report mate one as the first"
+  echo "        BEDPE \"block\"."
+  echo ""
+  echo "    --bed12"
+  echo "        type: boolean_true"
+  echo "        Write \"blocked\" BED format (aka \"BED12\"). Forces -split."
+  echo "        See http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1"
+  echo ""
+  echo "    --split"
+  echo "        type: boolean_true"
+  echo "        Report \"split\" BAM alignments as separate BED entries."
+  echo "        Splits only on N CIGAR operations."
+  echo ""
+  echo "    --splitD"
+  echo "        type: boolean_true"
+  echo "        Split alignments based on N and D CIGAR operators."
+  echo "        Forces -split."
+  echo ""
+  echo "    -ed, --edit_distance"
+  echo "        type: boolean_true"
+  echo "        Use BAM edit distance (NM tag) for BED score."
+  echo "        - Default for BED is to use mapping quality."
+  echo "        - Default for BEDPE is to use the minimum of"
+  echo "          the two mapping qualities for the pair."
+  echo "        - When -ed is used with -bedpe, the total edit"
+  echo "          distance from the two mates is reported."
+  echo ""
+  echo "    --tag"
+  echo "        type: string"
+  echo "        example: SM"
+  echo "        Use other NUMERIC BAM alignment tag for BED score."
+  echo "        Default for BED is to use mapping quality. Disallowed with BEDPE output."
+  echo ""
+  echo "    --color"
+  echo "        type: string"
+  echo "        example: 250,250,250"
+  echo "        An R,G,B string for the color used with BED12 format."
+  echo "        Default is (255,0,0)."
+  echo ""
+  echo "    --cigar"
+  echo "        type: boolean_true"
+  echo "        Add the CIGAR string to the BED entry as a 7th column."
+}
+
+# initialise variables
+VIASH_MODE='run'
+VIASH_ENGINE_ID='docker'
+
+######## Helper functions for setting up Docker images for viash ########
+# expects: ViashDockerBuild
+
+# ViashDockerInstallationCheck: check whether Docker is installed correctly
+#
+# examples:
+#   ViashDockerInstallationCheck
+function ViashDockerInstallationCheck {
+  ViashDebug "Checking whether Docker is installed"
+  if [ ! command -v docker &> /dev/null ]; then
+    ViashCritical "Docker doesn't seem to be installed. See 'https://docs.docker.com/get-docker/' for instructions."
+    exit 1
+  fi
+
+  ViashDebug "Checking whether the Docker daemon is running"
+  local save=$-; set +e
+  local docker_version=$(docker version --format '{{.Client.APIVersion}}' 2> /dev/null)
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashCritical "Docker daemon does not seem to be running. Try one of the following:"
+    ViashCritical "- Try running 'dockerd' in the command line"
+    ViashCritical "- See https://docs.docker.com/config/daemon/"
+    exit 1
+  fi
+}
+
+# ViashDockerRemoteTagCheck: check whether a Docker image is available 
+# on a remote. Assumes `docker login` has been performed, if relevant.
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerRemoteTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerRemoteTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerRemoteTagCheck {
+  docker manifest inspect $1 > /dev/null 2> /dev/null
+}
+
+# ViashDockerLocalTagCheck: check whether a Docker image is available locally
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   docker pull python:latest
+#   ViashDockerLocalTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerLocalTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerLocalTagCheck {
+  [ -n "$(docker images -q $1)" ]
+}
+
+# ViashDockerPull: pull a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPull python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPull sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPull {
+  ViashNotice "Checking if Docker image is available at '$1'"
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker pull $1 && return 0 || return 1
+  else
+    local save=$-; set +e
+    docker pull $1 2> /dev/null > /dev/null
+    local out=$?
+    [[ $save =~ e ]] && set -e
+    if [ $out -ne 0 ]; then
+      ViashWarning "Could not pull from '$1'. Docker image doesn't exist or is not accessible."
+    fi
+    return $out
+  fi
+}
+
+# ViashDockerPush: push a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPush python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPush sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPush {
+  ViashNotice "Pushing image to '$1'"
+  local save=$-; set +e
+  local out
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker push $1
+    out=$?
+  else
+    docker push $1 2> /dev/null > /dev/null
+    out=$?
+  fi
+  [[ $save =~ e ]] && set -e
+  if [ $out -eq 0 ]; then
+    ViashNotice "Container '$1' push succeeded."
+  else
+    ViashError "Container '$1' push errored. You might not be logged in or have the necessary permissions."
+  fi
+  return $out
+}
+
+# ViashDockerPullElseBuild: pull a Docker image, else build it
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# ViashDockerBuild    : a Bash function which builds a docker image, takes image identifier as argument.
+# examples:
+#   ViashDockerPullElseBuild mynewcomponent
+function ViashDockerPullElseBuild {
+  local save=$-; set +e
+  ViashDockerPull $1
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashDockerBuild $@
+  fi
+}
+
+# ViashDockerSetup: create a Docker image, according to specified docker setup strategy
+#
+# $1          : image identifier with format `[registry/]image[:tag]`
+# $2          : docker setup strategy, see DockerSetupStrategy.scala
+# examples:
+#   ViashDockerSetup mynewcomponent alwaysbuild
+function ViashDockerSetup {
+  local image_id="$1"
+  local setup_strategy="$2"
+  if [ "$setup_strategy" == "alwaysbuild" -o "$setup_strategy" == "build" -o "$setup_strategy" == "b" ]; then
+    ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspull" -o "$setup_strategy" == "pull" -o "$setup_strategy" == "p" ]; then
+    ViashDockerPull $image_id
+  elif [ "$setup_strategy" == "alwayspullelsebuild" -o "$setup_strategy" == "pullelsebuild" ]; then
+    ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspullelsecachedbuild" -o "$setup_strategy" == "pullelsecachedbuild" ]; then
+    ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayscachedbuild" -o "$setup_strategy" == "cachedbuild" -o "$setup_strategy" == "cb" ]; then
+    ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [[ "$setup_strategy" =~ ^ifneedbe ]]; then
+    local save=$-; set +e
+    ViashDockerLocalTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashInfo "Image $image_id already exists"
+    elif [ "$setup_strategy" == "ifneedbebuild" ]; then
+      ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbecachedbuild" ]; then
+      ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepull" ]; then
+      ViashDockerPull $image_id
+    elif [ "$setup_strategy" == "ifneedbepullelsebuild" ]; then
+      ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepullelsecachedbuild" ]; then
+      ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    else
+      ViashError "Unrecognised Docker strategy: $setup_strategy"
+      exit 1
+    fi
+  elif [ "$setup_strategy" == "push" -o "$setup_strategy" == "forcepush" -o "$setup_strategy" == "alwayspush" ]; then
+    ViashDockerPush "$image_id"
+  elif [ "$setup_strategy" == "pushifnotpresent" -o "$setup_strategy" == "gentlepush" -o "$setup_strategy" == "maybepush" ]; then
+    local save=$-; set +e
+    ViashDockerRemoteTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashNotice "Container '$image_id' exists, doing nothing."
+    else
+      ViashNotice "Container '$image_id' does not yet exist."
+      ViashDockerPush "$image_id"
+    fi
+  elif [ "$setup_strategy" == "donothing" -o "$setup_strategy" == "meh" ]; then
+    ViashNotice "Skipping setup."
+  else
+    ViashError "Unrecognised Docker strategy: $setup_strategy"
+    exit 1
+  fi
+}
+
+# ViashDockerCheckCommands: Check whether a docker container has the required commands
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# $@                  : commands to verify being present
+# examples:
+#   ViashDockerCheckCommands bash:4.0 bash ps foo
+function ViashDockerCheckCommands {
+  local image_id="$1"
+  shift 1
+  local commands="$@"
+  local save=$-; set +e
+  local missing # mark 'missing' as local in advance, otherwise the exit code of the command will be missing and always be '0'
+  missing=$(docker run --rm --entrypoint=sh "$image_id" -c "for command in $commands; do command -v \$command >/dev/null 2>&1; if [ \$? -ne 0 ]; then echo \$command; exit 1; fi; done")
+  local outCheck=$?
+  [[ $save =~ e ]] && set -e
+  if [ $outCheck -ne 0 ]; then
+  	ViashError "Docker container '$image_id' does not contain command '$missing'."
+  	exit 1
+  fi
+}
+
+# ViashDockerBuild: build a docker image
+# $1                               : image identifier with format `[registry/]image[:tag]`
+# $...                             : additional arguments to pass to docker build
+# $VIASH_META_TEMP_DIR             : temporary directory to store dockerfile & optional resources in
+# $VIASH_META_NAME                 : name of the component
+# $VIASH_META_RESOURCES_DIR        : directory containing the resources
+# $VIASH_VERBOSITY                 : verbosity level
+# exit code $?                     : whether or not the image was built successfully
+function ViashDockerBuild {
+  local image_id="$1"
+  shift 1
+
+  # create temporary directory to store dockerfile & optional resources in
+  local tmpdir=$(mktemp -d "$VIASH_META_TEMP_DIR/dockerbuild-$VIASH_META_NAME-XXXXXX")
+  local dockerfile="$tmpdir/Dockerfile"
+  function clean_up {
+    rm -rf "$tmpdir"
+  }
+  trap clean_up EXIT
+
+  # store dockerfile and resources
+  ViashDockerfile "$VIASH_ENGINE_ID" > "$dockerfile"
+
+  # generate the build command
+  local docker_build_cmd="docker build -t '$image_id' $@ '$VIASH_META_RESOURCES_DIR' -f '$dockerfile'"
+
+  # build the container
+  ViashNotice "Building container '$image_id' with Dockerfile"
+  ViashInfo "$docker_build_cmd"
+  local save=$-; set +e
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    eval $docker_build_cmd
+  else
+    eval $docker_build_cmd &> "$tmpdir/docker_build.log"
+  fi
+
+  # check exit code
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashError "Error occurred while building container '$image_id'"
+    if [ $VIASH_VERBOSITY -lt $VIASH_LOGCODE_INFO ]; then
+      ViashError "Transcript: --------------------------------"
+      cat "$tmpdir/docker_build.log"
+      ViashError "End of transcript --------------------------"
+    fi
+    exit 1
+  fi
+}
+
+######## End of helper functions for setting up Docker images for viash ########
+
+# ViashDockerFile: print the dockerfile to stdout
+# $1    : engine identifier
+# return : dockerfile required to run this component
+# examples:
+#   ViashDockerFile
+function ViashDockerfile {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    cat << 'VIASHDOCKER'
+FROM debian:stable-slim
+ENTRYPOINT []
+RUN apt-get update && \
+  DEBIAN_FRONTEND=noninteractive apt-get install -y bedtools procps && \
+  rm -rf /var/lib/apt/lists/*
+
+RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
+
+LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
+LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bamtobed"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
+LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+LABEL org.opencontainers.image.version="main"
+
+VIASHDOCKER
+  fi
+}
+
+# ViashDockerBuildArgs: return the arguments to pass to docker build
+# $1    : engine identifier
+# return : arguments to pass to docker build
+function ViashDockerBuildArgs {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    echo ""
+  fi
+}
+
+# ViashAbsolutePath: generate absolute path from relative path
+# borrowed from https://stackoverflow.com/a/21951256
+# $1     : relative filename
+# return : absolute path
+# examples:
+#   ViashAbsolutePath some_file.txt   # returns /path/to/some_file.txt
+#   ViashAbsolutePath /foo/bar/..     # returns /foo
+function ViashAbsolutePath {
+  local thePath
+  local parr
+  local outp
+  local len
+  if [[ ! "$1" =~ ^/ ]]; then
+    thePath="$PWD/$1"
+  else
+    thePath="$1"
+  fi
+  echo "$thePath" | (
+    IFS=/
+    read -a parr
+    declare -a outp
+    for i in "${parr[@]}"; do
+      case "$i" in
+      ''|.) continue ;;
+      ..)
+        len=${#outp[@]}
+        if ((len==0)); then
+          continue
+        else
+          unset outp[$((len-1))]
+        fi
+        ;;
+      *)
+        len=${#outp[@]}
+        outp[$len]="$i"
+      ;;
+      esac
+    done
+    echo /"${outp[*]}"
+  )
+}
+# ViashDockerAutodetectMount: auto configuring docker mounts from parameters
+# $1                             : The parameter value
+# returns                        : New parameter
+# $VIASH_DIRECTORY_MOUNTS        : Added another parameter to be passed to docker
+# $VIASH_DOCKER_AUTOMOUNT_PREFIX : The prefix to be used for the automounts
+# examples:
+#   ViashDockerAutodetectMount /path/to/bar      # returns '/viash_automount/path/to/bar'
+#   ViashDockerAutodetectMountArg /path/to/bar   # returns '--volume="/path/to:/viash_automount/path/to"'
+function ViashDockerAutodetectMount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  if [ -z "$base_name" ]; then
+    echo "$mount_target"
+  else
+    echo "$mount_target/$base_name"
+  fi
+}
+function ViashDockerAutodetectMountArg {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  ViashDebug "ViashDockerAutodetectMountArg $1 -> $mount_source -> $mount_target"
+  echo "--volume=\"$mount_source:$mount_target\""
+}
+function ViashDockerStripAutomount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  echo "${abs_path#$VIASH_DOCKER_AUTOMOUNT_PREFIX}"
+}
+# initialise variables
+VIASH_DIRECTORY_MOUNTS=()
+
+# configure default docker automount prefix if it is unset
+if [ -z "${VIASH_DOCKER_AUTOMOUNT_PREFIX+x}" ]; then
+  VIASH_DOCKER_AUTOMOUNT_PREFIX="/viash_automount"
+fi
+
+# initialise docker variables
+VIASH_DOCKER_RUN_ARGS=(-i --rm)
+
+# initialise array
+VIASH_POSITIONAL_ARGS=''
+
+while [[ $# -gt 0 ]]; do
+    case "$1" in
+        -h|--help)
+            ViashHelp
+            exit
+            ;;
+        ---v|---verbose)
+            let "VIASH_VERBOSITY=VIASH_VERBOSITY+1"
+            shift 1
+            ;;
+        ---verbosity)
+            VIASH_VERBOSITY="$2"
+            shift 2
+            ;;
+        ---verbosity=*)
+            VIASH_VERBOSITY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        --version)
+            echo "bedtools_bamtobed main"
+            exit
+            ;;
+        --input)
+            [ -n "$VIASH_PAR_INPUT" ] && ViashError Bad arguments for option \'--input\': \'$VIASH_PAR_INPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --input. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --input=*)
+            [ -n "$VIASH_PAR_INPUT" ] && ViashError Bad arguments for option \'--input=*\': \'$VIASH_PAR_INPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -i)
+            [ -n "$VIASH_PAR_INPUT" ] && ViashError Bad arguments for option \'-i\': \'$VIASH_PAR_INPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -i. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output=*)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output=*\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -o)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'-o\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -o. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --bedpe)
+            [ -n "$VIASH_PAR_BEDPE" ] && ViashError Bad arguments for option \'--bedpe\': \'$VIASH_PAR_BEDPE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_BEDPE=true
+            shift 1
+            ;;
+        --mate1)
+            [ -n "$VIASH_PAR_MATE1" ] && ViashError Bad arguments for option \'--mate1\': \'$VIASH_PAR_MATE1\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MATE1=true
+            shift 1
+            ;;
+        --bed12)
+            [ -n "$VIASH_PAR_BED12" ] && ViashError Bad arguments for option \'--bed12\': \'$VIASH_PAR_BED12\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_BED12=true
+            shift 1
+            ;;
+        --split)
+            [ -n "$VIASH_PAR_SPLIT" ] && ViashError Bad arguments for option \'--split\': \'$VIASH_PAR_SPLIT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_SPLIT=true
+            shift 1
+            ;;
+        --splitD)
+            [ -n "$VIASH_PAR_SPLITD" ] && ViashError Bad arguments for option \'--splitD\': \'$VIASH_PAR_SPLITD\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_SPLITD=true
+            shift 1
+            ;;
+        --edit_distance)
+            [ -n "$VIASH_PAR_EDIT_DISTANCE" ] && ViashError Bad arguments for option \'--edit_distance\': \'$VIASH_PAR_EDIT_DISTANCE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_EDIT_DISTANCE=true
+            shift 1
+            ;;
+        -ed)
+            [ -n "$VIASH_PAR_EDIT_DISTANCE" ] && ViashError Bad arguments for option \'-ed\': \'$VIASH_PAR_EDIT_DISTANCE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_EDIT_DISTANCE=true
+            shift 1
+            ;;
+        --tag)
+            [ -n "$VIASH_PAR_TAG" ] && ViashError Bad arguments for option \'--tag\': \'$VIASH_PAR_TAG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_TAG="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --tag. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --tag=*)
+            [ -n "$VIASH_PAR_TAG" ] && ViashError Bad arguments for option \'--tag=*\': \'$VIASH_PAR_TAG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_TAG=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        --color)
+            [ -n "$VIASH_PAR_COLOR" ] && ViashError Bad arguments for option \'--color\': \'$VIASH_PAR_COLOR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_COLOR="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --color. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --color=*)
+            [ -n "$VIASH_PAR_COLOR" ] && ViashError Bad arguments for option \'--color=*\': \'$VIASH_PAR_COLOR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_COLOR=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        --cigar)
+            [ -n "$VIASH_PAR_CIGAR" ] && ViashError Bad arguments for option \'--cigar\': \'$VIASH_PAR_CIGAR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_CIGAR=true
+            shift 1
+            ;;
+        ---engine)
+            VIASH_ENGINE_ID="$2"
+            shift 2
+            ;;
+        ---engine=*)
+            VIASH_ENGINE_ID="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---setup)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$2"
+            shift 2
+            ;;
+        ---setup=*)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---dockerfile)
+            VIASH_MODE='dockerfile'
+            shift 1
+            ;;
+        ---docker_run_args)
+            VIASH_DOCKER_RUN_ARGS+=("$2")
+            shift 2
+            ;;
+        ---docker_run_args=*)
+            VIASH_DOCKER_RUN_ARGS+=("$(ViashRemoveFlags "$1")")
+            shift 1
+            ;;
+        ---docker_image_id)
+            VIASH_MODE='docker_image_id'
+            shift 1
+            ;;
+        ---debug)
+            VIASH_MODE='debug'
+            shift 1
+            ;;
+        ---cpus)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---cpus. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---cpus=*)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus=*\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        ---memory)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---memory. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---memory=*)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory=*\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        *)  # positional arg or unknown option
+            # since the positional args will be eval'd, can we always quote, instead of using ViashQuote
+            VIASH_POSITIONAL_ARGS="$VIASH_POSITIONAL_ARGS '$1'"
+            [[ $1 == -* ]] && ViashWarning $1 looks like a parameter but is not a defined parameter and will instead be treated as a positional argument. Use "--help" to get more information on the parameters.
+            shift # past argument
+            ;;
+    esac
+done
+
+# parse positional parameters
+eval set -- $VIASH_POSITIONAL_ARGS
+
+
+if   [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  VIASH_ENGINE_TYPE='native'
+elif   [ "$VIASH_ENGINE_ID" == "docker" ]  ; then
+  VIASH_ENGINE_TYPE='docker'
+else
+  ViashError "Engine '$VIASH_ENGINE_ID' is not recognized. Options are: docker, native."
+  exit 1
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # check if docker is installed properly
+  ViashDockerInstallationCheck
+
+  # determine docker image id
+  if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
+    VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/bedtools/bedtools_bamtobed:main'
+  fi
+
+  # print dockerfile
+  if [ "$VIASH_MODE" == "dockerfile" ]; then
+    ViashDockerfile "$VIASH_ENGINE_ID"
+    exit 0
+
+  elif [ "$VIASH_MODE" == "docker_image_id" ]; then
+    echo "$VIASH_DOCKER_IMAGE_ID"
+    exit 0
+  
+  # enter docker container
+  elif [[ "$VIASH_MODE" == "debug" ]]; then
+    VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} -v '$(pwd)':/pwd --workdir /pwd -t $VIASH_DOCKER_IMAGE_ID"
+    ViashNotice "+ $VIASH_CMD"
+    eval $VIASH_CMD
+    exit 
+
+  # build docker image
+  elif [ "$VIASH_MODE" == "setup" ]; then
+    ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" "$VIASH_SETUP_STRATEGY"
+    ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+    exit 0
+  fi
+
+  # check if docker image exists
+  ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" ifneedbepullelsecachedbuild
+  ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+fi
+
+# setting computational defaults
+
+# helper function for parsing memory strings
+function ViashMemoryAsBytes {
+  local memory=`echo "$1" | tr '[:upper:]' '[:lower:]' | tr -d '[:space:]'`
+  local memory_regex='^([0-9]+)([kmgtp]i?b?|b)$'
+  if [[ $memory =~ $memory_regex ]]; then
+    local number=${memory/[^0-9]*/}
+    local symbol=${memory/*[0-9]/}
+    
+    case $symbol in
+      b)      memory_b=$number ;;
+      kb|k)   memory_b=$(( $number * 1000 )) ;;
+      mb|m)   memory_b=$(( $number * 1000 * 1000 )) ;;
+      gb|g)   memory_b=$(( $number * 1000 * 1000 * 1000 )) ;;
+      tb|t)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 )) ;;
+      pb|p)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 * 1000 )) ;;
+      kib|ki)   memory_b=$(( $number * 1024 )) ;;
+      mib|mi)   memory_b=$(( $number * 1024 * 1024 )) ;;
+      gib|gi)   memory_b=$(( $number * 1024 * 1024 * 1024 )) ;;
+      tib|ti)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 )) ;;
+      pib|pi)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 * 1024 )) ;;
+    esac
+    echo "$memory_b"
+  fi
+}
+# compute memory in different units
+if [ ! -z ${VIASH_META_MEMORY+x} ]; then
+  VIASH_META_MEMORY_B=`ViashMemoryAsBytes $VIASH_META_MEMORY`
+  # do not define other variables if memory_b is an empty string
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_META_MEMORY_KB=$(( ($VIASH_META_MEMORY_B+999) / 1000 ))
+    VIASH_META_MEMORY_MB=$(( ($VIASH_META_MEMORY_KB+999) / 1000 ))
+    VIASH_META_MEMORY_GB=$(( ($VIASH_META_MEMORY_MB+999) / 1000 ))
+    VIASH_META_MEMORY_TB=$(( ($VIASH_META_MEMORY_GB+999) / 1000 ))
+    VIASH_META_MEMORY_PB=$(( ($VIASH_META_MEMORY_TB+999) / 1000 ))
+    VIASH_META_MEMORY_KIB=$(( ($VIASH_META_MEMORY_B+1023) / 1024 ))
+    VIASH_META_MEMORY_MIB=$(( ($VIASH_META_MEMORY_KIB+1023) / 1024 ))
+    VIASH_META_MEMORY_GIB=$(( ($VIASH_META_MEMORY_MIB+1023) / 1024 ))
+    VIASH_META_MEMORY_TIB=$(( ($VIASH_META_MEMORY_GIB+1023) / 1024 ))
+    VIASH_META_MEMORY_PIB=$(( ($VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  else
+    # unset memory if string is empty
+    unset $VIASH_META_MEMORY_B
+  fi
+fi
+# unset nproc if string is empty
+if [ -z "$VIASH_META_CPUS" ]; then
+  unset $VIASH_META_CPUS
+fi
+
+
+# check whether required parameters exist
+if [ -z ${VIASH_PAR_INPUT+x} ]; then
+  ViashError '--input' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_PAR_OUTPUT+x} ]; then
+  ViashError '--output' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_NAME+x} ]; then
+  ViashError 'name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then
+  ViashError 'functionality_name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_RESOURCES_DIR+x} ]; then
+  ViashError 'resources_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_EXECUTABLE+x} ]; then
+  ViashError 'executable' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_CONFIG+x} ]; then
+  ViashError 'config' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_TEMP_DIR+x} ]; then
+  ViashError 'temp_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+
+# filling in defaults
+if [ -z ${VIASH_PAR_BEDPE+x} ]; then
+  VIASH_PAR_BEDPE="false"
+fi
+if [ -z ${VIASH_PAR_MATE1+x} ]; then
+  VIASH_PAR_MATE1="false"
+fi
+if [ -z ${VIASH_PAR_BED12+x} ]; then
+  VIASH_PAR_BED12="false"
+fi
+if [ -z ${VIASH_PAR_SPLIT+x} ]; then
+  VIASH_PAR_SPLIT="false"
+fi
+if [ -z ${VIASH_PAR_SPLITD+x} ]; then
+  VIASH_PAR_SPLITD="false"
+fi
+if [ -z ${VIASH_PAR_EDIT_DISTANCE+x} ]; then
+  VIASH_PAR_EDIT_DISTANCE="false"
+fi
+if [ -z ${VIASH_PAR_CIGAR+x} ]; then
+  VIASH_PAR_CIGAR="false"
+fi
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_INPUT" ] && [ ! -e "$VIASH_PAR_INPUT" ]; then
+  ViashError "Input file '$VIASH_PAR_INPUT' does not exist."
+  exit 1
+fi
+
+# check whether parameters values are of the right type
+if [[ -n "$VIASH_PAR_BEDPE" ]]; then
+  if ! [[ "$VIASH_PAR_BEDPE" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
+    ViashError '--bedpe' has to be a boolean_true. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_MATE1" ]]; then
+  if ! [[ "$VIASH_PAR_MATE1" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
+    ViashError '--mate1' has to be a boolean_true. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_BED12" ]]; then
+  if ! [[ "$VIASH_PAR_BED12" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
+    ViashError '--bed12' has to be a boolean_true. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_SPLIT" ]]; then
+  if ! [[ "$VIASH_PAR_SPLIT" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
+    ViashError '--split' has to be a boolean_true. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_SPLITD" ]]; then
+  if ! [[ "$VIASH_PAR_SPLITD" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
+    ViashError '--splitD' has to be a boolean_true. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_EDIT_DISTANCE" ]]; then
+  if ! [[ "$VIASH_PAR_EDIT_DISTANCE" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
+    ViashError '--edit_distance' has to be a boolean_true. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_CIGAR" ]]; then
+  if ! [[ "$VIASH_PAR_CIGAR" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
+    ViashError '--cigar' has to be a boolean_true. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_CPUS" ]]; then
+  if ! [[ "$VIASH_META_CPUS" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'cpus' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_B" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_B" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_b' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+
+# create parent directories of output files, if so desired
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT")"
+fi
+
+if  [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  if [ "$VIASH_MODE" == "run" ]; then
+    VIASH_CMD="bash"
+  else
+    ViashError "Engine '$VIASH_ENGINE_ID' does not support mode '$VIASH_MODE'."
+    exit 1
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # detect volumes from file arguments
+  VIASH_CHOWN_VARS=()
+if [ ! -z "$VIASH_PAR_INPUT" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_INPUT")" )
+  VIASH_PAR_INPUT=$(ViashDockerAutodetectMount "$VIASH_PAR_INPUT")
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT")" )
+  VIASH_PAR_OUTPUT=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT" )
+fi
+if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" )
+  VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR")
+fi
+if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_EXECUTABLE")" )
+  VIASH_META_EXECUTABLE=$(ViashDockerAutodetectMount "$VIASH_META_EXECUTABLE")
+fi
+if [ ! -z "$VIASH_META_CONFIG" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_CONFIG")" )
+  VIASH_META_CONFIG=$(ViashDockerAutodetectMount "$VIASH_META_CONFIG")
+fi
+if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_TEMP_DIR")" )
+  VIASH_META_TEMP_DIR=$(ViashDockerAutodetectMount "$VIASH_META_TEMP_DIR")
+fi
+  
+  # get unique mounts
+  VIASH_UNIQUE_MOUNTS=($(for val in "${VIASH_DIRECTORY_MOUNTS[@]}"; do echo "$val"; done | sort -u))
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # change file ownership
+  function ViashPerformChown {
+    if (( ${#VIASH_CHOWN_VARS[@]} )); then
+      set +e
+      VIASH_CMD="docker run --entrypoint=bash --rm ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID -c 'chown $(id -u):$(id -g) --silent --recursive ${VIASH_CHOWN_VARS[@]}'"
+      ViashDebug "+ $VIASH_CMD"
+      eval $VIASH_CMD
+      set -e
+    fi
+  }
+  trap ViashPerformChown EXIT
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # helper function for filling in extra docker args
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--memory=${VIASH_META_MEMORY_B}")
+  fi
+  if [ ! -z "$VIASH_META_CPUS" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--cpus=${VIASH_META_CPUS}")
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID"
+fi
+
+
+# set dependency paths
+
+
+ViashDebug "Running command: $(echo $VIASH_CMD)"
+cat << VIASHEOF | eval $VIASH_CMD
+set -e
+tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-bedtools_bamtobed-XXXXXX").sh
+function clean_up {
+  rm "\$tempscript"
+}
+function interrupt {
+  echo -e "\nCTRL-C Pressed..."
+  exit 1
+}
+trap clean_up EXIT
+trap interrupt INT SIGINT
+cat > "\$tempscript" << 'VIASHMAIN'
+#!/bin/bash
+
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_INPUT+x} ]; then echo "${VIASH_PAR_INPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_input='&'#" ; else echo "# par_input="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_PAR_BEDPE+x} ]; then echo "${VIASH_PAR_BEDPE}" | sed "s#'#'\"'\"'#g;s#.*#par_bedpe='&'#" ; else echo "# par_bedpe="; fi )
+$( if [ ! -z ${VIASH_PAR_MATE1+x} ]; then echo "${VIASH_PAR_MATE1}" | sed "s#'#'\"'\"'#g;s#.*#par_mate1='&'#" ; else echo "# par_mate1="; fi )
+$( if [ ! -z ${VIASH_PAR_BED12+x} ]; then echo "${VIASH_PAR_BED12}" | sed "s#'#'\"'\"'#g;s#.*#par_bed12='&'#" ; else echo "# par_bed12="; fi )
+$( if [ ! -z ${VIASH_PAR_SPLIT+x} ]; then echo "${VIASH_PAR_SPLIT}" | sed "s#'#'\"'\"'#g;s#.*#par_split='&'#" ; else echo "# par_split="; fi )
+$( if [ ! -z ${VIASH_PAR_SPLITD+x} ]; then echo "${VIASH_PAR_SPLITD}" | sed "s#'#'\"'\"'#g;s#.*#par_splitD='&'#" ; else echo "# par_splitD="; fi )
+$( if [ ! -z ${VIASH_PAR_EDIT_DISTANCE+x} ]; then echo "${VIASH_PAR_EDIT_DISTANCE}" | sed "s#'#'\"'\"'#g;s#.*#par_edit_distance='&'#" ; else echo "# par_edit_distance="; fi )
+$( if [ ! -z ${VIASH_PAR_TAG+x} ]; then echo "${VIASH_PAR_TAG}" | sed "s#'#'\"'\"'#g;s#.*#par_tag='&'#" ; else echo "# par_tag="; fi )
+$( if [ ! -z ${VIASH_PAR_COLOR+x} ]; then echo "${VIASH_PAR_COLOR}" | sed "s#'#'\"'\"'#g;s#.*#par_color='&'#" ; else echo "# par_color="; fi )
+$( if [ ! -z ${VIASH_PAR_CIGAR+x} ]; then echo "${VIASH_PAR_CIGAR}" | sed "s#'#'\"'\"'#g;s#.*#par_cigar='&'#" ; else echo "# par_cigar="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\"'\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\"'\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+
+set -eo pipefail
+
+# Unset parameters
+unset_if_false=( 
+  par_bedpe
+  par_mate1
+  par_bed12
+  par_split
+  par_splitD
+  par_edit_distance
+  par_tag
+  par_color
+  par_cigar
+)
+
+for par in \${unset_if_false[@]}; do
+    test_val="\${!par}"
+    [[ "\$test_val" == "false" ]] && unset \$par
+done
+
+# Execute bedtools sort with the provided arguments
+bedtools bamtobed \\
+    \${par_bedpe:+-bedpe} \\
+    \${par_mate1:+-mate1} \\
+    \${par_bed12:+-bed12} \\
+    \${par_split:+-split} \\
+    \${par_splitD:+-splitD} \\
+    \${par_edit_distance:+-ed} \\
+    \${par_tag:+-tag "\$par_tag"} \\
+    \${par_cigar:+-cigar} \\
+    \${par_color:+-color "\$par_color"} \\
+    -i "\$par_input" \\
+    > "\$par_output"
+VIASHMAIN
+bash "\$tempscript" &
+wait "\$!"
+
+VIASHEOF
+
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # strip viash automount from file paths
+  
+  if [ ! -z "$VIASH_PAR_INPUT" ]; then
+    VIASH_PAR_INPUT=$(ViashDockerStripAutomount "$VIASH_PAR_INPUT")
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+    VIASH_PAR_OUTPUT=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT")
+  fi
+  if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+    VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR")
+  fi
+  if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+    VIASH_META_EXECUTABLE=$(ViashDockerStripAutomount "$VIASH_META_EXECUTABLE")
+  fi
+  if [ ! -z "$VIASH_META_CONFIG" ]; then
+    VIASH_META_CONFIG=$(ViashDockerStripAutomount "$VIASH_META_CONFIG")
+  fi
+  if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+    VIASH_META_TEMP_DIR=$(ViashDockerStripAutomount "$VIASH_META_TEMP_DIR")
+  fi
+fi
+
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -e "$VIASH_PAR_OUTPUT" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT' does not exist."
+  exit 1
+fi
+
+
+exit 0
diff --git a/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml b/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml
index 69a0daa4..0acf32cf 100644
--- a/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml
@@ -187,9 +187,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_bamtofastq"
   executable: "target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq b/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq
index 0b372aee..b8e89008 100755
--- a/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq
+++ b/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq
@@ -483,9 +483,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bamtofastq"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml b/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml
index 19e18392..c4457466 100644
--- a/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml
@@ -176,9 +176,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_bed12tobed6"
   executable: "target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6 b/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6
index 89c98e2d..3f0c611a 100755
--- a/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6
+++ b/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6
@@ -480,9 +480,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bed12tobed6"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml b/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml
index b4f824a4..6d533216 100644
--- a/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml
@@ -214,9 +214,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_bedtobam"
   executable: "target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam b/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam
index cad7c621..a2f4a727 100755
--- a/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam
+++ b/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam
@@ -496,9 +496,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bedtobam"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:22Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:10Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml b/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml
index 0fa1fd43..d841906d 100644
--- a/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml
@@ -337,9 +337,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_genomecov"
   executable: "target/executable/bedtools/bedtools_genomecov/bedtools_genomecov"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov b/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov
index 397c9a3e..79221112 100755
--- a/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov
+++ b/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov
@@ -591,9 +591,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_genomecov"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml b/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml
index 0ec92d14..8fbf68b1 100644
--- a/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml
@@ -232,9 +232,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_getfasta"
   executable: "target/executable/bedtools/bedtools_getfasta/bedtools_getfasta"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta b/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta
index ce3a254a..da484e58 100755
--- a/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta
+++ b/target/executable/bedtools/bedtools_getfasta/bedtools_getfasta
@@ -526,9 +526,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Dries Schaumont"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_getfasta"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:22Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:10Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml b/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml
index 32f4fafd..fc195ac1 100644
--- a/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_groupby/.config.vsh.yaml
@@ -273,9 +273,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_groupby"
   executable: "target/executable/bedtools/bedtools_groupby/bedtools_groupby"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_groupby/bedtools_groupby b/target/executable/bedtools/bedtools_groupby/bedtools_groupby
index dc5c2c25..1f7a0a68 100755
--- a/target/executable/bedtools/bedtools_groupby/bedtools_groupby
+++ b/target/executable/bedtools/bedtools_groupby/bedtools_groupby
@@ -552,9 +552,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_groupby"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml b/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml
index 3ed95f00..df9afc62 100644
--- a/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_intersect/.config.vsh.yaml
@@ -410,9 +410,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_intersect"
   executable: "target/executable/bedtools/bedtools_intersect/bedtools_intersect"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_intersect/bedtools_intersect b/target/executable/bedtools/bedtools_intersect/bedtools_intersect
index 22cd99db..c399dec1 100755
--- a/target/executable/bedtools/bedtools_intersect/bedtools_intersect
+++ b/target/executable/bedtools/bedtools_intersect/bedtools_intersect
@@ -633,9 +633,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_intersect"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:19Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_links/.config.vsh.yaml b/target/executable/bedtools/bedtools_links/.config.vsh.yaml
index 29640690..9b28fd8a 100644
--- a/target/executable/bedtools/bedtools_links/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_links/.config.vsh.yaml
@@ -210,9 +210,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_links"
   executable: "target/executable/bedtools/bedtools_links/bedtools_links"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_links/bedtools_links b/target/executable/bedtools/bedtools_links/bedtools_links
index 0b7c6cfb..cb3cc188 100755
--- a/target/executable/bedtools/bedtools_links/bedtools_links
+++ b/target/executable/bedtools/bedtools_links/bedtools_links
@@ -500,9 +500,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_links"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_merge/.config.vsh.yaml b/target/executable/bedtools/bedtools_merge/.config.vsh.yaml
index 3e9d409c..fc36f972 100644
--- a/target/executable/bedtools/bedtools_merge/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_merge/.config.vsh.yaml
@@ -279,9 +279,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_merge"
   executable: "target/executable/bedtools/bedtools_merge/bedtools_merge"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_merge/bedtools_merge b/target/executable/bedtools/bedtools_merge/bedtools_merge
index 5a66fd02..069f45df 100755
--- a/target/executable/bedtools/bedtools_merge/bedtools_merge
+++ b/target/executable/bedtools/bedtools_merge/bedtools_merge
@@ -558,9 +558,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_merge"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/bedtools/bedtools_sort/.config.vsh.yaml b/target/executable/bedtools/bedtools_sort/.config.vsh.yaml
index 18e53863..dc23e354 100644
--- a/target/executable/bedtools/bedtools_sort/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_sort/.config.vsh.yaml
@@ -222,9 +222,9 @@ build_info:
   output: "target/executable/bedtools/bedtools_sort"
   executable: "target/executable/bedtools/bedtools_sort/bedtools_sort"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/bedtools/bedtools_sort/bedtools_sort b/target/executable/bedtools/bedtools_sort/bedtools_sort
index 12bcfbee..6f25ffc7 100755
--- a/target/executable/bedtools/bedtools_sort/bedtools_sort
+++ b/target/executable/bedtools/bedtools_sort/bedtools_sort
@@ -509,9 +509,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_sort"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:19Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/busco/busco_download_datasets/.config.vsh.yaml b/target/executable/busco/busco_download_datasets/.config.vsh.yaml
index 51570e50..bc7976b2 100644
--- a/target/executable/busco/busco_download_datasets/.config.vsh.yaml
+++ b/target/executable/busco/busco_download_datasets/.config.vsh.yaml
@@ -158,9 +158,9 @@ build_info:
   output: "target/executable/busco/busco_download_datasets"
   executable: "target/executable/busco/busco_download_datasets/busco_download_datasets"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/busco/busco_download_datasets/busco_download_datasets b/target/executable/busco/busco_download_datasets/busco_download_datasets
index 5a6c03a2..a33a4232 100755
--- a/target/executable/busco/busco_download_datasets/busco_download_datasets
+++ b/target/executable/busco/busco_download_datasets/busco_download_datasets
@@ -475,9 +475,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component busco busco_download_datasets"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:18Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:06Z"
 LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/busco/busco_list_datasets/.config.vsh.yaml b/target/executable/busco/busco_list_datasets/.config.vsh.yaml
index 67ad64c8..efa8a7e9 100644
--- a/target/executable/busco/busco_list_datasets/.config.vsh.yaml
+++ b/target/executable/busco/busco_list_datasets/.config.vsh.yaml
@@ -145,9 +145,9 @@ build_info:
   output: "target/executable/busco/busco_list_datasets"
   executable: "target/executable/busco/busco_list_datasets/busco_list_datasets"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/busco/busco_list_datasets/busco_list_datasets b/target/executable/busco/busco_list_datasets/busco_list_datasets
index a0e95e17..5f7fe70d 100755
--- a/target/executable/busco/busco_list_datasets/busco_list_datasets
+++ b/target/executable/busco/busco_list_datasets/busco_list_datasets
@@ -465,9 +465,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component busco busco_list_datasets"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:18Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:06Z"
 LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/busco/busco_run/.config.vsh.yaml b/target/executable/busco/busco_run/.config.vsh.yaml
index 6dc36832..241e6c2b 100644
--- a/target/executable/busco/busco_run/.config.vsh.yaml
+++ b/target/executable/busco/busco_run/.config.vsh.yaml
@@ -423,9 +423,9 @@ build_info:
   output: "target/executable/busco/busco_run"
   executable: "target/executable/busco/busco_run/busco_run"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/busco/busco_run/busco_run b/target/executable/busco/busco_run/busco_run
index bd0d4082..33a95e82 100755
--- a/target/executable/busco/busco_run/busco_run
+++ b/target/executable/busco/busco_run/busco_run
@@ -632,9 +632,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component busco busco_run"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:18Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:06Z"
 LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/cutadapt/.config.vsh.yaml b/target/executable/cutadapt/.config.vsh.yaml
index 38ebf207..ffb10c02 100644
--- a/target/executable/cutadapt/.config.vsh.yaml
+++ b/target/executable/cutadapt/.config.vsh.yaml
@@ -740,9 +740,9 @@ build_info:
   output: "target/executable/cutadapt"
   executable: "target/executable/cutadapt/cutadapt"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/cutadapt/cutadapt b/target/executable/cutadapt/cutadapt
index 835cd6c4..d9462971 100755
--- a/target/executable/cutadapt/cutadapt
+++ b/target/executable/cutadapt/cutadapt
@@ -831,9 +831,9 @@ RUN cutadapt --version | sed 's/\(.*\)/cutadapt: "\1"/' > /var/software_versions
 
 LABEL org.opencontainers.image.authors="Toni Verbeiren"
 LABEL org.opencontainers.image.description="Companion container for running component cutadapt"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:09Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:43:58Z"
 LABEL org.opencontainers.image.source="https://github.com/marcelm/cutadapt"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/falco/.config.vsh.yaml b/target/executable/falco/.config.vsh.yaml
index 494b0e4c..2cd5897c 100644
--- a/target/executable/falco/.config.vsh.yaml
+++ b/target/executable/falco/.config.vsh.yaml
@@ -317,9 +317,9 @@ build_info:
   output: "target/executable/falco"
   executable: "target/executable/falco/falco"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/falco/falco b/target/executable/falco/falco
index 7d377050..c12bd439 100755
--- a/target/executable/falco/falco
+++ b/target/executable/falco/falco
@@ -589,9 +589,9 @@ RUN echo "falco: \"$(falco -v | sed -n 's/^falco //p')\"" > /var/software_versio
 
 LABEL org.opencontainers.image.authors="Toni Verbeiren"
 LABEL org.opencontainers.image.description="Companion container for running component falco"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:11Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:00Z"
 LABEL org.opencontainers.image.source="https://github.com/smithlabcode/falco"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/fastp/.config.vsh.yaml b/target/executable/fastp/.config.vsh.yaml
index dfb037a6..67a2ddfc 100644
--- a/target/executable/fastp/.config.vsh.yaml
+++ b/target/executable/fastp/.config.vsh.yaml
@@ -1083,9 +1083,9 @@ build_info:
   output: "target/executable/fastp"
   executable: "target/executable/fastp/fastp"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/fastp/fastp b/target/executable/fastp/fastp
index 28df9eca..08fc63a3 100755
--- a/target/executable/fastp/fastp
+++ b/target/executable/fastp/fastp
@@ -1028,9 +1028,9 @@ RUN fastp --version 2>&1 | sed 's# #: "#;s#$#"#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Robrecht Cannoodt"
 LABEL org.opencontainers.image.description="Companion container for running component fastp"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:15Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:03Z"
 LABEL org.opencontainers.image.source="https://github.com/OpenGene/fastp"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/fastqc/.config.vsh.yaml b/target/executable/fastqc/.config.vsh.yaml
index 6cc331bd..76a69d20 100644
--- a/target/executable/fastqc/.config.vsh.yaml
+++ b/target/executable/fastqc/.config.vsh.yaml
@@ -340,9 +340,9 @@ build_info:
   output: "target/executable/fastqc"
   executable: "target/executable/fastqc/fastqc"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/fastqc/fastqc b/target/executable/fastqc/fastqc
index f647813a..6922494f 100755
--- a/target/executable/fastqc/fastqc
+++ b/target/executable/fastqc/fastqc
@@ -601,9 +601,9 @@ RUN echo "fastqc: $(fastqc --version | sed -n 's/^FastQC //p')" > /var/software_
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component fastqc"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:16Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:04Z"
 LABEL org.opencontainers.image.source="https://github.com/s-andrews/FastQC"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/featurecounts/.config.vsh.yaml b/target/executable/featurecounts/.config.vsh.yaml
index 6b60deb6..59e70f22 100644
--- a/target/executable/featurecounts/.config.vsh.yaml
+++ b/target/executable/featurecounts/.config.vsh.yaml
@@ -645,9 +645,9 @@ build_info:
   output: "target/executable/featurecounts"
   executable: "target/executable/featurecounts/featurecounts"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/featurecounts/featurecounts b/target/executable/featurecounts/featurecounts
index 2fcdf889..952763b5 100755
--- a/target/executable/featurecounts/featurecounts
+++ b/target/executable/featurecounts/featurecounts
@@ -754,9 +754,9 @@ RUN featureCounts -v 2>&1 | sed 's/featureCounts v\([0-9.]*\)/featureCounts: \1/
 
 LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
 LABEL org.opencontainers.image.description="Companion container for running component featurecounts"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:12Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:00Z"
 LABEL org.opencontainers.image.source="https://github.com/ShiLab-Bioinformatics/subread"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/fq_subsample/.config.vsh.yaml b/target/executable/fq_subsample/.config.vsh.yaml
index 8ee93f02..d4eb2bfe 100644
--- a/target/executable/fq_subsample/.config.vsh.yaml
+++ b/target/executable/fq_subsample/.config.vsh.yaml
@@ -190,9 +190,9 @@ build_info:
   output: "target/executable/fq_subsample"
   executable: "target/executable/fq_subsample/fq_subsample"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/fq_subsample/fq_subsample b/target/executable/fq_subsample/fq_subsample
index 5123ea27..e88955eb 100755
--- a/target/executable/fq_subsample/fq_subsample
+++ b/target/executable/fq_subsample/fq_subsample
@@ -493,9 +493,9 @@ mv target/release/fq /usr/local/bin/ && \
 cd / && rm -rf /fq
 
 LABEL org.opencontainers.image.description="Companion container for running component fq_subsample"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:12Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:00Z"
 LABEL org.opencontainers.image.source="https://github.com/stjude-rust-labs/fq"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/gffread/.config.vsh.yaml b/target/executable/gffread/.config.vsh.yaml
index ef6a6b98..95b23697 100644
--- a/target/executable/gffread/.config.vsh.yaml
+++ b/target/executable/gffread/.config.vsh.yaml
@@ -685,9 +685,9 @@ build_info:
   output: "target/executable/gffread"
   executable: "target/executable/gffread/gffread"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/gffread/gffread b/target/executable/gffread/gffread
index 305d5ea4..d6ebb00d 100755
--- a/target/executable/gffread/gffread
+++ b/target/executable/gffread/gffread
@@ -807,9 +807,9 @@ RUN echo "gffread: \"$(gffread --version 2>&1)\"" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component gffread"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:16Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:04Z"
 LABEL org.opencontainers.image.source="https://github.com/gpertea/gffread"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/kallisto/kallisto_index/.config.vsh.yaml b/target/executable/kallisto/kallisto_index/.config.vsh.yaml
index 70155d2b..60157212 100644
--- a/target/executable/kallisto/kallisto_index/.config.vsh.yaml
+++ b/target/executable/kallisto/kallisto_index/.config.vsh.yaml
@@ -218,9 +218,9 @@ build_info:
   output: "target/executable/kallisto/kallisto_index"
   executable: "target/executable/kallisto/kallisto_index/kallisto_index"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/kallisto/kallisto_index/kallisto_index b/target/executable/kallisto/kallisto_index/kallisto_index
index 92586614..b01f9560 100755
--- a/target/executable/kallisto/kallisto_index/kallisto_index
+++ b/target/executable/kallisto/kallisto_index/kallisto_index
@@ -506,9 +506,9 @@ tar -xzf kallisto_linux-v0.50.1.tar.gz && \
 mv kallisto/kallisto /usr/local/bin/
 
 LABEL org.opencontainers.image.description="Companion container for running component kallisto kallisto_index"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:22Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:10Z"
 LABEL org.opencontainers.image.source="https://github.com/pachterlab/kallisto"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/kallisto/kallisto_quant/.config.vsh.yaml b/target/executable/kallisto/kallisto_quant/.config.vsh.yaml
index 51855177..73593726 100644
--- a/target/executable/kallisto/kallisto_quant/.config.vsh.yaml
+++ b/target/executable/kallisto/kallisto_quant/.config.vsh.yaml
@@ -234,9 +234,9 @@ build_info:
   output: "target/executable/kallisto/kallisto_quant"
   executable: "target/executable/kallisto/kallisto_quant/kallisto_quant"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/kallisto/kallisto_quant/kallisto_quant b/target/executable/kallisto/kallisto_quant/kallisto_quant
index 5112ec5e..f0f06367 100755
--- a/target/executable/kallisto/kallisto_quant/kallisto_quant
+++ b/target/executable/kallisto/kallisto_quant/kallisto_quant
@@ -518,9 +518,9 @@ mv kallisto/kallisto /usr/local/bin/
 RUN echo "kallisto: $(kallisto version | sed 's/kallisto, version //')" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.description="Companion container for running component kallisto kallisto_quant"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:22Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:11Z"
 LABEL org.opencontainers.image.source="https://github.com/pachterlab/kallisto"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/lofreq/lofreq_call/.config.vsh.yaml b/target/executable/lofreq/lofreq_call/.config.vsh.yaml
index 9bb79963..42f277fa 100644
--- a/target/executable/lofreq/lofreq_call/.config.vsh.yaml
+++ b/target/executable/lofreq/lofreq_call/.config.vsh.yaml
@@ -507,9 +507,9 @@ build_info:
   output: "target/executable/lofreq/lofreq_call"
   executable: "target/executable/lofreq/lofreq_call/lofreq_call"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/lofreq/lofreq_call/lofreq_call b/target/executable/lofreq/lofreq_call/lofreq_call
index 5a411a76..9f97fbab 100755
--- a/target/executable/lofreq/lofreq_call/lofreq_call
+++ b/target/executable/lofreq/lofreq_call/lofreq_call
@@ -656,9 +656,9 @@ echo "lofreq: $version" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Kai Waldrant"
 LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_call"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:23Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:11Z"
 LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml b/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml
index efef3cd7..f7a06d09 100644
--- a/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml
+++ b/target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml
@@ -215,9 +215,9 @@ build_info:
   output: "target/executable/lofreq/lofreq_indelqual"
   executable: "target/executable/lofreq/lofreq_indelqual/lofreq_indelqual"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual b/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual
index ed1d85e5..990b7153 100755
--- a/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual
+++ b/target/executable/lofreq/lofreq_indelqual/lofreq_indelqual
@@ -501,9 +501,9 @@ echo "lofreq: $version" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Kai Waldrant"
 LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_indelqual"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:23Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:12Z"
 LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/multiqc/.config.vsh.yaml b/target/executable/multiqc/.config.vsh.yaml
index 5bb5de07..42ddb186 100644
--- a/target/executable/multiqc/.config.vsh.yaml
+++ b/target/executable/multiqc/.config.vsh.yaml
@@ -456,9 +456,9 @@ build_info:
   output: "target/executable/multiqc"
   executable: "target/executable/multiqc/multiqc"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/multiqc/multiqc b/target/executable/multiqc/multiqc
index 168effb8..55deff3b 100755
--- a/target/executable/multiqc/multiqc
+++ b/target/executable/multiqc/multiqc
@@ -637,9 +637,9 @@ RUN multiqc --version | sed 's/multiqc, version\s\(.*\)/multiqc: "\1"/' > /var/s
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component multiqc"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:18Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:05Z"
 LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/nanoplot/.config.vsh.yaml b/target/executable/nanoplot/.config.vsh.yaml
index 155935e4..99130c27 100644
--- a/target/executable/nanoplot/.config.vsh.yaml
+++ b/target/executable/nanoplot/.config.vsh.yaml
@@ -492,9 +492,9 @@ build_info:
   output: "target/executable/nanoplot"
   executable: "target/executable/nanoplot/nanoplot"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/nanoplot/nanoplot b/target/executable/nanoplot/nanoplot
index ed0f4c3e..3477c545 100755
--- a/target/executable/nanoplot/nanoplot
+++ b/target/executable/nanoplot/nanoplot
@@ -661,9 +661,9 @@ RUN version=$(NanoPlot --version) && \
 echo "$version" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.description="Companion container for running component nanoplot"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:18Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:05Z"
 LABEL org.opencontainers.image.source="https://github.com/wdecoster/NanoPlot"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/pear/.config.vsh.yaml b/target/executable/pear/.config.vsh.yaml
index cf0008d5..82e6e3e3 100644
--- a/target/executable/pear/.config.vsh.yaml
+++ b/target/executable/pear/.config.vsh.yaml
@@ -398,9 +398,9 @@ build_info:
   output: "target/executable/pear"
   executable: "target/executable/pear/pear"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/pear/pear b/target/executable/pear/pear
index b0728d72..c2891765 100755
--- a/target/executable/pear/pear
+++ b/target/executable/pear/pear
@@ -597,9 +597,9 @@ echo "pear: $version" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Kai Waldrant"
 LABEL org.opencontainers.image.description="Companion container for running component pear"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:08Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:43:57Z"
 LABEL org.opencontainers.image.source="https://github.com/tseemann/PEAR"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml b/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml
index 6fde6c8a..dfafc8c2 100644
--- a/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml
+++ b/target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml
@@ -264,9 +264,9 @@ build_info:
   output: "target/executable/qualimap/qualimap_rnaseq"
   executable: "target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq b/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq
index a6dba41b..e276cdf7 100755
--- a/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq
+++ b/target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq
@@ -527,9 +527,9 @@ RUN echo QualiMap: $(qualimap 2>&1 | grep QualiMap | sed 's/^.*QualiMap//') > /v
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component qualimap qualimap_rnaseq"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:13Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:00Z"
 LABEL org.opencontainers.image.source="https://bitbucket.org/kokonech/qualimap/commits/branch/master"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml b/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml
index c733c026..e8b5f602 100644
--- a/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml
+++ b/target/executable/rsem/rsem_calculate_expression/.config.vsh.yaml
@@ -852,9 +852,9 @@ build_info:
   output: "target/executable/rsem/rsem_calculate_expression"
   executable: "target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression b/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression
index 8134770e..84ca3bfd 100755
--- a/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression
+++ b/target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression
@@ -991,9 +991,9 @@ echo "bowtie: `bowtie --version | grep -oP 'bowtie-align-s version \K\d+\.\d+\.\
 echo "HISAT2: `hisat2 --version | grep -oP 'hisat2-align-s version \K\d+\.\d+\.\d+'`" >> /var/software_versions.txt
 
 LABEL org.opencontainers.image.description="Companion container for running component rsem rsem_calculate_expression"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:11Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:43:59Z"
 LABEL org.opencontainers.image.source="https://github.com/deweylab/RSEM"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml b/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml
index 55c195e0..fb530b60 100644
--- a/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml
+++ b/target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml
@@ -416,9 +416,9 @@ build_info:
   output: "target/executable/rsem/rsem_prepare_reference"
   executable: "target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference b/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference
index 1b3b4987..672a7028 100755
--- a/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference
+++ b/target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference
@@ -656,9 +656,9 @@ echo "HISAT2: `hisat2 --version | grep -oP 'hisat2-align-s version \K\d+\.\d+\.\
 
 LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
 LABEL org.opencontainers.image.description="Companion container for running component rsem rsem_prepare_reference"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:10Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:43:59Z"
 LABEL org.opencontainers.image.source="https://github.com/deweylab/RSEM"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/rseqc/rseqc_bamstat/.config.vsh.yaml b/target/executable/rseqc/rseqc_bamstat/.config.vsh.yaml
new file mode 100644
index 00000000..850fe78d
--- /dev/null
+++ b/target/executable/rseqc/rseqc_bamstat/.config.vsh.yaml
@@ -0,0 +1,202 @@
+name: "rseqc_bamstat"
+namespace: "rseqc"
+version: "main"
+authors:
+- name: "Emma Rousseau"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "emma@data-intuitive.com"
+      github: "emmarousseau"
+      linkedin: "emmarousseau1"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Input"
+  arguments:
+  - type: "file"
+    name: "--input_file"
+    alternatives:
+    - "-i"
+    description: "Input alignment file in BAM or SAM format."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--mapq"
+    alternatives:
+    - "-q"
+    description: "Minimum mapping quality (phred scaled) to determine uniquely mapped\
+      \ reads. Default: '30'.\n"
+    info: null
+    example:
+    - 30
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Output"
+  arguments:
+  - type: "file"
+    name: "--output"
+    description: "Output file (txt) with mapping quality statistics."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Generate statistics from a bam file."
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "rnaseq"
+- "genomics"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.1093/bioinformatics/bts356"
+links:
+  repository: "https://github.com/MonashBioinformaticsPlatform/RSeQC"
+  homepage: "https://rseqc.sourceforge.net/"
+  documentation: "https://rseqc.sourceforge.net/#bam-stat-py"
+  issue_tracker: "https://github.com/MonashBioinformaticsPlatform/RSeQC/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "python:3.10"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "python"
+    user: false
+    packages:
+    - "RSeQC"
+    upgrade: true
+  - type: "docker"
+    run:
+    - "echo \"RSeQC bam_stat.py: $(bam_stat.py --version | cut -d' ' -f2-)\" > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/rseqc/rseqc_bamstat/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/rseqc/rseqc_bamstat"
+  executable: "target/executable/rseqc/rseqc_bamstat/rseqc_bamstat"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/executable/rseqc/rseqc_bamstat/rseqc_bamstat b/target/executable/rseqc/rseqc_bamstat/rseqc_bamstat
new file mode 100755
index 00000000..c2fb8028
--- /dev/null
+++ b/target/executable/rseqc/rseqc_bamstat/rseqc_bamstat
@@ -0,0 +1,1119 @@
+#!/usr/bin/env bash
+
+# rseqc_bamstat main
+# 
+# This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+# work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+# Intuitive.
+# 
+# The component may contain files which fall under a different license. The
+# authors of this component should specify the license in the header of such
+# files, or include a separate license file detailing the licenses of all included
+# files.
+# 
+# Component authors:
+#  * Emma Rousseau (author, maintainer)
+
+set -e
+
+if [ -z "$VIASH_TEMP" ]; then
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMP}
+  VIASH_TEMP=${VIASH_TEMP:-/tmp}
+fi
+
+# define helper functions
+# ViashQuote: put quotes around non flag values
+# $1     : unquoted string
+# return : possibly quoted string
+# examples:
+#   ViashQuote --foo      # returns --foo
+#   ViashQuote bar        # returns 'bar'
+#   Viashquote --foo=bar  # returns --foo='bar'
+function ViashQuote {
+  if [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+=.+$ ]]; then
+    echo "$1" | sed "s#=\(.*\)#='\1'#"
+  elif [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+$ ]]; then
+    echo "$1"
+  else
+    echo "'$1'"
+  fi
+}
+# ViashRemoveFlags: Remove leading flag
+# $1     : string with a possible leading flag
+# return : string without possible leading flag
+# examples:
+#   ViashRemoveFlags --foo=bar  # returns bar
+function ViashRemoveFlags {
+  echo "$1" | sed 's/^--*[a-zA-Z0-9_\-]*=//'
+}
+# ViashSourceDir: return the path of a bash file, following symlinks
+# usage   : ViashSourceDir ${BASH_SOURCE[0]}
+# $1      : Should always be set to ${BASH_SOURCE[0]}
+# returns : The absolute path of the bash file
+function ViashSourceDir {
+  local source="$1"
+  while [ -h "$source" ]; do
+    local dir="$( cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd )"
+    source="$(readlink "$source")"
+    [[ $source != /* ]] && source="$dir/$source"
+  done
+  cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd
+}
+# ViashFindTargetDir: return the path of the '.build.yaml' file, following symlinks
+# usage   : ViashFindTargetDir 'ScriptPath'
+# $1      : The location from where to start the upward search
+# returns : The absolute path of the '.build.yaml' file
+function ViashFindTargetDir {
+  local source="$1"
+  while [[ "$source" != "" && ! -e "$source/.build.yaml" ]]; do
+    source=${source%/*}
+  done
+  echo $source
+}
+# see https://en.wikipedia.org/wiki/Syslog#Severity_level
+VIASH_LOGCODE_EMERGENCY=0
+VIASH_LOGCODE_ALERT=1
+VIASH_LOGCODE_CRITICAL=2
+VIASH_LOGCODE_ERROR=3
+VIASH_LOGCODE_WARNING=4
+VIASH_LOGCODE_NOTICE=5
+VIASH_LOGCODE_INFO=6
+VIASH_LOGCODE_DEBUG=7
+VIASH_VERBOSITY=$VIASH_LOGCODE_NOTICE
+
+# ViashLog: Log events depending on the verbosity level
+# usage: ViashLog 1 alert Oh no something went wrong!
+# $1: required verbosity level
+# $2: display tag
+# $3+: messages to display
+# stdout: Your input, prepended by '[$2] '.
+function ViashLog {
+  local required_level="$1"
+  local display_tag="$2"
+  shift 2
+  if [ $VIASH_VERBOSITY -ge $required_level ]; then
+    >&2 echo "[$display_tag]" "$@"
+  fi
+}
+
+# ViashEmergency: log events when the system is unstable
+# usage: ViashEmergency Oh no something went wrong.
+# stdout: Your input, prepended by '[emergency] '.
+function ViashEmergency {
+  ViashLog $VIASH_LOGCODE_EMERGENCY emergency "$@"
+}
+
+# ViashAlert: log events when actions must be taken immediately (e.g. corrupted system database)
+# usage: ViashAlert Oh no something went wrong.
+# stdout: Your input, prepended by '[alert] '.
+function ViashAlert {
+  ViashLog $VIASH_LOGCODE_ALERT alert "$@"
+}
+
+# ViashCritical: log events when a critical condition occurs
+# usage: ViashCritical Oh no something went wrong.
+# stdout: Your input, prepended by '[critical] '.
+function ViashCritical {
+  ViashLog $VIASH_LOGCODE_CRITICAL critical "$@"
+}
+
+# ViashError: log events when an error condition occurs
+# usage: ViashError Oh no something went wrong.
+# stdout: Your input, prepended by '[error] '.
+function ViashError {
+  ViashLog $VIASH_LOGCODE_ERROR error "$@"
+}
+
+# ViashWarning: log potentially abnormal events
+# usage: ViashWarning Something may have gone wrong.
+# stdout: Your input, prepended by '[warning] '.
+function ViashWarning {
+  ViashLog $VIASH_LOGCODE_WARNING warning "$@"
+}
+
+# ViashNotice: log significant but normal events
+# usage: ViashNotice This just happened.
+# stdout: Your input, prepended by '[notice] '.
+function ViashNotice {
+  ViashLog $VIASH_LOGCODE_NOTICE notice "$@"
+}
+
+# ViashInfo: log normal events
+# usage: ViashInfo This just happened.
+# stdout: Your input, prepended by '[info] '.
+function ViashInfo {
+  ViashLog $VIASH_LOGCODE_INFO info "$@"
+}
+
+# ViashDebug: log all events, for debugging purposes
+# usage: ViashDebug This just happened.
+# stdout: Your input, prepended by '[debug] '.
+function ViashDebug {
+  ViashLog $VIASH_LOGCODE_DEBUG debug "$@"
+}
+
+# find source folder of this component
+VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}`
+
+# find the root of the built components & dependencies
+VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR`
+
+# define meta fields
+VIASH_META_NAME="rseqc_bamstat"
+VIASH_META_FUNCTIONALITY_NAME="rseqc_bamstat"
+VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME"
+VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+VIASH_META_TEMP_DIR="$VIASH_TEMP"
+
+
+# ViashHelp: Display helpful explanation about this executable
+function ViashHelp {
+  echo "rseqc_bamstat main"
+  echo ""
+  echo "Generate statistics from a bam file."
+  echo ""
+  echo "Input:"
+  echo "    -i, --input_file"
+  echo "        type: file, required parameter, file must exist"
+  echo "        Input alignment file in BAM or SAM format."
+  echo ""
+  echo "    -q, --mapq"
+  echo "        type: integer"
+  echo "        example: 30"
+  echo "        Minimum mapping quality (phred scaled) to determine uniquely mapped"
+  echo "        reads. Default: '30'."
+  echo ""
+  echo "Output:"
+  echo "    --output"
+  echo "        type: file, output, file must exist"
+  echo "        Output file (txt) with mapping quality statistics."
+}
+
+# initialise variables
+VIASH_MODE='run'
+VIASH_ENGINE_ID='docker'
+
+######## Helper functions for setting up Docker images for viash ########
+# expects: ViashDockerBuild
+
+# ViashDockerInstallationCheck: check whether Docker is installed correctly
+#
+# examples:
+#   ViashDockerInstallationCheck
+function ViashDockerInstallationCheck {
+  ViashDebug "Checking whether Docker is installed"
+  if [ ! command -v docker &> /dev/null ]; then
+    ViashCritical "Docker doesn't seem to be installed. See 'https://docs.docker.com/get-docker/' for instructions."
+    exit 1
+  fi
+
+  ViashDebug "Checking whether the Docker daemon is running"
+  local save=$-; set +e
+  local docker_version=$(docker version --format '{{.Client.APIVersion}}' 2> /dev/null)
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashCritical "Docker daemon does not seem to be running. Try one of the following:"
+    ViashCritical "- Try running 'dockerd' in the command line"
+    ViashCritical "- See https://docs.docker.com/config/daemon/"
+    exit 1
+  fi
+}
+
+# ViashDockerRemoteTagCheck: check whether a Docker image is available 
+# on a remote. Assumes `docker login` has been performed, if relevant.
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerRemoteTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerRemoteTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerRemoteTagCheck {
+  docker manifest inspect $1 > /dev/null 2> /dev/null
+}
+
+# ViashDockerLocalTagCheck: check whether a Docker image is available locally
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   docker pull python:latest
+#   ViashDockerLocalTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerLocalTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerLocalTagCheck {
+  [ -n "$(docker images -q $1)" ]
+}
+
+# ViashDockerPull: pull a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPull python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPull sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPull {
+  ViashNotice "Checking if Docker image is available at '$1'"
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker pull $1 && return 0 || return 1
+  else
+    local save=$-; set +e
+    docker pull $1 2> /dev/null > /dev/null
+    local out=$?
+    [[ $save =~ e ]] && set -e
+    if [ $out -ne 0 ]; then
+      ViashWarning "Could not pull from '$1'. Docker image doesn't exist or is not accessible."
+    fi
+    return $out
+  fi
+}
+
+# ViashDockerPush: push a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPush python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPush sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPush {
+  ViashNotice "Pushing image to '$1'"
+  local save=$-; set +e
+  local out
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker push $1
+    out=$?
+  else
+    docker push $1 2> /dev/null > /dev/null
+    out=$?
+  fi
+  [[ $save =~ e ]] && set -e
+  if [ $out -eq 0 ]; then
+    ViashNotice "Container '$1' push succeeded."
+  else
+    ViashError "Container '$1' push errored. You might not be logged in or have the necessary permissions."
+  fi
+  return $out
+}
+
+# ViashDockerPullElseBuild: pull a Docker image, else build it
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# ViashDockerBuild    : a Bash function which builds a docker image, takes image identifier as argument.
+# examples:
+#   ViashDockerPullElseBuild mynewcomponent
+function ViashDockerPullElseBuild {
+  local save=$-; set +e
+  ViashDockerPull $1
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashDockerBuild $@
+  fi
+}
+
+# ViashDockerSetup: create a Docker image, according to specified docker setup strategy
+#
+# $1          : image identifier with format `[registry/]image[:tag]`
+# $2          : docker setup strategy, see DockerSetupStrategy.scala
+# examples:
+#   ViashDockerSetup mynewcomponent alwaysbuild
+function ViashDockerSetup {
+  local image_id="$1"
+  local setup_strategy="$2"
+  if [ "$setup_strategy" == "alwaysbuild" -o "$setup_strategy" == "build" -o "$setup_strategy" == "b" ]; then
+    ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspull" -o "$setup_strategy" == "pull" -o "$setup_strategy" == "p" ]; then
+    ViashDockerPull $image_id
+  elif [ "$setup_strategy" == "alwayspullelsebuild" -o "$setup_strategy" == "pullelsebuild" ]; then
+    ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspullelsecachedbuild" -o "$setup_strategy" == "pullelsecachedbuild" ]; then
+    ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayscachedbuild" -o "$setup_strategy" == "cachedbuild" -o "$setup_strategy" == "cb" ]; then
+    ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [[ "$setup_strategy" =~ ^ifneedbe ]]; then
+    local save=$-; set +e
+    ViashDockerLocalTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashInfo "Image $image_id already exists"
+    elif [ "$setup_strategy" == "ifneedbebuild" ]; then
+      ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbecachedbuild" ]; then
+      ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepull" ]; then
+      ViashDockerPull $image_id
+    elif [ "$setup_strategy" == "ifneedbepullelsebuild" ]; then
+      ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepullelsecachedbuild" ]; then
+      ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    else
+      ViashError "Unrecognised Docker strategy: $setup_strategy"
+      exit 1
+    fi
+  elif [ "$setup_strategy" == "push" -o "$setup_strategy" == "forcepush" -o "$setup_strategy" == "alwayspush" ]; then
+    ViashDockerPush "$image_id"
+  elif [ "$setup_strategy" == "pushifnotpresent" -o "$setup_strategy" == "gentlepush" -o "$setup_strategy" == "maybepush" ]; then
+    local save=$-; set +e
+    ViashDockerRemoteTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashNotice "Container '$image_id' exists, doing nothing."
+    else
+      ViashNotice "Container '$image_id' does not yet exist."
+      ViashDockerPush "$image_id"
+    fi
+  elif [ "$setup_strategy" == "donothing" -o "$setup_strategy" == "meh" ]; then
+    ViashNotice "Skipping setup."
+  else
+    ViashError "Unrecognised Docker strategy: $setup_strategy"
+    exit 1
+  fi
+}
+
+# ViashDockerCheckCommands: Check whether a docker container has the required commands
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# $@                  : commands to verify being present
+# examples:
+#   ViashDockerCheckCommands bash:4.0 bash ps foo
+function ViashDockerCheckCommands {
+  local image_id="$1"
+  shift 1
+  local commands="$@"
+  local save=$-; set +e
+  local missing # mark 'missing' as local in advance, otherwise the exit code of the command will be missing and always be '0'
+  missing=$(docker run --rm --entrypoint=sh "$image_id" -c "for command in $commands; do command -v \$command >/dev/null 2>&1; if [ \$? -ne 0 ]; then echo \$command; exit 1; fi; done")
+  local outCheck=$?
+  [[ $save =~ e ]] && set -e
+  if [ $outCheck -ne 0 ]; then
+  	ViashError "Docker container '$image_id' does not contain command '$missing'."
+  	exit 1
+  fi
+}
+
+# ViashDockerBuild: build a docker image
+# $1                               : image identifier with format `[registry/]image[:tag]`
+# $...                             : additional arguments to pass to docker build
+# $VIASH_META_TEMP_DIR             : temporary directory to store dockerfile & optional resources in
+# $VIASH_META_NAME                 : name of the component
+# $VIASH_META_RESOURCES_DIR        : directory containing the resources
+# $VIASH_VERBOSITY                 : verbosity level
+# exit code $?                     : whether or not the image was built successfully
+function ViashDockerBuild {
+  local image_id="$1"
+  shift 1
+
+  # create temporary directory to store dockerfile & optional resources in
+  local tmpdir=$(mktemp -d "$VIASH_META_TEMP_DIR/dockerbuild-$VIASH_META_NAME-XXXXXX")
+  local dockerfile="$tmpdir/Dockerfile"
+  function clean_up {
+    rm -rf "$tmpdir"
+  }
+  trap clean_up EXIT
+
+  # store dockerfile and resources
+  ViashDockerfile "$VIASH_ENGINE_ID" > "$dockerfile"
+
+  # generate the build command
+  local docker_build_cmd="docker build -t '$image_id' $@ '$VIASH_META_RESOURCES_DIR' -f '$dockerfile'"
+
+  # build the container
+  ViashNotice "Building container '$image_id' with Dockerfile"
+  ViashInfo "$docker_build_cmd"
+  local save=$-; set +e
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    eval $docker_build_cmd
+  else
+    eval $docker_build_cmd &> "$tmpdir/docker_build.log"
+  fi
+
+  # check exit code
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashError "Error occurred while building container '$image_id'"
+    if [ $VIASH_VERBOSITY -lt $VIASH_LOGCODE_INFO ]; then
+      ViashError "Transcript: --------------------------------"
+      cat "$tmpdir/docker_build.log"
+      ViashError "End of transcript --------------------------"
+    fi
+    exit 1
+  fi
+}
+
+######## End of helper functions for setting up Docker images for viash ########
+
+# ViashDockerFile: print the dockerfile to stdout
+# $1    : engine identifier
+# return : dockerfile required to run this component
+# examples:
+#   ViashDockerFile
+function ViashDockerfile {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    cat << 'VIASHDOCKER'
+FROM python:3.10
+ENTRYPOINT []
+RUN pip install --upgrade pip && \
+  pip install --upgrade --no-cache-dir "RSeQC"
+
+RUN echo "RSeQC bam_stat.py: $(bam_stat.py --version | cut -d' ' -f2-)" > /var/software_versions.txt
+
+LABEL org.opencontainers.image.authors="Emma Rousseau"
+LABEL org.opencontainers.image.description="Companion container for running component rseqc rseqc_bamstat"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:06Z"
+LABEL org.opencontainers.image.source="https://github.com/MonashBioinformaticsPlatform/RSeQC"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+LABEL org.opencontainers.image.version="main"
+
+VIASHDOCKER
+  fi
+}
+
+# ViashDockerBuildArgs: return the arguments to pass to docker build
+# $1    : engine identifier
+# return : arguments to pass to docker build
+function ViashDockerBuildArgs {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    echo ""
+  fi
+}
+
+# ViashAbsolutePath: generate absolute path from relative path
+# borrowed from https://stackoverflow.com/a/21951256
+# $1     : relative filename
+# return : absolute path
+# examples:
+#   ViashAbsolutePath some_file.txt   # returns /path/to/some_file.txt
+#   ViashAbsolutePath /foo/bar/..     # returns /foo
+function ViashAbsolutePath {
+  local thePath
+  local parr
+  local outp
+  local len
+  if [[ ! "$1" =~ ^/ ]]; then
+    thePath="$PWD/$1"
+  else
+    thePath="$1"
+  fi
+  echo "$thePath" | (
+    IFS=/
+    read -a parr
+    declare -a outp
+    for i in "${parr[@]}"; do
+      case "$i" in
+      ''|.) continue ;;
+      ..)
+        len=${#outp[@]}
+        if ((len==0)); then
+          continue
+        else
+          unset outp[$((len-1))]
+        fi
+        ;;
+      *)
+        len=${#outp[@]}
+        outp[$len]="$i"
+      ;;
+      esac
+    done
+    echo /"${outp[*]}"
+  )
+}
+# ViashDockerAutodetectMount: auto configuring docker mounts from parameters
+# $1                             : The parameter value
+# returns                        : New parameter
+# $VIASH_DIRECTORY_MOUNTS        : Added another parameter to be passed to docker
+# $VIASH_DOCKER_AUTOMOUNT_PREFIX : The prefix to be used for the automounts
+# examples:
+#   ViashDockerAutodetectMount /path/to/bar      # returns '/viash_automount/path/to/bar'
+#   ViashDockerAutodetectMountArg /path/to/bar   # returns '--volume="/path/to:/viash_automount/path/to"'
+function ViashDockerAutodetectMount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  if [ -z "$base_name" ]; then
+    echo "$mount_target"
+  else
+    echo "$mount_target/$base_name"
+  fi
+}
+function ViashDockerAutodetectMountArg {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  ViashDebug "ViashDockerAutodetectMountArg $1 -> $mount_source -> $mount_target"
+  echo "--volume=\"$mount_source:$mount_target\""
+}
+function ViashDockerStripAutomount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  echo "${abs_path#$VIASH_DOCKER_AUTOMOUNT_PREFIX}"
+}
+# initialise variables
+VIASH_DIRECTORY_MOUNTS=()
+
+# configure default docker automount prefix if it is unset
+if [ -z "${VIASH_DOCKER_AUTOMOUNT_PREFIX+x}" ]; then
+  VIASH_DOCKER_AUTOMOUNT_PREFIX="/viash_automount"
+fi
+
+# initialise docker variables
+VIASH_DOCKER_RUN_ARGS=(-i --rm)
+
+# initialise array
+VIASH_POSITIONAL_ARGS=''
+
+while [[ $# -gt 0 ]]; do
+    case "$1" in
+        -h|--help)
+            ViashHelp
+            exit
+            ;;
+        ---v|---verbose)
+            let "VIASH_VERBOSITY=VIASH_VERBOSITY+1"
+            shift 1
+            ;;
+        ---verbosity)
+            VIASH_VERBOSITY="$2"
+            shift 2
+            ;;
+        ---verbosity=*)
+            VIASH_VERBOSITY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        --version)
+            echo "rseqc_bamstat main"
+            exit
+            ;;
+        --input_file)
+            [ -n "$VIASH_PAR_INPUT_FILE" ] && ViashError Bad arguments for option \'--input_file\': \'$VIASH_PAR_INPUT_FILE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT_FILE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --input_file. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --input_file=*)
+            [ -n "$VIASH_PAR_INPUT_FILE" ] && ViashError Bad arguments for option \'--input_file=*\': \'$VIASH_PAR_INPUT_FILE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT_FILE=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -i)
+            [ -n "$VIASH_PAR_INPUT_FILE" ] && ViashError Bad arguments for option \'-i\': \'$VIASH_PAR_INPUT_FILE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT_FILE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -i. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --mapq)
+            [ -n "$VIASH_PAR_MAPQ" ] && ViashError Bad arguments for option \'--mapq\': \'$VIASH_PAR_MAPQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MAPQ="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --mapq. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --mapq=*)
+            [ -n "$VIASH_PAR_MAPQ" ] && ViashError Bad arguments for option \'--mapq=*\': \'$VIASH_PAR_MAPQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MAPQ=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -q)
+            [ -n "$VIASH_PAR_MAPQ" ] && ViashError Bad arguments for option \'-q\': \'$VIASH_PAR_MAPQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MAPQ="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -q. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output=*)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output=*\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        ---engine)
+            VIASH_ENGINE_ID="$2"
+            shift 2
+            ;;
+        ---engine=*)
+            VIASH_ENGINE_ID="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---setup)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$2"
+            shift 2
+            ;;
+        ---setup=*)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---dockerfile)
+            VIASH_MODE='dockerfile'
+            shift 1
+            ;;
+        ---docker_run_args)
+            VIASH_DOCKER_RUN_ARGS+=("$2")
+            shift 2
+            ;;
+        ---docker_run_args=*)
+            VIASH_DOCKER_RUN_ARGS+=("$(ViashRemoveFlags "$1")")
+            shift 1
+            ;;
+        ---docker_image_id)
+            VIASH_MODE='docker_image_id'
+            shift 1
+            ;;
+        ---debug)
+            VIASH_MODE='debug'
+            shift 1
+            ;;
+        ---cpus)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---cpus. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---cpus=*)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus=*\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        ---memory)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---memory. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---memory=*)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory=*\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        *)  # positional arg or unknown option
+            # since the positional args will be eval'd, can we always quote, instead of using ViashQuote
+            VIASH_POSITIONAL_ARGS="$VIASH_POSITIONAL_ARGS '$1'"
+            [[ $1 == -* ]] && ViashWarning $1 looks like a parameter but is not a defined parameter and will instead be treated as a positional argument. Use "--help" to get more information on the parameters.
+            shift # past argument
+            ;;
+    esac
+done
+
+# parse positional parameters
+eval set -- $VIASH_POSITIONAL_ARGS
+
+
+if   [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  VIASH_ENGINE_TYPE='native'
+elif   [ "$VIASH_ENGINE_ID" == "docker" ]  ; then
+  VIASH_ENGINE_TYPE='docker'
+else
+  ViashError "Engine '$VIASH_ENGINE_ID' is not recognized. Options are: docker, native."
+  exit 1
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # check if docker is installed properly
+  ViashDockerInstallationCheck
+
+  # determine docker image id
+  if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
+    VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/rseqc/rseqc_bamstat:main'
+  fi
+
+  # print dockerfile
+  if [ "$VIASH_MODE" == "dockerfile" ]; then
+    ViashDockerfile "$VIASH_ENGINE_ID"
+    exit 0
+
+  elif [ "$VIASH_MODE" == "docker_image_id" ]; then
+    echo "$VIASH_DOCKER_IMAGE_ID"
+    exit 0
+  
+  # enter docker container
+  elif [[ "$VIASH_MODE" == "debug" ]]; then
+    VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} -v '$(pwd)':/pwd --workdir /pwd -t $VIASH_DOCKER_IMAGE_ID"
+    ViashNotice "+ $VIASH_CMD"
+    eval $VIASH_CMD
+    exit 
+
+  # build docker image
+  elif [ "$VIASH_MODE" == "setup" ]; then
+    ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" "$VIASH_SETUP_STRATEGY"
+    ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+    exit 0
+  fi
+
+  # check if docker image exists
+  ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" ifneedbepullelsecachedbuild
+  ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+fi
+
+# setting computational defaults
+
+# helper function for parsing memory strings
+function ViashMemoryAsBytes {
+  local memory=`echo "$1" | tr '[:upper:]' '[:lower:]' | tr -d '[:space:]'`
+  local memory_regex='^([0-9]+)([kmgtp]i?b?|b)$'
+  if [[ $memory =~ $memory_regex ]]; then
+    local number=${memory/[^0-9]*/}
+    local symbol=${memory/*[0-9]/}
+    
+    case $symbol in
+      b)      memory_b=$number ;;
+      kb|k)   memory_b=$(( $number * 1000 )) ;;
+      mb|m)   memory_b=$(( $number * 1000 * 1000 )) ;;
+      gb|g)   memory_b=$(( $number * 1000 * 1000 * 1000 )) ;;
+      tb|t)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 )) ;;
+      pb|p)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 * 1000 )) ;;
+      kib|ki)   memory_b=$(( $number * 1024 )) ;;
+      mib|mi)   memory_b=$(( $number * 1024 * 1024 )) ;;
+      gib|gi)   memory_b=$(( $number * 1024 * 1024 * 1024 )) ;;
+      tib|ti)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 )) ;;
+      pib|pi)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 * 1024 )) ;;
+    esac
+    echo "$memory_b"
+  fi
+}
+# compute memory in different units
+if [ ! -z ${VIASH_META_MEMORY+x} ]; then
+  VIASH_META_MEMORY_B=`ViashMemoryAsBytes $VIASH_META_MEMORY`
+  # do not define other variables if memory_b is an empty string
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_META_MEMORY_KB=$(( ($VIASH_META_MEMORY_B+999) / 1000 ))
+    VIASH_META_MEMORY_MB=$(( ($VIASH_META_MEMORY_KB+999) / 1000 ))
+    VIASH_META_MEMORY_GB=$(( ($VIASH_META_MEMORY_MB+999) / 1000 ))
+    VIASH_META_MEMORY_TB=$(( ($VIASH_META_MEMORY_GB+999) / 1000 ))
+    VIASH_META_MEMORY_PB=$(( ($VIASH_META_MEMORY_TB+999) / 1000 ))
+    VIASH_META_MEMORY_KIB=$(( ($VIASH_META_MEMORY_B+1023) / 1024 ))
+    VIASH_META_MEMORY_MIB=$(( ($VIASH_META_MEMORY_KIB+1023) / 1024 ))
+    VIASH_META_MEMORY_GIB=$(( ($VIASH_META_MEMORY_MIB+1023) / 1024 ))
+    VIASH_META_MEMORY_TIB=$(( ($VIASH_META_MEMORY_GIB+1023) / 1024 ))
+    VIASH_META_MEMORY_PIB=$(( ($VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  else
+    # unset memory if string is empty
+    unset $VIASH_META_MEMORY_B
+  fi
+fi
+# unset nproc if string is empty
+if [ -z "$VIASH_META_CPUS" ]; then
+  unset $VIASH_META_CPUS
+fi
+
+
+# check whether required parameters exist
+if [ -z ${VIASH_PAR_INPUT_FILE+x} ]; then
+  ViashError '--input_file' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_NAME+x} ]; then
+  ViashError 'name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then
+  ViashError 'functionality_name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_RESOURCES_DIR+x} ]; then
+  ViashError 'resources_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_EXECUTABLE+x} ]; then
+  ViashError 'executable' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_CONFIG+x} ]; then
+  ViashError 'config' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_TEMP_DIR+x} ]; then
+  ViashError 'temp_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_INPUT_FILE" ] && [ ! -e "$VIASH_PAR_INPUT_FILE" ]; then
+  ViashError "Input file '$VIASH_PAR_INPUT_FILE' does not exist."
+  exit 1
+fi
+
+# check whether parameters values are of the right type
+if [[ -n "$VIASH_PAR_MAPQ" ]]; then
+  if ! [[ "$VIASH_PAR_MAPQ" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError '--mapq' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_CPUS" ]]; then
+  if ! [[ "$VIASH_META_CPUS" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'cpus' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_B" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_B" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_b' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+
+# create parent directories of output files, if so desired
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT")"
+fi
+
+if  [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  if [ "$VIASH_MODE" == "run" ]; then
+    VIASH_CMD="bash"
+  else
+    ViashError "Engine '$VIASH_ENGINE_ID' does not support mode '$VIASH_MODE'."
+    exit 1
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # detect volumes from file arguments
+  VIASH_CHOWN_VARS=()
+if [ ! -z "$VIASH_PAR_INPUT_FILE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_INPUT_FILE")" )
+  VIASH_PAR_INPUT_FILE=$(ViashDockerAutodetectMount "$VIASH_PAR_INPUT_FILE")
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT")" )
+  VIASH_PAR_OUTPUT=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT" )
+fi
+if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" )
+  VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR")
+fi
+if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_EXECUTABLE")" )
+  VIASH_META_EXECUTABLE=$(ViashDockerAutodetectMount "$VIASH_META_EXECUTABLE")
+fi
+if [ ! -z "$VIASH_META_CONFIG" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_CONFIG")" )
+  VIASH_META_CONFIG=$(ViashDockerAutodetectMount "$VIASH_META_CONFIG")
+fi
+if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_TEMP_DIR")" )
+  VIASH_META_TEMP_DIR=$(ViashDockerAutodetectMount "$VIASH_META_TEMP_DIR")
+fi
+  
+  # get unique mounts
+  VIASH_UNIQUE_MOUNTS=($(for val in "${VIASH_DIRECTORY_MOUNTS[@]}"; do echo "$val"; done | sort -u))
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # change file ownership
+  function ViashPerformChown {
+    if (( ${#VIASH_CHOWN_VARS[@]} )); then
+      set +e
+      VIASH_CMD="docker run --entrypoint=bash --rm ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID -c 'chown $(id -u):$(id -g) --silent --recursive ${VIASH_CHOWN_VARS[@]}'"
+      ViashDebug "+ $VIASH_CMD"
+      eval $VIASH_CMD
+      set -e
+    fi
+  }
+  trap ViashPerformChown EXIT
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # helper function for filling in extra docker args
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--memory=${VIASH_META_MEMORY_B}")
+  fi
+  if [ ! -z "$VIASH_META_CPUS" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--cpus=${VIASH_META_CPUS}")
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID"
+fi
+
+
+# set dependency paths
+
+
+ViashDebug "Running command: $(echo $VIASH_CMD)"
+cat << VIASHEOF | eval $VIASH_CMD
+set -e
+tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-rseqc_bamstat-XXXXXX").sh
+function clean_up {
+  rm "\$tempscript"
+}
+function interrupt {
+  echo -e "\nCTRL-C Pressed..."
+  exit 1
+}
+trap clean_up EXIT
+trap interrupt INT SIGINT
+cat > "\$tempscript" << 'VIASHMAIN'
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_INPUT_FILE+x} ]; then echo "${VIASH_PAR_INPUT_FILE}" | sed "s#'#'\"'\"'#g;s#.*#par_input_file='&'#" ; else echo "# par_input_file="; fi )
+$( if [ ! -z ${VIASH_PAR_MAPQ+x} ]; then echo "${VIASH_PAR_MAPQ}" | sed "s#'#'\"'\"'#g;s#.*#par_mapq='&'#" ; else echo "# par_mapq="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\"'\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\"'\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+#!/bin/bash
+
+
+set -eo pipefail 
+
+bam_stat.py \\
+    --input-file "\${par_input_file}" \\
+    \${par_mapq:+--mapq "\${par_mapq}"} \\
+> \$par_output
+VIASHMAIN
+bash "\$tempscript" &
+wait "\$!"
+
+VIASHEOF
+
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # strip viash automount from file paths
+  
+  if [ ! -z "$VIASH_PAR_INPUT_FILE" ]; then
+    VIASH_PAR_INPUT_FILE=$(ViashDockerStripAutomount "$VIASH_PAR_INPUT_FILE")
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+    VIASH_PAR_OUTPUT=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT")
+  fi
+  if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+    VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR")
+  fi
+  if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+    VIASH_META_EXECUTABLE=$(ViashDockerStripAutomount "$VIASH_META_EXECUTABLE")
+  fi
+  if [ ! -z "$VIASH_META_CONFIG" ]; then
+    VIASH_META_CONFIG=$(ViashDockerStripAutomount "$VIASH_META_CONFIG")
+  fi
+  if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+    VIASH_META_TEMP_DIR=$(ViashDockerStripAutomount "$VIASH_META_TEMP_DIR")
+  fi
+fi
+
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -e "$VIASH_PAR_OUTPUT" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT' does not exist."
+  exit 1
+fi
+
+
+exit 0
diff --git a/target/executable/rseqc/rseqc_inferexperiment/.config.vsh.yaml b/target/executable/rseqc/rseqc_inferexperiment/.config.vsh.yaml
new file mode 100644
index 00000000..c2be895c
--- /dev/null
+++ b/target/executable/rseqc/rseqc_inferexperiment/.config.vsh.yaml
@@ -0,0 +1,228 @@
+name: "rseqc_inferexperiment"
+namespace: "rseqc"
+version: "main"
+authors:
+- name: "Emma Rousseau"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "emma@data-intuitive.com"
+      github: "emmarousseau"
+      linkedin: "emmarousseau1"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Input"
+  arguments:
+  - type: "file"
+    name: "--input_file"
+    alternatives:
+    - "-i"
+    description: "input alignment file in BAM or SAM format"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--refgene"
+    alternatives:
+    - "-r"
+    description: "Reference gene model in bed format"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Output"
+  arguments:
+  - type: "file"
+    name: "--output"
+    description: "Output file (txt) of strandness report."
+    info: null
+    example:
+    - "$id.strandedness.txt"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Options"
+  arguments:
+  - type: "integer"
+    name: "--sample_size"
+    alternatives:
+    - "-s"
+    description: "Number of reads sampled from SAM/BAM file. Default: 200000\n"
+    info: null
+    example:
+    - 200000
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--mapq"
+    alternatives:
+    - "-q"
+    description: "Minimum mapping quality (phred scaled) to determine uniquely mapped\
+      \ reads. Default: 30\n"
+    info: null
+    example:
+    - 30
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Infer strandedness from sequencing reads\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.1093/bioinformatics/bts356"
+links:
+  repository: "https://github.com/MonashBioinformaticsPlatform/RSeQC"
+  homepage: "https://rseqc.sourceforge.net/"
+  documentation: "https://rseqc.sourceforge.net/#infer-experiment-py"
+  issue_tracker: "https://github.com/MonashBioinformaticsPlatform/RSeQC/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "python:3.10"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "python"
+    user: false
+    packages:
+    - "RSeQC"
+    upgrade: true
+  - type: "docker"
+    run:
+    - "echo \"RSeQC - infer_experiment.py: $(infer_experiment.py --version | cut -d'\
+      \ ' -f2)\" > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/rseqc/rseqc_inferexperiment/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/rseqc/rseqc_inferexperiment"
+  executable: "target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment b/target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment
new file mode 100755
index 00000000..f9f4c8ed
--- /dev/null
+++ b/target/executable/rseqc/rseqc_inferexperiment/rseqc_inferexperiment
@@ -0,0 +1,1192 @@
+#!/usr/bin/env bash
+
+# rseqc_inferexperiment main
+# 
+# This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+# work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+# Intuitive.
+# 
+# The component may contain files which fall under a different license. The
+# authors of this component should specify the license in the header of such
+# files, or include a separate license file detailing the licenses of all included
+# files.
+# 
+# Component authors:
+#  * Emma Rousseau (author, maintainer)
+
+set -e
+
+if [ -z "$VIASH_TEMP" ]; then
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMP}
+  VIASH_TEMP=${VIASH_TEMP:-/tmp}
+fi
+
+# define helper functions
+# ViashQuote: put quotes around non flag values
+# $1     : unquoted string
+# return : possibly quoted string
+# examples:
+#   ViashQuote --foo      # returns --foo
+#   ViashQuote bar        # returns 'bar'
+#   Viashquote --foo=bar  # returns --foo='bar'
+function ViashQuote {
+  if [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+=.+$ ]]; then
+    echo "$1" | sed "s#=\(.*\)#='\1'#"
+  elif [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+$ ]]; then
+    echo "$1"
+  else
+    echo "'$1'"
+  fi
+}
+# ViashRemoveFlags: Remove leading flag
+# $1     : string with a possible leading flag
+# return : string without possible leading flag
+# examples:
+#   ViashRemoveFlags --foo=bar  # returns bar
+function ViashRemoveFlags {
+  echo "$1" | sed 's/^--*[a-zA-Z0-9_\-]*=//'
+}
+# ViashSourceDir: return the path of a bash file, following symlinks
+# usage   : ViashSourceDir ${BASH_SOURCE[0]}
+# $1      : Should always be set to ${BASH_SOURCE[0]}
+# returns : The absolute path of the bash file
+function ViashSourceDir {
+  local source="$1"
+  while [ -h "$source" ]; do
+    local dir="$( cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd )"
+    source="$(readlink "$source")"
+    [[ $source != /* ]] && source="$dir/$source"
+  done
+  cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd
+}
+# ViashFindTargetDir: return the path of the '.build.yaml' file, following symlinks
+# usage   : ViashFindTargetDir 'ScriptPath'
+# $1      : The location from where to start the upward search
+# returns : The absolute path of the '.build.yaml' file
+function ViashFindTargetDir {
+  local source="$1"
+  while [[ "$source" != "" && ! -e "$source/.build.yaml" ]]; do
+    source=${source%/*}
+  done
+  echo $source
+}
+# see https://en.wikipedia.org/wiki/Syslog#Severity_level
+VIASH_LOGCODE_EMERGENCY=0
+VIASH_LOGCODE_ALERT=1
+VIASH_LOGCODE_CRITICAL=2
+VIASH_LOGCODE_ERROR=3
+VIASH_LOGCODE_WARNING=4
+VIASH_LOGCODE_NOTICE=5
+VIASH_LOGCODE_INFO=6
+VIASH_LOGCODE_DEBUG=7
+VIASH_VERBOSITY=$VIASH_LOGCODE_NOTICE
+
+# ViashLog: Log events depending on the verbosity level
+# usage: ViashLog 1 alert Oh no something went wrong!
+# $1: required verbosity level
+# $2: display tag
+# $3+: messages to display
+# stdout: Your input, prepended by '[$2] '.
+function ViashLog {
+  local required_level="$1"
+  local display_tag="$2"
+  shift 2
+  if [ $VIASH_VERBOSITY -ge $required_level ]; then
+    >&2 echo "[$display_tag]" "$@"
+  fi
+}
+
+# ViashEmergency: log events when the system is unstable
+# usage: ViashEmergency Oh no something went wrong.
+# stdout: Your input, prepended by '[emergency] '.
+function ViashEmergency {
+  ViashLog $VIASH_LOGCODE_EMERGENCY emergency "$@"
+}
+
+# ViashAlert: log events when actions must be taken immediately (e.g. corrupted system database)
+# usage: ViashAlert Oh no something went wrong.
+# stdout: Your input, prepended by '[alert] '.
+function ViashAlert {
+  ViashLog $VIASH_LOGCODE_ALERT alert "$@"
+}
+
+# ViashCritical: log events when a critical condition occurs
+# usage: ViashCritical Oh no something went wrong.
+# stdout: Your input, prepended by '[critical] '.
+function ViashCritical {
+  ViashLog $VIASH_LOGCODE_CRITICAL critical "$@"
+}
+
+# ViashError: log events when an error condition occurs
+# usage: ViashError Oh no something went wrong.
+# stdout: Your input, prepended by '[error] '.
+function ViashError {
+  ViashLog $VIASH_LOGCODE_ERROR error "$@"
+}
+
+# ViashWarning: log potentially abnormal events
+# usage: ViashWarning Something may have gone wrong.
+# stdout: Your input, prepended by '[warning] '.
+function ViashWarning {
+  ViashLog $VIASH_LOGCODE_WARNING warning "$@"
+}
+
+# ViashNotice: log significant but normal events
+# usage: ViashNotice This just happened.
+# stdout: Your input, prepended by '[notice] '.
+function ViashNotice {
+  ViashLog $VIASH_LOGCODE_NOTICE notice "$@"
+}
+
+# ViashInfo: log normal events
+# usage: ViashInfo This just happened.
+# stdout: Your input, prepended by '[info] '.
+function ViashInfo {
+  ViashLog $VIASH_LOGCODE_INFO info "$@"
+}
+
+# ViashDebug: log all events, for debugging purposes
+# usage: ViashDebug This just happened.
+# stdout: Your input, prepended by '[debug] '.
+function ViashDebug {
+  ViashLog $VIASH_LOGCODE_DEBUG debug "$@"
+}
+
+# find source folder of this component
+VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}`
+
+# find the root of the built components & dependencies
+VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR`
+
+# define meta fields
+VIASH_META_NAME="rseqc_inferexperiment"
+VIASH_META_FUNCTIONALITY_NAME="rseqc_inferexperiment"
+VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME"
+VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+VIASH_META_TEMP_DIR="$VIASH_TEMP"
+
+
+# ViashHelp: Display helpful explanation about this executable
+function ViashHelp {
+  echo "rseqc_inferexperiment main"
+  echo ""
+  echo "Infer strandedness from sequencing reads"
+  echo ""
+  echo "Input:"
+  echo "    -i, --input_file"
+  echo "        type: file, required parameter, file must exist"
+  echo "        input alignment file in BAM or SAM format"
+  echo ""
+  echo "    -r, --refgene"
+  echo "        type: file, required parameter, file must exist"
+  echo "        Reference gene model in bed format"
+  echo ""
+  echo "Output:"
+  echo "    --output"
+  echo "        type: file, required parameter, output, file must exist"
+  echo "        example: \$id.strandedness.txt"
+  echo "        Output file (txt) of strandness report."
+  echo ""
+  echo "Options:"
+  echo "    -s, --sample_size"
+  echo "        type: integer"
+  echo "        example: 200000"
+  echo "        Number of reads sampled from SAM/BAM file. Default: 200000"
+  echo ""
+  echo "    -q, --mapq"
+  echo "        type: integer"
+  echo "        example: 30"
+  echo "        Minimum mapping quality (phred scaled) to determine uniquely mapped"
+  echo "        reads. Default: 30"
+}
+
+# initialise variables
+VIASH_MODE='run'
+VIASH_ENGINE_ID='docker'
+
+######## Helper functions for setting up Docker images for viash ########
+# expects: ViashDockerBuild
+
+# ViashDockerInstallationCheck: check whether Docker is installed correctly
+#
+# examples:
+#   ViashDockerInstallationCheck
+function ViashDockerInstallationCheck {
+  ViashDebug "Checking whether Docker is installed"
+  if [ ! command -v docker &> /dev/null ]; then
+    ViashCritical "Docker doesn't seem to be installed. See 'https://docs.docker.com/get-docker/' for instructions."
+    exit 1
+  fi
+
+  ViashDebug "Checking whether the Docker daemon is running"
+  local save=$-; set +e
+  local docker_version=$(docker version --format '{{.Client.APIVersion}}' 2> /dev/null)
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashCritical "Docker daemon does not seem to be running. Try one of the following:"
+    ViashCritical "- Try running 'dockerd' in the command line"
+    ViashCritical "- See https://docs.docker.com/config/daemon/"
+    exit 1
+  fi
+}
+
+# ViashDockerRemoteTagCheck: check whether a Docker image is available 
+# on a remote. Assumes `docker login` has been performed, if relevant.
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerRemoteTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerRemoteTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerRemoteTagCheck {
+  docker manifest inspect $1 > /dev/null 2> /dev/null
+}
+
+# ViashDockerLocalTagCheck: check whether a Docker image is available locally
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   docker pull python:latest
+#   ViashDockerLocalTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerLocalTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerLocalTagCheck {
+  [ -n "$(docker images -q $1)" ]
+}
+
+# ViashDockerPull: pull a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPull python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPull sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPull {
+  ViashNotice "Checking if Docker image is available at '$1'"
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker pull $1 && return 0 || return 1
+  else
+    local save=$-; set +e
+    docker pull $1 2> /dev/null > /dev/null
+    local out=$?
+    [[ $save =~ e ]] && set -e
+    if [ $out -ne 0 ]; then
+      ViashWarning "Could not pull from '$1'. Docker image doesn't exist or is not accessible."
+    fi
+    return $out
+  fi
+}
+
+# ViashDockerPush: push a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPush python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPush sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPush {
+  ViashNotice "Pushing image to '$1'"
+  local save=$-; set +e
+  local out
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker push $1
+    out=$?
+  else
+    docker push $1 2> /dev/null > /dev/null
+    out=$?
+  fi
+  [[ $save =~ e ]] && set -e
+  if [ $out -eq 0 ]; then
+    ViashNotice "Container '$1' push succeeded."
+  else
+    ViashError "Container '$1' push errored. You might not be logged in or have the necessary permissions."
+  fi
+  return $out
+}
+
+# ViashDockerPullElseBuild: pull a Docker image, else build it
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# ViashDockerBuild    : a Bash function which builds a docker image, takes image identifier as argument.
+# examples:
+#   ViashDockerPullElseBuild mynewcomponent
+function ViashDockerPullElseBuild {
+  local save=$-; set +e
+  ViashDockerPull $1
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashDockerBuild $@
+  fi
+}
+
+# ViashDockerSetup: create a Docker image, according to specified docker setup strategy
+#
+# $1          : image identifier with format `[registry/]image[:tag]`
+# $2          : docker setup strategy, see DockerSetupStrategy.scala
+# examples:
+#   ViashDockerSetup mynewcomponent alwaysbuild
+function ViashDockerSetup {
+  local image_id="$1"
+  local setup_strategy="$2"
+  if [ "$setup_strategy" == "alwaysbuild" -o "$setup_strategy" == "build" -o "$setup_strategy" == "b" ]; then
+    ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspull" -o "$setup_strategy" == "pull" -o "$setup_strategy" == "p" ]; then
+    ViashDockerPull $image_id
+  elif [ "$setup_strategy" == "alwayspullelsebuild" -o "$setup_strategy" == "pullelsebuild" ]; then
+    ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspullelsecachedbuild" -o "$setup_strategy" == "pullelsecachedbuild" ]; then
+    ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayscachedbuild" -o "$setup_strategy" == "cachedbuild" -o "$setup_strategy" == "cb" ]; then
+    ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [[ "$setup_strategy" =~ ^ifneedbe ]]; then
+    local save=$-; set +e
+    ViashDockerLocalTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashInfo "Image $image_id already exists"
+    elif [ "$setup_strategy" == "ifneedbebuild" ]; then
+      ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbecachedbuild" ]; then
+      ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepull" ]; then
+      ViashDockerPull $image_id
+    elif [ "$setup_strategy" == "ifneedbepullelsebuild" ]; then
+      ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepullelsecachedbuild" ]; then
+      ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    else
+      ViashError "Unrecognised Docker strategy: $setup_strategy"
+      exit 1
+    fi
+  elif [ "$setup_strategy" == "push" -o "$setup_strategy" == "forcepush" -o "$setup_strategy" == "alwayspush" ]; then
+    ViashDockerPush "$image_id"
+  elif [ "$setup_strategy" == "pushifnotpresent" -o "$setup_strategy" == "gentlepush" -o "$setup_strategy" == "maybepush" ]; then
+    local save=$-; set +e
+    ViashDockerRemoteTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashNotice "Container '$image_id' exists, doing nothing."
+    else
+      ViashNotice "Container '$image_id' does not yet exist."
+      ViashDockerPush "$image_id"
+    fi
+  elif [ "$setup_strategy" == "donothing" -o "$setup_strategy" == "meh" ]; then
+    ViashNotice "Skipping setup."
+  else
+    ViashError "Unrecognised Docker strategy: $setup_strategy"
+    exit 1
+  fi
+}
+
+# ViashDockerCheckCommands: Check whether a docker container has the required commands
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# $@                  : commands to verify being present
+# examples:
+#   ViashDockerCheckCommands bash:4.0 bash ps foo
+function ViashDockerCheckCommands {
+  local image_id="$1"
+  shift 1
+  local commands="$@"
+  local save=$-; set +e
+  local missing # mark 'missing' as local in advance, otherwise the exit code of the command will be missing and always be '0'
+  missing=$(docker run --rm --entrypoint=sh "$image_id" -c "for command in $commands; do command -v \$command >/dev/null 2>&1; if [ \$? -ne 0 ]; then echo \$command; exit 1; fi; done")
+  local outCheck=$?
+  [[ $save =~ e ]] && set -e
+  if [ $outCheck -ne 0 ]; then
+  	ViashError "Docker container '$image_id' does not contain command '$missing'."
+  	exit 1
+  fi
+}
+
+# ViashDockerBuild: build a docker image
+# $1                               : image identifier with format `[registry/]image[:tag]`
+# $...                             : additional arguments to pass to docker build
+# $VIASH_META_TEMP_DIR             : temporary directory to store dockerfile & optional resources in
+# $VIASH_META_NAME                 : name of the component
+# $VIASH_META_RESOURCES_DIR        : directory containing the resources
+# $VIASH_VERBOSITY                 : verbosity level
+# exit code $?                     : whether or not the image was built successfully
+function ViashDockerBuild {
+  local image_id="$1"
+  shift 1
+
+  # create temporary directory to store dockerfile & optional resources in
+  local tmpdir=$(mktemp -d "$VIASH_META_TEMP_DIR/dockerbuild-$VIASH_META_NAME-XXXXXX")
+  local dockerfile="$tmpdir/Dockerfile"
+  function clean_up {
+    rm -rf "$tmpdir"
+  }
+  trap clean_up EXIT
+
+  # store dockerfile and resources
+  ViashDockerfile "$VIASH_ENGINE_ID" > "$dockerfile"
+
+  # generate the build command
+  local docker_build_cmd="docker build -t '$image_id' $@ '$VIASH_META_RESOURCES_DIR' -f '$dockerfile'"
+
+  # build the container
+  ViashNotice "Building container '$image_id' with Dockerfile"
+  ViashInfo "$docker_build_cmd"
+  local save=$-; set +e
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    eval $docker_build_cmd
+  else
+    eval $docker_build_cmd &> "$tmpdir/docker_build.log"
+  fi
+
+  # check exit code
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashError "Error occurred while building container '$image_id'"
+    if [ $VIASH_VERBOSITY -lt $VIASH_LOGCODE_INFO ]; then
+      ViashError "Transcript: --------------------------------"
+      cat "$tmpdir/docker_build.log"
+      ViashError "End of transcript --------------------------"
+    fi
+    exit 1
+  fi
+}
+
+######## End of helper functions for setting up Docker images for viash ########
+
+# ViashDockerFile: print the dockerfile to stdout
+# $1    : engine identifier
+# return : dockerfile required to run this component
+# examples:
+#   ViashDockerFile
+function ViashDockerfile {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    cat << 'VIASHDOCKER'
+FROM python:3.10
+ENTRYPOINT []
+RUN pip install --upgrade pip && \
+  pip install --upgrade --no-cache-dir "RSeQC"
+
+RUN echo "RSeQC - infer_experiment.py: $(infer_experiment.py --version | cut -d' ' -f2)" > /var/software_versions.txt
+
+LABEL org.opencontainers.image.authors="Emma Rousseau"
+LABEL org.opencontainers.image.description="Companion container for running component rseqc rseqc_inferexperiment"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:06Z"
+LABEL org.opencontainers.image.source="https://github.com/MonashBioinformaticsPlatform/RSeQC"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+LABEL org.opencontainers.image.version="main"
+
+VIASHDOCKER
+  fi
+}
+
+# ViashDockerBuildArgs: return the arguments to pass to docker build
+# $1    : engine identifier
+# return : arguments to pass to docker build
+function ViashDockerBuildArgs {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    echo ""
+  fi
+}
+
+# ViashAbsolutePath: generate absolute path from relative path
+# borrowed from https://stackoverflow.com/a/21951256
+# $1     : relative filename
+# return : absolute path
+# examples:
+#   ViashAbsolutePath some_file.txt   # returns /path/to/some_file.txt
+#   ViashAbsolutePath /foo/bar/..     # returns /foo
+function ViashAbsolutePath {
+  local thePath
+  local parr
+  local outp
+  local len
+  if [[ ! "$1" =~ ^/ ]]; then
+    thePath="$PWD/$1"
+  else
+    thePath="$1"
+  fi
+  echo "$thePath" | (
+    IFS=/
+    read -a parr
+    declare -a outp
+    for i in "${parr[@]}"; do
+      case "$i" in
+      ''|.) continue ;;
+      ..)
+        len=${#outp[@]}
+        if ((len==0)); then
+          continue
+        else
+          unset outp[$((len-1))]
+        fi
+        ;;
+      *)
+        len=${#outp[@]}
+        outp[$len]="$i"
+      ;;
+      esac
+    done
+    echo /"${outp[*]}"
+  )
+}
+# ViashDockerAutodetectMount: auto configuring docker mounts from parameters
+# $1                             : The parameter value
+# returns                        : New parameter
+# $VIASH_DIRECTORY_MOUNTS        : Added another parameter to be passed to docker
+# $VIASH_DOCKER_AUTOMOUNT_PREFIX : The prefix to be used for the automounts
+# examples:
+#   ViashDockerAutodetectMount /path/to/bar      # returns '/viash_automount/path/to/bar'
+#   ViashDockerAutodetectMountArg /path/to/bar   # returns '--volume="/path/to:/viash_automount/path/to"'
+function ViashDockerAutodetectMount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  if [ -z "$base_name" ]; then
+    echo "$mount_target"
+  else
+    echo "$mount_target/$base_name"
+  fi
+}
+function ViashDockerAutodetectMountArg {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  ViashDebug "ViashDockerAutodetectMountArg $1 -> $mount_source -> $mount_target"
+  echo "--volume=\"$mount_source:$mount_target\""
+}
+function ViashDockerStripAutomount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  echo "${abs_path#$VIASH_DOCKER_AUTOMOUNT_PREFIX}"
+}
+# initialise variables
+VIASH_DIRECTORY_MOUNTS=()
+
+# configure default docker automount prefix if it is unset
+if [ -z "${VIASH_DOCKER_AUTOMOUNT_PREFIX+x}" ]; then
+  VIASH_DOCKER_AUTOMOUNT_PREFIX="/viash_automount"
+fi
+
+# initialise docker variables
+VIASH_DOCKER_RUN_ARGS=(-i --rm)
+
+# initialise array
+VIASH_POSITIONAL_ARGS=''
+
+while [[ $# -gt 0 ]]; do
+    case "$1" in
+        -h|--help)
+            ViashHelp
+            exit
+            ;;
+        ---v|---verbose)
+            let "VIASH_VERBOSITY=VIASH_VERBOSITY+1"
+            shift 1
+            ;;
+        ---verbosity)
+            VIASH_VERBOSITY="$2"
+            shift 2
+            ;;
+        ---verbosity=*)
+            VIASH_VERBOSITY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        --version)
+            echo "rseqc_inferexperiment main"
+            exit
+            ;;
+        --input_file)
+            [ -n "$VIASH_PAR_INPUT_FILE" ] && ViashError Bad arguments for option \'--input_file\': \'$VIASH_PAR_INPUT_FILE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT_FILE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --input_file. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --input_file=*)
+            [ -n "$VIASH_PAR_INPUT_FILE" ] && ViashError Bad arguments for option \'--input_file=*\': \'$VIASH_PAR_INPUT_FILE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT_FILE=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -i)
+            [ -n "$VIASH_PAR_INPUT_FILE" ] && ViashError Bad arguments for option \'-i\': \'$VIASH_PAR_INPUT_FILE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT_FILE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -i. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --refgene)
+            [ -n "$VIASH_PAR_REFGENE" ] && ViashError Bad arguments for option \'--refgene\': \'$VIASH_PAR_REFGENE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_REFGENE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --refgene. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --refgene=*)
+            [ -n "$VIASH_PAR_REFGENE" ] && ViashError Bad arguments for option \'--refgene=*\': \'$VIASH_PAR_REFGENE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_REFGENE=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -r)
+            [ -n "$VIASH_PAR_REFGENE" ] && ViashError Bad arguments for option \'-r\': \'$VIASH_PAR_REFGENE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_REFGENE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -r. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output=*)
+            [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output=*\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        --sample_size)
+            [ -n "$VIASH_PAR_SAMPLE_SIZE" ] && ViashError Bad arguments for option \'--sample_size\': \'$VIASH_PAR_SAMPLE_SIZE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_SAMPLE_SIZE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --sample_size. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --sample_size=*)
+            [ -n "$VIASH_PAR_SAMPLE_SIZE" ] && ViashError Bad arguments for option \'--sample_size=*\': \'$VIASH_PAR_SAMPLE_SIZE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_SAMPLE_SIZE=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -s)
+            [ -n "$VIASH_PAR_SAMPLE_SIZE" ] && ViashError Bad arguments for option \'-s\': \'$VIASH_PAR_SAMPLE_SIZE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_SAMPLE_SIZE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -s. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --mapq)
+            [ -n "$VIASH_PAR_MAPQ" ] && ViashError Bad arguments for option \'--mapq\': \'$VIASH_PAR_MAPQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MAPQ="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --mapq. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --mapq=*)
+            [ -n "$VIASH_PAR_MAPQ" ] && ViashError Bad arguments for option \'--mapq=*\': \'$VIASH_PAR_MAPQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MAPQ=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -q)
+            [ -n "$VIASH_PAR_MAPQ" ] && ViashError Bad arguments for option \'-q\': \'$VIASH_PAR_MAPQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MAPQ="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -q. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---engine)
+            VIASH_ENGINE_ID="$2"
+            shift 2
+            ;;
+        ---engine=*)
+            VIASH_ENGINE_ID="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---setup)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$2"
+            shift 2
+            ;;
+        ---setup=*)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---dockerfile)
+            VIASH_MODE='dockerfile'
+            shift 1
+            ;;
+        ---docker_run_args)
+            VIASH_DOCKER_RUN_ARGS+=("$2")
+            shift 2
+            ;;
+        ---docker_run_args=*)
+            VIASH_DOCKER_RUN_ARGS+=("$(ViashRemoveFlags "$1")")
+            shift 1
+            ;;
+        ---docker_image_id)
+            VIASH_MODE='docker_image_id'
+            shift 1
+            ;;
+        ---debug)
+            VIASH_MODE='debug'
+            shift 1
+            ;;
+        ---cpus)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---cpus. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---cpus=*)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus=*\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        ---memory)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---memory. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---memory=*)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory=*\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        *)  # positional arg or unknown option
+            # since the positional args will be eval'd, can we always quote, instead of using ViashQuote
+            VIASH_POSITIONAL_ARGS="$VIASH_POSITIONAL_ARGS '$1'"
+            [[ $1 == -* ]] && ViashWarning $1 looks like a parameter but is not a defined parameter and will instead be treated as a positional argument. Use "--help" to get more information on the parameters.
+            shift # past argument
+            ;;
+    esac
+done
+
+# parse positional parameters
+eval set -- $VIASH_POSITIONAL_ARGS
+
+
+if   [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  VIASH_ENGINE_TYPE='native'
+elif   [ "$VIASH_ENGINE_ID" == "docker" ]  ; then
+  VIASH_ENGINE_TYPE='docker'
+else
+  ViashError "Engine '$VIASH_ENGINE_ID' is not recognized. Options are: docker, native."
+  exit 1
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # check if docker is installed properly
+  ViashDockerInstallationCheck
+
+  # determine docker image id
+  if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
+    VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/rseqc/rseqc_inferexperiment:main'
+  fi
+
+  # print dockerfile
+  if [ "$VIASH_MODE" == "dockerfile" ]; then
+    ViashDockerfile "$VIASH_ENGINE_ID"
+    exit 0
+
+  elif [ "$VIASH_MODE" == "docker_image_id" ]; then
+    echo "$VIASH_DOCKER_IMAGE_ID"
+    exit 0
+  
+  # enter docker container
+  elif [[ "$VIASH_MODE" == "debug" ]]; then
+    VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} -v '$(pwd)':/pwd --workdir /pwd -t $VIASH_DOCKER_IMAGE_ID"
+    ViashNotice "+ $VIASH_CMD"
+    eval $VIASH_CMD
+    exit 
+
+  # build docker image
+  elif [ "$VIASH_MODE" == "setup" ]; then
+    ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" "$VIASH_SETUP_STRATEGY"
+    ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+    exit 0
+  fi
+
+  # check if docker image exists
+  ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" ifneedbepullelsecachedbuild
+  ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+fi
+
+# setting computational defaults
+
+# helper function for parsing memory strings
+function ViashMemoryAsBytes {
+  local memory=`echo "$1" | tr '[:upper:]' '[:lower:]' | tr -d '[:space:]'`
+  local memory_regex='^([0-9]+)([kmgtp]i?b?|b)$'
+  if [[ $memory =~ $memory_regex ]]; then
+    local number=${memory/[^0-9]*/}
+    local symbol=${memory/*[0-9]/}
+    
+    case $symbol in
+      b)      memory_b=$number ;;
+      kb|k)   memory_b=$(( $number * 1000 )) ;;
+      mb|m)   memory_b=$(( $number * 1000 * 1000 )) ;;
+      gb|g)   memory_b=$(( $number * 1000 * 1000 * 1000 )) ;;
+      tb|t)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 )) ;;
+      pb|p)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 * 1000 )) ;;
+      kib|ki)   memory_b=$(( $number * 1024 )) ;;
+      mib|mi)   memory_b=$(( $number * 1024 * 1024 )) ;;
+      gib|gi)   memory_b=$(( $number * 1024 * 1024 * 1024 )) ;;
+      tib|ti)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 )) ;;
+      pib|pi)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 * 1024 )) ;;
+    esac
+    echo "$memory_b"
+  fi
+}
+# compute memory in different units
+if [ ! -z ${VIASH_META_MEMORY+x} ]; then
+  VIASH_META_MEMORY_B=`ViashMemoryAsBytes $VIASH_META_MEMORY`
+  # do not define other variables if memory_b is an empty string
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_META_MEMORY_KB=$(( ($VIASH_META_MEMORY_B+999) / 1000 ))
+    VIASH_META_MEMORY_MB=$(( ($VIASH_META_MEMORY_KB+999) / 1000 ))
+    VIASH_META_MEMORY_GB=$(( ($VIASH_META_MEMORY_MB+999) / 1000 ))
+    VIASH_META_MEMORY_TB=$(( ($VIASH_META_MEMORY_GB+999) / 1000 ))
+    VIASH_META_MEMORY_PB=$(( ($VIASH_META_MEMORY_TB+999) / 1000 ))
+    VIASH_META_MEMORY_KIB=$(( ($VIASH_META_MEMORY_B+1023) / 1024 ))
+    VIASH_META_MEMORY_MIB=$(( ($VIASH_META_MEMORY_KIB+1023) / 1024 ))
+    VIASH_META_MEMORY_GIB=$(( ($VIASH_META_MEMORY_MIB+1023) / 1024 ))
+    VIASH_META_MEMORY_TIB=$(( ($VIASH_META_MEMORY_GIB+1023) / 1024 ))
+    VIASH_META_MEMORY_PIB=$(( ($VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  else
+    # unset memory if string is empty
+    unset $VIASH_META_MEMORY_B
+  fi
+fi
+# unset nproc if string is empty
+if [ -z "$VIASH_META_CPUS" ]; then
+  unset $VIASH_META_CPUS
+fi
+
+
+# check whether required parameters exist
+if [ -z ${VIASH_PAR_INPUT_FILE+x} ]; then
+  ViashError '--input_file' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_PAR_REFGENE+x} ]; then
+  ViashError '--refgene' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_PAR_OUTPUT+x} ]; then
+  ViashError '--output' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_NAME+x} ]; then
+  ViashError 'name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then
+  ViashError 'functionality_name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_RESOURCES_DIR+x} ]; then
+  ViashError 'resources_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_EXECUTABLE+x} ]; then
+  ViashError 'executable' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_CONFIG+x} ]; then
+  ViashError 'config' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_TEMP_DIR+x} ]; then
+  ViashError 'temp_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_INPUT_FILE" ] && [ ! -e "$VIASH_PAR_INPUT_FILE" ]; then
+  ViashError "Input file '$VIASH_PAR_INPUT_FILE' does not exist."
+  exit 1
+fi
+if [ ! -z "$VIASH_PAR_REFGENE" ] && [ ! -e "$VIASH_PAR_REFGENE" ]; then
+  ViashError "Input file '$VIASH_PAR_REFGENE' does not exist."
+  exit 1
+fi
+
+# check whether parameters values are of the right type
+if [[ -n "$VIASH_PAR_SAMPLE_SIZE" ]]; then
+  if ! [[ "$VIASH_PAR_SAMPLE_SIZE" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError '--sample_size' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_MAPQ" ]]; then
+  if ! [[ "$VIASH_PAR_MAPQ" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError '--mapq' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_CPUS" ]]; then
+  if ! [[ "$VIASH_META_CPUS" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'cpus' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_B" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_B" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_b' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+
+# create parent directories of output files, if so desired
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT")"
+fi
+
+if  [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  if [ "$VIASH_MODE" == "run" ]; then
+    VIASH_CMD="bash"
+  else
+    ViashError "Engine '$VIASH_ENGINE_ID' does not support mode '$VIASH_MODE'."
+    exit 1
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # detect volumes from file arguments
+  VIASH_CHOWN_VARS=()
+if [ ! -z "$VIASH_PAR_INPUT_FILE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_INPUT_FILE")" )
+  VIASH_PAR_INPUT_FILE=$(ViashDockerAutodetectMount "$VIASH_PAR_INPUT_FILE")
+fi
+if [ ! -z "$VIASH_PAR_REFGENE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_REFGENE")" )
+  VIASH_PAR_REFGENE=$(ViashDockerAutodetectMount "$VIASH_PAR_REFGENE")
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT")" )
+  VIASH_PAR_OUTPUT=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT" )
+fi
+if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" )
+  VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR")
+fi
+if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_EXECUTABLE")" )
+  VIASH_META_EXECUTABLE=$(ViashDockerAutodetectMount "$VIASH_META_EXECUTABLE")
+fi
+if [ ! -z "$VIASH_META_CONFIG" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_CONFIG")" )
+  VIASH_META_CONFIG=$(ViashDockerAutodetectMount "$VIASH_META_CONFIG")
+fi
+if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_TEMP_DIR")" )
+  VIASH_META_TEMP_DIR=$(ViashDockerAutodetectMount "$VIASH_META_TEMP_DIR")
+fi
+  
+  # get unique mounts
+  VIASH_UNIQUE_MOUNTS=($(for val in "${VIASH_DIRECTORY_MOUNTS[@]}"; do echo "$val"; done | sort -u))
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # change file ownership
+  function ViashPerformChown {
+    if (( ${#VIASH_CHOWN_VARS[@]} )); then
+      set +e
+      VIASH_CMD="docker run --entrypoint=bash --rm ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID -c 'chown $(id -u):$(id -g) --silent --recursive ${VIASH_CHOWN_VARS[@]}'"
+      ViashDebug "+ $VIASH_CMD"
+      eval $VIASH_CMD
+      set -e
+    fi
+  }
+  trap ViashPerformChown EXIT
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # helper function for filling in extra docker args
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--memory=${VIASH_META_MEMORY_B}")
+  fi
+  if [ ! -z "$VIASH_META_CPUS" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--cpus=${VIASH_META_CPUS}")
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID"
+fi
+
+
+# set dependency paths
+
+
+ViashDebug "Running command: $(echo $VIASH_CMD)"
+cat << VIASHEOF | eval $VIASH_CMD
+set -e
+tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-rseqc_inferexperiment-XXXXXX").sh
+function clean_up {
+  rm "\$tempscript"
+}
+function interrupt {
+  echo -e "\nCTRL-C Pressed..."
+  exit 1
+}
+trap clean_up EXIT
+trap interrupt INT SIGINT
+cat > "\$tempscript" << 'VIASHMAIN'
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_INPUT_FILE+x} ]; then echo "${VIASH_PAR_INPUT_FILE}" | sed "s#'#'\"'\"'#g;s#.*#par_input_file='&'#" ; else echo "# par_input_file="; fi )
+$( if [ ! -z ${VIASH_PAR_REFGENE+x} ]; then echo "${VIASH_PAR_REFGENE}" | sed "s#'#'\"'\"'#g;s#.*#par_refgene='&'#" ; else echo "# par_refgene="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_PAR_SAMPLE_SIZE+x} ]; then echo "${VIASH_PAR_SAMPLE_SIZE}" | sed "s#'#'\"'\"'#g;s#.*#par_sample_size='&'#" ; else echo "# par_sample_size="; fi )
+$( if [ ! -z ${VIASH_PAR_MAPQ+x} ]; then echo "${VIASH_PAR_MAPQ}" | sed "s#'#'\"'\"'#g;s#.*#par_mapq='&'#" ; else echo "# par_mapq="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\"'\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\"'\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+#!/bin/bash
+
+set -eo pipefail 
+
+infer_experiment.py \\
+    -i \$par_input_file \\
+    -r \$par_refgene \\
+    \${par_sample_size:+-s "\${par_sample_size}"} \\
+    \${par_mapq:+-q "\${par_mapq}"} \\
+> \$par_output
+VIASHMAIN
+bash "\$tempscript" &
+wait "\$!"
+
+VIASHEOF
+
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # strip viash automount from file paths
+  
+  if [ ! -z "$VIASH_PAR_INPUT_FILE" ]; then
+    VIASH_PAR_INPUT_FILE=$(ViashDockerStripAutomount "$VIASH_PAR_INPUT_FILE")
+  fi
+  if [ ! -z "$VIASH_PAR_REFGENE" ]; then
+    VIASH_PAR_REFGENE=$(ViashDockerStripAutomount "$VIASH_PAR_REFGENE")
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
+    VIASH_PAR_OUTPUT=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT")
+  fi
+  if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+    VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR")
+  fi
+  if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+    VIASH_META_EXECUTABLE=$(ViashDockerStripAutomount "$VIASH_META_EXECUTABLE")
+  fi
+  if [ ! -z "$VIASH_META_CONFIG" ]; then
+    VIASH_META_CONFIG=$(ViashDockerStripAutomount "$VIASH_META_CONFIG")
+  fi
+  if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+    VIASH_META_TEMP_DIR=$(ViashDockerStripAutomount "$VIASH_META_TEMP_DIR")
+  fi
+fi
+
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -e "$VIASH_PAR_OUTPUT" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT' does not exist."
+  exit 1
+fi
+
+
+exit 0
diff --git a/target/executable/rseqc/rseqc_inner_distance/.config.vsh.yaml b/target/executable/rseqc/rseqc_inner_distance/.config.vsh.yaml
new file mode 100644
index 00000000..bc547d2e
--- /dev/null
+++ b/target/executable/rseqc/rseqc_inner_distance/.config.vsh.yaml
@@ -0,0 +1,321 @@
+name: "rseqc_inner_distance"
+namespace: "rseqc"
+version: "main"
+authors:
+- name: "Emma Rousseau"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "emma@data-intuitive.com"
+      github: "emmarousseau"
+      linkedin: "emmarousseau1"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Input"
+  arguments:
+  - type: "file"
+    name: "--input_file"
+    alternatives:
+    - "-i"
+    description: "input alignment file in BAM or SAM format"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--refgene"
+    alternatives:
+    - "-r"
+    description: "Reference gene model in bed format"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--sample_size"
+    alternatives:
+    - "-k"
+    description: "Numer of reads sampled from SAM/BAM file, default = 1000000."
+    info: null
+    example:
+    - 1000000
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--mapq"
+    alternatives:
+    - "-q"
+    description: "Minimum mapping quality (phred scaled) to determine uniquely mapped\
+      \ reads, default=30."
+    info: null
+    example:
+    - 30
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--lower_bound"
+    alternatives:
+    - "-l"
+    description: "Lower bound of inner distance (bp). This option is used for ploting\
+      \ histograme, default=-250."
+    info: null
+    example:
+    - -250
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--upper_bound"
+    alternatives:
+    - "-u"
+    description: "Upper bound of inner distance (bp). This option is used for ploting\
+      \ histograme, default=250."
+    info: null
+    example:
+    - 250
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--step"
+    alternatives:
+    - "-s"
+    description: "Step size (bp) of histograme. This option is used for plotting histogram,\
+      \ default=5."
+    info: null
+    example:
+    - 5
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Output"
+  arguments:
+  - type: "string"
+    name: "--output_prefix"
+    alternatives:
+    - "-o"
+    description: "Rrefix of output files."
+    info: null
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_stats"
+    description: "output file (txt) with summary statistics of inner distances of\
+      \ paired reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_dist"
+    description: "output file (txt) with inner distances of all paired reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_freq"
+    description: "output file (txt) with frequencies of inner distances of all paired\
+      \ reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_plot"
+    description: "output file (pdf) with histogram plot of of inner distances of all\
+      \ paired reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_plot_r"
+    description: "output file (R) with script of histogram plot of of inner distances\
+      \ of all paired reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Calculate inner distance between read pairs.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.1093/bioinformatics/bts356"
+links:
+  repository: "https://github.com/MonashBioinformaticsPlatform/RSeQC"
+  homepage: "https://rseqc.sourceforge.net/"
+  documentation: "https://rseqc.sourceforge.net/#inner-distance-py"
+  issue_tracker: "https://github.com/MonashBioinformaticsPlatform/RSeQC/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "python:3.10"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "apt"
+    packages:
+    - "r-base"
+    interactive: false
+  - type: "python"
+    user: false
+    packages:
+    - "RSeQC"
+    upgrade: true
+  - type: "docker"
+    run:
+    - "echo \"RSeQC - inner_distance.py: $(inner_distance.py --version | cut -d' '\
+      \ -f2)\" > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/rseqc/rseqc_inner_distance/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/rseqc/rseqc_inner_distance"
+  executable: "target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance b/target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance
new file mode 100755
index 00000000..098d90bc
--- /dev/null
+++ b/target/executable/rseqc/rseqc_inner_distance/rseqc_inner_distance
@@ -0,0 +1,1449 @@
+#!/usr/bin/env bash
+
+# rseqc_inner_distance main
+# 
+# This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+# work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+# Intuitive.
+# 
+# The component may contain files which fall under a different license. The
+# authors of this component should specify the license in the header of such
+# files, or include a separate license file detailing the licenses of all included
+# files.
+# 
+# Component authors:
+#  * Emma Rousseau (author, maintainer)
+
+set -e
+
+if [ -z "$VIASH_TEMP" ]; then
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TMP}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMPDIR}
+  VIASH_TEMP=${VIASH_TEMP:-$TEMP}
+  VIASH_TEMP=${VIASH_TEMP:-/tmp}
+fi
+
+# define helper functions
+# ViashQuote: put quotes around non flag values
+# $1     : unquoted string
+# return : possibly quoted string
+# examples:
+#   ViashQuote --foo      # returns --foo
+#   ViashQuote bar        # returns 'bar'
+#   Viashquote --foo=bar  # returns --foo='bar'
+function ViashQuote {
+  if [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+=.+$ ]]; then
+    echo "$1" | sed "s#=\(.*\)#='\1'#"
+  elif [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+$ ]]; then
+    echo "$1"
+  else
+    echo "'$1'"
+  fi
+}
+# ViashRemoveFlags: Remove leading flag
+# $1     : string with a possible leading flag
+# return : string without possible leading flag
+# examples:
+#   ViashRemoveFlags --foo=bar  # returns bar
+function ViashRemoveFlags {
+  echo "$1" | sed 's/^--*[a-zA-Z0-9_\-]*=//'
+}
+# ViashSourceDir: return the path of a bash file, following symlinks
+# usage   : ViashSourceDir ${BASH_SOURCE[0]}
+# $1      : Should always be set to ${BASH_SOURCE[0]}
+# returns : The absolute path of the bash file
+function ViashSourceDir {
+  local source="$1"
+  while [ -h "$source" ]; do
+    local dir="$( cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd )"
+    source="$(readlink "$source")"
+    [[ $source != /* ]] && source="$dir/$source"
+  done
+  cd -P "$( dirname "$source" )" >/dev/null 2>&1 && pwd
+}
+# ViashFindTargetDir: return the path of the '.build.yaml' file, following symlinks
+# usage   : ViashFindTargetDir 'ScriptPath'
+# $1      : The location from where to start the upward search
+# returns : The absolute path of the '.build.yaml' file
+function ViashFindTargetDir {
+  local source="$1"
+  while [[ "$source" != "" && ! -e "$source/.build.yaml" ]]; do
+    source=${source%/*}
+  done
+  echo $source
+}
+# see https://en.wikipedia.org/wiki/Syslog#Severity_level
+VIASH_LOGCODE_EMERGENCY=0
+VIASH_LOGCODE_ALERT=1
+VIASH_LOGCODE_CRITICAL=2
+VIASH_LOGCODE_ERROR=3
+VIASH_LOGCODE_WARNING=4
+VIASH_LOGCODE_NOTICE=5
+VIASH_LOGCODE_INFO=6
+VIASH_LOGCODE_DEBUG=7
+VIASH_VERBOSITY=$VIASH_LOGCODE_NOTICE
+
+# ViashLog: Log events depending on the verbosity level
+# usage: ViashLog 1 alert Oh no something went wrong!
+# $1: required verbosity level
+# $2: display tag
+# $3+: messages to display
+# stdout: Your input, prepended by '[$2] '.
+function ViashLog {
+  local required_level="$1"
+  local display_tag="$2"
+  shift 2
+  if [ $VIASH_VERBOSITY -ge $required_level ]; then
+    >&2 echo "[$display_tag]" "$@"
+  fi
+}
+
+# ViashEmergency: log events when the system is unstable
+# usage: ViashEmergency Oh no something went wrong.
+# stdout: Your input, prepended by '[emergency] '.
+function ViashEmergency {
+  ViashLog $VIASH_LOGCODE_EMERGENCY emergency "$@"
+}
+
+# ViashAlert: log events when actions must be taken immediately (e.g. corrupted system database)
+# usage: ViashAlert Oh no something went wrong.
+# stdout: Your input, prepended by '[alert] '.
+function ViashAlert {
+  ViashLog $VIASH_LOGCODE_ALERT alert "$@"
+}
+
+# ViashCritical: log events when a critical condition occurs
+# usage: ViashCritical Oh no something went wrong.
+# stdout: Your input, prepended by '[critical] '.
+function ViashCritical {
+  ViashLog $VIASH_LOGCODE_CRITICAL critical "$@"
+}
+
+# ViashError: log events when an error condition occurs
+# usage: ViashError Oh no something went wrong.
+# stdout: Your input, prepended by '[error] '.
+function ViashError {
+  ViashLog $VIASH_LOGCODE_ERROR error "$@"
+}
+
+# ViashWarning: log potentially abnormal events
+# usage: ViashWarning Something may have gone wrong.
+# stdout: Your input, prepended by '[warning] '.
+function ViashWarning {
+  ViashLog $VIASH_LOGCODE_WARNING warning "$@"
+}
+
+# ViashNotice: log significant but normal events
+# usage: ViashNotice This just happened.
+# stdout: Your input, prepended by '[notice] '.
+function ViashNotice {
+  ViashLog $VIASH_LOGCODE_NOTICE notice "$@"
+}
+
+# ViashInfo: log normal events
+# usage: ViashInfo This just happened.
+# stdout: Your input, prepended by '[info] '.
+function ViashInfo {
+  ViashLog $VIASH_LOGCODE_INFO info "$@"
+}
+
+# ViashDebug: log all events, for debugging purposes
+# usage: ViashDebug This just happened.
+# stdout: Your input, prepended by '[debug] '.
+function ViashDebug {
+  ViashLog $VIASH_LOGCODE_DEBUG debug "$@"
+}
+
+# find source folder of this component
+VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}`
+
+# find the root of the built components & dependencies
+VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR`
+
+# define meta fields
+VIASH_META_NAME="rseqc_inner_distance"
+VIASH_META_FUNCTIONALITY_NAME="rseqc_inner_distance"
+VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME"
+VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+VIASH_META_TEMP_DIR="$VIASH_TEMP"
+
+
+# ViashHelp: Display helpful explanation about this executable
+function ViashHelp {
+  echo "rseqc_inner_distance main"
+  echo ""
+  echo "Calculate inner distance between read pairs."
+  echo ""
+  echo "Input:"
+  echo "    -i, --input_file"
+  echo "        type: file, required parameter, file must exist"
+  echo "        input alignment file in BAM or SAM format"
+  echo ""
+  echo "    -r, --refgene"
+  echo "        type: file, required parameter, file must exist"
+  echo "        Reference gene model in bed format"
+  echo ""
+  echo "    -k, --sample_size"
+  echo "        type: integer"
+  echo "        example: 1000000"
+  echo "        Numer of reads sampled from SAM/BAM file, default = 1000000."
+  echo ""
+  echo "    -q, --mapq"
+  echo "        type: integer"
+  echo "        example: 30"
+  echo "        Minimum mapping quality (phred scaled) to determine uniquely mapped"
+  echo "        reads, default=30."
+  echo ""
+  echo "    -l, --lower_bound"
+  echo "        type: integer"
+  echo "        example: -250"
+  echo "        Lower bound of inner distance (bp). This option is used for ploting"
+  echo "        histograme, default=-250."
+  echo ""
+  echo "    -u, --upper_bound"
+  echo "        type: integer"
+  echo "        example: 250"
+  echo "        Upper bound of inner distance (bp). This option is used for ploting"
+  echo "        histograme, default=250."
+  echo ""
+  echo "    -s, --step"
+  echo "        type: integer"
+  echo "        example: 5"
+  echo "        Step size (bp) of histograme. This option is used for plotting"
+  echo "        histogram, default=5."
+  echo ""
+  echo "Output:"
+  echo "    -o, --output_prefix"
+  echo "        type: string, required parameter"
+  echo "        Rrefix of output files."
+  echo ""
+  echo "    --output_stats"
+  echo "        type: file, output, file must exist"
+  echo "        output file (txt) with summary statistics of inner distances of paired"
+  echo "        reads"
+  echo ""
+  echo "    --output_dist"
+  echo "        type: file, output, file must exist"
+  echo "        output file (txt) with inner distances of all paired reads"
+  echo ""
+  echo "    --output_freq"
+  echo "        type: file, output, file must exist"
+  echo "        output file (txt) with frequencies of inner distances of all paired"
+  echo "        reads"
+  echo ""
+  echo "    --output_plot"
+  echo "        type: file, output, file must exist"
+  echo "        output file (pdf) with histogram plot of of inner distances of all"
+  echo "        paired reads"
+  echo ""
+  echo "    --output_plot_r"
+  echo "        type: file, output, file must exist"
+  echo "        output file (R) with script of histogram plot of of inner distances of"
+  echo "        all paired reads"
+}
+
+# initialise variables
+VIASH_MODE='run'
+VIASH_ENGINE_ID='docker'
+
+######## Helper functions for setting up Docker images for viash ########
+# expects: ViashDockerBuild
+
+# ViashDockerInstallationCheck: check whether Docker is installed correctly
+#
+# examples:
+#   ViashDockerInstallationCheck
+function ViashDockerInstallationCheck {
+  ViashDebug "Checking whether Docker is installed"
+  if [ ! command -v docker &> /dev/null ]; then
+    ViashCritical "Docker doesn't seem to be installed. See 'https://docs.docker.com/get-docker/' for instructions."
+    exit 1
+  fi
+
+  ViashDebug "Checking whether the Docker daemon is running"
+  local save=$-; set +e
+  local docker_version=$(docker version --format '{{.Client.APIVersion}}' 2> /dev/null)
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashCritical "Docker daemon does not seem to be running. Try one of the following:"
+    ViashCritical "- Try running 'dockerd' in the command line"
+    ViashCritical "- See https://docs.docker.com/config/daemon/"
+    exit 1
+  fi
+}
+
+# ViashDockerRemoteTagCheck: check whether a Docker image is available 
+# on a remote. Assumes `docker login` has been performed, if relevant.
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerRemoteTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerRemoteTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerRemoteTagCheck {
+  docker manifest inspect $1 > /dev/null 2> /dev/null
+}
+
+# ViashDockerLocalTagCheck: check whether a Docker image is available locally
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   docker pull python:latest
+#   ViashDockerLocalTagCheck python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerLocalTagCheck sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerLocalTagCheck {
+  [ -n "$(docker images -q $1)" ]
+}
+
+# ViashDockerPull: pull a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPull python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPull sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPull {
+  ViashNotice "Checking if Docker image is available at '$1'"
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker pull $1 && return 0 || return 1
+  else
+    local save=$-; set +e
+    docker pull $1 2> /dev/null > /dev/null
+    local out=$?
+    [[ $save =~ e ]] && set -e
+    if [ $out -ne 0 ]; then
+      ViashWarning "Could not pull from '$1'. Docker image doesn't exist or is not accessible."
+    fi
+    return $out
+  fi
+}
+
+# ViashDockerPush: push a Docker image
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# exit code $?        : whether or not the image was found
+# examples:
+#   ViashDockerPush python:latest
+#   echo $?                                     # returns '0'
+#   ViashDockerPush sdaizudceahifu
+#   echo $?                                     # returns '1'
+function ViashDockerPush {
+  ViashNotice "Pushing image to '$1'"
+  local save=$-; set +e
+  local out
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    docker push $1
+    out=$?
+  else
+    docker push $1 2> /dev/null > /dev/null
+    out=$?
+  fi
+  [[ $save =~ e ]] && set -e
+  if [ $out -eq 0 ]; then
+    ViashNotice "Container '$1' push succeeded."
+  else
+    ViashError "Container '$1' push errored. You might not be logged in or have the necessary permissions."
+  fi
+  return $out
+}
+
+# ViashDockerPullElseBuild: pull a Docker image, else build it
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# ViashDockerBuild    : a Bash function which builds a docker image, takes image identifier as argument.
+# examples:
+#   ViashDockerPullElseBuild mynewcomponent
+function ViashDockerPullElseBuild {
+  local save=$-; set +e
+  ViashDockerPull $1
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashDockerBuild $@
+  fi
+}
+
+# ViashDockerSetup: create a Docker image, according to specified docker setup strategy
+#
+# $1          : image identifier with format `[registry/]image[:tag]`
+# $2          : docker setup strategy, see DockerSetupStrategy.scala
+# examples:
+#   ViashDockerSetup mynewcomponent alwaysbuild
+function ViashDockerSetup {
+  local image_id="$1"
+  local setup_strategy="$2"
+  if [ "$setup_strategy" == "alwaysbuild" -o "$setup_strategy" == "build" -o "$setup_strategy" == "b" ]; then
+    ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspull" -o "$setup_strategy" == "pull" -o "$setup_strategy" == "p" ]; then
+    ViashDockerPull $image_id
+  elif [ "$setup_strategy" == "alwayspullelsebuild" -o "$setup_strategy" == "pullelsebuild" ]; then
+    ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayspullelsecachedbuild" -o "$setup_strategy" == "pullelsecachedbuild" ]; then
+    ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [ "$setup_strategy" == "alwayscachedbuild" -o "$setup_strategy" == "cachedbuild" -o "$setup_strategy" == "cb" ]; then
+    ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+  elif [[ "$setup_strategy" =~ ^ifneedbe ]]; then
+    local save=$-; set +e
+    ViashDockerLocalTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashInfo "Image $image_id already exists"
+    elif [ "$setup_strategy" == "ifneedbebuild" ]; then
+      ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbecachedbuild" ]; then
+      ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepull" ]; then
+      ViashDockerPull $image_id
+    elif [ "$setup_strategy" == "ifneedbepullelsebuild" ]; then
+      ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id")
+    elif [ "$setup_strategy" == "ifneedbepullelsecachedbuild" ]; then
+      ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id")
+    else
+      ViashError "Unrecognised Docker strategy: $setup_strategy"
+      exit 1
+    fi
+  elif [ "$setup_strategy" == "push" -o "$setup_strategy" == "forcepush" -o "$setup_strategy" == "alwayspush" ]; then
+    ViashDockerPush "$image_id"
+  elif [ "$setup_strategy" == "pushifnotpresent" -o "$setup_strategy" == "gentlepush" -o "$setup_strategy" == "maybepush" ]; then
+    local save=$-; set +e
+    ViashDockerRemoteTagCheck $image_id
+    local outCheck=$?
+    [[ $save =~ e ]] && set -e
+    if [ $outCheck -eq 0 ]; then
+      ViashNotice "Container '$image_id' exists, doing nothing."
+    else
+      ViashNotice "Container '$image_id' does not yet exist."
+      ViashDockerPush "$image_id"
+    fi
+  elif [ "$setup_strategy" == "donothing" -o "$setup_strategy" == "meh" ]; then
+    ViashNotice "Skipping setup."
+  else
+    ViashError "Unrecognised Docker strategy: $setup_strategy"
+    exit 1
+  fi
+}
+
+# ViashDockerCheckCommands: Check whether a docker container has the required commands
+#
+# $1                  : image identifier with format `[registry/]image[:tag]`
+# $@                  : commands to verify being present
+# examples:
+#   ViashDockerCheckCommands bash:4.0 bash ps foo
+function ViashDockerCheckCommands {
+  local image_id="$1"
+  shift 1
+  local commands="$@"
+  local save=$-; set +e
+  local missing # mark 'missing' as local in advance, otherwise the exit code of the command will be missing and always be '0'
+  missing=$(docker run --rm --entrypoint=sh "$image_id" -c "for command in $commands; do command -v \$command >/dev/null 2>&1; if [ \$? -ne 0 ]; then echo \$command; exit 1; fi; done")
+  local outCheck=$?
+  [[ $save =~ e ]] && set -e
+  if [ $outCheck -ne 0 ]; then
+  	ViashError "Docker container '$image_id' does not contain command '$missing'."
+  	exit 1
+  fi
+}
+
+# ViashDockerBuild: build a docker image
+# $1                               : image identifier with format `[registry/]image[:tag]`
+# $...                             : additional arguments to pass to docker build
+# $VIASH_META_TEMP_DIR             : temporary directory to store dockerfile & optional resources in
+# $VIASH_META_NAME                 : name of the component
+# $VIASH_META_RESOURCES_DIR        : directory containing the resources
+# $VIASH_VERBOSITY                 : verbosity level
+# exit code $?                     : whether or not the image was built successfully
+function ViashDockerBuild {
+  local image_id="$1"
+  shift 1
+
+  # create temporary directory to store dockerfile & optional resources in
+  local tmpdir=$(mktemp -d "$VIASH_META_TEMP_DIR/dockerbuild-$VIASH_META_NAME-XXXXXX")
+  local dockerfile="$tmpdir/Dockerfile"
+  function clean_up {
+    rm -rf "$tmpdir"
+  }
+  trap clean_up EXIT
+
+  # store dockerfile and resources
+  ViashDockerfile "$VIASH_ENGINE_ID" > "$dockerfile"
+
+  # generate the build command
+  local docker_build_cmd="docker build -t '$image_id' $@ '$VIASH_META_RESOURCES_DIR' -f '$dockerfile'"
+
+  # build the container
+  ViashNotice "Building container '$image_id' with Dockerfile"
+  ViashInfo "$docker_build_cmd"
+  local save=$-; set +e
+  if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then
+    eval $docker_build_cmd
+  else
+    eval $docker_build_cmd &> "$tmpdir/docker_build.log"
+  fi
+
+  # check exit code
+  local out=$?
+  [[ $save =~ e ]] && set -e
+  if [ $out -ne 0 ]; then
+    ViashError "Error occurred while building container '$image_id'"
+    if [ $VIASH_VERBOSITY -lt $VIASH_LOGCODE_INFO ]; then
+      ViashError "Transcript: --------------------------------"
+      cat "$tmpdir/docker_build.log"
+      ViashError "End of transcript --------------------------"
+    fi
+    exit 1
+  fi
+}
+
+######## End of helper functions for setting up Docker images for viash ########
+
+# ViashDockerFile: print the dockerfile to stdout
+# $1    : engine identifier
+# return : dockerfile required to run this component
+# examples:
+#   ViashDockerFile
+function ViashDockerfile {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    cat << 'VIASHDOCKER'
+FROM python:3.10
+ENTRYPOINT []
+RUN apt-get update && \
+  DEBIAN_FRONTEND=noninteractive apt-get install -y r-base && \
+  rm -rf /var/lib/apt/lists/*
+
+RUN pip install --upgrade pip && \
+  pip install --upgrade --no-cache-dir "RSeQC"
+
+RUN echo "RSeQC - inner_distance.py: $(inner_distance.py --version | cut -d' ' -f2)" > /var/software_versions.txt
+
+LABEL org.opencontainers.image.authors="Emma Rousseau"
+LABEL org.opencontainers.image.description="Companion container for running component rseqc rseqc_inner_distance"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:06Z"
+LABEL org.opencontainers.image.source="https://github.com/MonashBioinformaticsPlatform/RSeQC"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+LABEL org.opencontainers.image.version="main"
+
+VIASHDOCKER
+  fi
+}
+
+# ViashDockerBuildArgs: return the arguments to pass to docker build
+# $1    : engine identifier
+# return : arguments to pass to docker build
+function ViashDockerBuildArgs {
+  local engine_id="$1"
+
+  if [[ "$engine_id" == "docker" ]]; then
+    echo ""
+  fi
+}
+
+# ViashAbsolutePath: generate absolute path from relative path
+# borrowed from https://stackoverflow.com/a/21951256
+# $1     : relative filename
+# return : absolute path
+# examples:
+#   ViashAbsolutePath some_file.txt   # returns /path/to/some_file.txt
+#   ViashAbsolutePath /foo/bar/..     # returns /foo
+function ViashAbsolutePath {
+  local thePath
+  local parr
+  local outp
+  local len
+  if [[ ! "$1" =~ ^/ ]]; then
+    thePath="$PWD/$1"
+  else
+    thePath="$1"
+  fi
+  echo "$thePath" | (
+    IFS=/
+    read -a parr
+    declare -a outp
+    for i in "${parr[@]}"; do
+      case "$i" in
+      ''|.) continue ;;
+      ..)
+        len=${#outp[@]}
+        if ((len==0)); then
+          continue
+        else
+          unset outp[$((len-1))]
+        fi
+        ;;
+      *)
+        len=${#outp[@]}
+        outp[$len]="$i"
+      ;;
+      esac
+    done
+    echo /"${outp[*]}"
+  )
+}
+# ViashDockerAutodetectMount: auto configuring docker mounts from parameters
+# $1                             : The parameter value
+# returns                        : New parameter
+# $VIASH_DIRECTORY_MOUNTS        : Added another parameter to be passed to docker
+# $VIASH_DOCKER_AUTOMOUNT_PREFIX : The prefix to be used for the automounts
+# examples:
+#   ViashDockerAutodetectMount /path/to/bar      # returns '/viash_automount/path/to/bar'
+#   ViashDockerAutodetectMountArg /path/to/bar   # returns '--volume="/path/to:/viash_automount/path/to"'
+function ViashDockerAutodetectMount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  if [ -z "$base_name" ]; then
+    echo "$mount_target"
+  else
+    echo "$mount_target/$base_name"
+  fi
+}
+function ViashDockerAutodetectMountArg {
+  local abs_path=$(ViashAbsolutePath "$1")
+  local mount_source
+  local base_name
+  if [ -d "$abs_path" ]; then
+    mount_source="$abs_path"
+    base_name=""
+  else
+    mount_source=`dirname "$abs_path"`
+    base_name=`basename "$abs_path"`
+  fi
+  local mount_target="$VIASH_DOCKER_AUTOMOUNT_PREFIX$mount_source"
+  ViashDebug "ViashDockerAutodetectMountArg $1 -> $mount_source -> $mount_target"
+  echo "--volume=\"$mount_source:$mount_target\""
+}
+function ViashDockerStripAutomount {
+  local abs_path=$(ViashAbsolutePath "$1")
+  echo "${abs_path#$VIASH_DOCKER_AUTOMOUNT_PREFIX}"
+}
+# initialise variables
+VIASH_DIRECTORY_MOUNTS=()
+
+# configure default docker automount prefix if it is unset
+if [ -z "${VIASH_DOCKER_AUTOMOUNT_PREFIX+x}" ]; then
+  VIASH_DOCKER_AUTOMOUNT_PREFIX="/viash_automount"
+fi
+
+# initialise docker variables
+VIASH_DOCKER_RUN_ARGS=(-i --rm)
+
+# initialise array
+VIASH_POSITIONAL_ARGS=''
+
+while [[ $# -gt 0 ]]; do
+    case "$1" in
+        -h|--help)
+            ViashHelp
+            exit
+            ;;
+        ---v|---verbose)
+            let "VIASH_VERBOSITY=VIASH_VERBOSITY+1"
+            shift 1
+            ;;
+        ---verbosity)
+            VIASH_VERBOSITY="$2"
+            shift 2
+            ;;
+        ---verbosity=*)
+            VIASH_VERBOSITY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        --version)
+            echo "rseqc_inner_distance main"
+            exit
+            ;;
+        --input_file)
+            [ -n "$VIASH_PAR_INPUT_FILE" ] && ViashError Bad arguments for option \'--input_file\': \'$VIASH_PAR_INPUT_FILE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT_FILE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --input_file. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --input_file=*)
+            [ -n "$VIASH_PAR_INPUT_FILE" ] && ViashError Bad arguments for option \'--input_file=*\': \'$VIASH_PAR_INPUT_FILE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT_FILE=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -i)
+            [ -n "$VIASH_PAR_INPUT_FILE" ] && ViashError Bad arguments for option \'-i\': \'$VIASH_PAR_INPUT_FILE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_INPUT_FILE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -i. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --refgene)
+            [ -n "$VIASH_PAR_REFGENE" ] && ViashError Bad arguments for option \'--refgene\': \'$VIASH_PAR_REFGENE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_REFGENE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --refgene. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --refgene=*)
+            [ -n "$VIASH_PAR_REFGENE" ] && ViashError Bad arguments for option \'--refgene=*\': \'$VIASH_PAR_REFGENE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_REFGENE=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -r)
+            [ -n "$VIASH_PAR_REFGENE" ] && ViashError Bad arguments for option \'-r\': \'$VIASH_PAR_REFGENE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_REFGENE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -r. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --sample_size)
+            [ -n "$VIASH_PAR_SAMPLE_SIZE" ] && ViashError Bad arguments for option \'--sample_size\': \'$VIASH_PAR_SAMPLE_SIZE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_SAMPLE_SIZE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --sample_size. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --sample_size=*)
+            [ -n "$VIASH_PAR_SAMPLE_SIZE" ] && ViashError Bad arguments for option \'--sample_size=*\': \'$VIASH_PAR_SAMPLE_SIZE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_SAMPLE_SIZE=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -k)
+            [ -n "$VIASH_PAR_SAMPLE_SIZE" ] && ViashError Bad arguments for option \'-k\': \'$VIASH_PAR_SAMPLE_SIZE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_SAMPLE_SIZE="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -k. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --mapq)
+            [ -n "$VIASH_PAR_MAPQ" ] && ViashError Bad arguments for option \'--mapq\': \'$VIASH_PAR_MAPQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MAPQ="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --mapq. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --mapq=*)
+            [ -n "$VIASH_PAR_MAPQ" ] && ViashError Bad arguments for option \'--mapq=*\': \'$VIASH_PAR_MAPQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MAPQ=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -q)
+            [ -n "$VIASH_PAR_MAPQ" ] && ViashError Bad arguments for option \'-q\': \'$VIASH_PAR_MAPQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_MAPQ="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -q. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --lower_bound)
+            [ -n "$VIASH_PAR_LOWER_BOUND" ] && ViashError Bad arguments for option \'--lower_bound\': \'$VIASH_PAR_LOWER_BOUND\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_LOWER_BOUND="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --lower_bound. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --lower_bound=*)
+            [ -n "$VIASH_PAR_LOWER_BOUND" ] && ViashError Bad arguments for option \'--lower_bound=*\': \'$VIASH_PAR_LOWER_BOUND\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_LOWER_BOUND=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -l)
+            [ -n "$VIASH_PAR_LOWER_BOUND" ] && ViashError Bad arguments for option \'-l\': \'$VIASH_PAR_LOWER_BOUND\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_LOWER_BOUND="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -l. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --upper_bound)
+            [ -n "$VIASH_PAR_UPPER_BOUND" ] && ViashError Bad arguments for option \'--upper_bound\': \'$VIASH_PAR_UPPER_BOUND\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_UPPER_BOUND="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --upper_bound. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --upper_bound=*)
+            [ -n "$VIASH_PAR_UPPER_BOUND" ] && ViashError Bad arguments for option \'--upper_bound=*\': \'$VIASH_PAR_UPPER_BOUND\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_UPPER_BOUND=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -u)
+            [ -n "$VIASH_PAR_UPPER_BOUND" ] && ViashError Bad arguments for option \'-u\': \'$VIASH_PAR_UPPER_BOUND\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_UPPER_BOUND="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -u. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --step)
+            [ -n "$VIASH_PAR_STEP" ] && ViashError Bad arguments for option \'--step\': \'$VIASH_PAR_STEP\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_STEP="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --step. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --step=*)
+            [ -n "$VIASH_PAR_STEP" ] && ViashError Bad arguments for option \'--step=*\': \'$VIASH_PAR_STEP\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_STEP=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -s)
+            [ -n "$VIASH_PAR_STEP" ] && ViashError Bad arguments for option \'-s\': \'$VIASH_PAR_STEP\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_STEP="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -s. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output_prefix)
+            [ -n "$VIASH_PAR_OUTPUT_PREFIX" ] && ViashError Bad arguments for option \'--output_prefix\': \'$VIASH_PAR_OUTPUT_PREFIX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_PREFIX="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output_prefix. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output_prefix=*)
+            [ -n "$VIASH_PAR_OUTPUT_PREFIX" ] && ViashError Bad arguments for option \'--output_prefix=*\': \'$VIASH_PAR_OUTPUT_PREFIX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_PREFIX=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        -o)
+            [ -n "$VIASH_PAR_OUTPUT_PREFIX" ] && ViashError Bad arguments for option \'-o\': \'$VIASH_PAR_OUTPUT_PREFIX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_PREFIX="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to -o. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output_stats)
+            [ -n "$VIASH_PAR_OUTPUT_STATS" ] && ViashError Bad arguments for option \'--output_stats\': \'$VIASH_PAR_OUTPUT_STATS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_STATS="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output_stats. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output_stats=*)
+            [ -n "$VIASH_PAR_OUTPUT_STATS" ] && ViashError Bad arguments for option \'--output_stats=*\': \'$VIASH_PAR_OUTPUT_STATS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_STATS=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        --output_dist)
+            [ -n "$VIASH_PAR_OUTPUT_DIST" ] && ViashError Bad arguments for option \'--output_dist\': \'$VIASH_PAR_OUTPUT_DIST\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_DIST="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output_dist. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output_dist=*)
+            [ -n "$VIASH_PAR_OUTPUT_DIST" ] && ViashError Bad arguments for option \'--output_dist=*\': \'$VIASH_PAR_OUTPUT_DIST\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_DIST=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        --output_freq)
+            [ -n "$VIASH_PAR_OUTPUT_FREQ" ] && ViashError Bad arguments for option \'--output_freq\': \'$VIASH_PAR_OUTPUT_FREQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_FREQ="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output_freq. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output_freq=*)
+            [ -n "$VIASH_PAR_OUTPUT_FREQ" ] && ViashError Bad arguments for option \'--output_freq=*\': \'$VIASH_PAR_OUTPUT_FREQ\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_FREQ=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        --output_plot)
+            [ -n "$VIASH_PAR_OUTPUT_PLOT" ] && ViashError Bad arguments for option \'--output_plot\': \'$VIASH_PAR_OUTPUT_PLOT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_PLOT="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output_plot. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output_plot=*)
+            [ -n "$VIASH_PAR_OUTPUT_PLOT" ] && ViashError Bad arguments for option \'--output_plot=*\': \'$VIASH_PAR_OUTPUT_PLOT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_PLOT=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        --output_plot_r)
+            [ -n "$VIASH_PAR_OUTPUT_PLOT_R" ] && ViashError Bad arguments for option \'--output_plot_r\': \'$VIASH_PAR_OUTPUT_PLOT_R\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_PLOT_R="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to --output_plot_r. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        --output_plot_r=*)
+            [ -n "$VIASH_PAR_OUTPUT_PLOT_R" ] && ViashError Bad arguments for option \'--output_plot_r=*\': \'$VIASH_PAR_OUTPUT_PLOT_R\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_PAR_OUTPUT_PLOT_R=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        ---engine)
+            VIASH_ENGINE_ID="$2"
+            shift 2
+            ;;
+        ---engine=*)
+            VIASH_ENGINE_ID="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---setup)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$2"
+            shift 2
+            ;;
+        ---setup=*)
+            VIASH_MODE='setup'
+            VIASH_SETUP_STRATEGY="$(ViashRemoveFlags "$1")"
+            shift 1
+            ;;
+        ---dockerfile)
+            VIASH_MODE='dockerfile'
+            shift 1
+            ;;
+        ---docker_run_args)
+            VIASH_DOCKER_RUN_ARGS+=("$2")
+            shift 2
+            ;;
+        ---docker_run_args=*)
+            VIASH_DOCKER_RUN_ARGS+=("$(ViashRemoveFlags "$1")")
+            shift 1
+            ;;
+        ---docker_image_id)
+            VIASH_MODE='docker_image_id'
+            shift 1
+            ;;
+        ---debug)
+            VIASH_MODE='debug'
+            shift 1
+            ;;
+        ---cpus)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---cpus. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---cpus=*)
+            [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus=*\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_CPUS=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        ---memory)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY="$2"
+            [ $# -lt 2 ] && ViashError Not enough arguments passed to ---memory. Use "--help" to get more information on the parameters. && exit 1
+            shift 2
+            ;;
+        ---memory=*)
+            [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory=*\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
+            VIASH_META_MEMORY=$(ViashRemoveFlags "$1")
+            shift 1
+            ;;
+        *)  # positional arg or unknown option
+            # since the positional args will be eval'd, can we always quote, instead of using ViashQuote
+            VIASH_POSITIONAL_ARGS="$VIASH_POSITIONAL_ARGS '$1'"
+            [[ $1 == -* ]] && ViashWarning $1 looks like a parameter but is not a defined parameter and will instead be treated as a positional argument. Use "--help" to get more information on the parameters.
+            shift # past argument
+            ;;
+    esac
+done
+
+# parse positional parameters
+eval set -- $VIASH_POSITIONAL_ARGS
+
+
+if   [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  VIASH_ENGINE_TYPE='native'
+elif   [ "$VIASH_ENGINE_ID" == "docker" ]  ; then
+  VIASH_ENGINE_TYPE='docker'
+else
+  ViashError "Engine '$VIASH_ENGINE_ID' is not recognized. Options are: docker, native."
+  exit 1
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # check if docker is installed properly
+  ViashDockerInstallationCheck
+
+  # determine docker image id
+  if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
+    VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/rseqc/rseqc_inner_distance:main'
+  fi
+
+  # print dockerfile
+  if [ "$VIASH_MODE" == "dockerfile" ]; then
+    ViashDockerfile "$VIASH_ENGINE_ID"
+    exit 0
+
+  elif [ "$VIASH_MODE" == "docker_image_id" ]; then
+    echo "$VIASH_DOCKER_IMAGE_ID"
+    exit 0
+  
+  # enter docker container
+  elif [[ "$VIASH_MODE" == "debug" ]]; then
+    VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} -v '$(pwd)':/pwd --workdir /pwd -t $VIASH_DOCKER_IMAGE_ID"
+    ViashNotice "+ $VIASH_CMD"
+    eval $VIASH_CMD
+    exit 
+
+  # build docker image
+  elif [ "$VIASH_MODE" == "setup" ]; then
+    ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" "$VIASH_SETUP_STRATEGY"
+    ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+    exit 0
+  fi
+
+  # check if docker image exists
+  ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" ifneedbepullelsecachedbuild
+  ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash'
+fi
+
+# setting computational defaults
+
+# helper function for parsing memory strings
+function ViashMemoryAsBytes {
+  local memory=`echo "$1" | tr '[:upper:]' '[:lower:]' | tr -d '[:space:]'`
+  local memory_regex='^([0-9]+)([kmgtp]i?b?|b)$'
+  if [[ $memory =~ $memory_regex ]]; then
+    local number=${memory/[^0-9]*/}
+    local symbol=${memory/*[0-9]/}
+    
+    case $symbol in
+      b)      memory_b=$number ;;
+      kb|k)   memory_b=$(( $number * 1000 )) ;;
+      mb|m)   memory_b=$(( $number * 1000 * 1000 )) ;;
+      gb|g)   memory_b=$(( $number * 1000 * 1000 * 1000 )) ;;
+      tb|t)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 )) ;;
+      pb|p)   memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 * 1000 )) ;;
+      kib|ki)   memory_b=$(( $number * 1024 )) ;;
+      mib|mi)   memory_b=$(( $number * 1024 * 1024 )) ;;
+      gib|gi)   memory_b=$(( $number * 1024 * 1024 * 1024 )) ;;
+      tib|ti)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 )) ;;
+      pib|pi)   memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 * 1024 )) ;;
+    esac
+    echo "$memory_b"
+  fi
+}
+# compute memory in different units
+if [ ! -z ${VIASH_META_MEMORY+x} ]; then
+  VIASH_META_MEMORY_B=`ViashMemoryAsBytes $VIASH_META_MEMORY`
+  # do not define other variables if memory_b is an empty string
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_META_MEMORY_KB=$(( ($VIASH_META_MEMORY_B+999) / 1000 ))
+    VIASH_META_MEMORY_MB=$(( ($VIASH_META_MEMORY_KB+999) / 1000 ))
+    VIASH_META_MEMORY_GB=$(( ($VIASH_META_MEMORY_MB+999) / 1000 ))
+    VIASH_META_MEMORY_TB=$(( ($VIASH_META_MEMORY_GB+999) / 1000 ))
+    VIASH_META_MEMORY_PB=$(( ($VIASH_META_MEMORY_TB+999) / 1000 ))
+    VIASH_META_MEMORY_KIB=$(( ($VIASH_META_MEMORY_B+1023) / 1024 ))
+    VIASH_META_MEMORY_MIB=$(( ($VIASH_META_MEMORY_KIB+1023) / 1024 ))
+    VIASH_META_MEMORY_GIB=$(( ($VIASH_META_MEMORY_MIB+1023) / 1024 ))
+    VIASH_META_MEMORY_TIB=$(( ($VIASH_META_MEMORY_GIB+1023) / 1024 ))
+    VIASH_META_MEMORY_PIB=$(( ($VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  else
+    # unset memory if string is empty
+    unset $VIASH_META_MEMORY_B
+  fi
+fi
+# unset nproc if string is empty
+if [ -z "$VIASH_META_CPUS" ]; then
+  unset $VIASH_META_CPUS
+fi
+
+
+# check whether required parameters exist
+if [ -z ${VIASH_PAR_INPUT_FILE+x} ]; then
+  ViashError '--input_file' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_PAR_REFGENE+x} ]; then
+  ViashError '--refgene' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_PAR_OUTPUT_PREFIX+x} ]; then
+  ViashError '--output_prefix' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_NAME+x} ]; then
+  ViashError 'name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then
+  ViashError 'functionality_name' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_RESOURCES_DIR+x} ]; then
+  ViashError 'resources_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_EXECUTABLE+x} ]; then
+  ViashError 'executable' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_CONFIG+x} ]; then
+  ViashError 'config' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+if [ -z ${VIASH_META_TEMP_DIR+x} ]; then
+  ViashError 'temp_dir' is a required argument. Use "--help" to get more information on the parameters.
+  exit 1
+fi
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_INPUT_FILE" ] && [ ! -e "$VIASH_PAR_INPUT_FILE" ]; then
+  ViashError "Input file '$VIASH_PAR_INPUT_FILE' does not exist."
+  exit 1
+fi
+if [ ! -z "$VIASH_PAR_REFGENE" ] && [ ! -e "$VIASH_PAR_REFGENE" ]; then
+  ViashError "Input file '$VIASH_PAR_REFGENE' does not exist."
+  exit 1
+fi
+
+# check whether parameters values are of the right type
+if [[ -n "$VIASH_PAR_SAMPLE_SIZE" ]]; then
+  if ! [[ "$VIASH_PAR_SAMPLE_SIZE" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError '--sample_size' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_MAPQ" ]]; then
+  if ! [[ "$VIASH_PAR_MAPQ" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError '--mapq' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_LOWER_BOUND" ]]; then
+  if ! [[ "$VIASH_PAR_LOWER_BOUND" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError '--lower_bound' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_UPPER_BOUND" ]]; then
+  if ! [[ "$VIASH_PAR_UPPER_BOUND" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError '--upper_bound' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_PAR_STEP" ]]; then
+  if ! [[ "$VIASH_PAR_STEP" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError '--step' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_CPUS" ]]; then
+  if ! [[ "$VIASH_META_CPUS" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'cpus' has to be an integer. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_B" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_B" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_b' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pb' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_KIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_KIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_kib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_MIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_MIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_mib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_GIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_GIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_gib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_TIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_TIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_tib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+if [[ -n "$VIASH_META_MEMORY_PIB" ]]; then
+  if ! [[ "$VIASH_META_MEMORY_PIB" =~ ^[-+]?[0-9]+$ ]]; then
+    ViashError 'memory_pib' has to be a long. Use "--help" to get more information on the parameters.
+    exit 1
+  fi
+fi
+
+# create parent directories of output files, if so desired
+if [ ! -z "$VIASH_PAR_OUTPUT_STATS" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT_STATS")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT_STATS")"
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_DIST" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT_DIST")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT_DIST")"
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_FREQ" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT_FREQ")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT_FREQ")"
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_PLOT" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT_PLOT")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT_PLOT")"
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_PLOT_R" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT_PLOT_R")" ]; then
+  mkdir -p "$(dirname "$VIASH_PAR_OUTPUT_PLOT_R")"
+fi
+
+if  [ "$VIASH_ENGINE_ID" == "native" ]  ; then
+  if [ "$VIASH_MODE" == "run" ]; then
+    VIASH_CMD="bash"
+  else
+    ViashError "Engine '$VIASH_ENGINE_ID' does not support mode '$VIASH_MODE'."
+    exit 1
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # detect volumes from file arguments
+  VIASH_CHOWN_VARS=()
+if [ ! -z "$VIASH_PAR_INPUT_FILE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_INPUT_FILE")" )
+  VIASH_PAR_INPUT_FILE=$(ViashDockerAutodetectMount "$VIASH_PAR_INPUT_FILE")
+fi
+if [ ! -z "$VIASH_PAR_REFGENE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_REFGENE")" )
+  VIASH_PAR_REFGENE=$(ViashDockerAutodetectMount "$VIASH_PAR_REFGENE")
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_STATS" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT_STATS")" )
+  VIASH_PAR_OUTPUT_STATS=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT_STATS")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT_STATS" )
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_DIST" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT_DIST")" )
+  VIASH_PAR_OUTPUT_DIST=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT_DIST")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT_DIST" )
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_FREQ" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT_FREQ")" )
+  VIASH_PAR_OUTPUT_FREQ=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT_FREQ")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT_FREQ" )
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_PLOT" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT_PLOT")" )
+  VIASH_PAR_OUTPUT_PLOT=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT_PLOT")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT_PLOT" )
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_PLOT_R" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT_PLOT_R")" )
+  VIASH_PAR_OUTPUT_PLOT_R=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT_PLOT_R")
+  VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT_PLOT_R" )
+fi
+if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" )
+  VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR")
+fi
+if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_EXECUTABLE")" )
+  VIASH_META_EXECUTABLE=$(ViashDockerAutodetectMount "$VIASH_META_EXECUTABLE")
+fi
+if [ ! -z "$VIASH_META_CONFIG" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_CONFIG")" )
+  VIASH_META_CONFIG=$(ViashDockerAutodetectMount "$VIASH_META_CONFIG")
+fi
+if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+  VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_TEMP_DIR")" )
+  VIASH_META_TEMP_DIR=$(ViashDockerAutodetectMount "$VIASH_META_TEMP_DIR")
+fi
+  
+  # get unique mounts
+  VIASH_UNIQUE_MOUNTS=($(for val in "${VIASH_DIRECTORY_MOUNTS[@]}"; do echo "$val"; done | sort -u))
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # change file ownership
+  function ViashPerformChown {
+    if (( ${#VIASH_CHOWN_VARS[@]} )); then
+      set +e
+      VIASH_CMD="docker run --entrypoint=bash --rm ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID -c 'chown $(id -u):$(id -g) --silent --recursive ${VIASH_CHOWN_VARS[@]}'"
+      ViashDebug "+ $VIASH_CMD"
+      eval $VIASH_CMD
+      set -e
+    fi
+  }
+  trap ViashPerformChown EXIT
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # helper function for filling in extra docker args
+  if [ ! -z "$VIASH_META_MEMORY_B" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--memory=${VIASH_META_MEMORY_B}")
+  fi
+  if [ ! -z "$VIASH_META_CPUS" ]; then
+    VIASH_DOCKER_RUN_ARGS+=("--cpus=${VIASH_META_CPUS}")
+  fi
+fi
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID"
+fi
+
+
+# set dependency paths
+
+
+ViashDebug "Running command: $(echo $VIASH_CMD)"
+cat << VIASHEOF | eval $VIASH_CMD
+set -e
+tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-rseqc_inner_distance-XXXXXX").sh
+function clean_up {
+  rm "\$tempscript"
+}
+function interrupt {
+  echo -e "\nCTRL-C Pressed..."
+  exit 1
+}
+trap clean_up EXIT
+trap interrupt INT SIGINT
+cat > "\$tempscript" << 'VIASHMAIN'
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_INPUT_FILE+x} ]; then echo "${VIASH_PAR_INPUT_FILE}" | sed "s#'#'\"'\"'#g;s#.*#par_input_file='&'#" ; else echo "# par_input_file="; fi )
+$( if [ ! -z ${VIASH_PAR_REFGENE+x} ]; then echo "${VIASH_PAR_REFGENE}" | sed "s#'#'\"'\"'#g;s#.*#par_refgene='&'#" ; else echo "# par_refgene="; fi )
+$( if [ ! -z ${VIASH_PAR_SAMPLE_SIZE+x} ]; then echo "${VIASH_PAR_SAMPLE_SIZE}" | sed "s#'#'\"'\"'#g;s#.*#par_sample_size='&'#" ; else echo "# par_sample_size="; fi )
+$( if [ ! -z ${VIASH_PAR_MAPQ+x} ]; then echo "${VIASH_PAR_MAPQ}" | sed "s#'#'\"'\"'#g;s#.*#par_mapq='&'#" ; else echo "# par_mapq="; fi )
+$( if [ ! -z ${VIASH_PAR_LOWER_BOUND+x} ]; then echo "${VIASH_PAR_LOWER_BOUND}" | sed "s#'#'\"'\"'#g;s#.*#par_lower_bound='&'#" ; else echo "# par_lower_bound="; fi )
+$( if [ ! -z ${VIASH_PAR_UPPER_BOUND+x} ]; then echo "${VIASH_PAR_UPPER_BOUND}" | sed "s#'#'\"'\"'#g;s#.*#par_upper_bound='&'#" ; else echo "# par_upper_bound="; fi )
+$( if [ ! -z ${VIASH_PAR_STEP+x} ]; then echo "${VIASH_PAR_STEP}" | sed "s#'#'\"'\"'#g;s#.*#par_step='&'#" ; else echo "# par_step="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_PREFIX+x} ]; then echo "${VIASH_PAR_OUTPUT_PREFIX}" | sed "s#'#'\"'\"'#g;s#.*#par_output_prefix='&'#" ; else echo "# par_output_prefix="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_STATS+x} ]; then echo "${VIASH_PAR_OUTPUT_STATS}" | sed "s#'#'\"'\"'#g;s#.*#par_output_stats='&'#" ; else echo "# par_output_stats="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_DIST+x} ]; then echo "${VIASH_PAR_OUTPUT_DIST}" | sed "s#'#'\"'\"'#g;s#.*#par_output_dist='&'#" ; else echo "# par_output_dist="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_FREQ+x} ]; then echo "${VIASH_PAR_OUTPUT_FREQ}" | sed "s#'#'\"'\"'#g;s#.*#par_output_freq='&'#" ; else echo "# par_output_freq="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_PLOT+x} ]; then echo "${VIASH_PAR_OUTPUT_PLOT}" | sed "s#'#'\"'\"'#g;s#.*#par_output_plot='&'#" ; else echo "# par_output_plot="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_PLOT_R+x} ]; then echo "${VIASH_PAR_OUTPUT_PLOT_R}" | sed "s#'#'\"'\"'#g;s#.*#par_output_plot_r='&'#" ; else echo "# par_output_plot_r="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\"'\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\"'\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+#!/bin/bash
+
+set -exo pipefail 
+
+
+inner_distance.py \\
+    -i \$par_input_file \\
+    -r \$par_refgene \\
+    -o \$par_output_prefix \\
+    \${par_sample_size:+-k "\${par_sample_size}"} \\
+    \${par_lower_bound:+-l "\${par_lower_bound}"} \\
+    \${par_upper_bound:+-u "\${par_upper_bound}"} \\
+    \${par_step:+-s "\${par_step}"} \\
+    \${par_mapq:+-q "\${par_mapq}"} \\
+> stdout.txt
+
+if [[ -n \$par_output_stats ]]; then head -n 2 stdout.txt > \$par_output_stats; fi
+
+
+[[ -n "\$par_output_dist" && -f "\$par_output_prefix.inner_distance.txt" ]] && mv \$par_output_prefix.inner_distance.txt \$par_output_dist
+[[ -n "\$par_output_plot" && -f "\$par_output_prefix.inner_distance_plot.pdf" ]] && mv \$par_output_prefix.inner_distance_plot.pdf \$par_output_plot
+[[ -n "\$par_output_plot_r" && -f "\$par_output_prefix.inner_distance_plot.r" ]] && mv \$par_output_prefix.inner_distance_plot.r \$par_output_plot_r
+[[ -n "\$par_output_freq" && -f "\$par_output_prefix.inner_distance_freq.txt" ]] && mv \$par_output_prefix.inner_distance_freq.txt \$par_output_freq
+
+exit 0
+VIASHMAIN
+bash "\$tempscript" &
+wait "\$!"
+
+VIASHEOF
+
+
+if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
+  # strip viash automount from file paths
+  
+  if [ ! -z "$VIASH_PAR_INPUT_FILE" ]; then
+    VIASH_PAR_INPUT_FILE=$(ViashDockerStripAutomount "$VIASH_PAR_INPUT_FILE")
+  fi
+  if [ ! -z "$VIASH_PAR_REFGENE" ]; then
+    VIASH_PAR_REFGENE=$(ViashDockerStripAutomount "$VIASH_PAR_REFGENE")
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT_STATS" ]; then
+    VIASH_PAR_OUTPUT_STATS=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT_STATS")
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT_DIST" ]; then
+    VIASH_PAR_OUTPUT_DIST=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT_DIST")
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT_FREQ" ]; then
+    VIASH_PAR_OUTPUT_FREQ=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT_FREQ")
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT_PLOT" ]; then
+    VIASH_PAR_OUTPUT_PLOT=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT_PLOT")
+  fi
+  if [ ! -z "$VIASH_PAR_OUTPUT_PLOT_R" ]; then
+    VIASH_PAR_OUTPUT_PLOT_R=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT_PLOT_R")
+  fi
+  if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
+    VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR")
+  fi
+  if [ ! -z "$VIASH_META_EXECUTABLE" ]; then
+    VIASH_META_EXECUTABLE=$(ViashDockerStripAutomount "$VIASH_META_EXECUTABLE")
+  fi
+  if [ ! -z "$VIASH_META_CONFIG" ]; then
+    VIASH_META_CONFIG=$(ViashDockerStripAutomount "$VIASH_META_CONFIG")
+  fi
+  if [ ! -z "$VIASH_META_TEMP_DIR" ]; then
+    VIASH_META_TEMP_DIR=$(ViashDockerStripAutomount "$VIASH_META_TEMP_DIR")
+  fi
+fi
+
+
+# check whether required files exist
+if [ ! -z "$VIASH_PAR_OUTPUT_STATS" ] && [ ! -e "$VIASH_PAR_OUTPUT_STATS" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT_STATS' does not exist."
+  exit 1
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_DIST" ] && [ ! -e "$VIASH_PAR_OUTPUT_DIST" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT_DIST' does not exist."
+  exit 1
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_FREQ" ] && [ ! -e "$VIASH_PAR_OUTPUT_FREQ" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT_FREQ' does not exist."
+  exit 1
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_PLOT" ] && [ ! -e "$VIASH_PAR_OUTPUT_PLOT" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT_PLOT' does not exist."
+  exit 1
+fi
+if [ ! -z "$VIASH_PAR_OUTPUT_PLOT_R" ] && [ ! -e "$VIASH_PAR_OUTPUT_PLOT_R" ]; then
+  ViashError "Output file '$VIASH_PAR_OUTPUT_PLOT_R' does not exist."
+  exit 1
+fi
+
+
+exit 0
diff --git a/target/executable/salmon/salmon_index/.config.vsh.yaml b/target/executable/salmon/salmon_index/.config.vsh.yaml
index 7712414d..d4ff9c33 100644
--- a/target/executable/salmon/salmon_index/.config.vsh.yaml
+++ b/target/executable/salmon/salmon_index/.config.vsh.yaml
@@ -277,9 +277,9 @@ build_info:
   output: "target/executable/salmon/salmon_index"
   executable: "target/executable/salmon/salmon_index/salmon_index"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/salmon/salmon_index/salmon_index b/target/executable/salmon/salmon_index/salmon_index
index d3202ec5..8ff5c23c 100755
--- a/target/executable/salmon/salmon_index/salmon_index
+++ b/target/executable/salmon/salmon_index/salmon_index
@@ -546,9 +546,9 @@ RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/softwar
 
 LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
 LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_index"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:17Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:05Z"
 LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/salmon/salmon_quant/.config.vsh.yaml b/target/executable/salmon/salmon_quant/.config.vsh.yaml
index dd56ab36..a9d3fa34 100644
--- a/target/executable/salmon/salmon_quant/.config.vsh.yaml
+++ b/target/executable/salmon/salmon_quant/.config.vsh.yaml
@@ -1173,9 +1173,9 @@ build_info:
   output: "target/executable/salmon/salmon_quant"
   executable: "target/executable/salmon/salmon_quant/salmon_quant"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/salmon/salmon_quant/salmon_quant b/target/executable/salmon/salmon_quant/salmon_quant
index ae600470..60877576 100755
--- a/target/executable/salmon/salmon_quant/salmon_quant
+++ b/target/executable/salmon/salmon_quant/salmon_quant
@@ -1168,9 +1168,9 @@ RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/softwar
 
 LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
 LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_quant"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:17Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:05Z"
 LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_collate/.config.vsh.yaml b/target/executable/samtools/samtools_collate/.config.vsh.yaml
index 73e7c4ad..067ca194 100644
--- a/target/executable/samtools/samtools_collate/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_collate/.config.vsh.yaml
@@ -264,9 +264,9 @@ build_info:
   output: "target/executable/samtools/samtools_collate"
   executable: "target/executable/samtools/samtools_collate/samtools_collate"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_collate/samtools_collate b/target/executable/samtools/samtools_collate/samtools_collate
index 75d985fe..6e0693d1 100755
--- a/target/executable/samtools/samtools_collate/samtools_collate
+++ b/target/executable/samtools/samtools_collate/samtools_collate
@@ -519,9 +519,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_collate"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:10Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:43:57Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_faidx/.config.vsh.yaml b/target/executable/samtools/samtools_faidx/.config.vsh.yaml
index 7b2b03d8..35641919 100644
--- a/target/executable/samtools/samtools_faidx/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_faidx/.config.vsh.yaml
@@ -243,9 +243,9 @@ build_info:
   output: "target/executable/samtools/samtools_faidx"
   executable: "target/executable/samtools/samtools_faidx/samtools_faidx"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_faidx/samtools_faidx b/target/executable/samtools/samtools_faidx/samtools_faidx
index c71964f1..685ac3ba 100755
--- a/target/executable/samtools/samtools_faidx/samtools_faidx
+++ b/target/executable/samtools/samtools_faidx/samtools_faidx
@@ -512,9 +512,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_faidx"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:09Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:12Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_fasta/.config.vsh.yaml b/target/executable/samtools/samtools_fasta/.config.vsh.yaml
index 0b6b957e..763a7d28 100644
--- a/target/executable/samtools/samtools_fasta/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_fasta/.config.vsh.yaml
@@ -433,9 +433,9 @@ build_info:
   output: "target/executable/samtools/samtools_fasta"
   executable: "target/executable/samtools/samtools_fasta/samtools_fasta"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_fasta/samtools_fasta b/target/executable/samtools/samtools_fasta/samtools_fasta
index 5896a136..523ba5b8 100755
--- a/target/executable/samtools/samtools_fasta/samtools_fasta
+++ b/target/executable/samtools/samtools_fasta/samtools_fasta
@@ -625,9 +625,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_fasta"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:10Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:43:58Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_fastq/.config.vsh.yaml b/target/executable/samtools/samtools_fastq/.config.vsh.yaml
index 9cbbb07f..8c4eb310 100644
--- a/target/executable/samtools/samtools_fastq/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_fastq/.config.vsh.yaml
@@ -433,9 +433,9 @@ build_info:
   output: "target/executable/samtools/samtools_fastq"
   executable: "target/executable/samtools/samtools_fastq/samtools_fastq"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_fastq/samtools_fastq b/target/executable/samtools/samtools_fastq/samtools_fastq
index 1e202ba3..771d7d84 100755
--- a/target/executable/samtools/samtools_fastq/samtools_fastq
+++ b/target/executable/samtools/samtools_fastq/samtools_fastq
@@ -626,9 +626,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_fastq"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:11Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:43:59Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_flagstat/.config.vsh.yaml b/target/executable/samtools/samtools_flagstat/.config.vsh.yaml
index c7ec1f54..34f6fd16 100644
--- a/target/executable/samtools/samtools_flagstat/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_flagstat/.config.vsh.yaml
@@ -173,9 +173,9 @@ build_info:
   output: "target/executable/samtools/samtools_flagstat"
   executable: "target/executable/samtools/samtools_flagstat/samtools_flagstat"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_flagstat/samtools_flagstat b/target/executable/samtools/samtools_flagstat/samtools_flagstat
index 5402a7e1..0d5928fe 100755
--- a/target/executable/samtools/samtools_flagstat/samtools_flagstat
+++ b/target/executable/samtools/samtools_flagstat/samtools_flagstat
@@ -474,9 +474,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_flagstat"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:23Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:11Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_idxstats/.config.vsh.yaml b/target/executable/samtools/samtools_idxstats/.config.vsh.yaml
index 48af23a9..2ecdffa7 100644
--- a/target/executable/samtools/samtools_idxstats/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_idxstats/.config.vsh.yaml
@@ -183,9 +183,9 @@ build_info:
   output: "target/executable/samtools/samtools_idxstats"
   executable: "target/executable/samtools/samtools_idxstats/samtools_idxstats"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_idxstats/samtools_idxstats b/target/executable/samtools/samtools_idxstats/samtools_idxstats
index e10cbca4..a083bf56 100755
--- a/target/executable/samtools/samtools_idxstats/samtools_idxstats
+++ b/target/executable/samtools/samtools_idxstats/samtools_idxstats
@@ -478,9 +478,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_idxstats"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:23Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:11Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_index/.config.vsh.yaml b/target/executable/samtools/samtools_index/.config.vsh.yaml
index 1c5a00d1..9d77a155 100644
--- a/target/executable/samtools/samtools_index/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_index/.config.vsh.yaml
@@ -189,9 +189,9 @@ build_info:
   output: "target/executable/samtools/samtools_index"
   executable: "target/executable/samtools/samtools_index/samtools_index"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_index/samtools_index b/target/executable/samtools/samtools_index/samtools_index
index 46a5ce1f..ea207921 100755
--- a/target/executable/samtools/samtools_index/samtools_index
+++ b/target/executable/samtools/samtools_index/samtools_index
@@ -485,9 +485,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_index"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:23Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:11Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_sort/.config.vsh.yaml b/target/executable/samtools/samtools_sort/.config.vsh.yaml
index 85987c2d..5fdab70a 100644
--- a/target/executable/samtools/samtools_sort/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_sort/.config.vsh.yaml
@@ -332,9 +332,9 @@ build_info:
   output: "target/executable/samtools/samtools_sort"
   executable: "target/executable/samtools/samtools_sort/samtools_sort"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_sort/samtools_sort b/target/executable/samtools/samtools_sort/samtools_sort
index 1d53a19b..7359bc89 100755
--- a/target/executable/samtools/samtools_sort/samtools_sort
+++ b/target/executable/samtools/samtools_sort/samtools_sort
@@ -556,9 +556,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_sort"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:11Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:43:58Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_stats/.config.vsh.yaml b/target/executable/samtools/samtools_stats/.config.vsh.yaml
index d60035f3..04c9c623 100644
--- a/target/executable/samtools/samtools_stats/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_stats/.config.vsh.yaml
@@ -401,9 +401,9 @@ build_info:
   output: "target/executable/samtools/samtools_stats"
   executable: "target/executable/samtools/samtools_stats/samtools_stats"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_stats/samtools_stats b/target/executable/samtools/samtools_stats/samtools_stats
index 616c2c36..5ee10440 100755
--- a/target/executable/samtools/samtools_stats/samtools_stats
+++ b/target/executable/samtools/samtools_stats/samtools_stats
@@ -575,9 +575,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_stats"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:22Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:10Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/samtools/samtools_view/.config.vsh.yaml b/target/executable/samtools/samtools_view/.config.vsh.yaml
index fc68fb02..8eac778f 100644
--- a/target/executable/samtools/samtools_view/.config.vsh.yaml
+++ b/target/executable/samtools/samtools_view/.config.vsh.yaml
@@ -665,9 +665,9 @@ build_info:
   output: "target/executable/samtools/samtools_view"
   executable: "target/executable/samtools/samtools_view/samtools_view"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/samtools/samtools_view/samtools_view b/target/executable/samtools/samtools_view/samtools_view
index 5c2e4650..dcac1e7b 100755
--- a/target/executable/samtools/samtools_view/samtools_view
+++ b/target/executable/samtools/samtools_view/samtools_view
@@ -825,9 +825,9 @@ sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_view"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:08Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:11Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/seqtk/seqtk_sample/.config.vsh.yaml b/target/executable/seqtk/seqtk_sample/.config.vsh.yaml
index 8dc51304..8ac08ff4 100644
--- a/target/executable/seqtk/seqtk_sample/.config.vsh.yaml
+++ b/target/executable/seqtk/seqtk_sample/.config.vsh.yaml
@@ -173,9 +173,9 @@ build_info:
   output: "target/executable/seqtk/seqtk_sample"
   executable: "target/executable/seqtk/seqtk_sample/seqtk_sample"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/seqtk/seqtk_sample/seqtk_sample b/target/executable/seqtk/seqtk_sample/seqtk_sample
index 85fa5dac..56dd3e1e 100755
--- a/target/executable/seqtk/seqtk_sample/seqtk_sample
+++ b/target/executable/seqtk/seqtk_sample/seqtk_sample
@@ -481,9 +481,9 @@ FROM quay.io/biocontainers/seqtk:1.4--he4a0461_2
 ENTRYPOINT []
 LABEL org.opencontainers.image.authors="Jakub Majercik"
 LABEL org.opencontainers.image.description="Companion container for running component seqtk seqtk_sample"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:23Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:12Z"
 LABEL org.opencontainers.image.source="https://github.com/lh3/seqtk/tree/v1.4"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml b/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml
index df8f14f3..f99e0ea2 100644
--- a/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml
+++ b/target/executable/seqtk/seqtk_subseq/.config.vsh.yaml
@@ -196,9 +196,9 @@ build_info:
   output: "target/executable/seqtk/seqtk_subseq"
   executable: "target/executable/seqtk/seqtk_subseq/seqtk_subseq"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/seqtk/seqtk_subseq/seqtk_subseq b/target/executable/seqtk/seqtk_subseq/seqtk_subseq
index 2b312b09..0f6c7136 100755
--- a/target/executable/seqtk/seqtk_subseq/seqtk_subseq
+++ b/target/executable/seqtk/seqtk_subseq/seqtk_subseq
@@ -491,9 +491,9 @@ RUN echo $(echo $(seqtk 2>&1) | sed -n 's/.*\(Version: [^ ]*\).*/\1/p') > /var/s
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component seqtk seqtk_subseq"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:24Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:12Z"
 LABEL org.opencontainers.image.source="https://github.com/lh3/seqtk/tree/v1.4"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/snpeff/.config.vsh.yaml b/target/executable/snpeff/.config.vsh.yaml
index b768e894..059b8b1a 100644
--- a/target/executable/snpeff/.config.vsh.yaml
+++ b/target/executable/snpeff/.config.vsh.yaml
@@ -628,9 +628,9 @@ build_info:
   output: "target/executable/snpeff"
   executable: "target/executable/snpeff/snpeff"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/snpeff/snpeff b/target/executable/snpeff/snpeff
index a2ef4445..cf8c7502 100755
--- a/target/executable/snpeff/snpeff
+++ b/target/executable/snpeff/snpeff
@@ -756,9 +756,9 @@ version_trimmed=$(echo "$version" | awk '{print $1, $2}') && \
 echo "$version_trimmed" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.description="Companion container for running component snpeff"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:15Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:02Z"
 LABEL org.opencontainers.image.source="https://github.com/pcingola/SnpEff"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/sortmerna/.config.vsh.yaml b/target/executable/sortmerna/.config.vsh.yaml
index eba5efce..c877c452 100644
--- a/target/executable/sortmerna/.config.vsh.yaml
+++ b/target/executable/sortmerna/.config.vsh.yaml
@@ -591,9 +591,9 @@ build_info:
   output: "target/executable/sortmerna"
   executable: "target/executable/sortmerna/sortmerna"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/sortmerna/sortmerna b/target/executable/sortmerna/sortmerna
index f915619d..0aaed3ab 100755
--- a/target/executable/sortmerna/sortmerna
+++ b/target/executable/sortmerna/sortmerna
@@ -744,9 +744,9 @@ wget --no-check-certificate https://github.com/sortmerna/sortmerna/releases/down
 bash sortmerna-4.3.6-Linux.sh --skip-license
 
 LABEL org.opencontainers.image.description="Companion container for running component sortmerna"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:12Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:43:59Z"
 LABEL org.opencontainers.image.source="https://github.com/sortmerna/sortmerna"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/star/star_align_reads/.config.vsh.yaml b/target/executable/star/star_align_reads/.config.vsh.yaml
index 406a6889..248068f2 100644
--- a/target/executable/star/star_align_reads/.config.vsh.yaml
+++ b/target/executable/star/star_align_reads/.config.vsh.yaml
@@ -2663,9 +2663,9 @@ build_info:
   output: "target/executable/star/star_align_reads"
   executable: "target/executable/star/star_align_reads/star_align_reads"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/star/star_align_reads/star_align_reads b/target/executable/star/star_align_reads/star_align_reads
index 3872c2ed..161c928b 100755
--- a/target/executable/star/star_align_reads/star_align_reads
+++ b/target/executable/star/star_align_reads/star_align_reads
@@ -1920,9 +1920,9 @@ RUN STAR --version | sed 's#\(.*\)#star: "\1"#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Angela Oliveira Pisco, Robrecht Cannoodt"
 LABEL org.opencontainers.image.description="Companion container for running component star star_align_reads"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:13Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:01Z"
 LABEL org.opencontainers.image.source="https://github.com/alexdobin/STAR"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/star/star_genome_generate/.config.vsh.yaml b/target/executable/star/star_genome_generate/.config.vsh.yaml
index 0e2b1ca0..15375b6d 100644
--- a/target/executable/star/star_genome_generate/.config.vsh.yaml
+++ b/target/executable/star/star_genome_generate/.config.vsh.yaml
@@ -333,9 +333,9 @@ build_info:
   output: "target/executable/star/star_genome_generate"
   executable: "target/executable/star/star_genome_generate/star_genome_generate"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/star/star_genome_generate/star_genome_generate b/target/executable/star/star_genome_generate/star_genome_generate
index 89e124d5..44422fdd 100755
--- a/target/executable/star/star_genome_generate/star_genome_generate
+++ b/target/executable/star/star_genome_generate/star_genome_generate
@@ -577,9 +577,9 @@ RUN STAR --version | sed 's#\(.*\)#star: "\1"#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
 LABEL org.opencontainers.image.description="Companion container for running component star star_genome_generate"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:13Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:00Z"
 LABEL org.opencontainers.image.source="https://github.com/alexdobin/STAR"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/trimgalore/.config.vsh.yaml b/target/executable/trimgalore/.config.vsh.yaml
index 56595b98..f2d9d3c4 100644
--- a/target/executable/trimgalore/.config.vsh.yaml
+++ b/target/executable/trimgalore/.config.vsh.yaml
@@ -770,9 +770,9 @@ build_info:
   output: "target/executable/trimgalore"
   executable: "target/executable/trimgalore/trimgalore"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/trimgalore/trimgalore b/target/executable/trimgalore/trimgalore
index ec3482b0..b599ba42 100755
--- a/target/executable/trimgalore/trimgalore
+++ b/target/executable/trimgalore/trimgalore
@@ -881,9 +881,9 @@ RUN echo "TrimGalore: `trim_galore --version | sed -n 's/.*version\s\+\([0-9]\+\
 
 LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
 LABEL org.opencontainers.image.description="Companion container for running component trimgalore"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:17Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:04Z"
 LABEL org.opencontainers.image.source="https://github.com/FelixKrueger/TrimGalore"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml b/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml
index 3e4323e0..be52b591 100644
--- a/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml
+++ b/target/executable/umi_tools/umi_tools_dedup/.config.vsh.yaml
@@ -611,9 +611,9 @@ build_info:
   output: "target/executable/umi_tools/umi_tools_dedup"
   executable: "target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup b/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup
index 72986d59..e3a53492 100755
--- a/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup
+++ b/target/executable/umi_tools/umi_tools_dedup/umi_tools_dedup
@@ -770,9 +770,9 @@ RUN umi_tools -v | sed 's/ version//g' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component umi_tools umi_tools_dedup"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:15Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:03Z"
 LABEL org.opencontainers.image.source="https://github.com/CGATOxford/UMI-tools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml b/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml
index 3337ecf1..232beff1 100644
--- a/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml
+++ b/target/executable/umi_tools/umi_tools_extract/.config.vsh.yaml
@@ -449,9 +449,9 @@ build_info:
   output: "target/executable/umi_tools/umi_tools_extract"
   executable: "target/executable/umi_tools/umi_tools_extract/umi_tools_extract"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/umi_tools/umi_tools_extract/umi_tools_extract b/target/executable/umi_tools/umi_tools_extract/umi_tools_extract
index 2783ccee..c95662ec 100755
--- a/target/executable/umi_tools/umi_tools_extract/umi_tools_extract
+++ b/target/executable/umi_tools/umi_tools_extract/umi_tools_extract
@@ -637,9 +637,9 @@ ENTRYPOINT []
 RUN umi_tools -v | sed 's/ version//g' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.description="Companion container for running component umi_tools umi_tools_extract"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:14Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:02Z"
 LABEL org.opencontainers.image.source="https://github.com/CGATOxford/UMI-tools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml b/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml
index 3a5953a6..ade1ff8b 100644
--- a/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml
+++ b/target/executable/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml
@@ -256,9 +256,9 @@ build_info:
   output: "target/executable/umi_tools/umi_tools_prepareforrsem"
   executable: "target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem b/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem
index ce36601f..a2d13fca 100755
--- a/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem
+++ b/target/executable/umi_tools/umi_tools_prepareforrsem/umi_tools_prepareforrsem
@@ -519,9 +519,9 @@ ENTRYPOINT []
 RUN umi_tools -v | sed 's/ version//g' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.description="Companion container for running component umi_tools umi_tools_prepareforrsem"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:15Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:03Z"
 LABEL org.opencontainers.image.source="https://github.com/CGATOxford/UMI-tools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"
 
 VIASHDOCKER
diff --git a/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml
index 5a504fbb..74d95755 100644
--- a/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml
+++ b/target/nextflow/agat/agat_convert_bed2gff/.config.vsh.yaml
@@ -235,9 +235,9 @@ build_info:
   output: "target/nextflow/agat/agat_convert_bed2gff"
   executable: "target/nextflow/agat/agat_convert_bed2gff/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/agat/agat_convert_bed2gff/main.nf b/target/nextflow/agat/agat_convert_bed2gff/main.nf
index fd90156a..070e7441 100644
--- a/target/nextflow/agat/agat_convert_bed2gff/main.nf
+++ b/target/nextflow/agat/agat_convert_bed2gff/main.nf
@@ -3092,9 +3092,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/agat/agat_convert_bed2gff",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml
index a8179014..ed155150 100644
--- a/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml
+++ b/target/nextflow/agat/agat_convert_embl2gff/.config.vsh.yaml
@@ -225,9 +225,9 @@ build_info:
   output: "target/nextflow/agat/agat_convert_embl2gff"
   executable: "target/nextflow/agat/agat_convert_embl2gff/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/agat/agat_convert_embl2gff/main.nf b/target/nextflow/agat/agat_convert_embl2gff/main.nf
index 5f822e39..e5405e5a 100644
--- a/target/nextflow/agat/agat_convert_embl2gff/main.nf
+++ b/target/nextflow/agat/agat_convert_embl2gff/main.nf
@@ -3085,9 +3085,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/agat/agat_convert_embl2gff",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml b/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml
index 59b91b2c..029ab91f 100644
--- a/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml
+++ b/target/nextflow/agat/agat_convert_genscan2gff/.config.vsh.yaml
@@ -230,9 +230,9 @@ build_info:
   output: "target/nextflow/agat/agat_convert_genscan2gff"
   executable: "target/nextflow/agat/agat_convert_genscan2gff/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/agat/agat_convert_genscan2gff/main.nf b/target/nextflow/agat/agat_convert_genscan2gff/main.nf
index 53486c7b..94c235c2 100644
--- a/target/nextflow/agat/agat_convert_genscan2gff/main.nf
+++ b/target/nextflow/agat/agat_convert_genscan2gff/main.nf
@@ -3087,9 +3087,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/agat/agat_convert_genscan2gff",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml b/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml
index 002de914..1e529b2d 100644
--- a/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml
+++ b/target/nextflow/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml
@@ -228,9 +228,9 @@ build_info:
   output: "target/nextflow/agat/agat_convert_sp_gff2gtf"
   executable: "target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf b/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf
index 22541ce6..3886681e 100644
--- a/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf
+++ b/target/nextflow/agat/agat_convert_sp_gff2gtf/main.nf
@@ -3068,9 +3068,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/agat/agat_convert_sp_gff2gtf",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml b/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml
index d51d52ee..626202b6 100644
--- a/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml
+++ b/target/nextflow/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml
@@ -188,9 +188,9 @@ build_info:
   output: "target/nextflow/agat/agat_convert_sp_gff2tsv"
   executable: "target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf b/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf
index d7e23757..f173da04 100644
--- a/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf
+++ b/target/nextflow/agat/agat_convert_sp_gff2tsv/main.nf
@@ -3046,9 +3046,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/agat/agat_convert_sp_gff2tsv",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml b/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml
index bfa89c8d..08454fd5 100644
--- a/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml
+++ b/target/nextflow/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml
@@ -195,9 +195,9 @@ build_info:
   output: "target/nextflow/agat/agat_convert_sp_gxf2gxf"
   executable: "target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf b/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf
index 8a9f2276..9483023f 100644
--- a/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf
+++ b/target/nextflow/agat/agat_convert_sp_gxf2gxf/main.nf
@@ -3046,9 +3046,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/agat/agat_convert_sp_gxf2gxf",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/agat/agat_sp_add_introns/.config.vsh.yaml b/target/nextflow/agat/agat_sp_add_introns/.config.vsh.yaml
index ecd1c859..83a50490 100644
--- a/target/nextflow/agat/agat_sp_add_introns/.config.vsh.yaml
+++ b/target/nextflow/agat/agat_sp_add_introns/.config.vsh.yaml
@@ -186,9 +186,9 @@ build_info:
   output: "target/nextflow/agat/agat_sp_add_introns"
   executable: "target/nextflow/agat/agat_sp_add_introns/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/agat/agat_sp_add_introns/main.nf b/target/nextflow/agat/agat_sp_add_introns/main.nf
index e7cc1aba..6aa25e0d 100644
--- a/target/nextflow/agat/agat_sp_add_introns/main.nf
+++ b/target/nextflow/agat/agat_sp_add_introns/main.nf
@@ -3049,9 +3049,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/agat/agat_sp_add_introns",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml
new file mode 100644
index 00000000..dd47e0a0
--- /dev/null
+++ b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml
@@ -0,0 +1,263 @@
+name: "agat_sp_filter_feature_from_kill_list"
+namespace: "agat"
+version: "main"
+authors:
+- name: "Leïla Paquay"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "leila@data-intuitive.com"
+      github: "Leila011"
+      linkedin: "leilapaquay"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Software Developer"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--gff"
+    alternatives:
+    - "-f"
+    - "--ref"
+    - "--reffile"
+    description: "Input GFF3 file that will be read."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--kill_list"
+    alternatives:
+    - "--kl"
+    description: "Text file containing the kill list. One value per line."
+    info: null
+    example:
+    - "kill_list.txt"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    - "--out"
+    description: "Path to the output GFF file that contains filtered features. \n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Arguments"
+  arguments:
+  - type: "string"
+    name: "--type"
+    alternatives:
+    - "-p"
+    - "-l"
+    description: "Primary tag option, case insensitive, list. Allow to specify the\
+      \ feature types that \nwill be handled. \n\nYou can specify a specific feature\
+      \ by giving its primary tag name (column 3) as: \n\n  * cds\n  * Gene\n  * mRNA\n\
+      \  \nYou can specify directly all the feature of a particular\nlevel: \n\n \
+      \ * level2=mRNA,ncRNA,tRNA,etc \n  * level3=CDS,exon,UTR,etc. \n\nBy default\
+      \ all features are taken into account. Fill the option with the value \"all\"\
+      \ will \nhave the same behaviour.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: true
+    multiple_sep: ";"
+  - type: "string"
+    name: "--attribute"
+    alternatives:
+    - "-a"
+    description: "Attribute tag to specify the attribute to analyse. Case sensitive.\
+      \ Default: ID\n"
+    info: null
+    example:
+    - "ID"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--config"
+    alternatives:
+    - "-c"
+    description: "AGAT config file. By default AGAT takes the original agat_config.yaml\
+      \ shipped with AGAT.\nThe `--config` option gives you the possibility to use\
+      \ your own AGAT config file (located \nelsewhere or named differently).\n"
+    info: null
+    example:
+    - "custom_agat_config.yaml"
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--verbose"
+    alternatives:
+    - "-v"
+    description: "Verbose option for debugging purpose."
+    info: null
+    direction: "input"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Remove features based on a kill list. The default behaviour is to look\
+  \ at the features's ID. \nIf the feature has an ID (case insensitive) listed among\
+  \ the kill list it will be removed.\nRemoving a level1 or level2 feature will automatically\
+  \ remove all linked subfeatures, and \nremoving all children of a feature will automatically\
+  \ remove this feature too.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "gene annotations"
+- "filtering"
+- "gff"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.5281/zenodo.3552717"
+links:
+  repository: "https://github.com/NBISweden/AGAT"
+  homepage: "https://github.com/NBISweden/AGAT"
+  documentation: "https://agat.readthedocs.io/en/latest/tools/agat_sp_filter_feature_from_kill_list.html"
+  issue_tracker: "https://github.com/NBISweden/AGAT/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "docker"
+    run:
+    - "agat --version | sed 's/AGAT\\s\\(.*\\)/agat: \"\\1\"/' > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml"
+  runner: "nextflow"
+  engine: "docker|native"
+  output: "target/nextflow/agat/agat_sp_filter_feature_from_kill_list"
+  executable: "target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf
new file mode 100644
index 00000000..42366c01
--- /dev/null
+++ b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/main.nf
@@ -0,0 +1,3669 @@
+// agat_sp_filter_feature_from_kill_list main
+// 
+// This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+// work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+// Intuitive.
+// 
+// The component may contain files which fall under a different license. The
+// authors of this component should specify the license in the header of such
+// files, or include a separate license file detailing the licenses of all included
+// files.
+// 
+// Component authors:
+//  * Leïla Paquay (author, maintainer)
+
+////////////////////////////
+// VDSL3 helper functions //
+////////////////////////////
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf'
+class UnexpectedArgumentTypeException extends Exception {
+  String errorIdentifier
+  String stage
+  String plainName
+  String expectedClass
+  String foundClass
+  
+  // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""}
+  UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) {
+    super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " +
+      "Expected type: ${expectedClass}. Found type: ${foundClass}")
+    this.errorIdentifier = errorIdentifier
+    this.stage = stage
+    this.plainName = plainName
+    this.expectedClass = expectedClass
+    this.foundClass = foundClass
+  }
+}
+
+/**
+  * Checks if the given value is of the expected type. If not, an exception is thrown.
+  *
+  * @param stage The stage of the argument (input or output)
+  * @param par The parameter definition
+  * @param value The value to check
+  * @param errorIdentifier The identifier to use in the error message
+  * @return The value, if it is of the expected type
+  * @throws UnexpectedArgumentTypeException If the value is not of the expected type
+*/
+def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) {
+  // expectedClass will only be != null if value is not of the expected type
+  def expectedClass = null
+  def foundClass = null
+  
+  // todo: split if need be
+  
+  if (!par.required && value == null) {
+    expectedClass = null
+  } else if (par.multiple) {
+    if (value !instanceof Collection) {
+      value = [value]
+    }
+    
+    // split strings
+    value = value.collectMany{ val ->
+      if (val instanceof String) {
+        // collect() to ensure that the result is a List and not simply an array
+        val.split(par.multiple_sep).collect()
+      } else {
+        [val]
+      }
+    }
+
+    // process globs
+    if (par.type == "file" && par.direction == "input") {
+      value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten()
+    }
+
+    // check types of elements in list
+    try {
+      value = value.collect { listVal ->
+        _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier)
+      }
+    } catch (UnexpectedArgumentTypeException e) {
+      expectedClass = "List[${e.expectedClass}]"
+      foundClass = "List[${e.foundClass}]"
+    }
+  } else if (par.type == "string") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else if (par.type == "integer") {
+    // cast to integer if need be
+    if (value instanceof String) {
+      try {
+        value = value.toInteger()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigInteger) {
+      value = value.intValue()
+    }
+    expectedClass = value instanceof Integer ? null : "Integer"
+  } else if (par.type == "long") {
+    // cast to long if need be
+    if (value instanceof String) {
+      try {
+        value = value.toLong()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof Integer) {
+      value = value.toLong()
+    }
+    expectedClass = value instanceof Long ? null : "Long"
+  } else if (par.type == "double") {
+    // cast to double if need be
+    if (value instanceof String) {
+      try {
+        value = value.toDouble()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigDecimal) {
+      value = value.doubleValue()
+    }
+    if (value instanceof Float) {
+      value = value.toDouble()
+    }
+    expectedClass = value instanceof Double ? null : "Double"
+  } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") {
+    // cast to boolean if need be
+    if (value instanceof String) {
+      def valueLower = value.toLowerCase()
+      if (valueLower == "true") {
+        value = true
+      } else if (valueLower == "false") {
+        value = false
+      }
+    }
+    expectedClass = value instanceof Boolean ? null : "Boolean"
+  } else if (par.type == "file" && (par.direction == "input" || stage == "output")) {
+    // cast to path if need be
+    if (value instanceof String) {
+      value = file(value, hidden: true)
+    }
+    if (value instanceof File) {
+      value = value.toPath()
+    }
+    expectedClass = value instanceof Path ? null : "Path"
+  } else if (par.type == "file" && stage == "input" && par.direction == "output") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else {
+    // didn't find a match for par.type
+    expectedClass = par.type
+  }
+
+  if (expectedClass != null) {
+    if (foundClass == null) {
+      foundClass = value.getClass().getName()
+    }
+    throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass)
+  }
+  
+  return value
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf'
+Map _processInputValues(Map inputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.required) {
+        assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing"
+      }
+    }
+
+    inputs = inputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument"
+
+      value = _checkArgumentType("input", par, value, "in module '$key' id '$id'")
+
+      [ name, value ]
+    }
+  }
+  return inputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf'
+Map _processOutputValues(Map outputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.direction == "output" && arg.required) {
+        assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing"
+      }
+    }
+
+    outputs = outputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && it.direction == "output" }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument"
+      
+      value = _checkArgumentType("output", par, value, "in module '$key' id '$id'")
+      
+      [ name, value ]
+    }
+  }
+  return outputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf'
+class IDChecker {
+  final def items = [] as Set
+
+  @groovy.transform.WithWriteLock
+  boolean observe(String item) {
+    if (items.contains(item)) {
+      return false
+    } else {
+      items << item
+      return true
+    }
+  }
+
+  @groovy.transform.WithReadLock
+  boolean contains(String item) {
+    return items.contains(item)
+  }
+
+  @groovy.transform.WithReadLock
+  Set getItems() {
+    return items.clone()
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf'
+
+/**
+ * Check if the ids are unique across parameter sets
+ *
+ * @param parameterSets a list of parameter sets.
+ */
+private void _checkUniqueIds(List<Tuple2<String, Map<String, Object>>> parameterSets) {
+  def ppIds = parameterSets.collect{it[0]}
+  assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds"
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf'
+
+// helper functions for reading params from file //
+def _getChild(parent, child) {
+  if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) {
+    child
+  } else {
+    def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString()
+    parentAbsolute.replaceAll('/[^/]*$', "/") + child
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf'
+/**
+  * Figure out the param list format based on the file extension
+  *
+  * @param param_list A String containing the path to the parameter list file.
+  *
+  * @return A String containing the format of the parameter list file.
+  */
+def _paramListGuessFormat(param_list) {
+  if (param_list !instanceof String) {
+    "asis"
+  } else if (param_list.endsWith(".csv")) {
+    "csv"
+  } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) {
+    "json"
+  } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) {
+    "yaml"
+  } else {
+    "yaml_blob"
+  }
+}
+
+
+/**
+  * Read the param list
+  * 
+  * @param param_list One of the following:
+  *   - A String containing the path to the parameter list file (csv, json or yaml),
+  *   - A yaml blob of a list of maps (yaml_blob),
+  *   - Or a groovy list of maps (asis).
+  * @param config A Map of the Viash configuration.
+  * 
+  * @return A List of Maps containing the parameters.
+  */
+def _parseParamList(param_list, Map config) {
+  // first determine format by extension
+  def paramListFormat = _paramListGuessFormat(param_list)
+
+  def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ?
+    file(param_list, hidden: true) :
+    null
+
+  // get the correct parser function for the detected params_list format
+  def paramSets = []
+  if (paramListFormat == "asis") {
+    paramSets = param_list
+  } else if (paramListFormat == "yaml_blob") {
+    paramSets = readYamlBlob(param_list)
+  } else if (paramListFormat == "yaml") {
+    paramSets = readYaml(paramListPath)
+  } else if (paramListFormat == "json") {
+    paramSets = readJson(paramListPath)
+  } else if (paramListFormat == "csv") {
+    paramSets = readCsv(paramListPath)
+  } else {
+    error "Format of provided --param_list not recognised.\n" +
+    "Found: '$paramListFormat'.\n" +
+    "Expected: a csv file, a json file, a yaml file,\n" +
+    "a yaml blob or a groovy list of maps."
+  }
+
+  // data checks
+  assert paramSets instanceof List: "--param_list should contain a list of maps"
+  for (value in paramSets) {
+    assert value instanceof Map: "--param_list should contain a list of maps"
+  }
+
+  // id is argument
+  def idIsArgument = config.allArguments.any{it.plainName == "id"}
+
+  // Reformat from List<Map> to List<Tuple2<String, Map>> by adding the ID as first element of a Tuple2
+  paramSets = paramSets.collect({ data ->
+    def id = data.id
+    if (!idIsArgument) {
+      data = data.findAll{k, v -> k != "id"}
+    }
+    [id, data]
+  })
+
+  // Split parameters with 'multiple: true'
+  paramSets = paramSets.collect({ id, data ->
+    data = _splitParams(data, config)
+    [id, data]
+  })
+  
+  // The paths of input files inside a param_list file may have been specified relatively to the
+  // location of the param_list file. These paths must be made absolute.
+  if (paramListPath) {
+    paramSets = paramSets.collect({ id, data ->
+      def new_data = data.collectEntries{ parName, parValue ->
+        def par = config.allArguments.find{it.plainName == parName}
+        if (par && par.type == "file" && par.direction == "input") {
+          if (parValue instanceof Collection) {
+            parValue = parValue.collectMany{path -> 
+              def x = _resolveSiblingIfNotAbsolute(path, paramListPath)
+              x instanceof Collection ? x : [x]
+            }
+          } else {
+            parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) 
+          }
+        }
+        [parName, parValue]
+      }
+      [id, new_data]
+    })
+  }
+
+  return paramSets
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf'
+/**
+ * Split parameters for arguments that accept multiple values using their separator
+ *
+ * @param paramList A Map containing parameters to split.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ *
+ * @return A Map of parameters where the parameter values have been split into a list using
+ *         their seperator.
+ */
+Map<String, Object> _splitParams(Map<String, Object> parValues, Map config){
+  def parsedParamValues = parValues.collectEntries { parName, parValue ->
+    def parameterSettings = config.allArguments.find({it.plainName == parName})
+
+    if (!parameterSettings) {
+      // if argument is not found, do not alter 
+      return [parName, parValue]
+    }
+    if (parameterSettings.multiple) { // Check if parameter can accept multiple values
+      if (parValue instanceof Collection) {
+        parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it }
+      } else if (parValue instanceof String) {
+        parValue = parValue.split(parameterSettings.multiple_sep)
+      } else if (parValue == null) {
+        parValue = []
+      } else {
+        parValue = [ parValue ]
+      }
+      parValue = parValue.flatten()
+    }
+    // For all parameters check if multiple values are only passed for
+    // arguments that allow it. Quietly simplify lists of length 1.
+    if (!parameterSettings.multiple && parValue instanceof Collection) {
+      assert parValue.size() == 1 : 
+      "Error: argument ${parName} has too many values.\n" +
+      "  Expected amount: 1. Found: ${parValue.size()}"
+      parValue = parValue[0]
+    }
+    [parName, parValue]
+  }
+  return parsedParamValues
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf'
+/**
+ * Parse nextflow parameters based on settings defined in a viash config.
+ * Return a list of parameter sets, each parameter set corresponding to 
+ * an event in a nextflow channel. The output from this function can be used
+ * with Channel.fromList to create a nextflow channel with Vdsl3 formatted 
+ * events.
+ *
+ * This function performs:
+ *   - A filtering of the params which can be found in the config file.
+ *   - Process the params_list argument which allows a user to to initialise 
+ *     a Vsdl3 channel with multiple parameter sets. Possible formats are 
+ *     csv, json, yaml, or simply a yaml_blob. A csv should have column names 
+ *     which correspond to the different arguments of this pipeline. A json or a yaml
+ *     file should be a list of maps, each of which has keys corresponding to the
+ *     arguments of the pipeline. A yaml blob can also be passed directly as a parameter.
+ *     When passing a csv, json or yaml, relative path names are relativized to the
+ *     location of the parameter file.
+ *   - Combine the parameter sets into a vdsl3 Channel.
+ *
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A list of parameters with the first element of the event being
+ *         the event ID and the second element containing a map of the parsed parameters.
+ */
+ 
+private List<Tuple2<String, Map<String, Object>>> _paramsToParamSets(Map params, Map config){
+  // todo: fetch key from run args
+  def key_ = config.name
+  
+  /* parse regular parameters (not in param_list)  */
+  /*************************************************/
+  def globalParams = config.allArguments
+    .findAll { params.containsKey(it.plainName) }
+    .collectEntries { [ it.plainName, params[it.plainName] ] }
+  def globalID = params.get("id", null)
+
+  /* process params_list arguments */
+  /*********************************/
+  def paramList = params.containsKey("param_list") && params.param_list != null ?
+    params.param_list : []
+  // if (paramList instanceof String) {
+  //   paramList = [paramList]
+  // }
+  // def paramSets = paramList.collectMany{ _parseParamList(it, config) }
+  // TODO: be able to process param_list when it is a list of strings
+  def paramSets = _parseParamList(paramList, config)
+  if (paramSets.isEmpty()) {
+    paramSets = [[null, [:]]]
+  }
+
+  /* combine arguments into channel */
+  /**********************************/
+  def processedParams = paramSets.indexed().collect{ index, tup ->
+    // Process ID
+    def id = tup[0] ?: globalID
+  
+    if (workflow.stubRun && !id) {
+      // if stub run, explicitly add an id if missing
+      id = "stub${index}"
+    }
+    assert id != null: "Each parameter set should have at least an 'id'"
+
+    // Process params
+    def parValues = globalParams + tup[1]
+    // // Remove parameters which are null, if the default is also null
+    // parValues = parValues.collectEntries{paramName, paramValue ->
+    //   parameterSettings = config.functionality.allArguments.find({it.plainName == paramName})
+    //   if ( paramValue != null || parameterSettings.get("default", null) != null ) {
+    //     [paramName, paramValue]
+    //   }
+    // }
+    parValues = parValues.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument"
+
+      if (par == null) {
+        return [:]
+      }
+      value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+
+      [ name, value ]
+    }
+
+    [id, parValues]
+  }
+
+  // Check if ids (first element of each list) is unique
+  _checkUniqueIds(processedParams)
+  return processedParams
+}
+
+/**
+ * Parse nextflow parameters based on settings defined in a viash config 
+ * and return a nextflow channel.
+ * 
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A nextflow Channel with events. Events are formatted as a tuple that contains 
+ *         first contains the ID of the event and as second element holds a parameter map.
+ *       
+ *
+ */
+def channelFromParams(Map params, Map config) {
+  def processedParams = _paramsToParamSets(params, config)
+  return Channel.fromList(processedParams)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf'
+def checkUniqueIds(Map args) {
+  def stopOnError = args.stopOnError == null ? args.stopOnError : true
+
+  def idChecker = new IDChecker()
+
+  return filter { tup ->
+    if (!idChecker.observe(tup[0])) {
+      if (stopOnError) {
+        error "Duplicate id: ${tup[0]}"
+      } else {
+        log.warn "Duplicate id: ${tup[0]}, removing duplicate entry"
+        return false
+      }
+    }
+    return true
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf'
+// This helper file will be deprecated soon
+preprocessInputsDeprecationWarningPrinted = false
+
+def preprocessInputsDeprecationWarning() {
+  if (!preprocessInputsDeprecationWarningPrinted) {
+    preprocessInputsDeprecationWarningPrinted = true
+    System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.")
+  }
+}
+
+/**
+ * Generate a nextflow Workflow that allows processing a channel of 
+ * Vdsl3 formatted events and apply a Viash config to them:
+ *    - Gather default parameters from the Viash config and make 
+ *      sure that they are correctly formatted (see applyConfig method).
+ *    - Format the input parameters (also using the applyConfig method).
+ *    - Apply the default parameter to the input parameters.
+ *    - Do some assertions:
+ *        ~ Check if the event IDs in the channel are unique.
+ * 
+ * The events in the channel are formatted as tuples, with the 
+ * first element of the tuples being a unique id of the parameter set, 
+ * and the second element containg the the parameters themselves.
+ * Optional extra elements of the tuples will be passed to the output as is.
+ *
+ * @param args A map that must contain a 'config' key that points
+ *              to a parsed config (see readConfig()). Optionally, a
+ *              'key' key can be provided which can be used to create a unique
+ *              name for the workflow process.
+ *
+ * @return A workflow that allows processing a channel of Vdsl3 formatted events
+ * and apply a Viash config to them.
+ */
+def preprocessInputs(Map args) {
+  preprocessInputsDeprecationWarning()
+
+  def config = args.config
+  assert config instanceof Map : 
+    "Error in preprocessInputs: config must be a map. " +
+    "Expected class: Map. Found: config.getClass() is ${config.getClass()}"
+  def key_ = args.key ?: config.name
+
+  // Get different parameter types (used throughout this function)
+  def defaultArgs = config.allArguments
+    .findAll { it.containsKey("default") }
+    .collectEntries { [ it.plainName, it.default ] }
+
+  map { tup ->
+    def id = tup[0]
+    def data = tup[1]
+    def passthrough = tup.drop(2)
+
+    def new_data = (defaultArgs + data).collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      
+      if (par != null) {
+        value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+      }
+
+      [ name, value ]
+    }
+
+    [ id, new_data ] + passthrough
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component config.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component config.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runComponents(Map args) {
+  log.warn("runComponents is deprecated, use runEach instead")
+  assert args.components: "runComponents should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runComponents"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def id_ = args.id
+
+  workflow runComponentsWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def comp_config = comp_.config
+
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_config)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          // def new_id = id_(tup[0], tup[1], comp_config)
+          def new_id = tup[0]
+          if (id_ instanceof String) {
+            new_id = id_
+          } else if (id_ instanceof Closure) {
+            new_id = id_(new_id, tup[1], comp_config)
+          }
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def data_ch = id_ch | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_config)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_config)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+      
+      post_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runComponentsWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component itself.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component itself.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runEach(Map args) {
+  assert args.components: "runEach should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runEach"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def runIf_ = args.runIf
+  def id_ = args.id
+
+  assert !runIf_ || runIf_ instanceof Closure: "runEach: must pass a Closure to runIf."
+
+  workflow runEachWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          def new_id = id_
+          if (new_id instanceof Closure) {
+            new_id = new_id(tup[0], tup[1], comp_)
+          }
+          assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}"
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def chPassthrough = null
+      def chRun = null
+      if (runIf_) {
+        def idRunIfBranch = id_ch.branch{ tup ->
+          run: runIf_(tup[0], tup[1], comp_)
+          passthrough: true
+        }
+        chPassthrough = idRunIfBranch.passthrough
+        chRun = idRunIfBranch.run
+      } else {
+        chRun = id_ch
+        chPassthrough = Channel.empty()
+      }
+      def data_ch = chRun | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+
+      def return_ch = post_ch
+        | concat(chPassthrough)
+      
+      return_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runEachWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf'
+/**
+ * Join sourceChannel to targetChannel
+ * 
+ * This function joins the sourceChannel to the targetChannel. 
+ * However, each id in the targetChannel must be present in the
+ * sourceChannel. If _meta.join_id exists in the targetChannel, that is 
+ * used as an id instead. If the id doesn't match any id in the sourceChannel,
+ * an error is thrown.
+ */
+
+def safeJoin(targetChannel, sourceChannel, key) {
+  def sourceIDs = new IDChecker()
+
+  def sourceCheck = sourceChannel
+    | map { tup ->
+      sourceIDs.observe(tup[0])
+      tup
+    }
+  def targetCheck = targetChannel
+    | map { tup ->
+      def id = tup[0]
+      
+      if (!sourceIDs.contains(id)) {
+        error (
+          "Error in module '${key}' when merging output with original state.\n" +
+          "  Reason: output with id '${id}' could not be joined with source channel.\n" +
+          "    If the IDs in the output channel differ from the input channel,\n" + 
+          "    please set `tup[1]._meta.join_id to the original ID.\n" +
+          "  Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + 
+          "  Unexpected ID in the output channel: '${id}'.\n" +
+          "  Example input event: [\"id\", [input: file(...)]],\n" +
+          "  Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]"
+        )
+      }
+      // TODO: add link to our documentation on how to fix this
+
+      tup
+    }
+  
+  sourceCheck.cross(targetChannel)
+    | map{ left, right ->
+      right + left.drop(1)
+    }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf'
+def _processArgument(arg) {
+  arg.multiple = arg.multiple != null ? arg.multiple : false
+  arg.required = arg.required != null ? arg.required : false
+  arg.direction = arg.direction != null ? arg.direction : "input"
+  arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";"
+  arg.plainName = arg.name.replaceAll("^-*", "")
+
+  if (arg.type == "file") {
+    arg.must_exist = arg.must_exist != null ? arg.must_exist : true
+    arg.create_parent = arg.create_parent != null ? arg.create_parent : true
+  }
+
+  // add default values to output files which haven't already got a default
+  if (arg.type == "file" && arg.direction == "output" && arg.default == null) {
+    def mult = arg.multiple ? "_*" : ""
+    def extSearch = ""
+    if (arg.default != null) {
+      extSearch = arg.default
+    } else if (arg.example != null) {
+      extSearch = arg.example
+    }
+    if (extSearch instanceof List) {
+      extSearch = extSearch[0]
+    }
+    def extSearchResult = extSearch.find("\\.[^\\.]+\$")
+    def ext = extSearchResult != null ? extSearchResult : ""
+    arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}"
+    if (arg.multiple) {
+      arg.default = [arg.default]
+    }
+  }
+
+  if (!arg.multiple) {
+    if (arg.default != null && arg.default instanceof List) {
+      arg.default = arg.default[0]
+    }
+    if (arg.example != null && arg.example instanceof List) {
+      arg.example = arg.example[0]
+    }
+  }
+
+  if (arg.type == "boolean_true") {
+    arg.default = false
+  }
+  if (arg.type == "boolean_false") {
+    arg.default = true
+  }
+
+  arg
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf'
+def addGlobalArguments(config) {
+  def localConfig = [
+    "argument_groups": [
+      [
+        "name": "Nextflow input-output arguments",
+        "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+        "arguments" : [
+          [
+            'name': '--publish_dir',
+            'required': true,
+            'type': 'string',
+            'description': 'Path to an output directory.',
+            'example': 'output/',
+            'multiple': false
+          ],
+          [
+            'name': '--param_list',
+            'required': false,
+            'type': 'string',
+            'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.
+            |
+            |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`.
+            |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.
+            |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`.
+            |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`.
+            |
+            |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(),
+            'example': 'my_params.yaml',
+            'multiple': false,
+            'hidden': true
+          ]
+          // TODO: allow multiple: true in param_list?
+          // TODO: allow to specify a --param_list_regex to filter the param_list?
+          // TODO: allow to specify a --param_list_from_state to remap entries in the param_list?
+        ]
+      ]
+    ]
+  ]
+
+  return processConfig(_mergeMap(config, localConfig))
+}
+
+def _mergeMap(Map lhs, Map rhs) {
+  return rhs.inject(lhs.clone()) { map, entry ->
+    if (map[entry.key] instanceof Map && entry.value instanceof Map) {
+      map[entry.key] = _mergeMap(map[entry.key], entry.value)
+    } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) {
+      map[entry.key] += entry.value
+    } else {
+      map[entry.key] = entry.value
+    }
+    return map
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf'
+def _generateArgumentHelp(param) {
+  // alternatives are not supported
+  // def names = param.alternatives ::: List(param.name)
+
+  def unnamedProps = [
+    ["required parameter", param.required],
+    ["multiple values allowed", param.multiple],
+    ["output", param.direction.toLowerCase() == "output"],
+    ["file must exist", param.type == "file" && param.must_exist]
+  ].findAll{it[1]}.collect{it[0]}
+  
+  def dflt = null
+  if (param.default != null) {
+    if (param.default instanceof List) {
+      dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      dflt = param.default.toString()
+    }
+  }
+  def example = null
+  if (param.example != null) {
+    if (param.example instanceof List) {
+      example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      example = param.example.toString()
+    }
+  }
+  def min = param.min?.toString()
+  def max = param.max?.toString()
+
+  def escapeChoice = { choice ->
+    def s1 = choice.replaceAll("\\n", "\\\\n")
+    def s2 = s1.replaceAll("\"", """\\\"""")
+    s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2
+  }
+  def choices = param.choices == null ? 
+    null : 
+    "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]"
+
+  def namedPropsStr = [
+    ["type", ([param.type] + unnamedProps).join(", ")],
+    ["default", dflt],
+    ["example", example],
+    ["choices", choices],
+    ["min", min],
+    ["max", max]
+  ]
+    .findAll{it[1]}
+    .collect{"\n        " + it[0] + ": " + it[1].replaceAll("\n", "\\n")}
+    .join("")
+  
+  def descStr = param.description == null ?
+    "" :
+    _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n        ")
+  
+  "\n    --" + param.plainName +
+    namedPropsStr +
+    descStr
+}
+
+// Based on Helper.generateHelp() in Helper.scala
+def _generateHelp(config) {
+  def fun = config
+
+  // PART 1: NAME AND VERSION
+  def nameStr = fun.name + 
+    (fun.version == null ? "" : " " + fun.version)
+
+  // PART 2: DESCRIPTION
+  def descrStr = fun.description == null ? 
+    "" :
+    "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n")
+
+  // PART 3: Usage
+  def usageStr = fun.usage == null ? 
+    "" :
+    "\n\nUsage:\n" + fun.usage.trim()
+
+  // PART 4: Options
+  def argGroupStrs = fun.allArgumentGroups.collect{argGroup ->
+    def name = argGroup.name
+    def descriptionStr = argGroup.description == null ?
+      "" :
+      "\n    " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n    ") + "\n"
+    def arguments = argGroup.arguments.collect{arg -> 
+      arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg
+    }.findAll{it != null}
+    def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)}
+    
+    "\n\n$name:" +
+      descriptionStr +
+      argumentStrs.join("\n")
+  }
+
+  // FINAL: combine
+  def out = nameStr + 
+    descrStr +
+    usageStr + 
+    argGroupStrs.join("")
+
+  return out
+}
+
+// based on Format._paragraphWrap
+def _paragraphWrap(str, maxLength) {
+  def outLines = []
+  str.split("\n").each{par ->
+    def words = par.split("\\s").toList()
+
+    def word = null
+    def line = words.pop()
+    while(!words.isEmpty()) {
+      word = words.pop()
+      if (line.length() + word.length() + 1 <= maxLength) {
+        line = line + " " + word
+      } else {
+        outLines.add(line)
+        line = word
+      }
+    }
+    if (words.isEmpty()) {
+      outLines.add(line)
+    }
+  }
+  return outLines
+}
+
+def helpMessage(config) {
+  if (params.containsKey("help") && params.help) {
+    def mergedConfig = addGlobalArguments(config)
+    def helpStr = _generateHelp(mergedConfig)
+    println(helpStr)
+    exit 0
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf'
+def processConfig(config) {
+  // set defaults for arguments
+  config.arguments = 
+    (config.arguments ?: []).collect{_processArgument(it)}
+
+  // set defaults for argument_group arguments
+  config.argument_groups =
+    (config.argument_groups ?: []).collect{grp ->
+      grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)}
+      grp
+    }
+
+  // create combined arguments list
+  config.allArguments = 
+    config.arguments +
+    config.argument_groups.collectMany{it.arguments}
+
+  // add missing argument groups (based on Functionality::allArgumentGroups())
+  def argGroups = config.argument_groups
+  if (argGroups.any{it.name.toLowerCase() == "arguments"}) {
+    argGroups = argGroups.collect{ grp ->
+      if (grp.name.toLowerCase() == "arguments") {
+        grp = grp + [
+          arguments: grp.arguments + config.arguments
+        ]
+      }
+      grp
+    }
+  } else {
+    argGroups = argGroups + [
+      name: "Arguments",
+      arguments: config.arguments
+    ]
+  }
+  config.allArgumentGroups = argGroups
+
+  config
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf'
+
+def readConfig(file) {
+  def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml"))
+  processConfig(config)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf'
+/**
+  * Resolve a path relative to the current file.
+  * 
+  * @param str The path to resolve, as a String.
+  * @param parentPath The path to resolve relative to, as a Path.
+  *
+  * @return The path that may have been resovled, as a Path.
+  */
+def _resolveSiblingIfNotAbsolute(str, parentPath) {
+  if (str !instanceof String) {
+    return str
+  }
+  if (!_stringIsAbsolutePath(str)) {
+    return parentPath.resolveSibling(str)
+  } else {
+    return file(str, hidden: true)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf'
+/**
+  * Check whether a path as a string is absolute.
+  *
+  * In the past, we tried using `file(., relative: true).isAbsolute()`,
+  * but the 'relative' option was added in 22.10.0.
+  *
+  * @param path The path to check, as a String.
+  *
+  * @return Whether the path is absolute, as a boolean.
+  */
+def _stringIsAbsolutePath(path) {
+  def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/
+
+  assert path instanceof String
+  return _resolve_URL_PROTOCOL.matcher(path).matches()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf'
+class CustomTraceObserver implements nextflow.trace.TraceObserver {
+  List traces
+
+  CustomTraceObserver(List traces) {
+    this.traces = traces
+  }
+
+  @Override
+  void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+
+  @Override
+  void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+}
+
+def collectTraces() {
+  def traces = Collections.synchronizedList([])
+
+  // add custom trace observer which stores traces in the traces object
+  session.observers.add(new CustomTraceObserver(traces))
+
+  traces
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf'
+/**
+  * Performs a deep clone of the given object.
+  * @param x an object
+  */
+def deepClone(x) {
+  iterateMap(x, {it instanceof Cloneable ? it.clone() : it})
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf'
+def getPublishDir() {
+  return params.containsKey("publish_dir") ? params.publish_dir : 
+    params.containsKey("publishDir") ? params.publishDir : 
+    null
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf'
+
+// Recurse upwards until we find a '.build.yaml' file
+def _findBuildYamlFile(pathPossiblySymlink) {
+  def path = pathPossiblySymlink.toRealPath()
+  def child = path.resolve(".build.yaml")
+  if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) {
+    return child
+  } else {
+    def parent = path.getParent()
+    if (parent == null) {
+      return null
+    } else {
+      return _findBuildYamlFile(parent)
+    }
+  }
+}
+
+// get the root of the target folder
+def getRootDir() {
+  def dir = _findBuildYamlFile(meta.resources_dir)
+  assert dir != null: "Could not find .build.yaml in the folder structure"
+  dir.getParent()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf'
+/**
+  * Recursively apply a function over the leaves of an object.
+  * @param obj The object to iterate over.
+  * @param fun The function to apply to each value.
+  * @return The object with the function applied to each value.
+  */
+def iterateMap(obj, fun) {
+  if (obj instanceof List && obj !instanceof String) {
+    return obj.collect{item ->
+      iterateMap(item, fun)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectEntries{key, item ->
+      [key.toString(), iterateMap(item, fun)]
+    }
+  } else {
+    return fun(obj)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf'
+/**
+  * A view for printing the event of each channel as a YAML blob.
+  * This is useful for debugging.
+  */
+def niceView() {
+  workflow niceViewWf {
+    take: input
+    main:
+      output = input
+        | view{toYamlBlob(it)}
+    emit: output
+  }
+  return niceViewWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf'
+
+def readCsv(file_path) {
+  def output = []
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+
+  // todo: allow escaped quotes in string
+  // todo: allow single quotes?
+  def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''')
+  def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''')
+
+  def br = java.nio.file.Files.newBufferedReader(inputFile)
+
+  def row = -1
+  def header = null
+  while (br.ready() && header == null) {
+    def line = br.readLine()
+    row++
+    if (!line.startsWith("#")) {
+      header = splitRegex.split(line, -1).collect{field ->
+        m = removeQuote.matcher(field)
+        m.find() ? m.replaceFirst('$1') : field
+      }
+    }
+  }
+  assert header != null: "CSV file should contain a header"
+
+  while (br.ready()) {
+    def line = br.readLine()
+    row++
+    if (line == null) {
+      br.close()
+      break
+    }
+
+    if (!line.startsWith("#")) {
+      def predata = splitRegex.split(line, -1)
+      def data = predata.collect{field ->
+        if (field == "") {
+          return null
+        }
+        def m = removeQuote.matcher(field)
+        if (m.find()) {
+          return m.replaceFirst('$1')
+        } else {
+          return field
+        }
+      }
+      assert header.size() == data.size(): "Row $row should contain the same number as fields as the header"
+      
+      def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null}
+      output.add(dataMap)
+    }
+  }
+
+  output
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf'
+def readJson(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parse(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf'
+def readJsonBlob(str) {
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parseText(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf'
+// Custom constructor to modify how certain objects are parsed from YAML
+class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor {
+  Path root
+
+  class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct {
+    public Object construct(org.yaml.snakeyaml.nodes.Node node) {
+      String filename = (String) constructScalar(node);
+      if (root != null) {
+        return root.resolve(filename);
+      }
+      return java.nio.file.Paths.get(filename);
+    }
+  }
+
+  CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) {
+    super(options)
+    this.root = root
+    // Handling !file tag and parse it back to a File type
+    this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath())
+  }
+}
+
+def readTaggedYaml(Path path) {
+  def options = new org.yaml.snakeyaml.LoaderOptions()
+  def constructor = new CustomConstructor(options, path.getParent())
+  def yaml = new org.yaml.snakeyaml.Yaml(constructor)
+  return yaml.load(path.text)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf'
+def readYaml(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf'
+def readYamlBlob(str) {
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf'
+String toJsonBlob(data) {
+  return groovy.json.JsonOutput.toJson(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf'
+// Custom representer to modify how certain objects are represented in YAML
+class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer {
+  Path relativizer
+
+  class RepresentPath implements org.yaml.snakeyaml.representer.Represent {
+    public String getFileName(Object obj) {
+      if (obj instanceof File) {
+        obj = ((File) obj).toPath();
+      }
+      if (obj !instanceof Path) {
+        throw new IllegalArgumentException("Object: " + obj + " is not a Path or File");
+      }
+      def path = (Path) obj;
+
+      if (relativizer != null) {
+        return relativizer.relativize(path).toString()
+      } else {
+        return path.toString()
+      }
+    }
+
+    public org.yaml.snakeyaml.nodes.Node representData(Object data) {
+      String filename = getFileName(data);
+      def tag = new org.yaml.snakeyaml.nodes.Tag("!file");
+      return representScalar(tag, filename);
+    }
+  }
+  CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) {
+    super(options)
+    this.relativizer = relativizer
+    this.representers.put(sun.nio.fs.UnixPath, new RepresentPath())
+    this.representers.put(Path, new RepresentPath())
+    this.representers.put(File, new RepresentPath())
+  }
+}
+
+String toTaggedYamlBlob(data) {
+  return toRelativeTaggedYamlBlob(data, null)
+}
+String toRelativeTaggedYamlBlob(data, Path relativizer) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  def representer = new CustomRepresenter(options, relativizer)
+  def yaml = new org.yaml.snakeyaml.Yaml(representer, options)
+  return yaml.dump(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf'
+String toYamlBlob(data) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  options.setPrettyFlow(true)
+  def yaml = new org.yaml.snakeyaml.Yaml(options)
+  def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it })
+  return yaml.dump(cleanData)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf'
+void writeJson(data, file) {
+  assert data: "writeJson: data should not be null"
+  assert file: "writeJson: file should not be null"
+  file.write(toJsonBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf'
+void writeYaml(data, file) {
+  assert data: "writeYaml: data should not be null"
+  assert file: "writeYaml: file should not be null"
+  file.write(toYamlBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf'
+def findStates(Map params, Map config) {
+  def auto_config = deepClone(config)
+  def auto_params = deepClone(params)
+
+  auto_config = auto_config.clone()
+  // override arguments
+  auto_config.argument_groups = []
+  auto_config.arguments = [
+    [
+      type: "string",
+      name: "--id",
+      description: "A dummy identifier",
+      required: false
+    ],
+    [
+      type: "file",
+      name: "--input_states",
+      example: "/path/to/input/directory/**/state.yaml",
+      description: "Path to input directory containing the datasets to be integrated.",
+      required: true,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--filter",
+      example: "foo/.*/state.yaml",
+      description: "Regex to filter state files by path.",
+      required: false
+    ],
+    // to do: make this a yaml blob?
+    [
+      type: "string",
+      name: "--rename_keys",
+      example: ["newKey1:oldKey1", "newKey2:oldKey2"],
+      description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.",
+      required: false,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--settings",
+      example: '{"output_dataset": "dataset.h5ad", "k": 10}',
+      description: "Global arguments as a JSON glob to be passed to all components.",
+      required: false
+    ]
+  ]
+  if (!(auto_params.containsKey("id"))) {
+    auto_params["id"] = "auto"
+  }
+
+  // run auto config through processConfig once more
+  auto_config = processConfig(auto_config)
+
+  workflow findStatesWf {
+    helpMessage(auto_config)
+
+    output_ch = 
+      channelFromParams(auto_params, auto_config)
+        | flatMap { autoId, args ->
+
+          def globalSettings = args.settings ? readYamlBlob(args.settings) : [:]
+
+          // look for state files in input dir
+          def stateFiles = args.input_states
+
+          // filter state files by regex
+          if (args.filter) {
+            stateFiles = stateFiles.findAll{ stateFile ->
+              def stateFileStr = stateFile.toString()
+              def matcher = stateFileStr =~ args.filter
+              matcher.matches()}
+          }
+
+          // read in states
+          def states = stateFiles.collect { stateFile ->
+            def state_ = readTaggedYaml(stateFile)
+            [state_.id, state_]
+          }
+
+          // construct renameMap
+          if (args.rename_keys) {
+            def renameMap = args.rename_keys.collectEntries{renameString ->
+              def split = renameString.split(":")
+              assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey', or 'newKey:oldKey;newKey:oldKey' in case of multiple values"
+              split
+            }
+
+            // rename keys in state, only let states through which have all keys
+            // also add global settings
+            states = states.collectMany{id, state ->
+              def newState = [:]
+
+              for (key in renameMap.keySet()) {
+                def origKey = renameMap[key]
+                if (!(state.containsKey(origKey))) {
+                  return []
+                }
+                newState[key] = state[origKey]
+              }
+
+              [[id, globalSettings + newState]]
+            }
+          }
+
+          states
+        }
+    emit:
+    output_ch
+  }
+
+  return findStatesWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf'
+def joinStates(Closure apply_) {
+  workflow joinStatesWf {
+    take: input_ch
+    main:
+    output_ch = input_ch
+      | toSortedList
+      | filter{ it.size() > 0 }
+      | map{ tups ->
+        def ids = tups.collect{it[0]}
+        def states = tups.collect{it[1]}
+        apply_(ids, states)
+      }
+
+    emit: output_ch
+  }
+  return joinStatesWf
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf'
+def collectFiles(obj) {
+  if (obj instanceof java.io.File || obj instanceof Path)  {
+    return [obj]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.collectMany{item ->
+      collectFiles(item)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectFiles(item)
+    }
+  } else {
+    return []
+  }
+}
+
+/**
+ * Recurse through a state and collect all input files and their target output filenames.
+ * @param obj The state to recurse through.
+ * @param prefix The prefix to prepend to the output filenames.
+ */
+def collectInputOutputPaths(obj, prefix) {
+  if (obj instanceof File || obj instanceof Path)  {
+    def path = obj instanceof Path ? obj : obj.toPath()
+    def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: ""
+    def newFilename = prefix + ext
+    return [[obj, newFilename]]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.withIndex().collectMany{item, ix ->
+      collectInputOutputPaths(item, prefix + "_" + ix)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectInputOutputPaths(item, prefix + "." + key)
+    }
+  } else {
+    return []
+  }
+}
+
+def publishStates(Map args) {
+  def key_ = args.get("key")
+  def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml'))
+
+  assert key_ != null : "publishStates: key must be specified"
+  
+  workflow publishStatesWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1]
+
+          // the input files and the target output filenames
+          def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose()
+          def inputFiles_ = inputoutputFilenames_[0]
+          def outputFilenames_ = inputoutputFilenames_[1]
+
+          def yamlFilename = yamlTemplate_
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+
+            // TODO: do the pathnames in state_ match up with the outputFilenames_?
+
+          // convert state to yaml blob
+          def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename))
+
+          [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesWf
+}
+process publishStatesProc {
+  // todo: check publishpath?
+  publishDir path: "${getPublishDir()}/", mode: "copy"
+  tag "$id"
+  input:
+    tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles)
+  output:
+    tuple val(id), path{[yamlFile] + outputFiles}
+  script:
+  def copyCommands = [
+    inputFiles instanceof List ? inputFiles : [inputFiles],
+    outputFiles instanceof List ? outputFiles : [outputFiles]
+  ]
+    .transpose()
+    .collectMany{infile, outfile ->
+      if (infile.toString() != outfile.toString()) {
+        [
+          "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"",
+          "cp -r '${infile.toString()}' '${outfile.toString()}'"
+        ]
+      } else {
+        // no need to copy if infile is the same as outfile
+        []
+      }
+    }
+  """
+mkdir -p "\$(dirname '${yamlFile}')"
+echo "Storing state as yaml"
+echo '${yamlBlob}' > '${yamlFile}'
+echo "Copying output files to destination folder"
+${copyCommands.join("\n  ")}
+"""
+}
+
+
+// this assumes that the state contains no other values other than those specified in the config
+def publishStatesByConfig(Map args) {
+  def config = args.get("config")
+  assert config != null : "publishStatesByConfig: config must be specified"
+
+  def key_ = args.get("key", config.name)
+  assert key_ != null : "publishStatesByConfig: key must be specified"
+  
+  workflow publishStatesSimpleWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10]
+          def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad']
+
+          // TODO: allow overriding the state.yaml template
+          // TODO TODO: if auto.publish == "state", add output_state as an argument
+          def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml'
+          def yamlFilename = yamlTemplate
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+          def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent()
+
+          // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where
+          //   - key is a String
+          //   - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path)
+          //   - inputPath is a List[Path]
+          //   - outputFilename is a List[String]
+          //   - (key, value) are the tuples that will be saved to the state.yaml file
+          //   - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml)
+          def processedState =
+            config.allArguments
+              .findAll { it.direction == "output" }
+              .collectMany { par ->
+                def plainName_ = par.plainName
+                // if the state does not contain the key, it's an
+                // optional argument for which the component did 
+                // not generate any output
+                if (!state_.containsKey(plainName_)) {
+                  return []
+                }
+                def value = state_[plainName_]
+                // if the parameter is not a file, it should be stored
+                // in the state as-is, but is not something that needs 
+                // to be copied from the source path to the dest path
+                if (par.type != "file") {
+                  return [[key: plainName_, value: value, inputPath: [], outputFilename: []]]
+                }
+                // if the orig state does not contain this filename,
+                // it's an optional argument for which the user specified
+                // that it should not be returned as a state
+                if (!origState_.containsKey(plainName_)) {
+                  return []
+                }
+                def filenameTemplate = origState_[plainName_]
+                // if the pararameter is multiple: true, fetch the template
+                if (par.multiple && filenameTemplate instanceof List) {
+                  filenameTemplate = filenameTemplate[0]
+                }
+                // instantiate the template
+                def filename = filenameTemplate
+                  .replaceAll('\\$id', id_)
+                  .replaceAll('\\$\\{id\\}', id_)
+                  .replaceAll('\\$key', key_)
+                  .replaceAll('\\$\\{key\\}', key_)
+                if (par.multiple) {
+                  // if the parameter is multiple: true, the filename
+                  // should contain a wildcard '*' that is replaced with
+                  // the index of the file
+                  assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}"
+                  def outputPerFile = value.withIndex().collect{ val, ix ->
+                    def filename_ix = filename.replace("*", ix.toString())
+                    def value_ = java.nio.file.Paths.get(filename_ix)
+                    // if id contains a slash
+                    if (yamlDir != null) {
+                      value_ = yamlDir.relativize(value_)
+                    }
+                    def inputPath = val instanceof File ? val.toPath() : val
+                    [value: value_, inputPath: inputPath, outputFilename: filename_ix]
+                  }
+                  def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> 
+                    [key, outputPerFile.collect{dic -> dic[key]}]
+                  }
+                  return [[key: plainName_] + transposedOutputs]
+                } else {
+                  def value_ = java.nio.file.Paths.get(filename)
+                  // if id contains a slash
+                  if (yamlDir != null) {
+                    value_ = yamlDir.relativize(value_)
+                  }
+                  def inputPath = value instanceof File ? value.toPath() : value
+                  return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]]
+                }
+              }
+          
+          def updatedState_ = processedState.collectEntries{[it.key, it.value]}
+          def inputPaths = processedState.collectMany{it.inputPath}
+          def outputFilenames = processedState.collectMany{it.outputFilename}
+          
+          // convert state to yaml blob
+          def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_)
+
+          [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesSimpleWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf'
+def setState(fun) {
+  assert fun instanceof Closure || fun instanceof Map || fun instanceof List :
+    "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}"
+
+  // if fun is a List, convert to map
+  if (fun instanceof List) {
+    // check whether fun is a list[string]
+    assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings"
+    fun = fun.collectEntries{[it, it]}
+  }
+
+  // if fun is a map, convert to closure
+  if (fun instanceof Map) {
+    // check whether fun is a map[string, string]
+    assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings"
+    assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings"
+    def funMap = fun.clone()
+    // turn the map into a closure to be used later on
+    fun = { id_, state_ ->
+      assert state_ instanceof Map : "Error in setState: the state is not a Map"
+      funMap.collectMany{newkey, origkey ->
+        if (state_.containsKey(origkey)) {
+          [[newkey, state_[origkey]]]
+        } else {
+          []
+        }
+      }.collectEntries()
+    }
+  }
+
+  map { tup ->
+    def id = tup[0]
+    def state = tup[1]
+    def unfilteredState = fun(id, state)
+    def newState = unfilteredState.findAll{key, val -> val != null}
+    [id, newState] + tup.drop(2)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf'
+// TODO: unit test processAuto
+def processAuto(Map auto) {
+  // remove null values
+  auto = auto.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"]
+  def unexpectedKeys = auto.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'"
+
+  // check auto.simplifyInput
+  assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean"
+
+  // check auto.simplifyOutput
+  assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean"
+
+  // check auto.transcript
+  assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean"
+
+  // check auto.publish
+  assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'"
+
+  return auto.subMap(expectedKeys)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf'
+def assertMapKeys(map, expectedKeys, requiredKeys, mapName) {
+  assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}"
+  map.forEach { key, val -> 
+    assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+  requiredKeys.forEach { requiredKey -> 
+    assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+}
+
+// TODO: unit test processDirectives
+def processDirectives(Map drctv) {
+  // remove null values
+  drctv = drctv.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = [
+    "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time"
+  ]
+  def unexpectedKeys = drctv.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'"
+
+  /* DIRECTIVE accelerator
+    accepted examples:
+    - [ limit: 4, type: "nvidia-tesla-k80" ]
+  */
+  if (drctv.containsKey("accelerator")) {
+    assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator")
+  }
+
+  /* DIRECTIVE afterScript
+    accepted examples:
+    - "source /cluster/bin/cleanup"
+  */
+  if (drctv.containsKey("afterScript")) {
+    assert drctv["afterScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE beforeScript
+    accepted examples:
+    - "source /cluster/bin/setup"
+  */
+  if (drctv.containsKey("beforeScript")) {
+    assert drctv["beforeScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cache
+    accepted examples:
+    - true
+    - false
+    - "deep"
+    - "lenient"
+  */
+  if (drctv.containsKey("cache")) {
+    assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean
+    if (drctv["cache"] instanceof CharSequence) {
+      assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache"
+    }
+  }
+
+  /* DIRECTIVE conda
+    accepted examples:
+    - "bwa=0.7.15"
+    - "bwa=0.7.15 fastqc=0.11.5"
+    - ["bwa=0.7.15", "fastqc=0.11.5"]
+  */
+  if (drctv.containsKey("conda")) {
+    if (drctv["conda"] instanceof List) {
+      drctv["conda"] = drctv["conda"].join(" ")
+    }
+    assert drctv["conda"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE container
+    accepted examples:
+    - "foo/bar:tag"
+    - [ registry: "reg", image: "im", tag: "ta" ]
+      is transformed to "reg/im:ta"
+    - [ image: "im" ] 
+      is transformed to "im:latest"
+  */
+  if (drctv.containsKey("container")) {
+    assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence
+    if (drctv["container"] instanceof Map) {
+      def m = drctv["container"]
+      assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container")
+      def part1 = 
+        System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : 
+        params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove?
+        m.registry ? m.registry + "/" : 
+        ""
+      def part2 = m.image
+      def part3 = m.tag ? ":" + m.tag : ":latest"
+      drctv["container"] = part1 + part2 + part3
+    }
+  }
+
+  /* DIRECTIVE containerOptions
+    accepted examples:
+    - "--foo bar"
+    - ["--foo bar", "-f b"]
+  */
+  if (drctv.containsKey("containerOptions")) {
+    if (drctv["containerOptions"] instanceof List) {
+      drctv["containerOptions"] = drctv["containerOptions"].join(" ")
+    }
+    assert drctv["containerOptions"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cpus
+    accepted examples:
+    - 1
+    - 10
+  */
+  if (drctv.containsKey("cpus")) {
+    assert drctv["cpus"] instanceof Integer
+  }
+
+  /* DIRECTIVE disk
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("disk")) {
+    assert drctv["disk"] instanceof CharSequence
+    // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE echo
+    accepted examples:
+    - true
+    - false
+  */
+  if (drctv.containsKey("echo")) {
+    assert drctv["echo"] instanceof Boolean
+  }
+
+  /* DIRECTIVE errorStrategy
+    accepted examples:
+    - "terminate"
+    - "finish"
+  */
+  if (drctv.containsKey("errorStrategy")) {
+    assert drctv["errorStrategy"] instanceof CharSequence
+    assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy"
+  }
+
+  /* DIRECTIVE executor
+    accepted examples:
+    - "local"
+    - "sge"
+  */
+  if (drctv.containsKey("executor")) {
+    assert drctv["executor"] instanceof CharSequence
+    assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor"
+  }
+
+  /* DIRECTIVE machineType
+    accepted examples:
+    - "n1-highmem-8"
+  */
+  if (drctv.containsKey("machineType")) {
+    assert drctv["machineType"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE maxErrors
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxErrors")) {
+    assert drctv["maxErrors"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxForks
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxForks")) {
+    assert drctv["maxForks"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxRetries
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxRetries")) {
+    assert drctv["maxRetries"] instanceof Integer
+  }
+
+  /* DIRECTIVE memory
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("memory")) {
+    assert drctv["memory"] instanceof CharSequence
+    // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE module
+    accepted examples:
+    - "ncbi-blast/2.2.27"
+    - "ncbi-blast/2.2.27:t_coffee/10.0"
+    - ["ncbi-blast/2.2.27", "t_coffee/10.0"]
+  */
+  if (drctv.containsKey("module")) {
+    if (drctv["module"] instanceof List) {
+      drctv["module"] = drctv["module"].join(":")
+    }
+    assert drctv["module"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE penv
+    accepted examples:
+    - "smp"
+  */
+  if (drctv.containsKey("penv")) {
+    assert drctv["penv"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE pod
+    accepted examples:
+    - [ label: "key", value: "val" ]
+    - [ annotation: "key", value: "val" ]
+    - [ env: "key", value: "val" ]
+    - [ [label: "l", value: "v"], [env: "e", value: "v"]]
+  */
+  if (drctv.containsKey("pod")) {
+    if (drctv["pod"] instanceof Map) {
+      drctv["pod"] = [ drctv["pod"] ]
+    }
+    assert drctv["pod"] instanceof List
+    drctv["pod"].forEach { pod ->
+      assert pod instanceof Map
+      // TODO: should more checks be added?
+      // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod
+      // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...?
+    }
+  }
+
+  /* DIRECTIVE publishDir
+    accepted examples:
+    - []
+    - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ]
+    - "/path/to/dir" 
+      is transformed to [[ path: "/path/to/dir" ]]
+    - [ path: "/path/to/dir", mode: "cache" ]
+      is transformed to [[ path: "/path/to/dir", mode: "cache" ]]
+  */
+  // TODO: should we also look at params["publishDir"]?
+  if (drctv.containsKey("publishDir")) {
+    def pblsh = drctv["publishDir"]
+    
+    // check different options
+    assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence
+    
+    // turn into list if not already so
+    // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work.
+    pblsh = pblsh instanceof List ? pblsh : [ pblsh ]
+
+    // check elements of publishDir
+    pblsh = pblsh.collect{ elem ->
+      // turn into map if not already so
+      elem = elem instanceof CharSequence ? [ path: elem ] : elem
+
+      // check types and keys
+      assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}"
+      assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir")
+
+      // check elements in map
+      assert elem.containsKey("path")
+      assert elem["path"] instanceof CharSequence
+      if (elem.containsKey("mode")) {
+        assert elem["mode"] instanceof CharSequence
+        assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ]
+      }
+      if (elem.containsKey("overwrite")) {
+        assert elem["overwrite"] instanceof Boolean
+      }
+      if (elem.containsKey("pattern")) {
+        assert elem["pattern"] instanceof CharSequence
+      }
+      if (elem.containsKey("saveAs")) {
+        assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'"
+      }
+      if (elem.containsKey("enabled")) {
+        assert elem["enabled"] instanceof Boolean
+      }
+
+      // return final result
+      elem
+    }
+    // store final directive
+    drctv["publishDir"] = pblsh
+  }
+
+  /* DIRECTIVE queue
+    accepted examples:
+    - "long"
+    - "short,long"
+    - ["short", "long"]
+  */
+  if (drctv.containsKey("queue")) {
+    if (drctv["queue"] instanceof List) {
+      drctv["queue"] = drctv["queue"].join(",")
+    }
+    assert drctv["queue"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE label
+    accepted examples:
+    - "big_mem"
+    - "big_cpu"
+    - ["big_mem", "big_cpu"]
+  */
+  if (drctv.containsKey("label")) {
+    if (drctv["label"] instanceof CharSequence) {
+      drctv["label"] = [ drctv["label"] ]
+    }
+    assert drctv["label"] instanceof List
+    drctv["label"].forEach { label ->
+      assert label instanceof CharSequence
+      // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?")
+      // ^ does not allow closures
+    }
+  }
+
+  /* DIRECTIVE scratch
+    accepted examples:
+    - true
+    - "/path/to/scratch"
+    - '$MY_PATH_TO_SCRATCH'
+    - "ram-disk"
+  */
+  if (drctv.containsKey("scratch")) {
+    assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE storeDir
+    accepted examples:
+    - "/path/to/storeDir"
+  */
+  if (drctv.containsKey("storeDir")) {
+    assert drctv["storeDir"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE stageInMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageInMode")) {
+    assert drctv["stageInMode"] instanceof CharSequence
+    assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"]
+  }
+
+  /* DIRECTIVE stageOutMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageOutMode")) {
+    assert drctv["stageOutMode"] instanceof CharSequence
+    assert drctv["stageOutMode"] in ["copy", "move", "rsync"]
+  }
+
+  /* DIRECTIVE tag
+    accepted examples:
+    - "foo"
+    - '$id'
+  */
+  if (drctv.containsKey("tag")) {
+    assert drctv["tag"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE time
+    accepted examples:
+    - "1h"
+    - "2days"
+    - "1day 6hours 3minutes 30seconds"
+  */
+  if (drctv.containsKey("time")) {
+    assert drctv["time"] instanceof CharSequence
+    // todo: validation regex?
+  }
+
+  return drctv
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf'
+def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) {
+  // override defaults with args
+  def workflowArgs = defaultWfArgs + args
+
+  // check whether 'key' exists
+  assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument"
+
+  // if 'key' is a closure, apply it to the original key
+  if (workflowArgs["key"] instanceof Closure) {
+    workflowArgs["key"] = workflowArgs["key"](meta.config.name)
+  }
+  def key = workflowArgs["key"]
+  assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}"
+  assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}"
+
+  // check for any unexpected keys
+  def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"]
+  def unexpectedKeys = workflowArgs.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'"
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument"
+  assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}"
+  workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"])
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument"
+  assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}"
+  workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"])
+
+  // auto define publish, if so desired
+  if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.publish_dir = \"./output/\""
+    def publishDir = getPublishDir()
+    
+    if (publishDir != null) {
+      workflowArgs.directives.publishDir = [[ 
+        path: publishDir, 
+        saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default
+        mode: "copy"
+      ]]
+    }
+  }
+
+  // auto define transcript, if so desired
+  if (workflowArgs.auto.transcript == true) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.transcripts_dir = \"./transcripts/\""
+    def transcriptsDir = 
+      params.containsKey("transcripts_dir") ? params.transcripts_dir : 
+      params.containsKey("transcriptsDir") ? params.transcriptsDir : 
+      params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" :
+      params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : 
+      null
+    if (transcriptsDir != null) {
+      def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss')
+      def transcriptsPublishDir = [ 
+        path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/",
+        saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", 
+        mode: "copy"
+      ]
+      def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : []
+      workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir
+    }
+  }
+
+  // if this is a stubrun, remove certain directives?
+  if (workflow.stubRun) {
+    workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"])
+  }
+
+  for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam]) {
+      assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}"
+    }
+  }
+
+  // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well?
+  for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) {
+      log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead."
+    }
+  }
+
+  // check fromState
+  workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config)
+
+  // check toState
+  workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config)
+
+  // return output
+  return workflowArgs
+}
+
+def _processFromState(fromState, key_, config_) {
+  assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List :
+    "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}"
+  if (fromState == null) {
+    return null
+  }
+  
+  // if fromState is a List, convert to map
+  if (fromState instanceof List) {
+    // check whether fromstate is a list[string]
+    assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings"
+    fromState = fromState.collectEntries{[it, it]}
+  }
+
+  // if fromState is a map, convert to closure
+  if (fromState instanceof Map) {
+    // check whether fromstate is a map[string, string]
+    assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings"
+    assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings"
+    def fromStateMap = fromState.clone()
+    def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    fromState = { it ->
+      def state = it[1]
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def data = fromStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (state.containsKey(origkey)) {
+          [[newkey, state[origkey]]]
+        } else if (!requiredInputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state")
+        }
+      }.collectEntries()
+      data
+    }
+  }
+  
+  return fromState
+}
+
+def _processToState(toState, key_, config_) {
+  if (toState == null) {
+    toState = { tup -> tup[1] }
+  }
+
+  // toState should be a closure, map[string, string], or list[string]
+  assert toState instanceof Closure || toState instanceof Map || toState instanceof List :
+    "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}"
+
+  // if toState is a List, convert to map
+  if (toState instanceof List) {
+    // check whether toState is a list[string]
+    assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings"
+    toState = toState.collectEntries{[it, it]}
+  }
+
+  // if toState is a map, convert to closure
+  if (toState instanceof Map) {
+    // check whether toState is a map[string, string]
+    assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings"
+    assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings"
+    def toStateMap = toState.clone()
+    def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    toState = { it ->
+      def output = it[1]
+      def state = it[2]
+      assert output instanceof Map : "Error in module '$key_': the output is not a Map"
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def extraEntries = toStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (output.containsKey(origkey)) {
+          [[newkey, output[origkey]]]
+        } else if (!requiredOutputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output")
+        }
+      }.collectEntries()
+      state + extraEntries
+    }
+  }
+
+  return toState
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf'
+def _debug(workflowArgs, debugKey) {
+  if (workflowArgs.debug) {
+    view { "process '${workflowArgs.key}' $debugKey tuple: $it"  }
+  } else {
+    map { it }
+  }
+}
+
+// depends on: innerWorkflowFactory
+def workflowFactory(Map args, Map defaultWfArgs, Map meta) {
+  def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta)
+  def key_ = workflowArgs["key"]
+  
+  workflow workflowInstance {
+    take: input_
+
+    main:
+    def chModified = input_
+      | checkUniqueIds([:])
+      | _debug(workflowArgs, "input")
+      | map { tuple ->
+        tuple = deepClone(tuple)
+        
+        if (workflowArgs.map) {
+          tuple = workflowArgs.map(tuple)
+        }
+        if (workflowArgs.mapId) {
+          tuple[0] = workflowArgs.mapId(tuple[0])
+        }
+        if (workflowArgs.mapData) {
+          tuple[1] = workflowArgs.mapData(tuple[1])
+        }
+        if (workflowArgs.mapPassthrough) {
+          tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2))
+        }
+
+        // check tuple
+        assert tuple instanceof List : 
+          "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}"
+        assert tuple.size() >= 2 : 
+          "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: tuple.size() == ${tuple.size()}"
+        
+        // check id field
+        if (tuple[0] instanceof GString) {
+          tuple[0] = tuple[0].toString()
+        }
+        assert tuple[0] instanceof CharSequence : 
+          "Error in module '${key_}': first element of tuple in channel should be a String\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: ${tuple[0]}"
+        
+        // match file to input file
+        if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) {
+          def inputFiles = meta.config.allArguments
+            .findAll { it.type == "file" && it.direction == "input" }
+          
+          assert inputFiles.size() == 1 : 
+              "Error in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Anonymous file inputs are only allowed when the process has exactly one file input.\n" +
+              "  Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}"
+
+          tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries()
+        }
+
+        // check data field
+        assert tuple[1] instanceof Map : 
+          "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+        // rename keys of data field in tuple
+        if (workflowArgs.renameKeys) {
+          assert workflowArgs.renameKeys instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}"
+          assert tuple[1] instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+          // TODO: allow renameKeys to be a function?
+          workflowArgs.renameKeys.each { newKey, oldKey ->
+            assert newKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}"
+            assert oldKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}"
+            assert tuple[1].containsKey(oldKey) : 
+              "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" +
+              "  Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'"
+            tuple[1].put(newKey, tuple[1][oldKey])
+          }
+          tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey })
+        }
+        tuple
+      }
+
+
+    def chRun = null
+    def chPassthrough = null
+    if (workflowArgs.runIf) {
+      def runIfBranch = chModified.branch{ tup ->
+        run: workflowArgs.runIf(tup[0], tup[1])
+        passthrough: true
+      }
+      chRun = runIfBranch.run
+      chPassthrough = runIfBranch.passthrough
+    } else {
+      chRun = chModified
+      chPassthrough = Channel.empty()
+    }
+
+    def chRunFiltered = workflowArgs.filter ?
+      chRun | filter{workflowArgs.filter(it)} :
+      chRun
+
+    def chArgs = workflowArgs.fromState ? 
+      chRunFiltered | map{
+        def new_data = workflowArgs.fromState(it.take(2))
+        [it[0], new_data]
+      } :
+      chRunFiltered | map {tup -> tup.take(2)}
+
+    // fill in defaults
+    def chArgsWithDefaults = chArgs
+      | map { tuple ->
+        def id_ = tuple[0]
+        def data_ = tuple[1]
+
+        // TODO: could move fromState to here
+
+        // fetch default params from functionality
+        def defaultArgs = meta.config.allArguments
+          .findAll { it.containsKey("default") }
+          .collectEntries { [ it.plainName, it.default ] }
+
+        // fetch overrides in params
+        def paramArgs = meta.config.allArguments
+          .findAll { par ->
+            def argKey = key_ + "__" + par.plainName
+            params.containsKey(argKey)
+          }
+          .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] }
+        
+        // fetch overrides in data
+        def dataArgs = meta.config.allArguments
+          .findAll { data_.containsKey(it.plainName) }
+          .collectEntries { [ it.plainName, data_[it.plainName] ] }
+        
+        // combine params
+        def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs
+
+        // remove arguments with explicit null values
+        combinedArgs
+          .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"}
+
+        combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_)
+
+        [id_, combinedArgs] + tuple.drop(2)
+      }
+
+    // TODO: move some of the _meta.join_id wrangling to the safeJoin() function.
+    def chInitialOutput = chArgsWithDefaults
+      | _debug(workflowArgs, "processed")
+      // run workflow
+      | innerWorkflowFactory(workflowArgs)
+      // check output tuple
+      | map { id_, output_ ->
+
+        // see if output map contains metadata
+        def meta_ =
+          output_ instanceof Map && output_.containsKey("_meta") ? 
+          output_["_meta"] :
+          [:]
+        def join_id = meta_.join_id ?: id_
+        
+        // remove metadata
+        output_ = output_.findAll{k, v -> k != "_meta"}
+
+        // check value types
+        output_ = _processOutputValues(output_, meta.config, id_, key_)
+
+        // simplify output if need be
+        if (workflowArgs.auto.simplifyOutput && output_.size() == 1) {
+          output_ = output_.values()[0]
+        }
+
+        [join_id, id_, output_]
+      }
+      // | view{"chInitialOutput: ${it.take(3)}"}
+
+    // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...]
+    def chNewState = safeJoin(chInitialOutput, chRunFiltered, key_)
+      // input tuple format: [join_id, id, output, prev_state, ...]
+      // output tuple format: [join_id, id, new_state, ...]
+      | map{ tup ->
+        def new_state = workflowArgs.toState(tup.drop(1).take(3))
+        tup.take(2) + [new_state] + tup.drop(4)
+      }
+
+    if (workflowArgs.auto.publish == "state") {
+      def chPublish = chNewState
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [join_id, id, new_state]
+        | map{ tup ->
+          tup.take(3)
+        }
+
+      safeJoin(chPublish, chArgsWithDefaults, key_)
+        // input tuple format: [join_id, id, new_state, orig_state, ...]
+        // output tuple format: [id, new_state, orig_state]
+        | map { tup ->
+          tup.drop(1).take(3)
+      }
+        | publishStatesByConfig(key: key_, config: meta.config)
+    }
+
+    // remove join_id and meta
+    chReturn = chNewState
+      | map { tup ->
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [id, new_state, ...]
+        tup.drop(1)
+      }
+      | _debug(workflowArgs, "output")
+      | concat(chPassthrough)
+
+    emit: chReturn
+  }
+
+  def wf = workflowInstance.cloneWithName(key_)
+
+  // add factory function
+  wf.metaClass.run = { runArgs ->
+    workflowFactory(runArgs, workflowArgs, meta)
+  }
+  // add config to module for later introspection
+  wf.metaClass.config = meta.config
+
+  return wf
+}
+
+nextflow.enable.dsl=2
+
+// START COMPONENT-SPECIFIC CODE
+
+// create meta object
+meta = [
+  "resources_dir": moduleDir.toRealPath().normalize(),
+  "config": processConfig(readJsonBlob('''{
+  "name" : "agat_sp_filter_feature_from_kill_list",
+  "namespace" : "agat",
+  "version" : "main",
+  "authors" : [
+    {
+      "name" : "Leïla Paquay",
+      "roles" : [
+        "author",
+        "maintainer"
+      ],
+      "info" : {
+        "links" : {
+          "email" : "leila@data-intuitive.com",
+          "github" : "Leila011",
+          "linkedin" : "leilapaquay"
+        },
+        "organizations" : [
+          {
+            "name" : "Data Intuitive",
+            "href" : "https://www.data-intuitive.com",
+            "role" : "Software Developer"
+          }
+        ]
+      }
+    }
+  ],
+  "argument_groups" : [
+    {
+      "name" : "Inputs",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--gff",
+          "alternatives" : [
+            "-f",
+            "--ref",
+            "--reffile"
+          ],
+          "description" : "Input GFF3 file that will be read.",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "file",
+          "name" : "--kill_list",
+          "alternatives" : [
+            "--kl"
+          ],
+          "description" : "Text file containing the kill list. One value per line.",
+          "example" : [
+            "kill_list.txt"
+          ],
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Outputs",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--output",
+          "alternatives" : [
+            "-o",
+            "--out"
+          ],
+          "description" : "Path to the output GFF file that contains filtered features. \n",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Arguments",
+      "arguments" : [
+        {
+          "type" : "string",
+          "name" : "--type",
+          "alternatives" : [
+            "-p",
+            "-l"
+          ],
+          "description" : "Primary tag option, case insensitive, list. Allow to specify the feature types that \nwill be handled. \n\nYou can specify a specific feature by giving its primary tag name (column 3) as: \n\n  * cds\n  * Gene\n  * mRNA\n  \nYou can specify directly all the feature of a particular\nlevel: \n\n  * level2=mRNA,ncRNA,tRNA,etc \n  * level3=CDS,exon,UTR,etc. \n\nBy default all features are taken into account. Fill the option with the value \\"all\\" will \nhave the same behaviour.\n",
+          "required" : false,
+          "direction" : "input",
+          "multiple" : true,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "string",
+          "name" : "--attribute",
+          "alternatives" : [
+            "-a"
+          ],
+          "description" : "Attribute tag to specify the attribute to analyse. Case sensitive. Default: ID\n",
+          "example" : [
+            "ID"
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "file",
+          "name" : "--config",
+          "alternatives" : [
+            "-c"
+          ],
+          "description" : "AGAT config file. By default AGAT takes the original agat_config.yaml shipped with AGAT.\nThe `--config` option gives you the possibility to use your own AGAT config file (located \nelsewhere or named differently).\n",
+          "example" : [
+            "custom_agat_config.yaml"
+          ],
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "boolean_true",
+          "name" : "--verbose",
+          "alternatives" : [
+            "-v"
+          ],
+          "description" : "Verbose option for debugging purpose.",
+          "direction" : "input"
+        }
+      ]
+    }
+  ],
+  "resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "script.sh",
+      "is_executable" : true
+    }
+  ],
+  "description" : "Remove features based on a kill list. The default behaviour is to look at the features's ID. \nIf the feature has an ID (case insensitive) listed among the kill list it will be removed.\nRemoving a level1 or level2 feature will automatically remove all linked subfeatures, and \nremoving all children of a feature will automatically remove this feature too.\n",
+  "test_resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "test.sh",
+      "is_executable" : true
+    },
+    {
+      "type" : "file",
+      "path" : "test_data"
+    }
+  ],
+  "status" : "enabled",
+  "requirements" : {
+    "commands" : [
+      "ps"
+    ]
+  },
+  "keywords" : [
+    "gene annotations",
+    "filtering",
+    "gff"
+  ],
+  "license" : "GPL-3.0",
+  "references" : {
+    "doi" : [
+      "10.5281/zenodo.3552717"
+    ]
+  },
+  "links" : {
+    "repository" : "https://github.com/NBISweden/AGAT",
+    "homepage" : "https://github.com/NBISweden/AGAT",
+    "documentation" : "https://agat.readthedocs.io/en/latest/tools/agat_sp_filter_feature_from_kill_list.html",
+    "issue_tracker" : "https://github.com/NBISweden/AGAT/issues"
+  },
+  "runners" : [
+    {
+      "type" : "executable",
+      "id" : "executable",
+      "docker_setup_strategy" : "ifneedbepullelsecachedbuild"
+    },
+    {
+      "type" : "nextflow",
+      "id" : "nextflow",
+      "directives" : {
+        "tag" : "$id"
+      },
+      "auto" : {
+        "simplifyInput" : true,
+        "simplifyOutput" : false,
+        "transcript" : false,
+        "publish" : false
+      },
+      "config" : {
+        "labels" : {
+          "mem1gb" : "memory = 1000000000.B",
+          "mem2gb" : "memory = 2000000000.B",
+          "mem5gb" : "memory = 5000000000.B",
+          "mem10gb" : "memory = 10000000000.B",
+          "mem20gb" : "memory = 20000000000.B",
+          "mem50gb" : "memory = 50000000000.B",
+          "mem100gb" : "memory = 100000000000.B",
+          "mem200gb" : "memory = 200000000000.B",
+          "mem500gb" : "memory = 500000000000.B",
+          "mem1tb" : "memory = 1000000000000.B",
+          "mem2tb" : "memory = 2000000000000.B",
+          "mem5tb" : "memory = 5000000000000.B",
+          "mem10tb" : "memory = 10000000000000.B",
+          "mem20tb" : "memory = 20000000000000.B",
+          "mem50tb" : "memory = 50000000000000.B",
+          "mem100tb" : "memory = 100000000000000.B",
+          "mem200tb" : "memory = 200000000000000.B",
+          "mem500tb" : "memory = 500000000000000.B",
+          "mem1gib" : "memory = 1073741824.B",
+          "mem2gib" : "memory = 2147483648.B",
+          "mem4gib" : "memory = 4294967296.B",
+          "mem8gib" : "memory = 8589934592.B",
+          "mem16gib" : "memory = 17179869184.B",
+          "mem32gib" : "memory = 34359738368.B",
+          "mem64gib" : "memory = 68719476736.B",
+          "mem128gib" : "memory = 137438953472.B",
+          "mem256gib" : "memory = 274877906944.B",
+          "mem512gib" : "memory = 549755813888.B",
+          "mem1tib" : "memory = 1099511627776.B",
+          "mem2tib" : "memory = 2199023255552.B",
+          "mem4tib" : "memory = 4398046511104.B",
+          "mem8tib" : "memory = 8796093022208.B",
+          "mem16tib" : "memory = 17592186044416.B",
+          "mem32tib" : "memory = 35184372088832.B",
+          "mem64tib" : "memory = 70368744177664.B",
+          "mem128tib" : "memory = 140737488355328.B",
+          "mem256tib" : "memory = 281474976710656.B",
+          "mem512tib" : "memory = 562949953421312.B",
+          "cpu1" : "cpus = 1",
+          "cpu2" : "cpus = 2",
+          "cpu5" : "cpus = 5",
+          "cpu10" : "cpus = 10",
+          "cpu20" : "cpus = 20",
+          "cpu50" : "cpus = 50",
+          "cpu100" : "cpus = 100",
+          "cpu200" : "cpus = 200",
+          "cpu500" : "cpus = 500",
+          "cpu1000" : "cpus = 1000"
+        }
+      },
+      "debug" : false,
+      "container" : "docker"
+    }
+  ],
+  "engines" : [
+    {
+      "type" : "docker",
+      "id" : "docker",
+      "image" : "quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0",
+      "target_registry" : "images.viash-hub.com",
+      "target_tag" : "main",
+      "namespace_separator" : "/",
+      "setup" : [
+        {
+          "type" : "docker",
+          "run" : [
+            "agat --version | sed 's/AGAT\\\\s\\\\(.*\\\\)/agat: \\"\\\\1\\"/' > /var/software_versions.txt\n"
+          ]
+        }
+      ]
+    },
+    {
+      "type" : "native",
+      "id" : "native"
+    }
+  ],
+  "build_info" : {
+    "config" : "/workdir/root/repo/src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml",
+    "runner" : "nextflow",
+    "engine" : "docker|native",
+    "output" : "target/nextflow/agat/agat_sp_filter_feature_from_kill_list",
+    "viash_version" : "0.9.0",
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
+  },
+  "package_config" : {
+    "name" : "biobox",
+    "version" : "main",
+    "description" : "A collection of bioinformatics tools for working with sequence data.\n",
+    "viash_version" : "0.9.0",
+    "source" : "src",
+    "target" : "target",
+    "config_mods" : [
+      ".requirements.commands := ['ps']\n",
+      ".engines += { type: \\"native\\" }",
+      ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
+      ".engines[.type == 'docker'].target_tag := 'main'"
+    ],
+    "keywords" : [
+      "bioinformatics",
+      "modules",
+      "sequencing"
+    ],
+    "license" : "MIT",
+    "organization" : "vsh",
+    "links" : {
+      "repository" : "https://github.com/viash-hub/biobox",
+      "issue_tracker" : "https://github.com/viash-hub/biobox/issues"
+    }
+  }
+}'''))
+]
+
+// resolve dependencies dependencies (if any)
+
+
+// inner workflow
+// inner workflow hook
+def innerWorkflowFactory(args) {
+  def rawScript = '''set -e
+tempscript=".viash_script.sh"
+cat > "$tempscript" << VIASHMAIN
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_GFF+x} ]; then echo "${VIASH_PAR_GFF}" | sed "s#'#'\\"'\\"'#g;s#.*#par_gff='&'#" ; else echo "# par_gff="; fi )
+$( if [ ! -z ${VIASH_PAR_KILL_LIST+x} ]; then echo "${VIASH_PAR_KILL_LIST}" | sed "s#'#'\\"'\\"'#g;s#.*#par_kill_list='&'#" ; else echo "# par_kill_list="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_PAR_TYPE+x} ]; then echo "${VIASH_PAR_TYPE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_type='&'#" ; else echo "# par_type="; fi )
+$( if [ ! -z ${VIASH_PAR_ATTRIBUTE+x} ]; then echo "${VIASH_PAR_ATTRIBUTE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_attribute='&'#" ; else echo "# par_attribute="; fi )
+$( if [ ! -z ${VIASH_PAR_CONFIG+x} ]; then echo "${VIASH_PAR_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#par_config='&'#" ; else echo "# par_config="; fi )
+$( if [ ! -z ${VIASH_PAR_VERBOSE+x} ]; then echo "${VIASH_PAR_VERBOSE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_verbose='&'#" ; else echo "# par_verbose="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+
+# unset flags
+[[ "\\$par_verbose" == "false" ]] && unset par_verbose
+
+# convert par_type to comma separated list
+par_type=\\$(echo \\$par_type | tr ';' ',')
+
+# run agat_sp_filter_feature_from_kill_list
+agat_sp_filter_feature_from_kill_list.pl \\\\
+  --gff "\\$par_gff" \\\\
+  --kill_list "\\$par_kill_list" \\\\
+  --output "\\$par_output" \\\\
+  \\${par_type:+--type "\\${par_type}"} \\\\
+  \\${par_attribute:+--attribute "\\${par_attribute}"} \\\\
+  \\${par_config:+--config "\\${par_config}"} \\\\
+  \\${par_verbose:+-v}
+VIASHMAIN
+bash "$tempscript"
+'''
+  
+  return vdsl3WorkflowFactory(args, meta, rawScript)
+}
+
+
+
+/**
+  * Generate a workflow for VDSL3 modules.
+  * 
+  * This function is called by the workflowFactory() function.
+  * 
+  * Input channel: [id, input_map]
+  * Output channel: [id, output_map]
+  * 
+  * Internally, this workflow will convert the input channel
+  * to a format which the Nextflow module will be able to handle.
+  */
+def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) {
+  def key = args["key"]
+  def processObj = null
+
+  workflow processWf {
+    take: input_
+    main:
+
+    if (processObj == null) {
+      processObj = _vdsl3ProcessFactory(args, meta, rawScript)
+    }
+    
+    output_ = input_
+      | map { tuple ->
+        def id = tuple[0]
+        def data_ = tuple[1]
+
+        if (workflow.stubRun) {
+          // add id if missing
+          data_ = [id: 'stub'] + data_
+        }
+
+        // process input files separately
+        def inputPaths = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "input" }
+          .collect { par ->
+            def val = data_.containsKey(par.plainName) ? data_[par.plainName] : []
+            def inputFiles = []
+            if (val == null) {
+              inputFiles = []
+            } else if (val instanceof List) {
+              inputFiles = val
+            } else if (val instanceof Path) {
+              inputFiles = [ val ]
+            } else {
+              inputFiles = []
+            }
+            if (!workflow.stubRun) {
+              // throw error when an input file doesn't exist
+              inputFiles.each{ file -> 
+                assert file.exists() :
+                  "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" +
+                  "  Required input file does not exist.\n" +
+                  "  Path: '$file'.\n" +
+                  "  Expected input file to exist"
+              }
+            }
+            inputFiles 
+          } 
+
+        // remove input files
+        def argsExclInputFiles = meta.config.allArguments
+          .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) }
+          .collectEntries { par ->
+            def parName = par.plainName
+            def val = data_[parName]
+            if (par.multiple && val instanceof Collection) {
+              val = val.join(par.multiple_sep)
+            }
+            if (par.direction == "output" && par.type == "file") {
+              val = val
+                .replaceAll('\\$id', id)
+                .replaceAll('\\$\\{id\\}', id)
+                .replaceAll('\\$key', key)
+                .replaceAll('\\$\\{key\\}', key)
+            }
+            [parName, val]
+          }
+
+        [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ]
+      }
+      | processObj
+      | map { output ->
+        def outputFiles = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "output" }
+          .indexed()
+          .collectEntries{ index, par ->
+            def out = output[index + 1]
+            // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678)
+            if (!out instanceof List || out.size() <= 1) {
+              if (par.multiple) {
+                out = []
+              } else {
+                assert !par.required :
+                    "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" +
+                    "  Required output file is missing"
+                out = null
+              }
+            } else if (out.size() == 2 && !par.multiple) {
+              out = out[1]
+            } else {
+              out = out.drop(1)
+            }
+            [ par.plainName, out ]
+          }
+        
+        // drop null outputs
+        outputFiles.removeAll{it.value == null}
+
+        [ output[0], outputFiles ]
+      }
+    emit: output_
+  }
+
+  return processWf
+}
+
+// depends on: session?
+def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) {
+  // autodetect process key
+  def wfKey = workflowArgs["key"]
+  def procKeyPrefix = "${wfKey}_process"
+  def scriptMeta = nextflow.script.ScriptMeta.current()
+  def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)}
+  def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()}
+  def newNumber = (numbers + [-1]).max() + 1
+
+  def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber"
+
+  if (newNumber > 0) {
+    log.warn "Key for module '${wfKey}' is duplicated.\n",
+      "If you run a component multiple times in the same workflow,\n" +
+      "it's recommended you set a unique key for every call,\n" +
+      "for example: ${wfKey}.run(key: \"foo\")."
+  }
+
+  // subset directives and convert to list of tuples
+  def drctv = workflowArgs.directives
+
+  // TODO: unit test the two commands below
+  // convert publish array into tags
+  def valueToStr = { val ->
+    // ignore closures
+    if (val instanceof CharSequence) {
+      if (!val.matches('^[{].*[}]$')) {
+        '"' + val + '"'
+      } else {
+        val
+      }
+    } else if (val instanceof List) {
+      "[" + val.collect{valueToStr(it)}.join(", ") + "]"
+    } else if (val instanceof Map) {
+      "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]"
+    } else {
+      val.inspect()
+    }
+  }
+
+  // multiple entries allowed: label, publishdir
+  def drctvStrs = drctv.collect { key, value ->
+    if (key in ["label", "publishDir"]) {
+      value.collect{ val ->
+        if (val instanceof Map) {
+          "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+        } else if (val == null) {
+          ""
+        } else {
+          "\n$key " + valueToStr(val)
+        }
+      }.join()
+    } else if (value instanceof Map) {
+      "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+    } else {
+      "\n$key " + valueToStr(value)
+    }
+  }.join()
+
+  def inputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "input" }
+    .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' }
+    .join()
+
+  def outputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par ->
+      // insert dummy into every output (see nextflow-io/nextflow#2678)
+      if (!par.multiple) {
+        ', path{[".exitcode", args.' + par.plainName + ']}'
+      } else {
+        ', path{[".exitcode"] + args.' + par.plainName + '}'
+      }
+    }
+    .join()
+
+  // TODO: move this functionality somewhere else?
+  if (workflowArgs.auto.transcript) {
+    outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}'
+  } else {
+    outputPaths = outputPaths + ', path{[".exitcode"]}'
+  }
+
+  // create dirs for output files (based on BashWrapper.createParentFiles)
+  def createParentStr = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" && it.create_parent }
+    .collect { par -> 
+      def contents = "args[\"${par.plainName}\"] instanceof List ? args[\"${par.plainName}\"].join('\" \"') : args[\"${par.plainName}\"]"
+      "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent '\" + escapeText(${contents}) + \"'\" : \"\" }"
+    }
+    .join("\n")
+
+  // construct inputFileExports
+  def inputFileExports = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction.toLowerCase() == "input" }
+    .collect { par ->
+      def contents = "viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName}"
+      "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}='\" + escapeText(${contents}) + \"'\"}"
+    }
+
+  // NOTE: if using docker, use /tmp instead of tmpDir!
+  def tmpDir = java.nio.file.Paths.get(
+    System.getenv('NXF_TEMP') ?: 
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('VIASH_TMPDIR') ?: 
+    System.getenv('VIASH_TEMPDIR') ?: 
+    System.getenv('VIASH_TMP') ?: 
+    System.getenv('TEMP') ?: 
+    System.getenv('TMPDIR') ?: 
+    System.getenv('TEMPDIR') ?:
+    System.getenv('TMP') ?: 
+    '/tmp'
+  ).toAbsolutePath()
+
+  // construct stub
+  def stub = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par -> 
+      "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }"
+    }
+    .join("\n")
+
+  // escape script
+  def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"')
+
+  // publishdir assert
+  def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? 
+    """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n  Example: --publish_dir './output/'" """ :
+    ""
+
+  // generate process string
+  def procStr = 
+  """nextflow.enable.dsl=2
+  |
+  |def escapeText = { s -> s.toString().replaceAll("'", "'\\\"'\\\"'") }
+  |process $procKey {$drctvStrs
+  |input:
+  |  tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources")
+  |output:
+  |  tuple val("\$id")$outputPaths, optional: true
+  |stub:
+  |\"\"\"
+  |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; }
+  |$stub
+  |\"\"\"
+  |script:$assertStr
+  |def parInject = args
+  |  .findAll{key, value -> value != null}
+  |  .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}='\${escapeText(value)}'"}
+  |  .join("\\n")
+  |\"\"\"
+  |# meta exports
+  |export VIASH_META_RESOURCES_DIR="\${resourcesDir}"
+  |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}"
+  |export VIASH_META_NAME="${meta.config.name}"
+  |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME"
+  |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+  |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" }
+  |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" }
+  |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then
+  |  export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 ))
+  |  export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  |fi
+  |
+  |# meta synonyms
+  |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR"
+  |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR"
+  |
+  |# create output dirs if need be
+  |function mkdir_parent {
+  |  for file in "\\\$@"; do 
+  |    mkdir -p "\\\$(dirname "\\\$file")"
+  |  done
+  |}
+  |$createParentStr
+  |
+  |# argument exports${inputFileExports.join()}
+  |\$parInject
+  |
+  |# process script
+  |${escapedScript}
+  |\"\"\"
+  |}
+  |""".stripMargin()
+
+  // TODO: print on debug
+  // if (workflowArgs.debug == true) {
+  //   println("######################\n$procStr\n######################")
+  // }
+
+  // write process to temp file
+  def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf")
+  addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) }
+  tempFile.text = procStr
+
+  // create process from temp file
+  def binding = new nextflow.script.ScriptBinding([:])
+  def session = nextflow.Nextflow.getSession()
+  def parser = new nextflow.script.ScriptParser(session)
+    .setModule(true)
+    .setBinding(binding)
+  def moduleScript = parser.runScript(tempFile)
+    .getScript()
+
+  // register module in meta
+  def module = new nextflow.script.IncludeDef.Module(name: procKey)
+  scriptMeta.addModule(moduleScript, module.name, module.alias)
+
+  // retrieve and return process from meta
+  return scriptMeta.getProcess(procKey)
+}
+
+// defaults
+meta["defaults"] = [
+  // key to be used to trace the process and determine output names
+  key: null,
+
+  // fixed arguments to be passed to script
+  args: [:],
+
+  // default directives
+  directives: readJsonBlob('''{
+  "container" : {
+    "registry" : "images.viash-hub.com",
+    "image" : "vsh/biobox/agat/agat_sp_filter_feature_from_kill_list",
+    "tag" : "main"
+  },
+  "tag" : "$id"
+}'''),
+
+  // auto settings
+  auto: readJsonBlob('''{
+  "simplifyInput" : true,
+  "simplifyOutput" : false,
+  "transcript" : false,
+  "publish" : false
+}'''),
+
+  // Apply a map over the incoming tuple
+  // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }`
+  map: null,
+
+  // Apply a map over the ID element of a tuple (i.e. the first element)
+  // Example: `{ id -> id + "_foo" }`
+  mapId: null,
+
+  // Apply a map over the data element of a tuple (i.e. the second element)
+  // Example: `{ data -> [ input: data.output ] }`
+  mapData: null,
+
+  // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements)
+  // Example: `{ pt -> pt.drop(1) }`
+  mapPassthrough: null,
+
+  // Filter the channel
+  // Example: `{ tup -> tup[0] == "foo" }`
+  filter: null,
+
+  // Choose whether or not to run the component on the tuple if the condition is true.
+  // Otherwise, the tuple will be passed through.
+  // Example: `{ tup -> tup[0] != "skip_this" }`
+  runIf: null,
+
+  // Rename keys in the data field of the tuple (i.e. the second element)
+  // Will likely be deprecated in favour of `fromState`.
+  // Example: `[ "new_key": "old_key" ]`
+  renameKeys: null,
+
+  // Fetch data from the state and pass it to the module without altering the current state.
+  // 
+  // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. 
+  // 
+  // - If it is `null`, the state will be passed to the module as is.
+  // - If it is a `List[String]`, the data will be the values of the state at the given keys.
+  // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map.
+  // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data.
+  // 
+  // Example: `{ id, state -> [input: state.fastq_file] }`
+  // Default: `null`
+  fromState: null,
+
+  // Determine how the state should be updated after the module has been run.
+  // 
+  // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function.
+  // 
+  // - If it is `null`, the state will be replaced with the output of the module.
+  // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys.
+  // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map.
+  // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state.
+  //
+  // Example: `{ id, output, state -> state + [counts: state.output] }`
+  // Default: `{ id, output, state -> output }`
+  toState: null,
+
+  // Whether or not to print debug messages
+  // Default: `false`
+  debug: false
+]
+
+// initialise default workflow
+meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta)
+
+// add workflow to environment
+nextflow.script.ScriptMeta.current().addDefinition(meta.workflow)
+
+// anonymous workflow for running this module as a standalone
+workflow {
+  // add id argument if it's not already in the config
+  // TODO: deep copy
+  def newConfig = deepClone(meta.config)
+  def newParams = deepClone(params)
+
+  def argsContainsId = newConfig.allArguments.any{it.plainName == "id"}
+  if (!argsContainsId) {
+    def idArg = [
+      'name': '--id',
+      'required': false,
+      'type': 'string',
+      'description': 'A unique id for every entry.',
+      'multiple': false
+    ]
+    newConfig.arguments.add(0, idArg)
+    newConfig = processConfig(newConfig)
+  }
+  if (!newParams.containsKey("id")) {
+    newParams.id = "run"
+  }
+
+  helpMessage(newConfig)
+
+  channelFromParams(newParams, newConfig)
+    // make sure id is not in the state if id is not in the args
+    | map {id, state ->
+      if (!argsContainsId) {
+        [id, state.findAll{k, v -> k != "id"}]
+      } else {
+        [id, state]
+      }
+    }
+    | meta.workflow.run(
+      auto: [ publish: "state" ]
+    )
+}
+
+// END COMPONENT-SPECIFIC CODE
diff --git a/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/nextflow.config b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/nextflow.config
new file mode 100644
index 00000000..8d00c5df
--- /dev/null
+++ b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/nextflow.config
@@ -0,0 +1,126 @@
+manifest {
+  name = 'agat/agat_sp_filter_feature_from_kill_list'
+  mainScript = 'main.nf'
+  nextflowVersion = '!>=20.12.1-edge'
+  version = 'main'
+  description = 'Remove features based on a kill list. The default behaviour is to look at the features\'s ID. \nIf the feature has an ID (case insensitive) listed among the kill list it will be removed.\nRemoving a level1 or level2 feature will automatically remove all linked subfeatures, and \nremoving all children of a feature will automatically remove this feature too.\n'
+  author = 'Leïla Paquay'
+}
+
+process.container = 'nextflow/bash:latest'
+
+// detect tempdir
+tempDir = java.nio.file.Paths.get(
+  System.getenv('NXF_TEMP') ?:
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('TEMPDIR') ?: 
+    System.getenv('TMPDIR') ?: 
+    '/tmp'
+).toAbsolutePath()
+
+profiles {
+  no_publish {
+    process {
+      withName: '.*' {
+        publishDir = [
+          enabled: false
+        ]
+      }
+    }
+  }
+  mount_temp {
+    docker.temp            = tempDir
+    podman.temp            = tempDir
+    charliecloud.temp      = tempDir
+  }
+  docker {
+    docker.enabled         = true
+    // docker.userEmulation   = true
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  singularity {
+    singularity.enabled    = true
+    singularity.autoMounts = true
+    docker.enabled         = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  podman {
+    podman.enabled         = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  shifter {
+    shifter.enabled        = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    charliecloud.enabled   = false
+  }
+  charliecloud {
+    charliecloud.enabled   = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+  }
+}
+
+process{
+  withLabel: mem1gb { memory = 1000000000.B }
+  withLabel: mem2gb { memory = 2000000000.B }
+  withLabel: mem5gb { memory = 5000000000.B }
+  withLabel: mem10gb { memory = 10000000000.B }
+  withLabel: mem20gb { memory = 20000000000.B }
+  withLabel: mem50gb { memory = 50000000000.B }
+  withLabel: mem100gb { memory = 100000000000.B }
+  withLabel: mem200gb { memory = 200000000000.B }
+  withLabel: mem500gb { memory = 500000000000.B }
+  withLabel: mem1tb { memory = 1000000000000.B }
+  withLabel: mem2tb { memory = 2000000000000.B }
+  withLabel: mem5tb { memory = 5000000000000.B }
+  withLabel: mem10tb { memory = 10000000000000.B }
+  withLabel: mem20tb { memory = 20000000000000.B }
+  withLabel: mem50tb { memory = 50000000000000.B }
+  withLabel: mem100tb { memory = 100000000000000.B }
+  withLabel: mem200tb { memory = 200000000000000.B }
+  withLabel: mem500tb { memory = 500000000000000.B }
+  withLabel: mem1gib { memory = 1073741824.B }
+  withLabel: mem2gib { memory = 2147483648.B }
+  withLabel: mem4gib { memory = 4294967296.B }
+  withLabel: mem8gib { memory = 8589934592.B }
+  withLabel: mem16gib { memory = 17179869184.B }
+  withLabel: mem32gib { memory = 34359738368.B }
+  withLabel: mem64gib { memory = 68719476736.B }
+  withLabel: mem128gib { memory = 137438953472.B }
+  withLabel: mem256gib { memory = 274877906944.B }
+  withLabel: mem512gib { memory = 549755813888.B }
+  withLabel: mem1tib { memory = 1099511627776.B }
+  withLabel: mem2tib { memory = 2199023255552.B }
+  withLabel: mem4tib { memory = 4398046511104.B }
+  withLabel: mem8tib { memory = 8796093022208.B }
+  withLabel: mem16tib { memory = 17592186044416.B }
+  withLabel: mem32tib { memory = 35184372088832.B }
+  withLabel: mem64tib { memory = 70368744177664.B }
+  withLabel: mem128tib { memory = 140737488355328.B }
+  withLabel: mem256tib { memory = 281474976710656.B }
+  withLabel: mem512tib { memory = 562949953421312.B }
+  withLabel: cpu1 { cpus = 1 }
+  withLabel: cpu2 { cpus = 2 }
+  withLabel: cpu5 { cpus = 5 }
+  withLabel: cpu10 { cpus = 10 }
+  withLabel: cpu20 { cpus = 20 }
+  withLabel: cpu50 { cpus = 50 }
+  withLabel: cpu100 { cpus = 100 }
+  withLabel: cpu200 { cpus = 200 }
+  withLabel: cpu500 { cpus = 500 }
+  withLabel: cpu1000 { cpus = 1000 }
+}
+
+
diff --git a/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/nextflow_schema.json b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/nextflow_schema.json
new file mode 100644
index 00000000..190b4aee
--- /dev/null
+++ b/target/nextflow/agat/agat_sp_filter_feature_from_kill_list/nextflow_schema.json
@@ -0,0 +1,160 @@
+{
+"$schema": "http://json-schema.org/draft-07/schema",
+"title": "agat_sp_filter_feature_from_kill_list",
+"description": "Remove features based on a kill list. The default behaviour is to look at the features\u0027s ID. \nIf the feature has an ID (case insensitive) listed among the kill list it will be removed.\nRemoving a level1 or level2 feature will automatically remove all linked subfeatures, and \nremoving all children of a feature will automatically remove this feature too.\n",
+"type": "object",
+"definitions": {
+
+    
+    
+    "inputs" : {
+    "title": "Inputs",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "gff": {
+                "type":
+                "string",
+                "description": "Type: `file`, required. Input GFF3 file that will be read",
+                "help_text": "Type: `file`, required. Input GFF3 file that will be read."
+            
+            }
+    
+
+        ,
+                "kill_list": {
+                "type":
+                "string",
+                "description": "Type: `file`, required, example: `kill_list.txt`. Text file containing the kill list",
+                "help_text": "Type: `file`, required, example: `kill_list.txt`. Text file containing the kill list. One value per line."
+            
+            }
+    
+
+}
+},
+    
+    
+    "outputs" : {
+    "title": "Outputs",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "output": {
+                "type":
+                "string",
+                "description": "Type: `file`, required, default: `$id.$key.output.output`. Path to the output GFF file that contains filtered features",
+                "help_text": "Type: `file`, required, default: `$id.$key.output.output`. Path to the output GFF file that contains filtered features. \n"
+            ,
+                "default": "$id.$key.output.output"
+            }
+    
+
+}
+},
+    
+    
+    "arguments" : {
+    "title": "Arguments",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "type": {
+                "type":
+                "string",
+                "description": "Type: List of `string`, multiple_sep: `\";\"`. Primary tag option, case insensitive, list",
+                "help_text": "Type: List of `string`, multiple_sep: `\";\"`. Primary tag option, case insensitive, list. Allow to specify the feature types that \nwill be handled. \n\nYou can specify a specific feature by giving its primary tag name (column 3) as: \n\n  * cds\n  * Gene\n  * mRNA\n  \nYou can specify directly all the feature of a particular\nlevel: \n\n  * level2=mRNA,ncRNA,tRNA,etc \n  * level3=CDS,exon,UTR,etc. \n\nBy default all features are taken into account. Fill the option with the value \"all\" will \nhave the same behaviour.\n"
+            
+            }
+    
+
+        ,
+                "attribute": {
+                "type":
+                "string",
+                "description": "Type: `string`, example: `ID`. Attribute tag to specify the attribute to analyse",
+                "help_text": "Type: `string`, example: `ID`. Attribute tag to specify the attribute to analyse. Case sensitive. Default: ID\n"
+            
+            }
+    
+
+        ,
+                "config": {
+                "type":
+                "string",
+                "description": "Type: `file`, example: `custom_agat_config.yaml`. AGAT config file",
+                "help_text": "Type: `file`, example: `custom_agat_config.yaml`. AGAT config file. By default AGAT takes the original agat_config.yaml shipped with AGAT.\nThe `--config` option gives you the possibility to use your own AGAT config file (located \nelsewhere or named differently).\n"
+            
+            }
+    
+
+        ,
+                "verbose": {
+                "type":
+                "boolean",
+                "description": "Type: `boolean_true`, default: `false`. Verbose option for debugging purpose",
+                "help_text": "Type: `boolean_true`, default: `false`. Verbose option for debugging purpose."
+            ,
+                "default": "False"
+            }
+    
+
+}
+},
+    
+    
+    "nextflow input-output arguments" : {
+    "title": "Nextflow input-output arguments",
+    "type": "object",
+    "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+    "properties": {
+    
+        
+                "publish_dir": {
+                "type":
+                "string",
+                "description": "Type: `string`, required, example: `output/`. Path to an output directory",
+                "help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
+            
+            }
+    
+
+        ,
+                "param_list": {
+                "type":
+                "string",
+                "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
+                "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
+                "hidden": true
+            
+            }
+    
+
+}
+}
+},
+"allOf": [
+
+    {
+    "$ref": "#/definitions/inputs"
+    },
+
+    {
+    "$ref": "#/definitions/outputs"
+    },
+
+    {
+    "$ref": "#/definitions/arguments"
+    },
+
+    {
+    "$ref": "#/definitions/nextflow input-output arguments"
+    }
+]
+}
diff --git a/target/nextflow/agat/agat_sp_merge_annotations/.config.vsh.yaml b/target/nextflow/agat/agat_sp_merge_annotations/.config.vsh.yaml
new file mode 100644
index 00000000..fce2f26a
--- /dev/null
+++ b/target/nextflow/agat/agat_sp_merge_annotations/.config.vsh.yaml
@@ -0,0 +1,211 @@
+name: "agat_sp_merge_annotations"
+namespace: "agat"
+version: "main"
+authors:
+- name: "Leïla Paquay"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "leila@data-intuitive.com"
+      github: "Leila011"
+      linkedin: "leilapaquay"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Software Developer"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--gff"
+    alternatives:
+    - "-f"
+    description: "Input GTF/GFF file(s).\n"
+    info: null
+    example:
+    - "input1.gff;input2.gff"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: true
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    - "--out"
+    description: "Output gff3 file where the gene incriminated will be writen."
+    info: null
+    example:
+    - "output.gff"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Arguments"
+  arguments:
+  - type: "file"
+    name: "--config"
+    alternatives:
+    - "-c"
+    description: "AGAT config file. By default AGAT takes the original agat_config.yaml\
+      \ shipped with AGAT. \nThe `--config` option gives you the possibility to use\
+      \ your own AGAT config file (located\nelsewhere or named differently).\n"
+    info: null
+    example:
+    - "custom_agat_config.yaml"
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Merge different gff annotation files into one. It uses the AGAT parser\
+  \ that takes care of\nduplicated names and fixes other oddities met in those files.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "gene annotations"
+- "merge"
+- "gff"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.5281/zenodo.3552717"
+links:
+  repository: "https://github.com/NBISweden/AGAT"
+  homepage: "https://github.com/NBISweden/AGAT"
+  documentation: "https://agat.readthedocs.io/en/latest/tools/agat_sp_merge_annotations.html"
+  issue_tracker: "https://github.com/NBISweden/AGAT/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "docker"
+    run:
+    - "agat --version | sed 's/AGAT\\s\\(.*\\)/agat: \"\\1\"/' > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/agat/agat_sp_merge_annotations/config.vsh.yaml"
+  runner: "nextflow"
+  engine: "docker|native"
+  output: "target/nextflow/agat/agat_sp_merge_annotations"
+  executable: "target/nextflow/agat/agat_sp_merge_annotations/main.nf"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/nextflow/agat/agat_sp_merge_annotations/main.nf b/target/nextflow/agat/agat_sp_merge_annotations/main.nf
new file mode 100644
index 00000000..f52667d1
--- /dev/null
+++ b/target/nextflow/agat/agat_sp_merge_annotations/main.nf
@@ -0,0 +1,3612 @@
+// agat_sp_merge_annotations main
+// 
+// This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+// work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+// Intuitive.
+// 
+// The component may contain files which fall under a different license. The
+// authors of this component should specify the license in the header of such
+// files, or include a separate license file detailing the licenses of all included
+// files.
+// 
+// Component authors:
+//  * Leïla Paquay (author, maintainer)
+
+////////////////////////////
+// VDSL3 helper functions //
+////////////////////////////
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf'
+class UnexpectedArgumentTypeException extends Exception {
+  String errorIdentifier
+  String stage
+  String plainName
+  String expectedClass
+  String foundClass
+  
+  // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""}
+  UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) {
+    super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " +
+      "Expected type: ${expectedClass}. Found type: ${foundClass}")
+    this.errorIdentifier = errorIdentifier
+    this.stage = stage
+    this.plainName = plainName
+    this.expectedClass = expectedClass
+    this.foundClass = foundClass
+  }
+}
+
+/**
+  * Checks if the given value is of the expected type. If not, an exception is thrown.
+  *
+  * @param stage The stage of the argument (input or output)
+  * @param par The parameter definition
+  * @param value The value to check
+  * @param errorIdentifier The identifier to use in the error message
+  * @return The value, if it is of the expected type
+  * @throws UnexpectedArgumentTypeException If the value is not of the expected type
+*/
+def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) {
+  // expectedClass will only be != null if value is not of the expected type
+  def expectedClass = null
+  def foundClass = null
+  
+  // todo: split if need be
+  
+  if (!par.required && value == null) {
+    expectedClass = null
+  } else if (par.multiple) {
+    if (value !instanceof Collection) {
+      value = [value]
+    }
+    
+    // split strings
+    value = value.collectMany{ val ->
+      if (val instanceof String) {
+        // collect() to ensure that the result is a List and not simply an array
+        val.split(par.multiple_sep).collect()
+      } else {
+        [val]
+      }
+    }
+
+    // process globs
+    if (par.type == "file" && par.direction == "input") {
+      value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten()
+    }
+
+    // check types of elements in list
+    try {
+      value = value.collect { listVal ->
+        _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier)
+      }
+    } catch (UnexpectedArgumentTypeException e) {
+      expectedClass = "List[${e.expectedClass}]"
+      foundClass = "List[${e.foundClass}]"
+    }
+  } else if (par.type == "string") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else if (par.type == "integer") {
+    // cast to integer if need be
+    if (value instanceof String) {
+      try {
+        value = value.toInteger()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigInteger) {
+      value = value.intValue()
+    }
+    expectedClass = value instanceof Integer ? null : "Integer"
+  } else if (par.type == "long") {
+    // cast to long if need be
+    if (value instanceof String) {
+      try {
+        value = value.toLong()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof Integer) {
+      value = value.toLong()
+    }
+    expectedClass = value instanceof Long ? null : "Long"
+  } else if (par.type == "double") {
+    // cast to double if need be
+    if (value instanceof String) {
+      try {
+        value = value.toDouble()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigDecimal) {
+      value = value.doubleValue()
+    }
+    if (value instanceof Float) {
+      value = value.toDouble()
+    }
+    expectedClass = value instanceof Double ? null : "Double"
+  } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") {
+    // cast to boolean if need be
+    if (value instanceof String) {
+      def valueLower = value.toLowerCase()
+      if (valueLower == "true") {
+        value = true
+      } else if (valueLower == "false") {
+        value = false
+      }
+    }
+    expectedClass = value instanceof Boolean ? null : "Boolean"
+  } else if (par.type == "file" && (par.direction == "input" || stage == "output")) {
+    // cast to path if need be
+    if (value instanceof String) {
+      value = file(value, hidden: true)
+    }
+    if (value instanceof File) {
+      value = value.toPath()
+    }
+    expectedClass = value instanceof Path ? null : "Path"
+  } else if (par.type == "file" && stage == "input" && par.direction == "output") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else {
+    // didn't find a match for par.type
+    expectedClass = par.type
+  }
+
+  if (expectedClass != null) {
+    if (foundClass == null) {
+      foundClass = value.getClass().getName()
+    }
+    throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass)
+  }
+  
+  return value
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf'
+Map _processInputValues(Map inputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.required) {
+        assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing"
+      }
+    }
+
+    inputs = inputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument"
+
+      value = _checkArgumentType("input", par, value, "in module '$key' id '$id'")
+
+      [ name, value ]
+    }
+  }
+  return inputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf'
+Map _processOutputValues(Map outputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.direction == "output" && arg.required) {
+        assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing"
+      }
+    }
+
+    outputs = outputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && it.direction == "output" }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument"
+      
+      value = _checkArgumentType("output", par, value, "in module '$key' id '$id'")
+      
+      [ name, value ]
+    }
+  }
+  return outputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf'
+class IDChecker {
+  final def items = [] as Set
+
+  @groovy.transform.WithWriteLock
+  boolean observe(String item) {
+    if (items.contains(item)) {
+      return false
+    } else {
+      items << item
+      return true
+    }
+  }
+
+  @groovy.transform.WithReadLock
+  boolean contains(String item) {
+    return items.contains(item)
+  }
+
+  @groovy.transform.WithReadLock
+  Set getItems() {
+    return items.clone()
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf'
+
+/**
+ * Check if the ids are unique across parameter sets
+ *
+ * @param parameterSets a list of parameter sets.
+ */
+private void _checkUniqueIds(List<Tuple2<String, Map<String, Object>>> parameterSets) {
+  def ppIds = parameterSets.collect{it[0]}
+  assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds"
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf'
+
+// helper functions for reading params from file //
+def _getChild(parent, child) {
+  if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) {
+    child
+  } else {
+    def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString()
+    parentAbsolute.replaceAll('/[^/]*$', "/") + child
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf'
+/**
+  * Figure out the param list format based on the file extension
+  *
+  * @param param_list A String containing the path to the parameter list file.
+  *
+  * @return A String containing the format of the parameter list file.
+  */
+def _paramListGuessFormat(param_list) {
+  if (param_list !instanceof String) {
+    "asis"
+  } else if (param_list.endsWith(".csv")) {
+    "csv"
+  } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) {
+    "json"
+  } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) {
+    "yaml"
+  } else {
+    "yaml_blob"
+  }
+}
+
+
+/**
+  * Read the param list
+  * 
+  * @param param_list One of the following:
+  *   - A String containing the path to the parameter list file (csv, json or yaml),
+  *   - A yaml blob of a list of maps (yaml_blob),
+  *   - Or a groovy list of maps (asis).
+  * @param config A Map of the Viash configuration.
+  * 
+  * @return A List of Maps containing the parameters.
+  */
+def _parseParamList(param_list, Map config) {
+  // first determine format by extension
+  def paramListFormat = _paramListGuessFormat(param_list)
+
+  def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ?
+    file(param_list, hidden: true) :
+    null
+
+  // get the correct parser function for the detected params_list format
+  def paramSets = []
+  if (paramListFormat == "asis") {
+    paramSets = param_list
+  } else if (paramListFormat == "yaml_blob") {
+    paramSets = readYamlBlob(param_list)
+  } else if (paramListFormat == "yaml") {
+    paramSets = readYaml(paramListPath)
+  } else if (paramListFormat == "json") {
+    paramSets = readJson(paramListPath)
+  } else if (paramListFormat == "csv") {
+    paramSets = readCsv(paramListPath)
+  } else {
+    error "Format of provided --param_list not recognised.\n" +
+    "Found: '$paramListFormat'.\n" +
+    "Expected: a csv file, a json file, a yaml file,\n" +
+    "a yaml blob or a groovy list of maps."
+  }
+
+  // data checks
+  assert paramSets instanceof List: "--param_list should contain a list of maps"
+  for (value in paramSets) {
+    assert value instanceof Map: "--param_list should contain a list of maps"
+  }
+
+  // id is argument
+  def idIsArgument = config.allArguments.any{it.plainName == "id"}
+
+  // Reformat from List<Map> to List<Tuple2<String, Map>> by adding the ID as first element of a Tuple2
+  paramSets = paramSets.collect({ data ->
+    def id = data.id
+    if (!idIsArgument) {
+      data = data.findAll{k, v -> k != "id"}
+    }
+    [id, data]
+  })
+
+  // Split parameters with 'multiple: true'
+  paramSets = paramSets.collect({ id, data ->
+    data = _splitParams(data, config)
+    [id, data]
+  })
+  
+  // The paths of input files inside a param_list file may have been specified relatively to the
+  // location of the param_list file. These paths must be made absolute.
+  if (paramListPath) {
+    paramSets = paramSets.collect({ id, data ->
+      def new_data = data.collectEntries{ parName, parValue ->
+        def par = config.allArguments.find{it.plainName == parName}
+        if (par && par.type == "file" && par.direction == "input") {
+          if (parValue instanceof Collection) {
+            parValue = parValue.collectMany{path -> 
+              def x = _resolveSiblingIfNotAbsolute(path, paramListPath)
+              x instanceof Collection ? x : [x]
+            }
+          } else {
+            parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) 
+          }
+        }
+        [parName, parValue]
+      }
+      [id, new_data]
+    })
+  }
+
+  return paramSets
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf'
+/**
+ * Split parameters for arguments that accept multiple values using their separator
+ *
+ * @param paramList A Map containing parameters to split.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ *
+ * @return A Map of parameters where the parameter values have been split into a list using
+ *         their seperator.
+ */
+Map<String, Object> _splitParams(Map<String, Object> parValues, Map config){
+  def parsedParamValues = parValues.collectEntries { parName, parValue ->
+    def parameterSettings = config.allArguments.find({it.plainName == parName})
+
+    if (!parameterSettings) {
+      // if argument is not found, do not alter 
+      return [parName, parValue]
+    }
+    if (parameterSettings.multiple) { // Check if parameter can accept multiple values
+      if (parValue instanceof Collection) {
+        parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it }
+      } else if (parValue instanceof String) {
+        parValue = parValue.split(parameterSettings.multiple_sep)
+      } else if (parValue == null) {
+        parValue = []
+      } else {
+        parValue = [ parValue ]
+      }
+      parValue = parValue.flatten()
+    }
+    // For all parameters check if multiple values are only passed for
+    // arguments that allow it. Quietly simplify lists of length 1.
+    if (!parameterSettings.multiple && parValue instanceof Collection) {
+      assert parValue.size() == 1 : 
+      "Error: argument ${parName} has too many values.\n" +
+      "  Expected amount: 1. Found: ${parValue.size()}"
+      parValue = parValue[0]
+    }
+    [parName, parValue]
+  }
+  return parsedParamValues
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf'
+/**
+ * Parse nextflow parameters based on settings defined in a viash config.
+ * Return a list of parameter sets, each parameter set corresponding to 
+ * an event in a nextflow channel. The output from this function can be used
+ * with Channel.fromList to create a nextflow channel with Vdsl3 formatted 
+ * events.
+ *
+ * This function performs:
+ *   - A filtering of the params which can be found in the config file.
+ *   - Process the params_list argument which allows a user to to initialise 
+ *     a Vsdl3 channel with multiple parameter sets. Possible formats are 
+ *     csv, json, yaml, or simply a yaml_blob. A csv should have column names 
+ *     which correspond to the different arguments of this pipeline. A json or a yaml
+ *     file should be a list of maps, each of which has keys corresponding to the
+ *     arguments of the pipeline. A yaml blob can also be passed directly as a parameter.
+ *     When passing a csv, json or yaml, relative path names are relativized to the
+ *     location of the parameter file.
+ *   - Combine the parameter sets into a vdsl3 Channel.
+ *
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A list of parameters with the first element of the event being
+ *         the event ID and the second element containing a map of the parsed parameters.
+ */
+ 
+private List<Tuple2<String, Map<String, Object>>> _paramsToParamSets(Map params, Map config){
+  // todo: fetch key from run args
+  def key_ = config.name
+  
+  /* parse regular parameters (not in param_list)  */
+  /*************************************************/
+  def globalParams = config.allArguments
+    .findAll { params.containsKey(it.plainName) }
+    .collectEntries { [ it.plainName, params[it.plainName] ] }
+  def globalID = params.get("id", null)
+
+  /* process params_list arguments */
+  /*********************************/
+  def paramList = params.containsKey("param_list") && params.param_list != null ?
+    params.param_list : []
+  // if (paramList instanceof String) {
+  //   paramList = [paramList]
+  // }
+  // def paramSets = paramList.collectMany{ _parseParamList(it, config) }
+  // TODO: be able to process param_list when it is a list of strings
+  def paramSets = _parseParamList(paramList, config)
+  if (paramSets.isEmpty()) {
+    paramSets = [[null, [:]]]
+  }
+
+  /* combine arguments into channel */
+  /**********************************/
+  def processedParams = paramSets.indexed().collect{ index, tup ->
+    // Process ID
+    def id = tup[0] ?: globalID
+  
+    if (workflow.stubRun && !id) {
+      // if stub run, explicitly add an id if missing
+      id = "stub${index}"
+    }
+    assert id != null: "Each parameter set should have at least an 'id'"
+
+    // Process params
+    def parValues = globalParams + tup[1]
+    // // Remove parameters which are null, if the default is also null
+    // parValues = parValues.collectEntries{paramName, paramValue ->
+    //   parameterSettings = config.functionality.allArguments.find({it.plainName == paramName})
+    //   if ( paramValue != null || parameterSettings.get("default", null) != null ) {
+    //     [paramName, paramValue]
+    //   }
+    // }
+    parValues = parValues.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument"
+
+      if (par == null) {
+        return [:]
+      }
+      value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+
+      [ name, value ]
+    }
+
+    [id, parValues]
+  }
+
+  // Check if ids (first element of each list) is unique
+  _checkUniqueIds(processedParams)
+  return processedParams
+}
+
+/**
+ * Parse nextflow parameters based on settings defined in a viash config 
+ * and return a nextflow channel.
+ * 
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A nextflow Channel with events. Events are formatted as a tuple that contains 
+ *         first contains the ID of the event and as second element holds a parameter map.
+ *       
+ *
+ */
+def channelFromParams(Map params, Map config) {
+  def processedParams = _paramsToParamSets(params, config)
+  return Channel.fromList(processedParams)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf'
+def checkUniqueIds(Map args) {
+  def stopOnError = args.stopOnError == null ? args.stopOnError : true
+
+  def idChecker = new IDChecker()
+
+  return filter { tup ->
+    if (!idChecker.observe(tup[0])) {
+      if (stopOnError) {
+        error "Duplicate id: ${tup[0]}"
+      } else {
+        log.warn "Duplicate id: ${tup[0]}, removing duplicate entry"
+        return false
+      }
+    }
+    return true
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf'
+// This helper file will be deprecated soon
+preprocessInputsDeprecationWarningPrinted = false
+
+def preprocessInputsDeprecationWarning() {
+  if (!preprocessInputsDeprecationWarningPrinted) {
+    preprocessInputsDeprecationWarningPrinted = true
+    System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.")
+  }
+}
+
+/**
+ * Generate a nextflow Workflow that allows processing a channel of 
+ * Vdsl3 formatted events and apply a Viash config to them:
+ *    - Gather default parameters from the Viash config and make 
+ *      sure that they are correctly formatted (see applyConfig method).
+ *    - Format the input parameters (also using the applyConfig method).
+ *    - Apply the default parameter to the input parameters.
+ *    - Do some assertions:
+ *        ~ Check if the event IDs in the channel are unique.
+ * 
+ * The events in the channel are formatted as tuples, with the 
+ * first element of the tuples being a unique id of the parameter set, 
+ * and the second element containg the the parameters themselves.
+ * Optional extra elements of the tuples will be passed to the output as is.
+ *
+ * @param args A map that must contain a 'config' key that points
+ *              to a parsed config (see readConfig()). Optionally, a
+ *              'key' key can be provided which can be used to create a unique
+ *              name for the workflow process.
+ *
+ * @return A workflow that allows processing a channel of Vdsl3 formatted events
+ * and apply a Viash config to them.
+ */
+def preprocessInputs(Map args) {
+  preprocessInputsDeprecationWarning()
+
+  def config = args.config
+  assert config instanceof Map : 
+    "Error in preprocessInputs: config must be a map. " +
+    "Expected class: Map. Found: config.getClass() is ${config.getClass()}"
+  def key_ = args.key ?: config.name
+
+  // Get different parameter types (used throughout this function)
+  def defaultArgs = config.allArguments
+    .findAll { it.containsKey("default") }
+    .collectEntries { [ it.plainName, it.default ] }
+
+  map { tup ->
+    def id = tup[0]
+    def data = tup[1]
+    def passthrough = tup.drop(2)
+
+    def new_data = (defaultArgs + data).collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      
+      if (par != null) {
+        value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+      }
+
+      [ name, value ]
+    }
+
+    [ id, new_data ] + passthrough
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component config.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component config.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runComponents(Map args) {
+  log.warn("runComponents is deprecated, use runEach instead")
+  assert args.components: "runComponents should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runComponents"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def id_ = args.id
+
+  workflow runComponentsWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def comp_config = comp_.config
+
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_config)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          // def new_id = id_(tup[0], tup[1], comp_config)
+          def new_id = tup[0]
+          if (id_ instanceof String) {
+            new_id = id_
+          } else if (id_ instanceof Closure) {
+            new_id = id_(new_id, tup[1], comp_config)
+          }
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def data_ch = id_ch | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_config)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_config)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+      
+      post_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runComponentsWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component itself.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component itself.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runEach(Map args) {
+  assert args.components: "runEach should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runEach"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def runIf_ = args.runIf
+  def id_ = args.id
+
+  assert !runIf_ || runIf_ instanceof Closure: "runEach: must pass a Closure to runIf."
+
+  workflow runEachWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          def new_id = id_
+          if (new_id instanceof Closure) {
+            new_id = new_id(tup[0], tup[1], comp_)
+          }
+          assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}"
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def chPassthrough = null
+      def chRun = null
+      if (runIf_) {
+        def idRunIfBranch = id_ch.branch{ tup ->
+          run: runIf_(tup[0], tup[1], comp_)
+          passthrough: true
+        }
+        chPassthrough = idRunIfBranch.passthrough
+        chRun = idRunIfBranch.run
+      } else {
+        chRun = id_ch
+        chPassthrough = Channel.empty()
+      }
+      def data_ch = chRun | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+
+      def return_ch = post_ch
+        | concat(chPassthrough)
+      
+      return_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runEachWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf'
+/**
+ * Join sourceChannel to targetChannel
+ * 
+ * This function joins the sourceChannel to the targetChannel. 
+ * However, each id in the targetChannel must be present in the
+ * sourceChannel. If _meta.join_id exists in the targetChannel, that is 
+ * used as an id instead. If the id doesn't match any id in the sourceChannel,
+ * an error is thrown.
+ */
+
+def safeJoin(targetChannel, sourceChannel, key) {
+  def sourceIDs = new IDChecker()
+
+  def sourceCheck = sourceChannel
+    | map { tup ->
+      sourceIDs.observe(tup[0])
+      tup
+    }
+  def targetCheck = targetChannel
+    | map { tup ->
+      def id = tup[0]
+      
+      if (!sourceIDs.contains(id)) {
+        error (
+          "Error in module '${key}' when merging output with original state.\n" +
+          "  Reason: output with id '${id}' could not be joined with source channel.\n" +
+          "    If the IDs in the output channel differ from the input channel,\n" + 
+          "    please set `tup[1]._meta.join_id to the original ID.\n" +
+          "  Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + 
+          "  Unexpected ID in the output channel: '${id}'.\n" +
+          "  Example input event: [\"id\", [input: file(...)]],\n" +
+          "  Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]"
+        )
+      }
+      // TODO: add link to our documentation on how to fix this
+
+      tup
+    }
+  
+  sourceCheck.cross(targetChannel)
+    | map{ left, right ->
+      right + left.drop(1)
+    }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf'
+def _processArgument(arg) {
+  arg.multiple = arg.multiple != null ? arg.multiple : false
+  arg.required = arg.required != null ? arg.required : false
+  arg.direction = arg.direction != null ? arg.direction : "input"
+  arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";"
+  arg.plainName = arg.name.replaceAll("^-*", "")
+
+  if (arg.type == "file") {
+    arg.must_exist = arg.must_exist != null ? arg.must_exist : true
+    arg.create_parent = arg.create_parent != null ? arg.create_parent : true
+  }
+
+  // add default values to output files which haven't already got a default
+  if (arg.type == "file" && arg.direction == "output" && arg.default == null) {
+    def mult = arg.multiple ? "_*" : ""
+    def extSearch = ""
+    if (arg.default != null) {
+      extSearch = arg.default
+    } else if (arg.example != null) {
+      extSearch = arg.example
+    }
+    if (extSearch instanceof List) {
+      extSearch = extSearch[0]
+    }
+    def extSearchResult = extSearch.find("\\.[^\\.]+\$")
+    def ext = extSearchResult != null ? extSearchResult : ""
+    arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}"
+    if (arg.multiple) {
+      arg.default = [arg.default]
+    }
+  }
+
+  if (!arg.multiple) {
+    if (arg.default != null && arg.default instanceof List) {
+      arg.default = arg.default[0]
+    }
+    if (arg.example != null && arg.example instanceof List) {
+      arg.example = arg.example[0]
+    }
+  }
+
+  if (arg.type == "boolean_true") {
+    arg.default = false
+  }
+  if (arg.type == "boolean_false") {
+    arg.default = true
+  }
+
+  arg
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf'
+def addGlobalArguments(config) {
+  def localConfig = [
+    "argument_groups": [
+      [
+        "name": "Nextflow input-output arguments",
+        "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+        "arguments" : [
+          [
+            'name': '--publish_dir',
+            'required': true,
+            'type': 'string',
+            'description': 'Path to an output directory.',
+            'example': 'output/',
+            'multiple': false
+          ],
+          [
+            'name': '--param_list',
+            'required': false,
+            'type': 'string',
+            'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.
+            |
+            |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`.
+            |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.
+            |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`.
+            |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`.
+            |
+            |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(),
+            'example': 'my_params.yaml',
+            'multiple': false,
+            'hidden': true
+          ]
+          // TODO: allow multiple: true in param_list?
+          // TODO: allow to specify a --param_list_regex to filter the param_list?
+          // TODO: allow to specify a --param_list_from_state to remap entries in the param_list?
+        ]
+      ]
+    ]
+  ]
+
+  return processConfig(_mergeMap(config, localConfig))
+}
+
+def _mergeMap(Map lhs, Map rhs) {
+  return rhs.inject(lhs.clone()) { map, entry ->
+    if (map[entry.key] instanceof Map && entry.value instanceof Map) {
+      map[entry.key] = _mergeMap(map[entry.key], entry.value)
+    } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) {
+      map[entry.key] += entry.value
+    } else {
+      map[entry.key] = entry.value
+    }
+    return map
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf'
+def _generateArgumentHelp(param) {
+  // alternatives are not supported
+  // def names = param.alternatives ::: List(param.name)
+
+  def unnamedProps = [
+    ["required parameter", param.required],
+    ["multiple values allowed", param.multiple],
+    ["output", param.direction.toLowerCase() == "output"],
+    ["file must exist", param.type == "file" && param.must_exist]
+  ].findAll{it[1]}.collect{it[0]}
+  
+  def dflt = null
+  if (param.default != null) {
+    if (param.default instanceof List) {
+      dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      dflt = param.default.toString()
+    }
+  }
+  def example = null
+  if (param.example != null) {
+    if (param.example instanceof List) {
+      example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      example = param.example.toString()
+    }
+  }
+  def min = param.min?.toString()
+  def max = param.max?.toString()
+
+  def escapeChoice = { choice ->
+    def s1 = choice.replaceAll("\\n", "\\\\n")
+    def s2 = s1.replaceAll("\"", """\\\"""")
+    s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2
+  }
+  def choices = param.choices == null ? 
+    null : 
+    "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]"
+
+  def namedPropsStr = [
+    ["type", ([param.type] + unnamedProps).join(", ")],
+    ["default", dflt],
+    ["example", example],
+    ["choices", choices],
+    ["min", min],
+    ["max", max]
+  ]
+    .findAll{it[1]}
+    .collect{"\n        " + it[0] + ": " + it[1].replaceAll("\n", "\\n")}
+    .join("")
+  
+  def descStr = param.description == null ?
+    "" :
+    _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n        ")
+  
+  "\n    --" + param.plainName +
+    namedPropsStr +
+    descStr
+}
+
+// Based on Helper.generateHelp() in Helper.scala
+def _generateHelp(config) {
+  def fun = config
+
+  // PART 1: NAME AND VERSION
+  def nameStr = fun.name + 
+    (fun.version == null ? "" : " " + fun.version)
+
+  // PART 2: DESCRIPTION
+  def descrStr = fun.description == null ? 
+    "" :
+    "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n")
+
+  // PART 3: Usage
+  def usageStr = fun.usage == null ? 
+    "" :
+    "\n\nUsage:\n" + fun.usage.trim()
+
+  // PART 4: Options
+  def argGroupStrs = fun.allArgumentGroups.collect{argGroup ->
+    def name = argGroup.name
+    def descriptionStr = argGroup.description == null ?
+      "" :
+      "\n    " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n    ") + "\n"
+    def arguments = argGroup.arguments.collect{arg -> 
+      arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg
+    }.findAll{it != null}
+    def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)}
+    
+    "\n\n$name:" +
+      descriptionStr +
+      argumentStrs.join("\n")
+  }
+
+  // FINAL: combine
+  def out = nameStr + 
+    descrStr +
+    usageStr + 
+    argGroupStrs.join("")
+
+  return out
+}
+
+// based on Format._paragraphWrap
+def _paragraphWrap(str, maxLength) {
+  def outLines = []
+  str.split("\n").each{par ->
+    def words = par.split("\\s").toList()
+
+    def word = null
+    def line = words.pop()
+    while(!words.isEmpty()) {
+      word = words.pop()
+      if (line.length() + word.length() + 1 <= maxLength) {
+        line = line + " " + word
+      } else {
+        outLines.add(line)
+        line = word
+      }
+    }
+    if (words.isEmpty()) {
+      outLines.add(line)
+    }
+  }
+  return outLines
+}
+
+def helpMessage(config) {
+  if (params.containsKey("help") && params.help) {
+    def mergedConfig = addGlobalArguments(config)
+    def helpStr = _generateHelp(mergedConfig)
+    println(helpStr)
+    exit 0
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf'
+def processConfig(config) {
+  // set defaults for arguments
+  config.arguments = 
+    (config.arguments ?: []).collect{_processArgument(it)}
+
+  // set defaults for argument_group arguments
+  config.argument_groups =
+    (config.argument_groups ?: []).collect{grp ->
+      grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)}
+      grp
+    }
+
+  // create combined arguments list
+  config.allArguments = 
+    config.arguments +
+    config.argument_groups.collectMany{it.arguments}
+
+  // add missing argument groups (based on Functionality::allArgumentGroups())
+  def argGroups = config.argument_groups
+  if (argGroups.any{it.name.toLowerCase() == "arguments"}) {
+    argGroups = argGroups.collect{ grp ->
+      if (grp.name.toLowerCase() == "arguments") {
+        grp = grp + [
+          arguments: grp.arguments + config.arguments
+        ]
+      }
+      grp
+    }
+  } else {
+    argGroups = argGroups + [
+      name: "Arguments",
+      arguments: config.arguments
+    ]
+  }
+  config.allArgumentGroups = argGroups
+
+  config
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf'
+
+def readConfig(file) {
+  def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml"))
+  processConfig(config)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf'
+/**
+  * Resolve a path relative to the current file.
+  * 
+  * @param str The path to resolve, as a String.
+  * @param parentPath The path to resolve relative to, as a Path.
+  *
+  * @return The path that may have been resovled, as a Path.
+  */
+def _resolveSiblingIfNotAbsolute(str, parentPath) {
+  if (str !instanceof String) {
+    return str
+  }
+  if (!_stringIsAbsolutePath(str)) {
+    return parentPath.resolveSibling(str)
+  } else {
+    return file(str, hidden: true)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf'
+/**
+  * Check whether a path as a string is absolute.
+  *
+  * In the past, we tried using `file(., relative: true).isAbsolute()`,
+  * but the 'relative' option was added in 22.10.0.
+  *
+  * @param path The path to check, as a String.
+  *
+  * @return Whether the path is absolute, as a boolean.
+  */
+def _stringIsAbsolutePath(path) {
+  def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/
+
+  assert path instanceof String
+  return _resolve_URL_PROTOCOL.matcher(path).matches()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf'
+class CustomTraceObserver implements nextflow.trace.TraceObserver {
+  List traces
+
+  CustomTraceObserver(List traces) {
+    this.traces = traces
+  }
+
+  @Override
+  void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+
+  @Override
+  void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+}
+
+def collectTraces() {
+  def traces = Collections.synchronizedList([])
+
+  // add custom trace observer which stores traces in the traces object
+  session.observers.add(new CustomTraceObserver(traces))
+
+  traces
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf'
+/**
+  * Performs a deep clone of the given object.
+  * @param x an object
+  */
+def deepClone(x) {
+  iterateMap(x, {it instanceof Cloneable ? it.clone() : it})
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf'
+def getPublishDir() {
+  return params.containsKey("publish_dir") ? params.publish_dir : 
+    params.containsKey("publishDir") ? params.publishDir : 
+    null
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf'
+
+// Recurse upwards until we find a '.build.yaml' file
+def _findBuildYamlFile(pathPossiblySymlink) {
+  def path = pathPossiblySymlink.toRealPath()
+  def child = path.resolve(".build.yaml")
+  if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) {
+    return child
+  } else {
+    def parent = path.getParent()
+    if (parent == null) {
+      return null
+    } else {
+      return _findBuildYamlFile(parent)
+    }
+  }
+}
+
+// get the root of the target folder
+def getRootDir() {
+  def dir = _findBuildYamlFile(meta.resources_dir)
+  assert dir != null: "Could not find .build.yaml in the folder structure"
+  dir.getParent()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf'
+/**
+  * Recursively apply a function over the leaves of an object.
+  * @param obj The object to iterate over.
+  * @param fun The function to apply to each value.
+  * @return The object with the function applied to each value.
+  */
+def iterateMap(obj, fun) {
+  if (obj instanceof List && obj !instanceof String) {
+    return obj.collect{item ->
+      iterateMap(item, fun)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectEntries{key, item ->
+      [key.toString(), iterateMap(item, fun)]
+    }
+  } else {
+    return fun(obj)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf'
+/**
+  * A view for printing the event of each channel as a YAML blob.
+  * This is useful for debugging.
+  */
+def niceView() {
+  workflow niceViewWf {
+    take: input
+    main:
+      output = input
+        | view{toYamlBlob(it)}
+    emit: output
+  }
+  return niceViewWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf'
+
+def readCsv(file_path) {
+  def output = []
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+
+  // todo: allow escaped quotes in string
+  // todo: allow single quotes?
+  def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''')
+  def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''')
+
+  def br = java.nio.file.Files.newBufferedReader(inputFile)
+
+  def row = -1
+  def header = null
+  while (br.ready() && header == null) {
+    def line = br.readLine()
+    row++
+    if (!line.startsWith("#")) {
+      header = splitRegex.split(line, -1).collect{field ->
+        m = removeQuote.matcher(field)
+        m.find() ? m.replaceFirst('$1') : field
+      }
+    }
+  }
+  assert header != null: "CSV file should contain a header"
+
+  while (br.ready()) {
+    def line = br.readLine()
+    row++
+    if (line == null) {
+      br.close()
+      break
+    }
+
+    if (!line.startsWith("#")) {
+      def predata = splitRegex.split(line, -1)
+      def data = predata.collect{field ->
+        if (field == "") {
+          return null
+        }
+        def m = removeQuote.matcher(field)
+        if (m.find()) {
+          return m.replaceFirst('$1')
+        } else {
+          return field
+        }
+      }
+      assert header.size() == data.size(): "Row $row should contain the same number as fields as the header"
+      
+      def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null}
+      output.add(dataMap)
+    }
+  }
+
+  output
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf'
+def readJson(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parse(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf'
+def readJsonBlob(str) {
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parseText(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf'
+// Custom constructor to modify how certain objects are parsed from YAML
+class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor {
+  Path root
+
+  class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct {
+    public Object construct(org.yaml.snakeyaml.nodes.Node node) {
+      String filename = (String) constructScalar(node);
+      if (root != null) {
+        return root.resolve(filename);
+      }
+      return java.nio.file.Paths.get(filename);
+    }
+  }
+
+  CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) {
+    super(options)
+    this.root = root
+    // Handling !file tag and parse it back to a File type
+    this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath())
+  }
+}
+
+def readTaggedYaml(Path path) {
+  def options = new org.yaml.snakeyaml.LoaderOptions()
+  def constructor = new CustomConstructor(options, path.getParent())
+  def yaml = new org.yaml.snakeyaml.Yaml(constructor)
+  return yaml.load(path.text)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf'
+def readYaml(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf'
+def readYamlBlob(str) {
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf'
+String toJsonBlob(data) {
+  return groovy.json.JsonOutput.toJson(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf'
+// Custom representer to modify how certain objects are represented in YAML
+class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer {
+  Path relativizer
+
+  class RepresentPath implements org.yaml.snakeyaml.representer.Represent {
+    public String getFileName(Object obj) {
+      if (obj instanceof File) {
+        obj = ((File) obj).toPath();
+      }
+      if (obj !instanceof Path) {
+        throw new IllegalArgumentException("Object: " + obj + " is not a Path or File");
+      }
+      def path = (Path) obj;
+
+      if (relativizer != null) {
+        return relativizer.relativize(path).toString()
+      } else {
+        return path.toString()
+      }
+    }
+
+    public org.yaml.snakeyaml.nodes.Node representData(Object data) {
+      String filename = getFileName(data);
+      def tag = new org.yaml.snakeyaml.nodes.Tag("!file");
+      return representScalar(tag, filename);
+    }
+  }
+  CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) {
+    super(options)
+    this.relativizer = relativizer
+    this.representers.put(sun.nio.fs.UnixPath, new RepresentPath())
+    this.representers.put(Path, new RepresentPath())
+    this.representers.put(File, new RepresentPath())
+  }
+}
+
+String toTaggedYamlBlob(data) {
+  return toRelativeTaggedYamlBlob(data, null)
+}
+String toRelativeTaggedYamlBlob(data, Path relativizer) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  def representer = new CustomRepresenter(options, relativizer)
+  def yaml = new org.yaml.snakeyaml.Yaml(representer, options)
+  return yaml.dump(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf'
+String toYamlBlob(data) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  options.setPrettyFlow(true)
+  def yaml = new org.yaml.snakeyaml.Yaml(options)
+  def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it })
+  return yaml.dump(cleanData)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf'
+void writeJson(data, file) {
+  assert data: "writeJson: data should not be null"
+  assert file: "writeJson: file should not be null"
+  file.write(toJsonBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf'
+void writeYaml(data, file) {
+  assert data: "writeYaml: data should not be null"
+  assert file: "writeYaml: file should not be null"
+  file.write(toYamlBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf'
+def findStates(Map params, Map config) {
+  def auto_config = deepClone(config)
+  def auto_params = deepClone(params)
+
+  auto_config = auto_config.clone()
+  // override arguments
+  auto_config.argument_groups = []
+  auto_config.arguments = [
+    [
+      type: "string",
+      name: "--id",
+      description: "A dummy identifier",
+      required: false
+    ],
+    [
+      type: "file",
+      name: "--input_states",
+      example: "/path/to/input/directory/**/state.yaml",
+      description: "Path to input directory containing the datasets to be integrated.",
+      required: true,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--filter",
+      example: "foo/.*/state.yaml",
+      description: "Regex to filter state files by path.",
+      required: false
+    ],
+    // to do: make this a yaml blob?
+    [
+      type: "string",
+      name: "--rename_keys",
+      example: ["newKey1:oldKey1", "newKey2:oldKey2"],
+      description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.",
+      required: false,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--settings",
+      example: '{"output_dataset": "dataset.h5ad", "k": 10}',
+      description: "Global arguments as a JSON glob to be passed to all components.",
+      required: false
+    ]
+  ]
+  if (!(auto_params.containsKey("id"))) {
+    auto_params["id"] = "auto"
+  }
+
+  // run auto config through processConfig once more
+  auto_config = processConfig(auto_config)
+
+  workflow findStatesWf {
+    helpMessage(auto_config)
+
+    output_ch = 
+      channelFromParams(auto_params, auto_config)
+        | flatMap { autoId, args ->
+
+          def globalSettings = args.settings ? readYamlBlob(args.settings) : [:]
+
+          // look for state files in input dir
+          def stateFiles = args.input_states
+
+          // filter state files by regex
+          if (args.filter) {
+            stateFiles = stateFiles.findAll{ stateFile ->
+              def stateFileStr = stateFile.toString()
+              def matcher = stateFileStr =~ args.filter
+              matcher.matches()}
+          }
+
+          // read in states
+          def states = stateFiles.collect { stateFile ->
+            def state_ = readTaggedYaml(stateFile)
+            [state_.id, state_]
+          }
+
+          // construct renameMap
+          if (args.rename_keys) {
+            def renameMap = args.rename_keys.collectEntries{renameString ->
+              def split = renameString.split(":")
+              assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey', or 'newKey:oldKey;newKey:oldKey' in case of multiple values"
+              split
+            }
+
+            // rename keys in state, only let states through which have all keys
+            // also add global settings
+            states = states.collectMany{id, state ->
+              def newState = [:]
+
+              for (key in renameMap.keySet()) {
+                def origKey = renameMap[key]
+                if (!(state.containsKey(origKey))) {
+                  return []
+                }
+                newState[key] = state[origKey]
+              }
+
+              [[id, globalSettings + newState]]
+            }
+          }
+
+          states
+        }
+    emit:
+    output_ch
+  }
+
+  return findStatesWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf'
+def joinStates(Closure apply_) {
+  workflow joinStatesWf {
+    take: input_ch
+    main:
+    output_ch = input_ch
+      | toSortedList
+      | filter{ it.size() > 0 }
+      | map{ tups ->
+        def ids = tups.collect{it[0]}
+        def states = tups.collect{it[1]}
+        apply_(ids, states)
+      }
+
+    emit: output_ch
+  }
+  return joinStatesWf
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf'
+def collectFiles(obj) {
+  if (obj instanceof java.io.File || obj instanceof Path)  {
+    return [obj]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.collectMany{item ->
+      collectFiles(item)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectFiles(item)
+    }
+  } else {
+    return []
+  }
+}
+
+/**
+ * Recurse through a state and collect all input files and their target output filenames.
+ * @param obj The state to recurse through.
+ * @param prefix The prefix to prepend to the output filenames.
+ */
+def collectInputOutputPaths(obj, prefix) {
+  if (obj instanceof File || obj instanceof Path)  {
+    def path = obj instanceof Path ? obj : obj.toPath()
+    def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: ""
+    def newFilename = prefix + ext
+    return [[obj, newFilename]]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.withIndex().collectMany{item, ix ->
+      collectInputOutputPaths(item, prefix + "_" + ix)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectInputOutputPaths(item, prefix + "." + key)
+    }
+  } else {
+    return []
+  }
+}
+
+def publishStates(Map args) {
+  def key_ = args.get("key")
+  def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml'))
+
+  assert key_ != null : "publishStates: key must be specified"
+  
+  workflow publishStatesWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1]
+
+          // the input files and the target output filenames
+          def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose()
+          def inputFiles_ = inputoutputFilenames_[0]
+          def outputFilenames_ = inputoutputFilenames_[1]
+
+          def yamlFilename = yamlTemplate_
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+
+            // TODO: do the pathnames in state_ match up with the outputFilenames_?
+
+          // convert state to yaml blob
+          def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename))
+
+          [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesWf
+}
+process publishStatesProc {
+  // todo: check publishpath?
+  publishDir path: "${getPublishDir()}/", mode: "copy"
+  tag "$id"
+  input:
+    tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles)
+  output:
+    tuple val(id), path{[yamlFile] + outputFiles}
+  script:
+  def copyCommands = [
+    inputFiles instanceof List ? inputFiles : [inputFiles],
+    outputFiles instanceof List ? outputFiles : [outputFiles]
+  ]
+    .transpose()
+    .collectMany{infile, outfile ->
+      if (infile.toString() != outfile.toString()) {
+        [
+          "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"",
+          "cp -r '${infile.toString()}' '${outfile.toString()}'"
+        ]
+      } else {
+        // no need to copy if infile is the same as outfile
+        []
+      }
+    }
+  """
+mkdir -p "\$(dirname '${yamlFile}')"
+echo "Storing state as yaml"
+echo '${yamlBlob}' > '${yamlFile}'
+echo "Copying output files to destination folder"
+${copyCommands.join("\n  ")}
+"""
+}
+
+
+// this assumes that the state contains no other values other than those specified in the config
+def publishStatesByConfig(Map args) {
+  def config = args.get("config")
+  assert config != null : "publishStatesByConfig: config must be specified"
+
+  def key_ = args.get("key", config.name)
+  assert key_ != null : "publishStatesByConfig: key must be specified"
+  
+  workflow publishStatesSimpleWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10]
+          def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad']
+
+          // TODO: allow overriding the state.yaml template
+          // TODO TODO: if auto.publish == "state", add output_state as an argument
+          def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml'
+          def yamlFilename = yamlTemplate
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+          def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent()
+
+          // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where
+          //   - key is a String
+          //   - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path)
+          //   - inputPath is a List[Path]
+          //   - outputFilename is a List[String]
+          //   - (key, value) are the tuples that will be saved to the state.yaml file
+          //   - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml)
+          def processedState =
+            config.allArguments
+              .findAll { it.direction == "output" }
+              .collectMany { par ->
+                def plainName_ = par.plainName
+                // if the state does not contain the key, it's an
+                // optional argument for which the component did 
+                // not generate any output
+                if (!state_.containsKey(plainName_)) {
+                  return []
+                }
+                def value = state_[plainName_]
+                // if the parameter is not a file, it should be stored
+                // in the state as-is, but is not something that needs 
+                // to be copied from the source path to the dest path
+                if (par.type != "file") {
+                  return [[key: plainName_, value: value, inputPath: [], outputFilename: []]]
+                }
+                // if the orig state does not contain this filename,
+                // it's an optional argument for which the user specified
+                // that it should not be returned as a state
+                if (!origState_.containsKey(plainName_)) {
+                  return []
+                }
+                def filenameTemplate = origState_[plainName_]
+                // if the pararameter is multiple: true, fetch the template
+                if (par.multiple && filenameTemplate instanceof List) {
+                  filenameTemplate = filenameTemplate[0]
+                }
+                // instantiate the template
+                def filename = filenameTemplate
+                  .replaceAll('\\$id', id_)
+                  .replaceAll('\\$\\{id\\}', id_)
+                  .replaceAll('\\$key', key_)
+                  .replaceAll('\\$\\{key\\}', key_)
+                if (par.multiple) {
+                  // if the parameter is multiple: true, the filename
+                  // should contain a wildcard '*' that is replaced with
+                  // the index of the file
+                  assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}"
+                  def outputPerFile = value.withIndex().collect{ val, ix ->
+                    def filename_ix = filename.replace("*", ix.toString())
+                    def value_ = java.nio.file.Paths.get(filename_ix)
+                    // if id contains a slash
+                    if (yamlDir != null) {
+                      value_ = yamlDir.relativize(value_)
+                    }
+                    def inputPath = val instanceof File ? val.toPath() : val
+                    [value: value_, inputPath: inputPath, outputFilename: filename_ix]
+                  }
+                  def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> 
+                    [key, outputPerFile.collect{dic -> dic[key]}]
+                  }
+                  return [[key: plainName_] + transposedOutputs]
+                } else {
+                  def value_ = java.nio.file.Paths.get(filename)
+                  // if id contains a slash
+                  if (yamlDir != null) {
+                    value_ = yamlDir.relativize(value_)
+                  }
+                  def inputPath = value instanceof File ? value.toPath() : value
+                  return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]]
+                }
+              }
+          
+          def updatedState_ = processedState.collectEntries{[it.key, it.value]}
+          def inputPaths = processedState.collectMany{it.inputPath}
+          def outputFilenames = processedState.collectMany{it.outputFilename}
+          
+          // convert state to yaml blob
+          def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_)
+
+          [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesSimpleWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf'
+def setState(fun) {
+  assert fun instanceof Closure || fun instanceof Map || fun instanceof List :
+    "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}"
+
+  // if fun is a List, convert to map
+  if (fun instanceof List) {
+    // check whether fun is a list[string]
+    assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings"
+    fun = fun.collectEntries{[it, it]}
+  }
+
+  // if fun is a map, convert to closure
+  if (fun instanceof Map) {
+    // check whether fun is a map[string, string]
+    assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings"
+    assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings"
+    def funMap = fun.clone()
+    // turn the map into a closure to be used later on
+    fun = { id_, state_ ->
+      assert state_ instanceof Map : "Error in setState: the state is not a Map"
+      funMap.collectMany{newkey, origkey ->
+        if (state_.containsKey(origkey)) {
+          [[newkey, state_[origkey]]]
+        } else {
+          []
+        }
+      }.collectEntries()
+    }
+  }
+
+  map { tup ->
+    def id = tup[0]
+    def state = tup[1]
+    def unfilteredState = fun(id, state)
+    def newState = unfilteredState.findAll{key, val -> val != null}
+    [id, newState] + tup.drop(2)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf'
+// TODO: unit test processAuto
+def processAuto(Map auto) {
+  // remove null values
+  auto = auto.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"]
+  def unexpectedKeys = auto.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'"
+
+  // check auto.simplifyInput
+  assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean"
+
+  // check auto.simplifyOutput
+  assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean"
+
+  // check auto.transcript
+  assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean"
+
+  // check auto.publish
+  assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'"
+
+  return auto.subMap(expectedKeys)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf'
+def assertMapKeys(map, expectedKeys, requiredKeys, mapName) {
+  assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}"
+  map.forEach { key, val -> 
+    assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+  requiredKeys.forEach { requiredKey -> 
+    assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+}
+
+// TODO: unit test processDirectives
+def processDirectives(Map drctv) {
+  // remove null values
+  drctv = drctv.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = [
+    "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time"
+  ]
+  def unexpectedKeys = drctv.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'"
+
+  /* DIRECTIVE accelerator
+    accepted examples:
+    - [ limit: 4, type: "nvidia-tesla-k80" ]
+  */
+  if (drctv.containsKey("accelerator")) {
+    assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator")
+  }
+
+  /* DIRECTIVE afterScript
+    accepted examples:
+    - "source /cluster/bin/cleanup"
+  */
+  if (drctv.containsKey("afterScript")) {
+    assert drctv["afterScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE beforeScript
+    accepted examples:
+    - "source /cluster/bin/setup"
+  */
+  if (drctv.containsKey("beforeScript")) {
+    assert drctv["beforeScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cache
+    accepted examples:
+    - true
+    - false
+    - "deep"
+    - "lenient"
+  */
+  if (drctv.containsKey("cache")) {
+    assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean
+    if (drctv["cache"] instanceof CharSequence) {
+      assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache"
+    }
+  }
+
+  /* DIRECTIVE conda
+    accepted examples:
+    - "bwa=0.7.15"
+    - "bwa=0.7.15 fastqc=0.11.5"
+    - ["bwa=0.7.15", "fastqc=0.11.5"]
+  */
+  if (drctv.containsKey("conda")) {
+    if (drctv["conda"] instanceof List) {
+      drctv["conda"] = drctv["conda"].join(" ")
+    }
+    assert drctv["conda"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE container
+    accepted examples:
+    - "foo/bar:tag"
+    - [ registry: "reg", image: "im", tag: "ta" ]
+      is transformed to "reg/im:ta"
+    - [ image: "im" ] 
+      is transformed to "im:latest"
+  */
+  if (drctv.containsKey("container")) {
+    assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence
+    if (drctv["container"] instanceof Map) {
+      def m = drctv["container"]
+      assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container")
+      def part1 = 
+        System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : 
+        params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove?
+        m.registry ? m.registry + "/" : 
+        ""
+      def part2 = m.image
+      def part3 = m.tag ? ":" + m.tag : ":latest"
+      drctv["container"] = part1 + part2 + part3
+    }
+  }
+
+  /* DIRECTIVE containerOptions
+    accepted examples:
+    - "--foo bar"
+    - ["--foo bar", "-f b"]
+  */
+  if (drctv.containsKey("containerOptions")) {
+    if (drctv["containerOptions"] instanceof List) {
+      drctv["containerOptions"] = drctv["containerOptions"].join(" ")
+    }
+    assert drctv["containerOptions"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cpus
+    accepted examples:
+    - 1
+    - 10
+  */
+  if (drctv.containsKey("cpus")) {
+    assert drctv["cpus"] instanceof Integer
+  }
+
+  /* DIRECTIVE disk
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("disk")) {
+    assert drctv["disk"] instanceof CharSequence
+    // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE echo
+    accepted examples:
+    - true
+    - false
+  */
+  if (drctv.containsKey("echo")) {
+    assert drctv["echo"] instanceof Boolean
+  }
+
+  /* DIRECTIVE errorStrategy
+    accepted examples:
+    - "terminate"
+    - "finish"
+  */
+  if (drctv.containsKey("errorStrategy")) {
+    assert drctv["errorStrategy"] instanceof CharSequence
+    assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy"
+  }
+
+  /* DIRECTIVE executor
+    accepted examples:
+    - "local"
+    - "sge"
+  */
+  if (drctv.containsKey("executor")) {
+    assert drctv["executor"] instanceof CharSequence
+    assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor"
+  }
+
+  /* DIRECTIVE machineType
+    accepted examples:
+    - "n1-highmem-8"
+  */
+  if (drctv.containsKey("machineType")) {
+    assert drctv["machineType"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE maxErrors
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxErrors")) {
+    assert drctv["maxErrors"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxForks
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxForks")) {
+    assert drctv["maxForks"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxRetries
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxRetries")) {
+    assert drctv["maxRetries"] instanceof Integer
+  }
+
+  /* DIRECTIVE memory
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("memory")) {
+    assert drctv["memory"] instanceof CharSequence
+    // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE module
+    accepted examples:
+    - "ncbi-blast/2.2.27"
+    - "ncbi-blast/2.2.27:t_coffee/10.0"
+    - ["ncbi-blast/2.2.27", "t_coffee/10.0"]
+  */
+  if (drctv.containsKey("module")) {
+    if (drctv["module"] instanceof List) {
+      drctv["module"] = drctv["module"].join(":")
+    }
+    assert drctv["module"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE penv
+    accepted examples:
+    - "smp"
+  */
+  if (drctv.containsKey("penv")) {
+    assert drctv["penv"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE pod
+    accepted examples:
+    - [ label: "key", value: "val" ]
+    - [ annotation: "key", value: "val" ]
+    - [ env: "key", value: "val" ]
+    - [ [label: "l", value: "v"], [env: "e", value: "v"]]
+  */
+  if (drctv.containsKey("pod")) {
+    if (drctv["pod"] instanceof Map) {
+      drctv["pod"] = [ drctv["pod"] ]
+    }
+    assert drctv["pod"] instanceof List
+    drctv["pod"].forEach { pod ->
+      assert pod instanceof Map
+      // TODO: should more checks be added?
+      // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod
+      // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...?
+    }
+  }
+
+  /* DIRECTIVE publishDir
+    accepted examples:
+    - []
+    - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ]
+    - "/path/to/dir" 
+      is transformed to [[ path: "/path/to/dir" ]]
+    - [ path: "/path/to/dir", mode: "cache" ]
+      is transformed to [[ path: "/path/to/dir", mode: "cache" ]]
+  */
+  // TODO: should we also look at params["publishDir"]?
+  if (drctv.containsKey("publishDir")) {
+    def pblsh = drctv["publishDir"]
+    
+    // check different options
+    assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence
+    
+    // turn into list if not already so
+    // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work.
+    pblsh = pblsh instanceof List ? pblsh : [ pblsh ]
+
+    // check elements of publishDir
+    pblsh = pblsh.collect{ elem ->
+      // turn into map if not already so
+      elem = elem instanceof CharSequence ? [ path: elem ] : elem
+
+      // check types and keys
+      assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}"
+      assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir")
+
+      // check elements in map
+      assert elem.containsKey("path")
+      assert elem["path"] instanceof CharSequence
+      if (elem.containsKey("mode")) {
+        assert elem["mode"] instanceof CharSequence
+        assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ]
+      }
+      if (elem.containsKey("overwrite")) {
+        assert elem["overwrite"] instanceof Boolean
+      }
+      if (elem.containsKey("pattern")) {
+        assert elem["pattern"] instanceof CharSequence
+      }
+      if (elem.containsKey("saveAs")) {
+        assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'"
+      }
+      if (elem.containsKey("enabled")) {
+        assert elem["enabled"] instanceof Boolean
+      }
+
+      // return final result
+      elem
+    }
+    // store final directive
+    drctv["publishDir"] = pblsh
+  }
+
+  /* DIRECTIVE queue
+    accepted examples:
+    - "long"
+    - "short,long"
+    - ["short", "long"]
+  */
+  if (drctv.containsKey("queue")) {
+    if (drctv["queue"] instanceof List) {
+      drctv["queue"] = drctv["queue"].join(",")
+    }
+    assert drctv["queue"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE label
+    accepted examples:
+    - "big_mem"
+    - "big_cpu"
+    - ["big_mem", "big_cpu"]
+  */
+  if (drctv.containsKey("label")) {
+    if (drctv["label"] instanceof CharSequence) {
+      drctv["label"] = [ drctv["label"] ]
+    }
+    assert drctv["label"] instanceof List
+    drctv["label"].forEach { label ->
+      assert label instanceof CharSequence
+      // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?")
+      // ^ does not allow closures
+    }
+  }
+
+  /* DIRECTIVE scratch
+    accepted examples:
+    - true
+    - "/path/to/scratch"
+    - '$MY_PATH_TO_SCRATCH'
+    - "ram-disk"
+  */
+  if (drctv.containsKey("scratch")) {
+    assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE storeDir
+    accepted examples:
+    - "/path/to/storeDir"
+  */
+  if (drctv.containsKey("storeDir")) {
+    assert drctv["storeDir"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE stageInMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageInMode")) {
+    assert drctv["stageInMode"] instanceof CharSequence
+    assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"]
+  }
+
+  /* DIRECTIVE stageOutMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageOutMode")) {
+    assert drctv["stageOutMode"] instanceof CharSequence
+    assert drctv["stageOutMode"] in ["copy", "move", "rsync"]
+  }
+
+  /* DIRECTIVE tag
+    accepted examples:
+    - "foo"
+    - '$id'
+  */
+  if (drctv.containsKey("tag")) {
+    assert drctv["tag"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE time
+    accepted examples:
+    - "1h"
+    - "2days"
+    - "1day 6hours 3minutes 30seconds"
+  */
+  if (drctv.containsKey("time")) {
+    assert drctv["time"] instanceof CharSequence
+    // todo: validation regex?
+  }
+
+  return drctv
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf'
+def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) {
+  // override defaults with args
+  def workflowArgs = defaultWfArgs + args
+
+  // check whether 'key' exists
+  assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument"
+
+  // if 'key' is a closure, apply it to the original key
+  if (workflowArgs["key"] instanceof Closure) {
+    workflowArgs["key"] = workflowArgs["key"](meta.config.name)
+  }
+  def key = workflowArgs["key"]
+  assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}"
+  assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}"
+
+  // check for any unexpected keys
+  def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"]
+  def unexpectedKeys = workflowArgs.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'"
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument"
+  assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}"
+  workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"])
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument"
+  assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}"
+  workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"])
+
+  // auto define publish, if so desired
+  if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.publish_dir = \"./output/\""
+    def publishDir = getPublishDir()
+    
+    if (publishDir != null) {
+      workflowArgs.directives.publishDir = [[ 
+        path: publishDir, 
+        saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default
+        mode: "copy"
+      ]]
+    }
+  }
+
+  // auto define transcript, if so desired
+  if (workflowArgs.auto.transcript == true) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.transcripts_dir = \"./transcripts/\""
+    def transcriptsDir = 
+      params.containsKey("transcripts_dir") ? params.transcripts_dir : 
+      params.containsKey("transcriptsDir") ? params.transcriptsDir : 
+      params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" :
+      params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : 
+      null
+    if (transcriptsDir != null) {
+      def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss')
+      def transcriptsPublishDir = [ 
+        path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/",
+        saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", 
+        mode: "copy"
+      ]
+      def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : []
+      workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir
+    }
+  }
+
+  // if this is a stubrun, remove certain directives?
+  if (workflow.stubRun) {
+    workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"])
+  }
+
+  for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam]) {
+      assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}"
+    }
+  }
+
+  // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well?
+  for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) {
+      log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead."
+    }
+  }
+
+  // check fromState
+  workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config)
+
+  // check toState
+  workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config)
+
+  // return output
+  return workflowArgs
+}
+
+def _processFromState(fromState, key_, config_) {
+  assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List :
+    "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}"
+  if (fromState == null) {
+    return null
+  }
+  
+  // if fromState is a List, convert to map
+  if (fromState instanceof List) {
+    // check whether fromstate is a list[string]
+    assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings"
+    fromState = fromState.collectEntries{[it, it]}
+  }
+
+  // if fromState is a map, convert to closure
+  if (fromState instanceof Map) {
+    // check whether fromstate is a map[string, string]
+    assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings"
+    assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings"
+    def fromStateMap = fromState.clone()
+    def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    fromState = { it ->
+      def state = it[1]
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def data = fromStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (state.containsKey(origkey)) {
+          [[newkey, state[origkey]]]
+        } else if (!requiredInputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state")
+        }
+      }.collectEntries()
+      data
+    }
+  }
+  
+  return fromState
+}
+
+def _processToState(toState, key_, config_) {
+  if (toState == null) {
+    toState = { tup -> tup[1] }
+  }
+
+  // toState should be a closure, map[string, string], or list[string]
+  assert toState instanceof Closure || toState instanceof Map || toState instanceof List :
+    "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}"
+
+  // if toState is a List, convert to map
+  if (toState instanceof List) {
+    // check whether toState is a list[string]
+    assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings"
+    toState = toState.collectEntries{[it, it]}
+  }
+
+  // if toState is a map, convert to closure
+  if (toState instanceof Map) {
+    // check whether toState is a map[string, string]
+    assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings"
+    assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings"
+    def toStateMap = toState.clone()
+    def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    toState = { it ->
+      def output = it[1]
+      def state = it[2]
+      assert output instanceof Map : "Error in module '$key_': the output is not a Map"
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def extraEntries = toStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (output.containsKey(origkey)) {
+          [[newkey, output[origkey]]]
+        } else if (!requiredOutputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output")
+        }
+      }.collectEntries()
+      state + extraEntries
+    }
+  }
+
+  return toState
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf'
+def _debug(workflowArgs, debugKey) {
+  if (workflowArgs.debug) {
+    view { "process '${workflowArgs.key}' $debugKey tuple: $it"  }
+  } else {
+    map { it }
+  }
+}
+
+// depends on: innerWorkflowFactory
+def workflowFactory(Map args, Map defaultWfArgs, Map meta) {
+  def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta)
+  def key_ = workflowArgs["key"]
+  
+  workflow workflowInstance {
+    take: input_
+
+    main:
+    def chModified = input_
+      | checkUniqueIds([:])
+      | _debug(workflowArgs, "input")
+      | map { tuple ->
+        tuple = deepClone(tuple)
+        
+        if (workflowArgs.map) {
+          tuple = workflowArgs.map(tuple)
+        }
+        if (workflowArgs.mapId) {
+          tuple[0] = workflowArgs.mapId(tuple[0])
+        }
+        if (workflowArgs.mapData) {
+          tuple[1] = workflowArgs.mapData(tuple[1])
+        }
+        if (workflowArgs.mapPassthrough) {
+          tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2))
+        }
+
+        // check tuple
+        assert tuple instanceof List : 
+          "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}"
+        assert tuple.size() >= 2 : 
+          "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: tuple.size() == ${tuple.size()}"
+        
+        // check id field
+        if (tuple[0] instanceof GString) {
+          tuple[0] = tuple[0].toString()
+        }
+        assert tuple[0] instanceof CharSequence : 
+          "Error in module '${key_}': first element of tuple in channel should be a String\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: ${tuple[0]}"
+        
+        // match file to input file
+        if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) {
+          def inputFiles = meta.config.allArguments
+            .findAll { it.type == "file" && it.direction == "input" }
+          
+          assert inputFiles.size() == 1 : 
+              "Error in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Anonymous file inputs are only allowed when the process has exactly one file input.\n" +
+              "  Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}"
+
+          tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries()
+        }
+
+        // check data field
+        assert tuple[1] instanceof Map : 
+          "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+        // rename keys of data field in tuple
+        if (workflowArgs.renameKeys) {
+          assert workflowArgs.renameKeys instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}"
+          assert tuple[1] instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+          // TODO: allow renameKeys to be a function?
+          workflowArgs.renameKeys.each { newKey, oldKey ->
+            assert newKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}"
+            assert oldKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}"
+            assert tuple[1].containsKey(oldKey) : 
+              "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" +
+              "  Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'"
+            tuple[1].put(newKey, tuple[1][oldKey])
+          }
+          tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey })
+        }
+        tuple
+      }
+
+
+    def chRun = null
+    def chPassthrough = null
+    if (workflowArgs.runIf) {
+      def runIfBranch = chModified.branch{ tup ->
+        run: workflowArgs.runIf(tup[0], tup[1])
+        passthrough: true
+      }
+      chRun = runIfBranch.run
+      chPassthrough = runIfBranch.passthrough
+    } else {
+      chRun = chModified
+      chPassthrough = Channel.empty()
+    }
+
+    def chRunFiltered = workflowArgs.filter ?
+      chRun | filter{workflowArgs.filter(it)} :
+      chRun
+
+    def chArgs = workflowArgs.fromState ? 
+      chRunFiltered | map{
+        def new_data = workflowArgs.fromState(it.take(2))
+        [it[0], new_data]
+      } :
+      chRunFiltered | map {tup -> tup.take(2)}
+
+    // fill in defaults
+    def chArgsWithDefaults = chArgs
+      | map { tuple ->
+        def id_ = tuple[0]
+        def data_ = tuple[1]
+
+        // TODO: could move fromState to here
+
+        // fetch default params from functionality
+        def defaultArgs = meta.config.allArguments
+          .findAll { it.containsKey("default") }
+          .collectEntries { [ it.plainName, it.default ] }
+
+        // fetch overrides in params
+        def paramArgs = meta.config.allArguments
+          .findAll { par ->
+            def argKey = key_ + "__" + par.plainName
+            params.containsKey(argKey)
+          }
+          .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] }
+        
+        // fetch overrides in data
+        def dataArgs = meta.config.allArguments
+          .findAll { data_.containsKey(it.plainName) }
+          .collectEntries { [ it.plainName, data_[it.plainName] ] }
+        
+        // combine params
+        def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs
+
+        // remove arguments with explicit null values
+        combinedArgs
+          .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"}
+
+        combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_)
+
+        [id_, combinedArgs] + tuple.drop(2)
+      }
+
+    // TODO: move some of the _meta.join_id wrangling to the safeJoin() function.
+    def chInitialOutput = chArgsWithDefaults
+      | _debug(workflowArgs, "processed")
+      // run workflow
+      | innerWorkflowFactory(workflowArgs)
+      // check output tuple
+      | map { id_, output_ ->
+
+        // see if output map contains metadata
+        def meta_ =
+          output_ instanceof Map && output_.containsKey("_meta") ? 
+          output_["_meta"] :
+          [:]
+        def join_id = meta_.join_id ?: id_
+        
+        // remove metadata
+        output_ = output_.findAll{k, v -> k != "_meta"}
+
+        // check value types
+        output_ = _processOutputValues(output_, meta.config, id_, key_)
+
+        // simplify output if need be
+        if (workflowArgs.auto.simplifyOutput && output_.size() == 1) {
+          output_ = output_.values()[0]
+        }
+
+        [join_id, id_, output_]
+      }
+      // | view{"chInitialOutput: ${it.take(3)}"}
+
+    // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...]
+    def chNewState = safeJoin(chInitialOutput, chRunFiltered, key_)
+      // input tuple format: [join_id, id, output, prev_state, ...]
+      // output tuple format: [join_id, id, new_state, ...]
+      | map{ tup ->
+        def new_state = workflowArgs.toState(tup.drop(1).take(3))
+        tup.take(2) + [new_state] + tup.drop(4)
+      }
+
+    if (workflowArgs.auto.publish == "state") {
+      def chPublish = chNewState
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [join_id, id, new_state]
+        | map{ tup ->
+          tup.take(3)
+        }
+
+      safeJoin(chPublish, chArgsWithDefaults, key_)
+        // input tuple format: [join_id, id, new_state, orig_state, ...]
+        // output tuple format: [id, new_state, orig_state]
+        | map { tup ->
+          tup.drop(1).take(3)
+      }
+        | publishStatesByConfig(key: key_, config: meta.config)
+    }
+
+    // remove join_id and meta
+    chReturn = chNewState
+      | map { tup ->
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [id, new_state, ...]
+        tup.drop(1)
+      }
+      | _debug(workflowArgs, "output")
+      | concat(chPassthrough)
+
+    emit: chReturn
+  }
+
+  def wf = workflowInstance.cloneWithName(key_)
+
+  // add factory function
+  wf.metaClass.run = { runArgs ->
+    workflowFactory(runArgs, workflowArgs, meta)
+  }
+  // add config to module for later introspection
+  wf.metaClass.config = meta.config
+
+  return wf
+}
+
+nextflow.enable.dsl=2
+
+// START COMPONENT-SPECIFIC CODE
+
+// create meta object
+meta = [
+  "resources_dir": moduleDir.toRealPath().normalize(),
+  "config": processConfig(readJsonBlob('''{
+  "name" : "agat_sp_merge_annotations",
+  "namespace" : "agat",
+  "version" : "main",
+  "authors" : [
+    {
+      "name" : "Leïla Paquay",
+      "roles" : [
+        "author",
+        "maintainer"
+      ],
+      "info" : {
+        "links" : {
+          "email" : "leila@data-intuitive.com",
+          "github" : "Leila011",
+          "linkedin" : "leilapaquay"
+        },
+        "organizations" : [
+          {
+            "name" : "Data Intuitive",
+            "href" : "https://www.data-intuitive.com",
+            "role" : "Software Developer"
+          }
+        ]
+      }
+    }
+  ],
+  "argument_groups" : [
+    {
+      "name" : "Inputs",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--gff",
+          "alternatives" : [
+            "-f"
+          ],
+          "description" : "Input GTF/GFF file(s).\n",
+          "example" : [
+            "input1.gff;input2.gff"
+          ],
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "input",
+          "multiple" : true,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Outputs",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--output",
+          "alternatives" : [
+            "-o",
+            "--out"
+          ],
+          "description" : "Output gff3 file where the gene incriminated will be writen.",
+          "example" : [
+            "output.gff"
+          ],
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Arguments",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--config",
+          "alternatives" : [
+            "-c"
+          ],
+          "description" : "AGAT config file. By default AGAT takes the original agat_config.yaml shipped with AGAT. \nThe `--config` option gives you the possibility to use your own AGAT config file (located\nelsewhere or named differently).\n",
+          "example" : [
+            "custom_agat_config.yaml"
+          ],
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    }
+  ],
+  "resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "script.sh",
+      "is_executable" : true
+    }
+  ],
+  "description" : "Merge different gff annotation files into one. It uses the AGAT parser that takes care of\nduplicated names and fixes other oddities met in those files.\n",
+  "test_resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "test.sh",
+      "is_executable" : true
+    },
+    {
+      "type" : "file",
+      "path" : "test_data"
+    }
+  ],
+  "status" : "enabled",
+  "requirements" : {
+    "commands" : [
+      "ps"
+    ]
+  },
+  "keywords" : [
+    "gene annotations",
+    "merge",
+    "gff"
+  ],
+  "license" : "GPL-3.0",
+  "references" : {
+    "doi" : [
+      "10.5281/zenodo.3552717"
+    ]
+  },
+  "links" : {
+    "repository" : "https://github.com/NBISweden/AGAT",
+    "homepage" : "https://github.com/NBISweden/AGAT",
+    "documentation" : "https://agat.readthedocs.io/en/latest/tools/agat_sp_merge_annotations.html",
+    "issue_tracker" : "https://github.com/NBISweden/AGAT/issues"
+  },
+  "runners" : [
+    {
+      "type" : "executable",
+      "id" : "executable",
+      "docker_setup_strategy" : "ifneedbepullelsecachedbuild"
+    },
+    {
+      "type" : "nextflow",
+      "id" : "nextflow",
+      "directives" : {
+        "tag" : "$id"
+      },
+      "auto" : {
+        "simplifyInput" : true,
+        "simplifyOutput" : false,
+        "transcript" : false,
+        "publish" : false
+      },
+      "config" : {
+        "labels" : {
+          "mem1gb" : "memory = 1000000000.B",
+          "mem2gb" : "memory = 2000000000.B",
+          "mem5gb" : "memory = 5000000000.B",
+          "mem10gb" : "memory = 10000000000.B",
+          "mem20gb" : "memory = 20000000000.B",
+          "mem50gb" : "memory = 50000000000.B",
+          "mem100gb" : "memory = 100000000000.B",
+          "mem200gb" : "memory = 200000000000.B",
+          "mem500gb" : "memory = 500000000000.B",
+          "mem1tb" : "memory = 1000000000000.B",
+          "mem2tb" : "memory = 2000000000000.B",
+          "mem5tb" : "memory = 5000000000000.B",
+          "mem10tb" : "memory = 10000000000000.B",
+          "mem20tb" : "memory = 20000000000000.B",
+          "mem50tb" : "memory = 50000000000000.B",
+          "mem100tb" : "memory = 100000000000000.B",
+          "mem200tb" : "memory = 200000000000000.B",
+          "mem500tb" : "memory = 500000000000000.B",
+          "mem1gib" : "memory = 1073741824.B",
+          "mem2gib" : "memory = 2147483648.B",
+          "mem4gib" : "memory = 4294967296.B",
+          "mem8gib" : "memory = 8589934592.B",
+          "mem16gib" : "memory = 17179869184.B",
+          "mem32gib" : "memory = 34359738368.B",
+          "mem64gib" : "memory = 68719476736.B",
+          "mem128gib" : "memory = 137438953472.B",
+          "mem256gib" : "memory = 274877906944.B",
+          "mem512gib" : "memory = 549755813888.B",
+          "mem1tib" : "memory = 1099511627776.B",
+          "mem2tib" : "memory = 2199023255552.B",
+          "mem4tib" : "memory = 4398046511104.B",
+          "mem8tib" : "memory = 8796093022208.B",
+          "mem16tib" : "memory = 17592186044416.B",
+          "mem32tib" : "memory = 35184372088832.B",
+          "mem64tib" : "memory = 70368744177664.B",
+          "mem128tib" : "memory = 140737488355328.B",
+          "mem256tib" : "memory = 281474976710656.B",
+          "mem512tib" : "memory = 562949953421312.B",
+          "cpu1" : "cpus = 1",
+          "cpu2" : "cpus = 2",
+          "cpu5" : "cpus = 5",
+          "cpu10" : "cpus = 10",
+          "cpu20" : "cpus = 20",
+          "cpu50" : "cpus = 50",
+          "cpu100" : "cpus = 100",
+          "cpu200" : "cpus = 200",
+          "cpu500" : "cpus = 500",
+          "cpu1000" : "cpus = 1000"
+        }
+      },
+      "debug" : false,
+      "container" : "docker"
+    }
+  ],
+  "engines" : [
+    {
+      "type" : "docker",
+      "id" : "docker",
+      "image" : "quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0",
+      "target_registry" : "images.viash-hub.com",
+      "target_tag" : "main",
+      "namespace_separator" : "/",
+      "setup" : [
+        {
+          "type" : "docker",
+          "run" : [
+            "agat --version | sed 's/AGAT\\\\s\\\\(.*\\\\)/agat: \\"\\\\1\\"/' > /var/software_versions.txt\n"
+          ]
+        }
+      ]
+    },
+    {
+      "type" : "native",
+      "id" : "native"
+    }
+  ],
+  "build_info" : {
+    "config" : "/workdir/root/repo/src/agat/agat_sp_merge_annotations/config.vsh.yaml",
+    "runner" : "nextflow",
+    "engine" : "docker|native",
+    "output" : "target/nextflow/agat/agat_sp_merge_annotations",
+    "viash_version" : "0.9.0",
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
+  },
+  "package_config" : {
+    "name" : "biobox",
+    "version" : "main",
+    "description" : "A collection of bioinformatics tools for working with sequence data.\n",
+    "viash_version" : "0.9.0",
+    "source" : "src",
+    "target" : "target",
+    "config_mods" : [
+      ".requirements.commands := ['ps']\n",
+      ".engines += { type: \\"native\\" }",
+      ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
+      ".engines[.type == 'docker'].target_tag := 'main'"
+    ],
+    "keywords" : [
+      "bioinformatics",
+      "modules",
+      "sequencing"
+    ],
+    "license" : "MIT",
+    "organization" : "vsh",
+    "links" : {
+      "repository" : "https://github.com/viash-hub/biobox",
+      "issue_tracker" : "https://github.com/viash-hub/biobox/issues"
+    }
+  }
+}'''))
+]
+
+// resolve dependencies dependencies (if any)
+
+
+// inner workflow
+// inner workflow hook
+def innerWorkflowFactory(args) {
+  def rawScript = '''set -e
+tempscript=".viash_script.sh"
+cat > "$tempscript" << VIASHMAIN
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_GFF+x} ]; then echo "${VIASH_PAR_GFF}" | sed "s#'#'\\"'\\"'#g;s#.*#par_gff='&'#" ; else echo "# par_gff="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_PAR_CONFIG+x} ]; then echo "${VIASH_PAR_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#par_config='&'#" ; else echo "# par_config="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+
+# Convert a list of file names to multiple -gff arguments
+input_files=""
+IFS=";" read -ra file_names <<< "\\$par_gff"
+for file in "\\${file_names[@]}"; do
+    input_files+="--gff \\$file "
+done
+
+# run agat_sp_merge_annotations
+agat_sp_merge_annotations.pl \\\\
+  \\$input_files \\\\
+  -o "\\$par_output" \\\\
+  \\${par_config:+--config "\\${par_config}"}
+VIASHMAIN
+bash "$tempscript"
+'''
+  
+  return vdsl3WorkflowFactory(args, meta, rawScript)
+}
+
+
+
+/**
+  * Generate a workflow for VDSL3 modules.
+  * 
+  * This function is called by the workflowFactory() function.
+  * 
+  * Input channel: [id, input_map]
+  * Output channel: [id, output_map]
+  * 
+  * Internally, this workflow will convert the input channel
+  * to a format which the Nextflow module will be able to handle.
+  */
+def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) {
+  def key = args["key"]
+  def processObj = null
+
+  workflow processWf {
+    take: input_
+    main:
+
+    if (processObj == null) {
+      processObj = _vdsl3ProcessFactory(args, meta, rawScript)
+    }
+    
+    output_ = input_
+      | map { tuple ->
+        def id = tuple[0]
+        def data_ = tuple[1]
+
+        if (workflow.stubRun) {
+          // add id if missing
+          data_ = [id: 'stub'] + data_
+        }
+
+        // process input files separately
+        def inputPaths = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "input" }
+          .collect { par ->
+            def val = data_.containsKey(par.plainName) ? data_[par.plainName] : []
+            def inputFiles = []
+            if (val == null) {
+              inputFiles = []
+            } else if (val instanceof List) {
+              inputFiles = val
+            } else if (val instanceof Path) {
+              inputFiles = [ val ]
+            } else {
+              inputFiles = []
+            }
+            if (!workflow.stubRun) {
+              // throw error when an input file doesn't exist
+              inputFiles.each{ file -> 
+                assert file.exists() :
+                  "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" +
+                  "  Required input file does not exist.\n" +
+                  "  Path: '$file'.\n" +
+                  "  Expected input file to exist"
+              }
+            }
+            inputFiles 
+          } 
+
+        // remove input files
+        def argsExclInputFiles = meta.config.allArguments
+          .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) }
+          .collectEntries { par ->
+            def parName = par.plainName
+            def val = data_[parName]
+            if (par.multiple && val instanceof Collection) {
+              val = val.join(par.multiple_sep)
+            }
+            if (par.direction == "output" && par.type == "file") {
+              val = val
+                .replaceAll('\\$id', id)
+                .replaceAll('\\$\\{id\\}', id)
+                .replaceAll('\\$key', key)
+                .replaceAll('\\$\\{key\\}', key)
+            }
+            [parName, val]
+          }
+
+        [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ]
+      }
+      | processObj
+      | map { output ->
+        def outputFiles = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "output" }
+          .indexed()
+          .collectEntries{ index, par ->
+            def out = output[index + 1]
+            // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678)
+            if (!out instanceof List || out.size() <= 1) {
+              if (par.multiple) {
+                out = []
+              } else {
+                assert !par.required :
+                    "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" +
+                    "  Required output file is missing"
+                out = null
+              }
+            } else if (out.size() == 2 && !par.multiple) {
+              out = out[1]
+            } else {
+              out = out.drop(1)
+            }
+            [ par.plainName, out ]
+          }
+        
+        // drop null outputs
+        outputFiles.removeAll{it.value == null}
+
+        [ output[0], outputFiles ]
+      }
+    emit: output_
+  }
+
+  return processWf
+}
+
+// depends on: session?
+def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) {
+  // autodetect process key
+  def wfKey = workflowArgs["key"]
+  def procKeyPrefix = "${wfKey}_process"
+  def scriptMeta = nextflow.script.ScriptMeta.current()
+  def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)}
+  def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()}
+  def newNumber = (numbers + [-1]).max() + 1
+
+  def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber"
+
+  if (newNumber > 0) {
+    log.warn "Key for module '${wfKey}' is duplicated.\n",
+      "If you run a component multiple times in the same workflow,\n" +
+      "it's recommended you set a unique key for every call,\n" +
+      "for example: ${wfKey}.run(key: \"foo\")."
+  }
+
+  // subset directives and convert to list of tuples
+  def drctv = workflowArgs.directives
+
+  // TODO: unit test the two commands below
+  // convert publish array into tags
+  def valueToStr = { val ->
+    // ignore closures
+    if (val instanceof CharSequence) {
+      if (!val.matches('^[{].*[}]$')) {
+        '"' + val + '"'
+      } else {
+        val
+      }
+    } else if (val instanceof List) {
+      "[" + val.collect{valueToStr(it)}.join(", ") + "]"
+    } else if (val instanceof Map) {
+      "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]"
+    } else {
+      val.inspect()
+    }
+  }
+
+  // multiple entries allowed: label, publishdir
+  def drctvStrs = drctv.collect { key, value ->
+    if (key in ["label", "publishDir"]) {
+      value.collect{ val ->
+        if (val instanceof Map) {
+          "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+        } else if (val == null) {
+          ""
+        } else {
+          "\n$key " + valueToStr(val)
+        }
+      }.join()
+    } else if (value instanceof Map) {
+      "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+    } else {
+      "\n$key " + valueToStr(value)
+    }
+  }.join()
+
+  def inputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "input" }
+    .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' }
+    .join()
+
+  def outputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par ->
+      // insert dummy into every output (see nextflow-io/nextflow#2678)
+      if (!par.multiple) {
+        ', path{[".exitcode", args.' + par.plainName + ']}'
+      } else {
+        ', path{[".exitcode"] + args.' + par.plainName + '}'
+      }
+    }
+    .join()
+
+  // TODO: move this functionality somewhere else?
+  if (workflowArgs.auto.transcript) {
+    outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}'
+  } else {
+    outputPaths = outputPaths + ', path{[".exitcode"]}'
+  }
+
+  // create dirs for output files (based on BashWrapper.createParentFiles)
+  def createParentStr = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" && it.create_parent }
+    .collect { par -> 
+      def contents = "args[\"${par.plainName}\"] instanceof List ? args[\"${par.plainName}\"].join('\" \"') : args[\"${par.plainName}\"]"
+      "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent '\" + escapeText(${contents}) + \"'\" : \"\" }"
+    }
+    .join("\n")
+
+  // construct inputFileExports
+  def inputFileExports = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction.toLowerCase() == "input" }
+    .collect { par ->
+      def contents = "viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName}"
+      "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}='\" + escapeText(${contents}) + \"'\"}"
+    }
+
+  // NOTE: if using docker, use /tmp instead of tmpDir!
+  def tmpDir = java.nio.file.Paths.get(
+    System.getenv('NXF_TEMP') ?: 
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('VIASH_TMPDIR') ?: 
+    System.getenv('VIASH_TEMPDIR') ?: 
+    System.getenv('VIASH_TMP') ?: 
+    System.getenv('TEMP') ?: 
+    System.getenv('TMPDIR') ?: 
+    System.getenv('TEMPDIR') ?:
+    System.getenv('TMP') ?: 
+    '/tmp'
+  ).toAbsolutePath()
+
+  // construct stub
+  def stub = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par -> 
+      "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }"
+    }
+    .join("\n")
+
+  // escape script
+  def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"')
+
+  // publishdir assert
+  def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? 
+    """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n  Example: --publish_dir './output/'" """ :
+    ""
+
+  // generate process string
+  def procStr = 
+  """nextflow.enable.dsl=2
+  |
+  |def escapeText = { s -> s.toString().replaceAll("'", "'\\\"'\\\"'") }
+  |process $procKey {$drctvStrs
+  |input:
+  |  tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources")
+  |output:
+  |  tuple val("\$id")$outputPaths, optional: true
+  |stub:
+  |\"\"\"
+  |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; }
+  |$stub
+  |\"\"\"
+  |script:$assertStr
+  |def parInject = args
+  |  .findAll{key, value -> value != null}
+  |  .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}='\${escapeText(value)}'"}
+  |  .join("\\n")
+  |\"\"\"
+  |# meta exports
+  |export VIASH_META_RESOURCES_DIR="\${resourcesDir}"
+  |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}"
+  |export VIASH_META_NAME="${meta.config.name}"
+  |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME"
+  |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+  |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" }
+  |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" }
+  |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then
+  |  export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 ))
+  |  export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  |fi
+  |
+  |# meta synonyms
+  |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR"
+  |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR"
+  |
+  |# create output dirs if need be
+  |function mkdir_parent {
+  |  for file in "\\\$@"; do 
+  |    mkdir -p "\\\$(dirname "\\\$file")"
+  |  done
+  |}
+  |$createParentStr
+  |
+  |# argument exports${inputFileExports.join()}
+  |\$parInject
+  |
+  |# process script
+  |${escapedScript}
+  |\"\"\"
+  |}
+  |""".stripMargin()
+
+  // TODO: print on debug
+  // if (workflowArgs.debug == true) {
+  //   println("######################\n$procStr\n######################")
+  // }
+
+  // write process to temp file
+  def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf")
+  addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) }
+  tempFile.text = procStr
+
+  // create process from temp file
+  def binding = new nextflow.script.ScriptBinding([:])
+  def session = nextflow.Nextflow.getSession()
+  def parser = new nextflow.script.ScriptParser(session)
+    .setModule(true)
+    .setBinding(binding)
+  def moduleScript = parser.runScript(tempFile)
+    .getScript()
+
+  // register module in meta
+  def module = new nextflow.script.IncludeDef.Module(name: procKey)
+  scriptMeta.addModule(moduleScript, module.name, module.alias)
+
+  // retrieve and return process from meta
+  return scriptMeta.getProcess(procKey)
+}
+
+// defaults
+meta["defaults"] = [
+  // key to be used to trace the process and determine output names
+  key: null,
+
+  // fixed arguments to be passed to script
+  args: [:],
+
+  // default directives
+  directives: readJsonBlob('''{
+  "container" : {
+    "registry" : "images.viash-hub.com",
+    "image" : "vsh/biobox/agat/agat_sp_merge_annotations",
+    "tag" : "main"
+  },
+  "tag" : "$id"
+}'''),
+
+  // auto settings
+  auto: readJsonBlob('''{
+  "simplifyInput" : true,
+  "simplifyOutput" : false,
+  "transcript" : false,
+  "publish" : false
+}'''),
+
+  // Apply a map over the incoming tuple
+  // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }`
+  map: null,
+
+  // Apply a map over the ID element of a tuple (i.e. the first element)
+  // Example: `{ id -> id + "_foo" }`
+  mapId: null,
+
+  // Apply a map over the data element of a tuple (i.e. the second element)
+  // Example: `{ data -> [ input: data.output ] }`
+  mapData: null,
+
+  // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements)
+  // Example: `{ pt -> pt.drop(1) }`
+  mapPassthrough: null,
+
+  // Filter the channel
+  // Example: `{ tup -> tup[0] == "foo" }`
+  filter: null,
+
+  // Choose whether or not to run the component on the tuple if the condition is true.
+  // Otherwise, the tuple will be passed through.
+  // Example: `{ tup -> tup[0] != "skip_this" }`
+  runIf: null,
+
+  // Rename keys in the data field of the tuple (i.e. the second element)
+  // Will likely be deprecated in favour of `fromState`.
+  // Example: `[ "new_key": "old_key" ]`
+  renameKeys: null,
+
+  // Fetch data from the state and pass it to the module without altering the current state.
+  // 
+  // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. 
+  // 
+  // - If it is `null`, the state will be passed to the module as is.
+  // - If it is a `List[String]`, the data will be the values of the state at the given keys.
+  // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map.
+  // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data.
+  // 
+  // Example: `{ id, state -> [input: state.fastq_file] }`
+  // Default: `null`
+  fromState: null,
+
+  // Determine how the state should be updated after the module has been run.
+  // 
+  // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function.
+  // 
+  // - If it is `null`, the state will be replaced with the output of the module.
+  // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys.
+  // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map.
+  // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state.
+  //
+  // Example: `{ id, output, state -> state + [counts: state.output] }`
+  // Default: `{ id, output, state -> output }`
+  toState: null,
+
+  // Whether or not to print debug messages
+  // Default: `false`
+  debug: false
+]
+
+// initialise default workflow
+meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta)
+
+// add workflow to environment
+nextflow.script.ScriptMeta.current().addDefinition(meta.workflow)
+
+// anonymous workflow for running this module as a standalone
+workflow {
+  // add id argument if it's not already in the config
+  // TODO: deep copy
+  def newConfig = deepClone(meta.config)
+  def newParams = deepClone(params)
+
+  def argsContainsId = newConfig.allArguments.any{it.plainName == "id"}
+  if (!argsContainsId) {
+    def idArg = [
+      'name': '--id',
+      'required': false,
+      'type': 'string',
+      'description': 'A unique id for every entry.',
+      'multiple': false
+    ]
+    newConfig.arguments.add(0, idArg)
+    newConfig = processConfig(newConfig)
+  }
+  if (!newParams.containsKey("id")) {
+    newParams.id = "run"
+  }
+
+  helpMessage(newConfig)
+
+  channelFromParams(newParams, newConfig)
+    // make sure id is not in the state if id is not in the args
+    | map {id, state ->
+      if (!argsContainsId) {
+        [id, state.findAll{k, v -> k != "id"}]
+      } else {
+        [id, state]
+      }
+    }
+    | meta.workflow.run(
+      auto: [ publish: "state" ]
+    )
+}
+
+// END COMPONENT-SPECIFIC CODE
diff --git a/target/nextflow/agat/agat_sp_merge_annotations/nextflow.config b/target/nextflow/agat/agat_sp_merge_annotations/nextflow.config
new file mode 100644
index 00000000..bc7adce8
--- /dev/null
+++ b/target/nextflow/agat/agat_sp_merge_annotations/nextflow.config
@@ -0,0 +1,126 @@
+manifest {
+  name = 'agat/agat_sp_merge_annotations'
+  mainScript = 'main.nf'
+  nextflowVersion = '!>=20.12.1-edge'
+  version = 'main'
+  description = 'Merge different gff annotation files into one. It uses the AGAT parser that takes care of\nduplicated names and fixes other oddities met in those files.\n'
+  author = 'Leïla Paquay'
+}
+
+process.container = 'nextflow/bash:latest'
+
+// detect tempdir
+tempDir = java.nio.file.Paths.get(
+  System.getenv('NXF_TEMP') ?:
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('TEMPDIR') ?: 
+    System.getenv('TMPDIR') ?: 
+    '/tmp'
+).toAbsolutePath()
+
+profiles {
+  no_publish {
+    process {
+      withName: '.*' {
+        publishDir = [
+          enabled: false
+        ]
+      }
+    }
+  }
+  mount_temp {
+    docker.temp            = tempDir
+    podman.temp            = tempDir
+    charliecloud.temp      = tempDir
+  }
+  docker {
+    docker.enabled         = true
+    // docker.userEmulation   = true
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  singularity {
+    singularity.enabled    = true
+    singularity.autoMounts = true
+    docker.enabled         = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  podman {
+    podman.enabled         = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  shifter {
+    shifter.enabled        = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    charliecloud.enabled   = false
+  }
+  charliecloud {
+    charliecloud.enabled   = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+  }
+}
+
+process{
+  withLabel: mem1gb { memory = 1000000000.B }
+  withLabel: mem2gb { memory = 2000000000.B }
+  withLabel: mem5gb { memory = 5000000000.B }
+  withLabel: mem10gb { memory = 10000000000.B }
+  withLabel: mem20gb { memory = 20000000000.B }
+  withLabel: mem50gb { memory = 50000000000.B }
+  withLabel: mem100gb { memory = 100000000000.B }
+  withLabel: mem200gb { memory = 200000000000.B }
+  withLabel: mem500gb { memory = 500000000000.B }
+  withLabel: mem1tb { memory = 1000000000000.B }
+  withLabel: mem2tb { memory = 2000000000000.B }
+  withLabel: mem5tb { memory = 5000000000000.B }
+  withLabel: mem10tb { memory = 10000000000000.B }
+  withLabel: mem20tb { memory = 20000000000000.B }
+  withLabel: mem50tb { memory = 50000000000000.B }
+  withLabel: mem100tb { memory = 100000000000000.B }
+  withLabel: mem200tb { memory = 200000000000000.B }
+  withLabel: mem500tb { memory = 500000000000000.B }
+  withLabel: mem1gib { memory = 1073741824.B }
+  withLabel: mem2gib { memory = 2147483648.B }
+  withLabel: mem4gib { memory = 4294967296.B }
+  withLabel: mem8gib { memory = 8589934592.B }
+  withLabel: mem16gib { memory = 17179869184.B }
+  withLabel: mem32gib { memory = 34359738368.B }
+  withLabel: mem64gib { memory = 68719476736.B }
+  withLabel: mem128gib { memory = 137438953472.B }
+  withLabel: mem256gib { memory = 274877906944.B }
+  withLabel: mem512gib { memory = 549755813888.B }
+  withLabel: mem1tib { memory = 1099511627776.B }
+  withLabel: mem2tib { memory = 2199023255552.B }
+  withLabel: mem4tib { memory = 4398046511104.B }
+  withLabel: mem8tib { memory = 8796093022208.B }
+  withLabel: mem16tib { memory = 17592186044416.B }
+  withLabel: mem32tib { memory = 35184372088832.B }
+  withLabel: mem64tib { memory = 70368744177664.B }
+  withLabel: mem128tib { memory = 140737488355328.B }
+  withLabel: mem256tib { memory = 281474976710656.B }
+  withLabel: mem512tib { memory = 562949953421312.B }
+  withLabel: cpu1 { cpus = 1 }
+  withLabel: cpu2 { cpus = 2 }
+  withLabel: cpu5 { cpus = 5 }
+  withLabel: cpu10 { cpus = 10 }
+  withLabel: cpu20 { cpus = 20 }
+  withLabel: cpu50 { cpus = 50 }
+  withLabel: cpu100 { cpus = 100 }
+  withLabel: cpu200 { cpus = 200 }
+  withLabel: cpu500 { cpus = 500 }
+  withLabel: cpu1000 { cpus = 1000 }
+}
+
+
diff --git a/target/nextflow/agat/agat_sp_merge_annotations/nextflow_schema.json b/target/nextflow/agat/agat_sp_merge_annotations/nextflow_schema.json
new file mode 100644
index 00000000..d864d8fa
--- /dev/null
+++ b/target/nextflow/agat/agat_sp_merge_annotations/nextflow_schema.json
@@ -0,0 +1,119 @@
+{
+"$schema": "http://json-schema.org/draft-07/schema",
+"title": "agat_sp_merge_annotations",
+"description": "Merge different gff annotation files into one. It uses the AGAT parser that takes care of\nduplicated names and fixes other oddities met in those files.\n",
+"type": "object",
+"definitions": {
+
+    
+    
+    "inputs" : {
+    "title": "Inputs",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "gff": {
+                "type":
+                "string",
+                "description": "Type: List of `file`, required, example: `input1.gff;input2.gff`, multiple_sep: `\";\"`. Input GTF/GFF file(s)",
+                "help_text": "Type: List of `file`, required, example: `input1.gff;input2.gff`, multiple_sep: `\";\"`. Input GTF/GFF file(s).\n"
+            
+            }
+    
+
+}
+},
+    
+    
+    "outputs" : {
+    "title": "Outputs",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "output": {
+                "type":
+                "string",
+                "description": "Type: `file`, required, default: `$id.$key.output.gff`, example: `output.gff`. Output gff3 file where the gene incriminated will be writen",
+                "help_text": "Type: `file`, required, default: `$id.$key.output.gff`, example: `output.gff`. Output gff3 file where the gene incriminated will be writen."
+            ,
+                "default": "$id.$key.output.gff"
+            }
+    
+
+}
+},
+    
+    
+    "arguments" : {
+    "title": "Arguments",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "config": {
+                "type":
+                "string",
+                "description": "Type: `file`, example: `custom_agat_config.yaml`. AGAT config file",
+                "help_text": "Type: `file`, example: `custom_agat_config.yaml`. AGAT config file. By default AGAT takes the original agat_config.yaml shipped with AGAT. \nThe `--config` option gives you the possibility to use your own AGAT config file (located\nelsewhere or named differently).\n"
+            
+            }
+    
+
+}
+},
+    
+    
+    "nextflow input-output arguments" : {
+    "title": "Nextflow input-output arguments",
+    "type": "object",
+    "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+    "properties": {
+    
+        
+                "publish_dir": {
+                "type":
+                "string",
+                "description": "Type: `string`, required, example: `output/`. Path to an output directory",
+                "help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
+            
+            }
+    
+
+        ,
+                "param_list": {
+                "type":
+                "string",
+                "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
+                "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
+                "hidden": true
+            
+            }
+    
+
+}
+}
+},
+"allOf": [
+
+    {
+    "$ref": "#/definitions/inputs"
+    },
+
+    {
+    "$ref": "#/definitions/outputs"
+    },
+
+    {
+    "$ref": "#/definitions/arguments"
+    },
+
+    {
+    "$ref": "#/definitions/nextflow input-output arguments"
+    }
+]
+}
diff --git a/target/nextflow/agat/agat_sp_statistics/.config.vsh.yaml b/target/nextflow/agat/agat_sp_statistics/.config.vsh.yaml
index 6906ff69..bbb23a8f 100644
--- a/target/nextflow/agat/agat_sp_statistics/.config.vsh.yaml
+++ b/target/nextflow/agat/agat_sp_statistics/.config.vsh.yaml
@@ -231,9 +231,9 @@ build_info:
   output: "target/nextflow/agat/agat_sp_statistics"
   executable: "target/nextflow/agat/agat_sp_statistics/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/agat/agat_sp_statistics/main.nf b/target/nextflow/agat/agat_sp_statistics/main.nf
index 21e1f6c1..6fb56cdf 100644
--- a/target/nextflow/agat/agat_sp_statistics/main.nf
+++ b/target/nextflow/agat/agat_sp_statistics/main.nf
@@ -3096,9 +3096,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/agat/agat_sp_statistics",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/arriba/.config.vsh.yaml b/target/nextflow/arriba/.config.vsh.yaml
index 157b9d78..2336cb67 100644
--- a/target/nextflow/arriba/.config.vsh.yaml
+++ b/target/nextflow/arriba/.config.vsh.yaml
@@ -706,9 +706,9 @@ build_info:
   output: "target/nextflow/arriba"
   executable: "target/nextflow/arriba/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/arriba/main.nf b/target/nextflow/arriba/main.nf
index 0b4b6791..8941edc0 100644
--- a/target/nextflow/arriba/main.nf
+++ b/target/nextflow/arriba/main.nf
@@ -3592,9 +3592,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/arriba",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml b/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml
index b5b1d1e7..b052ae29 100644
--- a/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml
+++ b/target/nextflow/bbmap/bbmap_bbsplit/.config.vsh.yaml
@@ -359,9 +359,9 @@ build_info:
   output: "target/nextflow/bbmap/bbmap_bbsplit"
   executable: "target/nextflow/bbmap/bbmap_bbsplit/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bbmap/bbmap_bbsplit/main.nf b/target/nextflow/bbmap/bbmap_bbsplit/main.nf
index 0f56fce6..64b97122 100644
--- a/target/nextflow/bbmap/bbmap_bbsplit/main.nf
+++ b/target/nextflow/bbmap/bbmap_bbsplit/main.nf
@@ -3207,9 +3207,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bbmap/bbmap_bbsplit",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml
index 955049a6..e26babf9 100644
--- a/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml
+++ b/target/nextflow/bcftools/bcftools_annotate/.config.vsh.yaml
@@ -469,9 +469,9 @@ build_info:
   output: "target/nextflow/bcftools/bcftools_annotate"
   executable: "target/nextflow/bcftools/bcftools_annotate/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bcftools/bcftools_annotate/main.nf b/target/nextflow/bcftools/bcftools_annotate/main.nf
index 24d5bb9f..493c6cbb 100644
--- a/target/nextflow/bcftools/bcftools_annotate/main.nf
+++ b/target/nextflow/bcftools/bcftools_annotate/main.nf
@@ -3335,9 +3335,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bcftools/bcftools_annotate",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml
index 38373267..8725a7c6 100644
--- a/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml
+++ b/target/nextflow/bcftools/bcftools_concat/.config.vsh.yaml
@@ -335,9 +335,9 @@ build_info:
   output: "target/nextflow/bcftools/bcftools_concat"
   executable: "target/nextflow/bcftools/bcftools_concat/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bcftools/bcftools_concat/main.nf b/target/nextflow/bcftools/bcftools_concat/main.nf
index 9a83e318..301be3f6 100644
--- a/target/nextflow/bcftools/bcftools_concat/main.nf
+++ b/target/nextflow/bcftools/bcftools_concat/main.nf
@@ -3207,9 +3207,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bcftools/bcftools_concat",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml
index 179ad075..92d42517 100644
--- a/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml
+++ b/target/nextflow/bcftools/bcftools_norm/.config.vsh.yaml
@@ -416,9 +416,9 @@ build_info:
   output: "target/nextflow/bcftools/bcftools_norm"
   executable: "target/nextflow/bcftools/bcftools_norm/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bcftools/bcftools_norm/main.nf b/target/nextflow/bcftools/bcftools_norm/main.nf
index cd963691..7ada3f0d 100644
--- a/target/nextflow/bcftools/bcftools_norm/main.nf
+++ b/target/nextflow/bcftools/bcftools_norm/main.nf
@@ -3300,9 +3300,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bcftools/bcftools_norm",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml
index c7bd6350..77670a0d 100644
--- a/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml
+++ b/target/nextflow/bcftools/bcftools_sort/.config.vsh.yaml
@@ -185,9 +185,9 @@ build_info:
   output: "target/nextflow/bcftools/bcftools_sort"
   executable: "target/nextflow/bcftools/bcftools_sort/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bcftools/bcftools_sort/main.nf b/target/nextflow/bcftools/bcftools_sort/main.nf
index a775fe7f..bb214da8 100644
--- a/target/nextflow/bcftools/bcftools_sort/main.nf
+++ b/target/nextflow/bcftools/bcftools_sort/main.nf
@@ -3048,9 +3048,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bcftools/bcftools_sort",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml b/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml
index 00ca9fba..3ad6adbf 100644
--- a/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml
+++ b/target/nextflow/bcftools/bcftools_stats/.config.vsh.yaml
@@ -458,9 +458,9 @@ build_info:
   output: "target/nextflow/bcftools/bcftools_stats"
   executable: "target/nextflow/bcftools/bcftools_stats/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bcftools/bcftools_stats/main.nf b/target/nextflow/bcftools/bcftools_stats/main.nf
index 0a26132e..325d573b 100644
--- a/target/nextflow/bcftools/bcftools_stats/main.nf
+++ b/target/nextflow/bcftools/bcftools_stats/main.nf
@@ -3337,9 +3337,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bcftools/bcftools_stats",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bcl_convert/.config.vsh.yaml b/target/nextflow/bcl_convert/.config.vsh.yaml
index 4c3d2f2d..aba9cf97 100644
--- a/target/nextflow/bcl_convert/.config.vsh.yaml
+++ b/target/nextflow/bcl_convert/.config.vsh.yaml
@@ -418,9 +418,9 @@ build_info:
   output: "target/nextflow/bcl_convert"
   executable: "target/nextflow/bcl_convert/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bcl_convert/main.nf b/target/nextflow/bcl_convert/main.nf
index 6ef9e358..a8dc67d6 100644
--- a/target/nextflow/bcl_convert/main.nf
+++ b/target/nextflow/bcl_convert/main.nf
@@ -3329,9 +3329,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bcl_convert",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml
index 2d466e4f..da113e86 100644
--- a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml
+++ b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml
@@ -274,9 +274,9 @@ build_info:
   output: "target/nextflow/bd_rhapsody/bd_rhapsody_make_reference"
   executable: "target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf
index c39b9a5a..fc2e45a8 100644
--- a/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf
+++ b/target/nextflow/bd_rhapsody/bd_rhapsody_make_reference/main.nf
@@ -3146,9 +3146,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bd_rhapsody/bd_rhapsody_make_reference",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml
index 3685de52..fe3a2bc2 100644
--- a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml
+++ b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml
@@ -1115,9 +1115,9 @@ build_info:
   output: "target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis"
   executable: "target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf
index 34723612..be33fd1f 100644
--- a/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf
+++ b/target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis/main.nf
@@ -4193,9 +4193,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bd_rhapsody/bd_rhapsody_sequence_analysis",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_bamtobed/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bamtobed/.config.vsh.yaml
new file mode 100644
index 00000000..3549a3f5
--- /dev/null
+++ b/target/nextflow/bedtools/bedtools_bamtobed/.config.vsh.yaml
@@ -0,0 +1,262 @@
+name: "bedtools_bamtobed"
+namespace: "bedtools"
+version: "main"
+authors:
+- name: "Theodoro Gasperin Terra Camargo"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "theodorogtc@gmail.com"
+      github: "tgaspe"
+      linkedin: "theodoro-gasperin-terra-camargo"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--input"
+    alternatives:
+    - "-i"
+    description: "Input BAM file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    description: "Output BED file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Options"
+  arguments:
+  - type: "boolean_true"
+    name: "--bedpe"
+    description: "Write BEDPE format. Requires BAM to be grouped or sorted by query.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--mate1"
+    description: "When writing BEDPE (-bedpe) format, always report mate one as the\
+      \ first BEDPE \"block\".\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--bed12"
+    description: "Write \"blocked\" BED format (aka \"BED12\"). Forces -split.\nSee\
+      \ http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--split"
+    description: "Report \"split\" BAM alignments as separate BED entries.\nSplits\
+      \ only on N CIGAR operations.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--splitD"
+    description: "Split alignments based on N and D CIGAR operators.\nForces -split.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--edit_distance"
+    alternatives:
+    - "-ed"
+    description: "Use BAM edit distance (NM tag) for BED score.\n- Default for BED\
+      \ is to use mapping quality.\n- Default for BEDPE is to use the minimum of\n\
+      \  the two mapping qualities for the pair.\n- When -ed is used with -bedpe,\
+      \ the total edit\n  distance from the two mates is reported.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--tag"
+    description: "Use other NUMERIC BAM alignment tag for BED score.\nDefault for\
+      \ BED is to use mapping quality. Disallowed with BEDPE output.\n"
+    info: null
+    example:
+    - "SM"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--color"
+    description: "An R,G,B string for the color used with BED12 format.\nDefault is\
+      \ (255,0,0).\n"
+    info: null
+    example:
+    - "250,250,250"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--cigar"
+    description: "Add the CIGAR string to the BED entry as a 7th column.\n"
+    info: null
+    direction: "input"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Converts BAM alignments to BED6 or BEDPE format."
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "Converts"
+- "BAM"
+- "BED"
+- "BED6"
+- "BEDPE"
+license: "MIT"
+references:
+  doi:
+  - "10.1093/bioinformatics/btq033"
+links:
+  repository: "https://github.com/arq5x/bedtools2"
+  homepage: "https://bedtools.readthedocs.io/en/latest/#"
+  documentation: "https://bedtools.readthedocs.io/en/latest/content/tools/bamtobed.html"
+  issue_tracker: "https://github.com/arq5x/bedtools2/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "debian:stable-slim"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "apt"
+    packages:
+    - "bedtools"
+    - "procps"
+    interactive: false
+  - type: "docker"
+    run:
+    - "echo \"bedtools: \\\"$(bedtools --version | sed -n 's/^bedtools //p')\\\"\"\
+      \ > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/bedtools/bedtools_bamtobed/config.vsh.yaml"
+  runner: "nextflow"
+  engine: "docker|native"
+  output: "target/nextflow/bedtools/bedtools_bamtobed"
+  executable: "target/nextflow/bedtools/bedtools_bamtobed/main.nf"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/nextflow/bedtools/bedtools_bamtobed/main.nf b/target/nextflow/bedtools/bedtools_bamtobed/main.nf
new file mode 100644
index 00000000..38dce111
--- /dev/null
+++ b/target/nextflow/bedtools/bedtools_bamtobed/main.nf
@@ -0,0 +1,3694 @@
+// bedtools_bamtobed main
+// 
+// This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+// work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+// Intuitive.
+// 
+// The component may contain files which fall under a different license. The
+// authors of this component should specify the license in the header of such
+// files, or include a separate license file detailing the licenses of all included
+// files.
+// 
+// Component authors:
+//  * Theodoro Gasperin Terra Camargo (author, maintainer)
+
+////////////////////////////
+// VDSL3 helper functions //
+////////////////////////////
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf'
+class UnexpectedArgumentTypeException extends Exception {
+  String errorIdentifier
+  String stage
+  String plainName
+  String expectedClass
+  String foundClass
+  
+  // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""}
+  UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) {
+    super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " +
+      "Expected type: ${expectedClass}. Found type: ${foundClass}")
+    this.errorIdentifier = errorIdentifier
+    this.stage = stage
+    this.plainName = plainName
+    this.expectedClass = expectedClass
+    this.foundClass = foundClass
+  }
+}
+
+/**
+  * Checks if the given value is of the expected type. If not, an exception is thrown.
+  *
+  * @param stage The stage of the argument (input or output)
+  * @param par The parameter definition
+  * @param value The value to check
+  * @param errorIdentifier The identifier to use in the error message
+  * @return The value, if it is of the expected type
+  * @throws UnexpectedArgumentTypeException If the value is not of the expected type
+*/
+def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) {
+  // expectedClass will only be != null if value is not of the expected type
+  def expectedClass = null
+  def foundClass = null
+  
+  // todo: split if need be
+  
+  if (!par.required && value == null) {
+    expectedClass = null
+  } else if (par.multiple) {
+    if (value !instanceof Collection) {
+      value = [value]
+    }
+    
+    // split strings
+    value = value.collectMany{ val ->
+      if (val instanceof String) {
+        // collect() to ensure that the result is a List and not simply an array
+        val.split(par.multiple_sep).collect()
+      } else {
+        [val]
+      }
+    }
+
+    // process globs
+    if (par.type == "file" && par.direction == "input") {
+      value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten()
+    }
+
+    // check types of elements in list
+    try {
+      value = value.collect { listVal ->
+        _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier)
+      }
+    } catch (UnexpectedArgumentTypeException e) {
+      expectedClass = "List[${e.expectedClass}]"
+      foundClass = "List[${e.foundClass}]"
+    }
+  } else if (par.type == "string") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else if (par.type == "integer") {
+    // cast to integer if need be
+    if (value instanceof String) {
+      try {
+        value = value.toInteger()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigInteger) {
+      value = value.intValue()
+    }
+    expectedClass = value instanceof Integer ? null : "Integer"
+  } else if (par.type == "long") {
+    // cast to long if need be
+    if (value instanceof String) {
+      try {
+        value = value.toLong()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof Integer) {
+      value = value.toLong()
+    }
+    expectedClass = value instanceof Long ? null : "Long"
+  } else if (par.type == "double") {
+    // cast to double if need be
+    if (value instanceof String) {
+      try {
+        value = value.toDouble()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigDecimal) {
+      value = value.doubleValue()
+    }
+    if (value instanceof Float) {
+      value = value.toDouble()
+    }
+    expectedClass = value instanceof Double ? null : "Double"
+  } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") {
+    // cast to boolean if need be
+    if (value instanceof String) {
+      def valueLower = value.toLowerCase()
+      if (valueLower == "true") {
+        value = true
+      } else if (valueLower == "false") {
+        value = false
+      }
+    }
+    expectedClass = value instanceof Boolean ? null : "Boolean"
+  } else if (par.type == "file" && (par.direction == "input" || stage == "output")) {
+    // cast to path if need be
+    if (value instanceof String) {
+      value = file(value, hidden: true)
+    }
+    if (value instanceof File) {
+      value = value.toPath()
+    }
+    expectedClass = value instanceof Path ? null : "Path"
+  } else if (par.type == "file" && stage == "input" && par.direction == "output") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else {
+    // didn't find a match for par.type
+    expectedClass = par.type
+  }
+
+  if (expectedClass != null) {
+    if (foundClass == null) {
+      foundClass = value.getClass().getName()
+    }
+    throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass)
+  }
+  
+  return value
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf'
+Map _processInputValues(Map inputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.required) {
+        assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing"
+      }
+    }
+
+    inputs = inputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument"
+
+      value = _checkArgumentType("input", par, value, "in module '$key' id '$id'")
+
+      [ name, value ]
+    }
+  }
+  return inputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf'
+Map _processOutputValues(Map outputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.direction == "output" && arg.required) {
+        assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing"
+      }
+    }
+
+    outputs = outputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && it.direction == "output" }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument"
+      
+      value = _checkArgumentType("output", par, value, "in module '$key' id '$id'")
+      
+      [ name, value ]
+    }
+  }
+  return outputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf'
+class IDChecker {
+  final def items = [] as Set
+
+  @groovy.transform.WithWriteLock
+  boolean observe(String item) {
+    if (items.contains(item)) {
+      return false
+    } else {
+      items << item
+      return true
+    }
+  }
+
+  @groovy.transform.WithReadLock
+  boolean contains(String item) {
+    return items.contains(item)
+  }
+
+  @groovy.transform.WithReadLock
+  Set getItems() {
+    return items.clone()
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf'
+
+/**
+ * Check if the ids are unique across parameter sets
+ *
+ * @param parameterSets a list of parameter sets.
+ */
+private void _checkUniqueIds(List<Tuple2<String, Map<String, Object>>> parameterSets) {
+  def ppIds = parameterSets.collect{it[0]}
+  assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds"
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf'
+
+// helper functions for reading params from file //
+def _getChild(parent, child) {
+  if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) {
+    child
+  } else {
+    def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString()
+    parentAbsolute.replaceAll('/[^/]*$', "/") + child
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf'
+/**
+  * Figure out the param list format based on the file extension
+  *
+  * @param param_list A String containing the path to the parameter list file.
+  *
+  * @return A String containing the format of the parameter list file.
+  */
+def _paramListGuessFormat(param_list) {
+  if (param_list !instanceof String) {
+    "asis"
+  } else if (param_list.endsWith(".csv")) {
+    "csv"
+  } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) {
+    "json"
+  } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) {
+    "yaml"
+  } else {
+    "yaml_blob"
+  }
+}
+
+
+/**
+  * Read the param list
+  * 
+  * @param param_list One of the following:
+  *   - A String containing the path to the parameter list file (csv, json or yaml),
+  *   - A yaml blob of a list of maps (yaml_blob),
+  *   - Or a groovy list of maps (asis).
+  * @param config A Map of the Viash configuration.
+  * 
+  * @return A List of Maps containing the parameters.
+  */
+def _parseParamList(param_list, Map config) {
+  // first determine format by extension
+  def paramListFormat = _paramListGuessFormat(param_list)
+
+  def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ?
+    file(param_list, hidden: true) :
+    null
+
+  // get the correct parser function for the detected params_list format
+  def paramSets = []
+  if (paramListFormat == "asis") {
+    paramSets = param_list
+  } else if (paramListFormat == "yaml_blob") {
+    paramSets = readYamlBlob(param_list)
+  } else if (paramListFormat == "yaml") {
+    paramSets = readYaml(paramListPath)
+  } else if (paramListFormat == "json") {
+    paramSets = readJson(paramListPath)
+  } else if (paramListFormat == "csv") {
+    paramSets = readCsv(paramListPath)
+  } else {
+    error "Format of provided --param_list not recognised.\n" +
+    "Found: '$paramListFormat'.\n" +
+    "Expected: a csv file, a json file, a yaml file,\n" +
+    "a yaml blob or a groovy list of maps."
+  }
+
+  // data checks
+  assert paramSets instanceof List: "--param_list should contain a list of maps"
+  for (value in paramSets) {
+    assert value instanceof Map: "--param_list should contain a list of maps"
+  }
+
+  // id is argument
+  def idIsArgument = config.allArguments.any{it.plainName == "id"}
+
+  // Reformat from List<Map> to List<Tuple2<String, Map>> by adding the ID as first element of a Tuple2
+  paramSets = paramSets.collect({ data ->
+    def id = data.id
+    if (!idIsArgument) {
+      data = data.findAll{k, v -> k != "id"}
+    }
+    [id, data]
+  })
+
+  // Split parameters with 'multiple: true'
+  paramSets = paramSets.collect({ id, data ->
+    data = _splitParams(data, config)
+    [id, data]
+  })
+  
+  // The paths of input files inside a param_list file may have been specified relatively to the
+  // location of the param_list file. These paths must be made absolute.
+  if (paramListPath) {
+    paramSets = paramSets.collect({ id, data ->
+      def new_data = data.collectEntries{ parName, parValue ->
+        def par = config.allArguments.find{it.plainName == parName}
+        if (par && par.type == "file" && par.direction == "input") {
+          if (parValue instanceof Collection) {
+            parValue = parValue.collectMany{path -> 
+              def x = _resolveSiblingIfNotAbsolute(path, paramListPath)
+              x instanceof Collection ? x : [x]
+            }
+          } else {
+            parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) 
+          }
+        }
+        [parName, parValue]
+      }
+      [id, new_data]
+    })
+  }
+
+  return paramSets
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf'
+/**
+ * Split parameters for arguments that accept multiple values using their separator
+ *
+ * @param paramList A Map containing parameters to split.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ *
+ * @return A Map of parameters where the parameter values have been split into a list using
+ *         their seperator.
+ */
+Map<String, Object> _splitParams(Map<String, Object> parValues, Map config){
+  def parsedParamValues = parValues.collectEntries { parName, parValue ->
+    def parameterSettings = config.allArguments.find({it.plainName == parName})
+
+    if (!parameterSettings) {
+      // if argument is not found, do not alter 
+      return [parName, parValue]
+    }
+    if (parameterSettings.multiple) { // Check if parameter can accept multiple values
+      if (parValue instanceof Collection) {
+        parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it }
+      } else if (parValue instanceof String) {
+        parValue = parValue.split(parameterSettings.multiple_sep)
+      } else if (parValue == null) {
+        parValue = []
+      } else {
+        parValue = [ parValue ]
+      }
+      parValue = parValue.flatten()
+    }
+    // For all parameters check if multiple values are only passed for
+    // arguments that allow it. Quietly simplify lists of length 1.
+    if (!parameterSettings.multiple && parValue instanceof Collection) {
+      assert parValue.size() == 1 : 
+      "Error: argument ${parName} has too many values.\n" +
+      "  Expected amount: 1. Found: ${parValue.size()}"
+      parValue = parValue[0]
+    }
+    [parName, parValue]
+  }
+  return parsedParamValues
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf'
+/**
+ * Parse nextflow parameters based on settings defined in a viash config.
+ * Return a list of parameter sets, each parameter set corresponding to 
+ * an event in a nextflow channel. The output from this function can be used
+ * with Channel.fromList to create a nextflow channel with Vdsl3 formatted 
+ * events.
+ *
+ * This function performs:
+ *   - A filtering of the params which can be found in the config file.
+ *   - Process the params_list argument which allows a user to to initialise 
+ *     a Vsdl3 channel with multiple parameter sets. Possible formats are 
+ *     csv, json, yaml, or simply a yaml_blob. A csv should have column names 
+ *     which correspond to the different arguments of this pipeline. A json or a yaml
+ *     file should be a list of maps, each of which has keys corresponding to the
+ *     arguments of the pipeline. A yaml blob can also be passed directly as a parameter.
+ *     When passing a csv, json or yaml, relative path names are relativized to the
+ *     location of the parameter file.
+ *   - Combine the parameter sets into a vdsl3 Channel.
+ *
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A list of parameters with the first element of the event being
+ *         the event ID and the second element containing a map of the parsed parameters.
+ */
+ 
+private List<Tuple2<String, Map<String, Object>>> _paramsToParamSets(Map params, Map config){
+  // todo: fetch key from run args
+  def key_ = config.name
+  
+  /* parse regular parameters (not in param_list)  */
+  /*************************************************/
+  def globalParams = config.allArguments
+    .findAll { params.containsKey(it.plainName) }
+    .collectEntries { [ it.plainName, params[it.plainName] ] }
+  def globalID = params.get("id", null)
+
+  /* process params_list arguments */
+  /*********************************/
+  def paramList = params.containsKey("param_list") && params.param_list != null ?
+    params.param_list : []
+  // if (paramList instanceof String) {
+  //   paramList = [paramList]
+  // }
+  // def paramSets = paramList.collectMany{ _parseParamList(it, config) }
+  // TODO: be able to process param_list when it is a list of strings
+  def paramSets = _parseParamList(paramList, config)
+  if (paramSets.isEmpty()) {
+    paramSets = [[null, [:]]]
+  }
+
+  /* combine arguments into channel */
+  /**********************************/
+  def processedParams = paramSets.indexed().collect{ index, tup ->
+    // Process ID
+    def id = tup[0] ?: globalID
+  
+    if (workflow.stubRun && !id) {
+      // if stub run, explicitly add an id if missing
+      id = "stub${index}"
+    }
+    assert id != null: "Each parameter set should have at least an 'id'"
+
+    // Process params
+    def parValues = globalParams + tup[1]
+    // // Remove parameters which are null, if the default is also null
+    // parValues = parValues.collectEntries{paramName, paramValue ->
+    //   parameterSettings = config.functionality.allArguments.find({it.plainName == paramName})
+    //   if ( paramValue != null || parameterSettings.get("default", null) != null ) {
+    //     [paramName, paramValue]
+    //   }
+    // }
+    parValues = parValues.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument"
+
+      if (par == null) {
+        return [:]
+      }
+      value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+
+      [ name, value ]
+    }
+
+    [id, parValues]
+  }
+
+  // Check if ids (first element of each list) is unique
+  _checkUniqueIds(processedParams)
+  return processedParams
+}
+
+/**
+ * Parse nextflow parameters based on settings defined in a viash config 
+ * and return a nextflow channel.
+ * 
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A nextflow Channel with events. Events are formatted as a tuple that contains 
+ *         first contains the ID of the event and as second element holds a parameter map.
+ *       
+ *
+ */
+def channelFromParams(Map params, Map config) {
+  def processedParams = _paramsToParamSets(params, config)
+  return Channel.fromList(processedParams)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf'
+def checkUniqueIds(Map args) {
+  def stopOnError = args.stopOnError == null ? args.stopOnError : true
+
+  def idChecker = new IDChecker()
+
+  return filter { tup ->
+    if (!idChecker.observe(tup[0])) {
+      if (stopOnError) {
+        error "Duplicate id: ${tup[0]}"
+      } else {
+        log.warn "Duplicate id: ${tup[0]}, removing duplicate entry"
+        return false
+      }
+    }
+    return true
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf'
+// This helper file will be deprecated soon
+preprocessInputsDeprecationWarningPrinted = false
+
+def preprocessInputsDeprecationWarning() {
+  if (!preprocessInputsDeprecationWarningPrinted) {
+    preprocessInputsDeprecationWarningPrinted = true
+    System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.")
+  }
+}
+
+/**
+ * Generate a nextflow Workflow that allows processing a channel of 
+ * Vdsl3 formatted events and apply a Viash config to them:
+ *    - Gather default parameters from the Viash config and make 
+ *      sure that they are correctly formatted (see applyConfig method).
+ *    - Format the input parameters (also using the applyConfig method).
+ *    - Apply the default parameter to the input parameters.
+ *    - Do some assertions:
+ *        ~ Check if the event IDs in the channel are unique.
+ * 
+ * The events in the channel are formatted as tuples, with the 
+ * first element of the tuples being a unique id of the parameter set, 
+ * and the second element containg the the parameters themselves.
+ * Optional extra elements of the tuples will be passed to the output as is.
+ *
+ * @param args A map that must contain a 'config' key that points
+ *              to a parsed config (see readConfig()). Optionally, a
+ *              'key' key can be provided which can be used to create a unique
+ *              name for the workflow process.
+ *
+ * @return A workflow that allows processing a channel of Vdsl3 formatted events
+ * and apply a Viash config to them.
+ */
+def preprocessInputs(Map args) {
+  preprocessInputsDeprecationWarning()
+
+  def config = args.config
+  assert config instanceof Map : 
+    "Error in preprocessInputs: config must be a map. " +
+    "Expected class: Map. Found: config.getClass() is ${config.getClass()}"
+  def key_ = args.key ?: config.name
+
+  // Get different parameter types (used throughout this function)
+  def defaultArgs = config.allArguments
+    .findAll { it.containsKey("default") }
+    .collectEntries { [ it.plainName, it.default ] }
+
+  map { tup ->
+    def id = tup[0]
+    def data = tup[1]
+    def passthrough = tup.drop(2)
+
+    def new_data = (defaultArgs + data).collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      
+      if (par != null) {
+        value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+      }
+
+      [ name, value ]
+    }
+
+    [ id, new_data ] + passthrough
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component config.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component config.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runComponents(Map args) {
+  log.warn("runComponents is deprecated, use runEach instead")
+  assert args.components: "runComponents should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runComponents"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def id_ = args.id
+
+  workflow runComponentsWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def comp_config = comp_.config
+
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_config)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          // def new_id = id_(tup[0], tup[1], comp_config)
+          def new_id = tup[0]
+          if (id_ instanceof String) {
+            new_id = id_
+          } else if (id_ instanceof Closure) {
+            new_id = id_(new_id, tup[1], comp_config)
+          }
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def data_ch = id_ch | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_config)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_config)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+      
+      post_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runComponentsWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component itself.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component itself.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runEach(Map args) {
+  assert args.components: "runEach should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runEach"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def runIf_ = args.runIf
+  def id_ = args.id
+
+  assert !runIf_ || runIf_ instanceof Closure: "runEach: must pass a Closure to runIf."
+
+  workflow runEachWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          def new_id = id_
+          if (new_id instanceof Closure) {
+            new_id = new_id(tup[0], tup[1], comp_)
+          }
+          assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}"
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def chPassthrough = null
+      def chRun = null
+      if (runIf_) {
+        def idRunIfBranch = id_ch.branch{ tup ->
+          run: runIf_(tup[0], tup[1], comp_)
+          passthrough: true
+        }
+        chPassthrough = idRunIfBranch.passthrough
+        chRun = idRunIfBranch.run
+      } else {
+        chRun = id_ch
+        chPassthrough = Channel.empty()
+      }
+      def data_ch = chRun | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+
+      def return_ch = post_ch
+        | concat(chPassthrough)
+      
+      return_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runEachWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf'
+/**
+ * Join sourceChannel to targetChannel
+ * 
+ * This function joins the sourceChannel to the targetChannel. 
+ * However, each id in the targetChannel must be present in the
+ * sourceChannel. If _meta.join_id exists in the targetChannel, that is 
+ * used as an id instead. If the id doesn't match any id in the sourceChannel,
+ * an error is thrown.
+ */
+
+def safeJoin(targetChannel, sourceChannel, key) {
+  def sourceIDs = new IDChecker()
+
+  def sourceCheck = sourceChannel
+    | map { tup ->
+      sourceIDs.observe(tup[0])
+      tup
+    }
+  def targetCheck = targetChannel
+    | map { tup ->
+      def id = tup[0]
+      
+      if (!sourceIDs.contains(id)) {
+        error (
+          "Error in module '${key}' when merging output with original state.\n" +
+          "  Reason: output with id '${id}' could not be joined with source channel.\n" +
+          "    If the IDs in the output channel differ from the input channel,\n" + 
+          "    please set `tup[1]._meta.join_id to the original ID.\n" +
+          "  Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + 
+          "  Unexpected ID in the output channel: '${id}'.\n" +
+          "  Example input event: [\"id\", [input: file(...)]],\n" +
+          "  Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]"
+        )
+      }
+      // TODO: add link to our documentation on how to fix this
+
+      tup
+    }
+  
+  sourceCheck.cross(targetChannel)
+    | map{ left, right ->
+      right + left.drop(1)
+    }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf'
+def _processArgument(arg) {
+  arg.multiple = arg.multiple != null ? arg.multiple : false
+  arg.required = arg.required != null ? arg.required : false
+  arg.direction = arg.direction != null ? arg.direction : "input"
+  arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";"
+  arg.plainName = arg.name.replaceAll("^-*", "")
+
+  if (arg.type == "file") {
+    arg.must_exist = arg.must_exist != null ? arg.must_exist : true
+    arg.create_parent = arg.create_parent != null ? arg.create_parent : true
+  }
+
+  // add default values to output files which haven't already got a default
+  if (arg.type == "file" && arg.direction == "output" && arg.default == null) {
+    def mult = arg.multiple ? "_*" : ""
+    def extSearch = ""
+    if (arg.default != null) {
+      extSearch = arg.default
+    } else if (arg.example != null) {
+      extSearch = arg.example
+    }
+    if (extSearch instanceof List) {
+      extSearch = extSearch[0]
+    }
+    def extSearchResult = extSearch.find("\\.[^\\.]+\$")
+    def ext = extSearchResult != null ? extSearchResult : ""
+    arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}"
+    if (arg.multiple) {
+      arg.default = [arg.default]
+    }
+  }
+
+  if (!arg.multiple) {
+    if (arg.default != null && arg.default instanceof List) {
+      arg.default = arg.default[0]
+    }
+    if (arg.example != null && arg.example instanceof List) {
+      arg.example = arg.example[0]
+    }
+  }
+
+  if (arg.type == "boolean_true") {
+    arg.default = false
+  }
+  if (arg.type == "boolean_false") {
+    arg.default = true
+  }
+
+  arg
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf'
+def addGlobalArguments(config) {
+  def localConfig = [
+    "argument_groups": [
+      [
+        "name": "Nextflow input-output arguments",
+        "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+        "arguments" : [
+          [
+            'name': '--publish_dir',
+            'required': true,
+            'type': 'string',
+            'description': 'Path to an output directory.',
+            'example': 'output/',
+            'multiple': false
+          ],
+          [
+            'name': '--param_list',
+            'required': false,
+            'type': 'string',
+            'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.
+            |
+            |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`.
+            |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.
+            |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`.
+            |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`.
+            |
+            |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(),
+            'example': 'my_params.yaml',
+            'multiple': false,
+            'hidden': true
+          ]
+          // TODO: allow multiple: true in param_list?
+          // TODO: allow to specify a --param_list_regex to filter the param_list?
+          // TODO: allow to specify a --param_list_from_state to remap entries in the param_list?
+        ]
+      ]
+    ]
+  ]
+
+  return processConfig(_mergeMap(config, localConfig))
+}
+
+def _mergeMap(Map lhs, Map rhs) {
+  return rhs.inject(lhs.clone()) { map, entry ->
+    if (map[entry.key] instanceof Map && entry.value instanceof Map) {
+      map[entry.key] = _mergeMap(map[entry.key], entry.value)
+    } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) {
+      map[entry.key] += entry.value
+    } else {
+      map[entry.key] = entry.value
+    }
+    return map
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf'
+def _generateArgumentHelp(param) {
+  // alternatives are not supported
+  // def names = param.alternatives ::: List(param.name)
+
+  def unnamedProps = [
+    ["required parameter", param.required],
+    ["multiple values allowed", param.multiple],
+    ["output", param.direction.toLowerCase() == "output"],
+    ["file must exist", param.type == "file" && param.must_exist]
+  ].findAll{it[1]}.collect{it[0]}
+  
+  def dflt = null
+  if (param.default != null) {
+    if (param.default instanceof List) {
+      dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      dflt = param.default.toString()
+    }
+  }
+  def example = null
+  if (param.example != null) {
+    if (param.example instanceof List) {
+      example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      example = param.example.toString()
+    }
+  }
+  def min = param.min?.toString()
+  def max = param.max?.toString()
+
+  def escapeChoice = { choice ->
+    def s1 = choice.replaceAll("\\n", "\\\\n")
+    def s2 = s1.replaceAll("\"", """\\\"""")
+    s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2
+  }
+  def choices = param.choices == null ? 
+    null : 
+    "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]"
+
+  def namedPropsStr = [
+    ["type", ([param.type] + unnamedProps).join(", ")],
+    ["default", dflt],
+    ["example", example],
+    ["choices", choices],
+    ["min", min],
+    ["max", max]
+  ]
+    .findAll{it[1]}
+    .collect{"\n        " + it[0] + ": " + it[1].replaceAll("\n", "\\n")}
+    .join("")
+  
+  def descStr = param.description == null ?
+    "" :
+    _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n        ")
+  
+  "\n    --" + param.plainName +
+    namedPropsStr +
+    descStr
+}
+
+// Based on Helper.generateHelp() in Helper.scala
+def _generateHelp(config) {
+  def fun = config
+
+  // PART 1: NAME AND VERSION
+  def nameStr = fun.name + 
+    (fun.version == null ? "" : " " + fun.version)
+
+  // PART 2: DESCRIPTION
+  def descrStr = fun.description == null ? 
+    "" :
+    "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n")
+
+  // PART 3: Usage
+  def usageStr = fun.usage == null ? 
+    "" :
+    "\n\nUsage:\n" + fun.usage.trim()
+
+  // PART 4: Options
+  def argGroupStrs = fun.allArgumentGroups.collect{argGroup ->
+    def name = argGroup.name
+    def descriptionStr = argGroup.description == null ?
+      "" :
+      "\n    " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n    ") + "\n"
+    def arguments = argGroup.arguments.collect{arg -> 
+      arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg
+    }.findAll{it != null}
+    def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)}
+    
+    "\n\n$name:" +
+      descriptionStr +
+      argumentStrs.join("\n")
+  }
+
+  // FINAL: combine
+  def out = nameStr + 
+    descrStr +
+    usageStr + 
+    argGroupStrs.join("")
+
+  return out
+}
+
+// based on Format._paragraphWrap
+def _paragraphWrap(str, maxLength) {
+  def outLines = []
+  str.split("\n").each{par ->
+    def words = par.split("\\s").toList()
+
+    def word = null
+    def line = words.pop()
+    while(!words.isEmpty()) {
+      word = words.pop()
+      if (line.length() + word.length() + 1 <= maxLength) {
+        line = line + " " + word
+      } else {
+        outLines.add(line)
+        line = word
+      }
+    }
+    if (words.isEmpty()) {
+      outLines.add(line)
+    }
+  }
+  return outLines
+}
+
+def helpMessage(config) {
+  if (params.containsKey("help") && params.help) {
+    def mergedConfig = addGlobalArguments(config)
+    def helpStr = _generateHelp(mergedConfig)
+    println(helpStr)
+    exit 0
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf'
+def processConfig(config) {
+  // set defaults for arguments
+  config.arguments = 
+    (config.arguments ?: []).collect{_processArgument(it)}
+
+  // set defaults for argument_group arguments
+  config.argument_groups =
+    (config.argument_groups ?: []).collect{grp ->
+      grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)}
+      grp
+    }
+
+  // create combined arguments list
+  config.allArguments = 
+    config.arguments +
+    config.argument_groups.collectMany{it.arguments}
+
+  // add missing argument groups (based on Functionality::allArgumentGroups())
+  def argGroups = config.argument_groups
+  if (argGroups.any{it.name.toLowerCase() == "arguments"}) {
+    argGroups = argGroups.collect{ grp ->
+      if (grp.name.toLowerCase() == "arguments") {
+        grp = grp + [
+          arguments: grp.arguments + config.arguments
+        ]
+      }
+      grp
+    }
+  } else {
+    argGroups = argGroups + [
+      name: "Arguments",
+      arguments: config.arguments
+    ]
+  }
+  config.allArgumentGroups = argGroups
+
+  config
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf'
+
+def readConfig(file) {
+  def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml"))
+  processConfig(config)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf'
+/**
+  * Resolve a path relative to the current file.
+  * 
+  * @param str The path to resolve, as a String.
+  * @param parentPath The path to resolve relative to, as a Path.
+  *
+  * @return The path that may have been resovled, as a Path.
+  */
+def _resolveSiblingIfNotAbsolute(str, parentPath) {
+  if (str !instanceof String) {
+    return str
+  }
+  if (!_stringIsAbsolutePath(str)) {
+    return parentPath.resolveSibling(str)
+  } else {
+    return file(str, hidden: true)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf'
+/**
+  * Check whether a path as a string is absolute.
+  *
+  * In the past, we tried using `file(., relative: true).isAbsolute()`,
+  * but the 'relative' option was added in 22.10.0.
+  *
+  * @param path The path to check, as a String.
+  *
+  * @return Whether the path is absolute, as a boolean.
+  */
+def _stringIsAbsolutePath(path) {
+  def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/
+
+  assert path instanceof String
+  return _resolve_URL_PROTOCOL.matcher(path).matches()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf'
+class CustomTraceObserver implements nextflow.trace.TraceObserver {
+  List traces
+
+  CustomTraceObserver(List traces) {
+    this.traces = traces
+  }
+
+  @Override
+  void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+
+  @Override
+  void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+}
+
+def collectTraces() {
+  def traces = Collections.synchronizedList([])
+
+  // add custom trace observer which stores traces in the traces object
+  session.observers.add(new CustomTraceObserver(traces))
+
+  traces
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf'
+/**
+  * Performs a deep clone of the given object.
+  * @param x an object
+  */
+def deepClone(x) {
+  iterateMap(x, {it instanceof Cloneable ? it.clone() : it})
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf'
+def getPublishDir() {
+  return params.containsKey("publish_dir") ? params.publish_dir : 
+    params.containsKey("publishDir") ? params.publishDir : 
+    null
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf'
+
+// Recurse upwards until we find a '.build.yaml' file
+def _findBuildYamlFile(pathPossiblySymlink) {
+  def path = pathPossiblySymlink.toRealPath()
+  def child = path.resolve(".build.yaml")
+  if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) {
+    return child
+  } else {
+    def parent = path.getParent()
+    if (parent == null) {
+      return null
+    } else {
+      return _findBuildYamlFile(parent)
+    }
+  }
+}
+
+// get the root of the target folder
+def getRootDir() {
+  def dir = _findBuildYamlFile(meta.resources_dir)
+  assert dir != null: "Could not find .build.yaml in the folder structure"
+  dir.getParent()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf'
+/**
+  * Recursively apply a function over the leaves of an object.
+  * @param obj The object to iterate over.
+  * @param fun The function to apply to each value.
+  * @return The object with the function applied to each value.
+  */
+def iterateMap(obj, fun) {
+  if (obj instanceof List && obj !instanceof String) {
+    return obj.collect{item ->
+      iterateMap(item, fun)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectEntries{key, item ->
+      [key.toString(), iterateMap(item, fun)]
+    }
+  } else {
+    return fun(obj)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf'
+/**
+  * A view for printing the event of each channel as a YAML blob.
+  * This is useful for debugging.
+  */
+def niceView() {
+  workflow niceViewWf {
+    take: input
+    main:
+      output = input
+        | view{toYamlBlob(it)}
+    emit: output
+  }
+  return niceViewWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf'
+
+def readCsv(file_path) {
+  def output = []
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+
+  // todo: allow escaped quotes in string
+  // todo: allow single quotes?
+  def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''')
+  def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''')
+
+  def br = java.nio.file.Files.newBufferedReader(inputFile)
+
+  def row = -1
+  def header = null
+  while (br.ready() && header == null) {
+    def line = br.readLine()
+    row++
+    if (!line.startsWith("#")) {
+      header = splitRegex.split(line, -1).collect{field ->
+        m = removeQuote.matcher(field)
+        m.find() ? m.replaceFirst('$1') : field
+      }
+    }
+  }
+  assert header != null: "CSV file should contain a header"
+
+  while (br.ready()) {
+    def line = br.readLine()
+    row++
+    if (line == null) {
+      br.close()
+      break
+    }
+
+    if (!line.startsWith("#")) {
+      def predata = splitRegex.split(line, -1)
+      def data = predata.collect{field ->
+        if (field == "") {
+          return null
+        }
+        def m = removeQuote.matcher(field)
+        if (m.find()) {
+          return m.replaceFirst('$1')
+        } else {
+          return field
+        }
+      }
+      assert header.size() == data.size(): "Row $row should contain the same number as fields as the header"
+      
+      def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null}
+      output.add(dataMap)
+    }
+  }
+
+  output
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf'
+def readJson(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parse(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf'
+def readJsonBlob(str) {
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parseText(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf'
+// Custom constructor to modify how certain objects are parsed from YAML
+class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor {
+  Path root
+
+  class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct {
+    public Object construct(org.yaml.snakeyaml.nodes.Node node) {
+      String filename = (String) constructScalar(node);
+      if (root != null) {
+        return root.resolve(filename);
+      }
+      return java.nio.file.Paths.get(filename);
+    }
+  }
+
+  CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) {
+    super(options)
+    this.root = root
+    // Handling !file tag and parse it back to a File type
+    this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath())
+  }
+}
+
+def readTaggedYaml(Path path) {
+  def options = new org.yaml.snakeyaml.LoaderOptions()
+  def constructor = new CustomConstructor(options, path.getParent())
+  def yaml = new org.yaml.snakeyaml.Yaml(constructor)
+  return yaml.load(path.text)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf'
+def readYaml(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf'
+def readYamlBlob(str) {
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf'
+String toJsonBlob(data) {
+  return groovy.json.JsonOutput.toJson(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf'
+// Custom representer to modify how certain objects are represented in YAML
+class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer {
+  Path relativizer
+
+  class RepresentPath implements org.yaml.snakeyaml.representer.Represent {
+    public String getFileName(Object obj) {
+      if (obj instanceof File) {
+        obj = ((File) obj).toPath();
+      }
+      if (obj !instanceof Path) {
+        throw new IllegalArgumentException("Object: " + obj + " is not a Path or File");
+      }
+      def path = (Path) obj;
+
+      if (relativizer != null) {
+        return relativizer.relativize(path).toString()
+      } else {
+        return path.toString()
+      }
+    }
+
+    public org.yaml.snakeyaml.nodes.Node representData(Object data) {
+      String filename = getFileName(data);
+      def tag = new org.yaml.snakeyaml.nodes.Tag("!file");
+      return representScalar(tag, filename);
+    }
+  }
+  CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) {
+    super(options)
+    this.relativizer = relativizer
+    this.representers.put(sun.nio.fs.UnixPath, new RepresentPath())
+    this.representers.put(Path, new RepresentPath())
+    this.representers.put(File, new RepresentPath())
+  }
+}
+
+String toTaggedYamlBlob(data) {
+  return toRelativeTaggedYamlBlob(data, null)
+}
+String toRelativeTaggedYamlBlob(data, Path relativizer) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  def representer = new CustomRepresenter(options, relativizer)
+  def yaml = new org.yaml.snakeyaml.Yaml(representer, options)
+  return yaml.dump(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf'
+String toYamlBlob(data) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  options.setPrettyFlow(true)
+  def yaml = new org.yaml.snakeyaml.Yaml(options)
+  def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it })
+  return yaml.dump(cleanData)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf'
+void writeJson(data, file) {
+  assert data: "writeJson: data should not be null"
+  assert file: "writeJson: file should not be null"
+  file.write(toJsonBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf'
+void writeYaml(data, file) {
+  assert data: "writeYaml: data should not be null"
+  assert file: "writeYaml: file should not be null"
+  file.write(toYamlBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf'
+def findStates(Map params, Map config) {
+  def auto_config = deepClone(config)
+  def auto_params = deepClone(params)
+
+  auto_config = auto_config.clone()
+  // override arguments
+  auto_config.argument_groups = []
+  auto_config.arguments = [
+    [
+      type: "string",
+      name: "--id",
+      description: "A dummy identifier",
+      required: false
+    ],
+    [
+      type: "file",
+      name: "--input_states",
+      example: "/path/to/input/directory/**/state.yaml",
+      description: "Path to input directory containing the datasets to be integrated.",
+      required: true,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--filter",
+      example: "foo/.*/state.yaml",
+      description: "Regex to filter state files by path.",
+      required: false
+    ],
+    // to do: make this a yaml blob?
+    [
+      type: "string",
+      name: "--rename_keys",
+      example: ["newKey1:oldKey1", "newKey2:oldKey2"],
+      description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.",
+      required: false,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--settings",
+      example: '{"output_dataset": "dataset.h5ad", "k": 10}',
+      description: "Global arguments as a JSON glob to be passed to all components.",
+      required: false
+    ]
+  ]
+  if (!(auto_params.containsKey("id"))) {
+    auto_params["id"] = "auto"
+  }
+
+  // run auto config through processConfig once more
+  auto_config = processConfig(auto_config)
+
+  workflow findStatesWf {
+    helpMessage(auto_config)
+
+    output_ch = 
+      channelFromParams(auto_params, auto_config)
+        | flatMap { autoId, args ->
+
+          def globalSettings = args.settings ? readYamlBlob(args.settings) : [:]
+
+          // look for state files in input dir
+          def stateFiles = args.input_states
+
+          // filter state files by regex
+          if (args.filter) {
+            stateFiles = stateFiles.findAll{ stateFile ->
+              def stateFileStr = stateFile.toString()
+              def matcher = stateFileStr =~ args.filter
+              matcher.matches()}
+          }
+
+          // read in states
+          def states = stateFiles.collect { stateFile ->
+            def state_ = readTaggedYaml(stateFile)
+            [state_.id, state_]
+          }
+
+          // construct renameMap
+          if (args.rename_keys) {
+            def renameMap = args.rename_keys.collectEntries{renameString ->
+              def split = renameString.split(":")
+              assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey', or 'newKey:oldKey;newKey:oldKey' in case of multiple values"
+              split
+            }
+
+            // rename keys in state, only let states through which have all keys
+            // also add global settings
+            states = states.collectMany{id, state ->
+              def newState = [:]
+
+              for (key in renameMap.keySet()) {
+                def origKey = renameMap[key]
+                if (!(state.containsKey(origKey))) {
+                  return []
+                }
+                newState[key] = state[origKey]
+              }
+
+              [[id, globalSettings + newState]]
+            }
+          }
+
+          states
+        }
+    emit:
+    output_ch
+  }
+
+  return findStatesWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf'
+def joinStates(Closure apply_) {
+  workflow joinStatesWf {
+    take: input_ch
+    main:
+    output_ch = input_ch
+      | toSortedList
+      | filter{ it.size() > 0 }
+      | map{ tups ->
+        def ids = tups.collect{it[0]}
+        def states = tups.collect{it[1]}
+        apply_(ids, states)
+      }
+
+    emit: output_ch
+  }
+  return joinStatesWf
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf'
+def collectFiles(obj) {
+  if (obj instanceof java.io.File || obj instanceof Path)  {
+    return [obj]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.collectMany{item ->
+      collectFiles(item)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectFiles(item)
+    }
+  } else {
+    return []
+  }
+}
+
+/**
+ * Recurse through a state and collect all input files and their target output filenames.
+ * @param obj The state to recurse through.
+ * @param prefix The prefix to prepend to the output filenames.
+ */
+def collectInputOutputPaths(obj, prefix) {
+  if (obj instanceof File || obj instanceof Path)  {
+    def path = obj instanceof Path ? obj : obj.toPath()
+    def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: ""
+    def newFilename = prefix + ext
+    return [[obj, newFilename]]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.withIndex().collectMany{item, ix ->
+      collectInputOutputPaths(item, prefix + "_" + ix)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectInputOutputPaths(item, prefix + "." + key)
+    }
+  } else {
+    return []
+  }
+}
+
+def publishStates(Map args) {
+  def key_ = args.get("key")
+  def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml'))
+
+  assert key_ != null : "publishStates: key must be specified"
+  
+  workflow publishStatesWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1]
+
+          // the input files and the target output filenames
+          def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose()
+          def inputFiles_ = inputoutputFilenames_[0]
+          def outputFilenames_ = inputoutputFilenames_[1]
+
+          def yamlFilename = yamlTemplate_
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+
+            // TODO: do the pathnames in state_ match up with the outputFilenames_?
+
+          // convert state to yaml blob
+          def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename))
+
+          [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesWf
+}
+process publishStatesProc {
+  // todo: check publishpath?
+  publishDir path: "${getPublishDir()}/", mode: "copy"
+  tag "$id"
+  input:
+    tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles)
+  output:
+    tuple val(id), path{[yamlFile] + outputFiles}
+  script:
+  def copyCommands = [
+    inputFiles instanceof List ? inputFiles : [inputFiles],
+    outputFiles instanceof List ? outputFiles : [outputFiles]
+  ]
+    .transpose()
+    .collectMany{infile, outfile ->
+      if (infile.toString() != outfile.toString()) {
+        [
+          "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"",
+          "cp -r '${infile.toString()}' '${outfile.toString()}'"
+        ]
+      } else {
+        // no need to copy if infile is the same as outfile
+        []
+      }
+    }
+  """
+mkdir -p "\$(dirname '${yamlFile}')"
+echo "Storing state as yaml"
+echo '${yamlBlob}' > '${yamlFile}'
+echo "Copying output files to destination folder"
+${copyCommands.join("\n  ")}
+"""
+}
+
+
+// this assumes that the state contains no other values other than those specified in the config
+def publishStatesByConfig(Map args) {
+  def config = args.get("config")
+  assert config != null : "publishStatesByConfig: config must be specified"
+
+  def key_ = args.get("key", config.name)
+  assert key_ != null : "publishStatesByConfig: key must be specified"
+  
+  workflow publishStatesSimpleWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10]
+          def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad']
+
+          // TODO: allow overriding the state.yaml template
+          // TODO TODO: if auto.publish == "state", add output_state as an argument
+          def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml'
+          def yamlFilename = yamlTemplate
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+          def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent()
+
+          // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where
+          //   - key is a String
+          //   - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path)
+          //   - inputPath is a List[Path]
+          //   - outputFilename is a List[String]
+          //   - (key, value) are the tuples that will be saved to the state.yaml file
+          //   - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml)
+          def processedState =
+            config.allArguments
+              .findAll { it.direction == "output" }
+              .collectMany { par ->
+                def plainName_ = par.plainName
+                // if the state does not contain the key, it's an
+                // optional argument for which the component did 
+                // not generate any output
+                if (!state_.containsKey(plainName_)) {
+                  return []
+                }
+                def value = state_[plainName_]
+                // if the parameter is not a file, it should be stored
+                // in the state as-is, but is not something that needs 
+                // to be copied from the source path to the dest path
+                if (par.type != "file") {
+                  return [[key: plainName_, value: value, inputPath: [], outputFilename: []]]
+                }
+                // if the orig state does not contain this filename,
+                // it's an optional argument for which the user specified
+                // that it should not be returned as a state
+                if (!origState_.containsKey(plainName_)) {
+                  return []
+                }
+                def filenameTemplate = origState_[plainName_]
+                // if the pararameter is multiple: true, fetch the template
+                if (par.multiple && filenameTemplate instanceof List) {
+                  filenameTemplate = filenameTemplate[0]
+                }
+                // instantiate the template
+                def filename = filenameTemplate
+                  .replaceAll('\\$id', id_)
+                  .replaceAll('\\$\\{id\\}', id_)
+                  .replaceAll('\\$key', key_)
+                  .replaceAll('\\$\\{key\\}', key_)
+                if (par.multiple) {
+                  // if the parameter is multiple: true, the filename
+                  // should contain a wildcard '*' that is replaced with
+                  // the index of the file
+                  assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}"
+                  def outputPerFile = value.withIndex().collect{ val, ix ->
+                    def filename_ix = filename.replace("*", ix.toString())
+                    def value_ = java.nio.file.Paths.get(filename_ix)
+                    // if id contains a slash
+                    if (yamlDir != null) {
+                      value_ = yamlDir.relativize(value_)
+                    }
+                    def inputPath = val instanceof File ? val.toPath() : val
+                    [value: value_, inputPath: inputPath, outputFilename: filename_ix]
+                  }
+                  def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> 
+                    [key, outputPerFile.collect{dic -> dic[key]}]
+                  }
+                  return [[key: plainName_] + transposedOutputs]
+                } else {
+                  def value_ = java.nio.file.Paths.get(filename)
+                  // if id contains a slash
+                  if (yamlDir != null) {
+                    value_ = yamlDir.relativize(value_)
+                  }
+                  def inputPath = value instanceof File ? value.toPath() : value
+                  return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]]
+                }
+              }
+          
+          def updatedState_ = processedState.collectEntries{[it.key, it.value]}
+          def inputPaths = processedState.collectMany{it.inputPath}
+          def outputFilenames = processedState.collectMany{it.outputFilename}
+          
+          // convert state to yaml blob
+          def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_)
+
+          [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesSimpleWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf'
+def setState(fun) {
+  assert fun instanceof Closure || fun instanceof Map || fun instanceof List :
+    "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}"
+
+  // if fun is a List, convert to map
+  if (fun instanceof List) {
+    // check whether fun is a list[string]
+    assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings"
+    fun = fun.collectEntries{[it, it]}
+  }
+
+  // if fun is a map, convert to closure
+  if (fun instanceof Map) {
+    // check whether fun is a map[string, string]
+    assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings"
+    assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings"
+    def funMap = fun.clone()
+    // turn the map into a closure to be used later on
+    fun = { id_, state_ ->
+      assert state_ instanceof Map : "Error in setState: the state is not a Map"
+      funMap.collectMany{newkey, origkey ->
+        if (state_.containsKey(origkey)) {
+          [[newkey, state_[origkey]]]
+        } else {
+          []
+        }
+      }.collectEntries()
+    }
+  }
+
+  map { tup ->
+    def id = tup[0]
+    def state = tup[1]
+    def unfilteredState = fun(id, state)
+    def newState = unfilteredState.findAll{key, val -> val != null}
+    [id, newState] + tup.drop(2)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf'
+// TODO: unit test processAuto
+def processAuto(Map auto) {
+  // remove null values
+  auto = auto.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"]
+  def unexpectedKeys = auto.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'"
+
+  // check auto.simplifyInput
+  assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean"
+
+  // check auto.simplifyOutput
+  assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean"
+
+  // check auto.transcript
+  assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean"
+
+  // check auto.publish
+  assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'"
+
+  return auto.subMap(expectedKeys)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf'
+def assertMapKeys(map, expectedKeys, requiredKeys, mapName) {
+  assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}"
+  map.forEach { key, val -> 
+    assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+  requiredKeys.forEach { requiredKey -> 
+    assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+}
+
+// TODO: unit test processDirectives
+def processDirectives(Map drctv) {
+  // remove null values
+  drctv = drctv.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = [
+    "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time"
+  ]
+  def unexpectedKeys = drctv.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'"
+
+  /* DIRECTIVE accelerator
+    accepted examples:
+    - [ limit: 4, type: "nvidia-tesla-k80" ]
+  */
+  if (drctv.containsKey("accelerator")) {
+    assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator")
+  }
+
+  /* DIRECTIVE afterScript
+    accepted examples:
+    - "source /cluster/bin/cleanup"
+  */
+  if (drctv.containsKey("afterScript")) {
+    assert drctv["afterScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE beforeScript
+    accepted examples:
+    - "source /cluster/bin/setup"
+  */
+  if (drctv.containsKey("beforeScript")) {
+    assert drctv["beforeScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cache
+    accepted examples:
+    - true
+    - false
+    - "deep"
+    - "lenient"
+  */
+  if (drctv.containsKey("cache")) {
+    assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean
+    if (drctv["cache"] instanceof CharSequence) {
+      assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache"
+    }
+  }
+
+  /* DIRECTIVE conda
+    accepted examples:
+    - "bwa=0.7.15"
+    - "bwa=0.7.15 fastqc=0.11.5"
+    - ["bwa=0.7.15", "fastqc=0.11.5"]
+  */
+  if (drctv.containsKey("conda")) {
+    if (drctv["conda"] instanceof List) {
+      drctv["conda"] = drctv["conda"].join(" ")
+    }
+    assert drctv["conda"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE container
+    accepted examples:
+    - "foo/bar:tag"
+    - [ registry: "reg", image: "im", tag: "ta" ]
+      is transformed to "reg/im:ta"
+    - [ image: "im" ] 
+      is transformed to "im:latest"
+  */
+  if (drctv.containsKey("container")) {
+    assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence
+    if (drctv["container"] instanceof Map) {
+      def m = drctv["container"]
+      assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container")
+      def part1 = 
+        System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : 
+        params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove?
+        m.registry ? m.registry + "/" : 
+        ""
+      def part2 = m.image
+      def part3 = m.tag ? ":" + m.tag : ":latest"
+      drctv["container"] = part1 + part2 + part3
+    }
+  }
+
+  /* DIRECTIVE containerOptions
+    accepted examples:
+    - "--foo bar"
+    - ["--foo bar", "-f b"]
+  */
+  if (drctv.containsKey("containerOptions")) {
+    if (drctv["containerOptions"] instanceof List) {
+      drctv["containerOptions"] = drctv["containerOptions"].join(" ")
+    }
+    assert drctv["containerOptions"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cpus
+    accepted examples:
+    - 1
+    - 10
+  */
+  if (drctv.containsKey("cpus")) {
+    assert drctv["cpus"] instanceof Integer
+  }
+
+  /* DIRECTIVE disk
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("disk")) {
+    assert drctv["disk"] instanceof CharSequence
+    // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE echo
+    accepted examples:
+    - true
+    - false
+  */
+  if (drctv.containsKey("echo")) {
+    assert drctv["echo"] instanceof Boolean
+  }
+
+  /* DIRECTIVE errorStrategy
+    accepted examples:
+    - "terminate"
+    - "finish"
+  */
+  if (drctv.containsKey("errorStrategy")) {
+    assert drctv["errorStrategy"] instanceof CharSequence
+    assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy"
+  }
+
+  /* DIRECTIVE executor
+    accepted examples:
+    - "local"
+    - "sge"
+  */
+  if (drctv.containsKey("executor")) {
+    assert drctv["executor"] instanceof CharSequence
+    assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor"
+  }
+
+  /* DIRECTIVE machineType
+    accepted examples:
+    - "n1-highmem-8"
+  */
+  if (drctv.containsKey("machineType")) {
+    assert drctv["machineType"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE maxErrors
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxErrors")) {
+    assert drctv["maxErrors"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxForks
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxForks")) {
+    assert drctv["maxForks"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxRetries
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxRetries")) {
+    assert drctv["maxRetries"] instanceof Integer
+  }
+
+  /* DIRECTIVE memory
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("memory")) {
+    assert drctv["memory"] instanceof CharSequence
+    // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE module
+    accepted examples:
+    - "ncbi-blast/2.2.27"
+    - "ncbi-blast/2.2.27:t_coffee/10.0"
+    - ["ncbi-blast/2.2.27", "t_coffee/10.0"]
+  */
+  if (drctv.containsKey("module")) {
+    if (drctv["module"] instanceof List) {
+      drctv["module"] = drctv["module"].join(":")
+    }
+    assert drctv["module"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE penv
+    accepted examples:
+    - "smp"
+  */
+  if (drctv.containsKey("penv")) {
+    assert drctv["penv"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE pod
+    accepted examples:
+    - [ label: "key", value: "val" ]
+    - [ annotation: "key", value: "val" ]
+    - [ env: "key", value: "val" ]
+    - [ [label: "l", value: "v"], [env: "e", value: "v"]]
+  */
+  if (drctv.containsKey("pod")) {
+    if (drctv["pod"] instanceof Map) {
+      drctv["pod"] = [ drctv["pod"] ]
+    }
+    assert drctv["pod"] instanceof List
+    drctv["pod"].forEach { pod ->
+      assert pod instanceof Map
+      // TODO: should more checks be added?
+      // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod
+      // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...?
+    }
+  }
+
+  /* DIRECTIVE publishDir
+    accepted examples:
+    - []
+    - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ]
+    - "/path/to/dir" 
+      is transformed to [[ path: "/path/to/dir" ]]
+    - [ path: "/path/to/dir", mode: "cache" ]
+      is transformed to [[ path: "/path/to/dir", mode: "cache" ]]
+  */
+  // TODO: should we also look at params["publishDir"]?
+  if (drctv.containsKey("publishDir")) {
+    def pblsh = drctv["publishDir"]
+    
+    // check different options
+    assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence
+    
+    // turn into list if not already so
+    // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work.
+    pblsh = pblsh instanceof List ? pblsh : [ pblsh ]
+
+    // check elements of publishDir
+    pblsh = pblsh.collect{ elem ->
+      // turn into map if not already so
+      elem = elem instanceof CharSequence ? [ path: elem ] : elem
+
+      // check types and keys
+      assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}"
+      assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir")
+
+      // check elements in map
+      assert elem.containsKey("path")
+      assert elem["path"] instanceof CharSequence
+      if (elem.containsKey("mode")) {
+        assert elem["mode"] instanceof CharSequence
+        assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ]
+      }
+      if (elem.containsKey("overwrite")) {
+        assert elem["overwrite"] instanceof Boolean
+      }
+      if (elem.containsKey("pattern")) {
+        assert elem["pattern"] instanceof CharSequence
+      }
+      if (elem.containsKey("saveAs")) {
+        assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'"
+      }
+      if (elem.containsKey("enabled")) {
+        assert elem["enabled"] instanceof Boolean
+      }
+
+      // return final result
+      elem
+    }
+    // store final directive
+    drctv["publishDir"] = pblsh
+  }
+
+  /* DIRECTIVE queue
+    accepted examples:
+    - "long"
+    - "short,long"
+    - ["short", "long"]
+  */
+  if (drctv.containsKey("queue")) {
+    if (drctv["queue"] instanceof List) {
+      drctv["queue"] = drctv["queue"].join(",")
+    }
+    assert drctv["queue"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE label
+    accepted examples:
+    - "big_mem"
+    - "big_cpu"
+    - ["big_mem", "big_cpu"]
+  */
+  if (drctv.containsKey("label")) {
+    if (drctv["label"] instanceof CharSequence) {
+      drctv["label"] = [ drctv["label"] ]
+    }
+    assert drctv["label"] instanceof List
+    drctv["label"].forEach { label ->
+      assert label instanceof CharSequence
+      // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?")
+      // ^ does not allow closures
+    }
+  }
+
+  /* DIRECTIVE scratch
+    accepted examples:
+    - true
+    - "/path/to/scratch"
+    - '$MY_PATH_TO_SCRATCH'
+    - "ram-disk"
+  */
+  if (drctv.containsKey("scratch")) {
+    assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE storeDir
+    accepted examples:
+    - "/path/to/storeDir"
+  */
+  if (drctv.containsKey("storeDir")) {
+    assert drctv["storeDir"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE stageInMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageInMode")) {
+    assert drctv["stageInMode"] instanceof CharSequence
+    assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"]
+  }
+
+  /* DIRECTIVE stageOutMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageOutMode")) {
+    assert drctv["stageOutMode"] instanceof CharSequence
+    assert drctv["stageOutMode"] in ["copy", "move", "rsync"]
+  }
+
+  /* DIRECTIVE tag
+    accepted examples:
+    - "foo"
+    - '$id'
+  */
+  if (drctv.containsKey("tag")) {
+    assert drctv["tag"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE time
+    accepted examples:
+    - "1h"
+    - "2days"
+    - "1day 6hours 3minutes 30seconds"
+  */
+  if (drctv.containsKey("time")) {
+    assert drctv["time"] instanceof CharSequence
+    // todo: validation regex?
+  }
+
+  return drctv
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf'
+def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) {
+  // override defaults with args
+  def workflowArgs = defaultWfArgs + args
+
+  // check whether 'key' exists
+  assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument"
+
+  // if 'key' is a closure, apply it to the original key
+  if (workflowArgs["key"] instanceof Closure) {
+    workflowArgs["key"] = workflowArgs["key"](meta.config.name)
+  }
+  def key = workflowArgs["key"]
+  assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}"
+  assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}"
+
+  // check for any unexpected keys
+  def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"]
+  def unexpectedKeys = workflowArgs.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'"
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument"
+  assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}"
+  workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"])
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument"
+  assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}"
+  workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"])
+
+  // auto define publish, if so desired
+  if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.publish_dir = \"./output/\""
+    def publishDir = getPublishDir()
+    
+    if (publishDir != null) {
+      workflowArgs.directives.publishDir = [[ 
+        path: publishDir, 
+        saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default
+        mode: "copy"
+      ]]
+    }
+  }
+
+  // auto define transcript, if so desired
+  if (workflowArgs.auto.transcript == true) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.transcripts_dir = \"./transcripts/\""
+    def transcriptsDir = 
+      params.containsKey("transcripts_dir") ? params.transcripts_dir : 
+      params.containsKey("transcriptsDir") ? params.transcriptsDir : 
+      params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" :
+      params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : 
+      null
+    if (transcriptsDir != null) {
+      def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss')
+      def transcriptsPublishDir = [ 
+        path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/",
+        saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", 
+        mode: "copy"
+      ]
+      def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : []
+      workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir
+    }
+  }
+
+  // if this is a stubrun, remove certain directives?
+  if (workflow.stubRun) {
+    workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"])
+  }
+
+  for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam]) {
+      assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}"
+    }
+  }
+
+  // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well?
+  for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) {
+      log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead."
+    }
+  }
+
+  // check fromState
+  workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config)
+
+  // check toState
+  workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config)
+
+  // return output
+  return workflowArgs
+}
+
+def _processFromState(fromState, key_, config_) {
+  assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List :
+    "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}"
+  if (fromState == null) {
+    return null
+  }
+  
+  // if fromState is a List, convert to map
+  if (fromState instanceof List) {
+    // check whether fromstate is a list[string]
+    assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings"
+    fromState = fromState.collectEntries{[it, it]}
+  }
+
+  // if fromState is a map, convert to closure
+  if (fromState instanceof Map) {
+    // check whether fromstate is a map[string, string]
+    assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings"
+    assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings"
+    def fromStateMap = fromState.clone()
+    def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    fromState = { it ->
+      def state = it[1]
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def data = fromStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (state.containsKey(origkey)) {
+          [[newkey, state[origkey]]]
+        } else if (!requiredInputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state")
+        }
+      }.collectEntries()
+      data
+    }
+  }
+  
+  return fromState
+}
+
+def _processToState(toState, key_, config_) {
+  if (toState == null) {
+    toState = { tup -> tup[1] }
+  }
+
+  // toState should be a closure, map[string, string], or list[string]
+  assert toState instanceof Closure || toState instanceof Map || toState instanceof List :
+    "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}"
+
+  // if toState is a List, convert to map
+  if (toState instanceof List) {
+    // check whether toState is a list[string]
+    assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings"
+    toState = toState.collectEntries{[it, it]}
+  }
+
+  // if toState is a map, convert to closure
+  if (toState instanceof Map) {
+    // check whether toState is a map[string, string]
+    assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings"
+    assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings"
+    def toStateMap = toState.clone()
+    def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    toState = { it ->
+      def output = it[1]
+      def state = it[2]
+      assert output instanceof Map : "Error in module '$key_': the output is not a Map"
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def extraEntries = toStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (output.containsKey(origkey)) {
+          [[newkey, output[origkey]]]
+        } else if (!requiredOutputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output")
+        }
+      }.collectEntries()
+      state + extraEntries
+    }
+  }
+
+  return toState
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf'
+def _debug(workflowArgs, debugKey) {
+  if (workflowArgs.debug) {
+    view { "process '${workflowArgs.key}' $debugKey tuple: $it"  }
+  } else {
+    map { it }
+  }
+}
+
+// depends on: innerWorkflowFactory
+def workflowFactory(Map args, Map defaultWfArgs, Map meta) {
+  def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta)
+  def key_ = workflowArgs["key"]
+  
+  workflow workflowInstance {
+    take: input_
+
+    main:
+    def chModified = input_
+      | checkUniqueIds([:])
+      | _debug(workflowArgs, "input")
+      | map { tuple ->
+        tuple = deepClone(tuple)
+        
+        if (workflowArgs.map) {
+          tuple = workflowArgs.map(tuple)
+        }
+        if (workflowArgs.mapId) {
+          tuple[0] = workflowArgs.mapId(tuple[0])
+        }
+        if (workflowArgs.mapData) {
+          tuple[1] = workflowArgs.mapData(tuple[1])
+        }
+        if (workflowArgs.mapPassthrough) {
+          tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2))
+        }
+
+        // check tuple
+        assert tuple instanceof List : 
+          "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}"
+        assert tuple.size() >= 2 : 
+          "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: tuple.size() == ${tuple.size()}"
+        
+        // check id field
+        if (tuple[0] instanceof GString) {
+          tuple[0] = tuple[0].toString()
+        }
+        assert tuple[0] instanceof CharSequence : 
+          "Error in module '${key_}': first element of tuple in channel should be a String\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: ${tuple[0]}"
+        
+        // match file to input file
+        if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) {
+          def inputFiles = meta.config.allArguments
+            .findAll { it.type == "file" && it.direction == "input" }
+          
+          assert inputFiles.size() == 1 : 
+              "Error in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Anonymous file inputs are only allowed when the process has exactly one file input.\n" +
+              "  Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}"
+
+          tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries()
+        }
+
+        // check data field
+        assert tuple[1] instanceof Map : 
+          "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+        // rename keys of data field in tuple
+        if (workflowArgs.renameKeys) {
+          assert workflowArgs.renameKeys instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}"
+          assert tuple[1] instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+          // TODO: allow renameKeys to be a function?
+          workflowArgs.renameKeys.each { newKey, oldKey ->
+            assert newKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}"
+            assert oldKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}"
+            assert tuple[1].containsKey(oldKey) : 
+              "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" +
+              "  Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'"
+            tuple[1].put(newKey, tuple[1][oldKey])
+          }
+          tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey })
+        }
+        tuple
+      }
+
+
+    def chRun = null
+    def chPassthrough = null
+    if (workflowArgs.runIf) {
+      def runIfBranch = chModified.branch{ tup ->
+        run: workflowArgs.runIf(tup[0], tup[1])
+        passthrough: true
+      }
+      chRun = runIfBranch.run
+      chPassthrough = runIfBranch.passthrough
+    } else {
+      chRun = chModified
+      chPassthrough = Channel.empty()
+    }
+
+    def chRunFiltered = workflowArgs.filter ?
+      chRun | filter{workflowArgs.filter(it)} :
+      chRun
+
+    def chArgs = workflowArgs.fromState ? 
+      chRunFiltered | map{
+        def new_data = workflowArgs.fromState(it.take(2))
+        [it[0], new_data]
+      } :
+      chRunFiltered | map {tup -> tup.take(2)}
+
+    // fill in defaults
+    def chArgsWithDefaults = chArgs
+      | map { tuple ->
+        def id_ = tuple[0]
+        def data_ = tuple[1]
+
+        // TODO: could move fromState to here
+
+        // fetch default params from functionality
+        def defaultArgs = meta.config.allArguments
+          .findAll { it.containsKey("default") }
+          .collectEntries { [ it.plainName, it.default ] }
+
+        // fetch overrides in params
+        def paramArgs = meta.config.allArguments
+          .findAll { par ->
+            def argKey = key_ + "__" + par.plainName
+            params.containsKey(argKey)
+          }
+          .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] }
+        
+        // fetch overrides in data
+        def dataArgs = meta.config.allArguments
+          .findAll { data_.containsKey(it.plainName) }
+          .collectEntries { [ it.plainName, data_[it.plainName] ] }
+        
+        // combine params
+        def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs
+
+        // remove arguments with explicit null values
+        combinedArgs
+          .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"}
+
+        combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_)
+
+        [id_, combinedArgs] + tuple.drop(2)
+      }
+
+    // TODO: move some of the _meta.join_id wrangling to the safeJoin() function.
+    def chInitialOutput = chArgsWithDefaults
+      | _debug(workflowArgs, "processed")
+      // run workflow
+      | innerWorkflowFactory(workflowArgs)
+      // check output tuple
+      | map { id_, output_ ->
+
+        // see if output map contains metadata
+        def meta_ =
+          output_ instanceof Map && output_.containsKey("_meta") ? 
+          output_["_meta"] :
+          [:]
+        def join_id = meta_.join_id ?: id_
+        
+        // remove metadata
+        output_ = output_.findAll{k, v -> k != "_meta"}
+
+        // check value types
+        output_ = _processOutputValues(output_, meta.config, id_, key_)
+
+        // simplify output if need be
+        if (workflowArgs.auto.simplifyOutput && output_.size() == 1) {
+          output_ = output_.values()[0]
+        }
+
+        [join_id, id_, output_]
+      }
+      // | view{"chInitialOutput: ${it.take(3)}"}
+
+    // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...]
+    def chNewState = safeJoin(chInitialOutput, chRunFiltered, key_)
+      // input tuple format: [join_id, id, output, prev_state, ...]
+      // output tuple format: [join_id, id, new_state, ...]
+      | map{ tup ->
+        def new_state = workflowArgs.toState(tup.drop(1).take(3))
+        tup.take(2) + [new_state] + tup.drop(4)
+      }
+
+    if (workflowArgs.auto.publish == "state") {
+      def chPublish = chNewState
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [join_id, id, new_state]
+        | map{ tup ->
+          tup.take(3)
+        }
+
+      safeJoin(chPublish, chArgsWithDefaults, key_)
+        // input tuple format: [join_id, id, new_state, orig_state, ...]
+        // output tuple format: [id, new_state, orig_state]
+        | map { tup ->
+          tup.drop(1).take(3)
+      }
+        | publishStatesByConfig(key: key_, config: meta.config)
+    }
+
+    // remove join_id and meta
+    chReturn = chNewState
+      | map { tup ->
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [id, new_state, ...]
+        tup.drop(1)
+      }
+      | _debug(workflowArgs, "output")
+      | concat(chPassthrough)
+
+    emit: chReturn
+  }
+
+  def wf = workflowInstance.cloneWithName(key_)
+
+  // add factory function
+  wf.metaClass.run = { runArgs ->
+    workflowFactory(runArgs, workflowArgs, meta)
+  }
+  // add config to module for later introspection
+  wf.metaClass.config = meta.config
+
+  return wf
+}
+
+nextflow.enable.dsl=2
+
+// START COMPONENT-SPECIFIC CODE
+
+// create meta object
+meta = [
+  "resources_dir": moduleDir.toRealPath().normalize(),
+  "config": processConfig(readJsonBlob('''{
+  "name" : "bedtools_bamtobed",
+  "namespace" : "bedtools",
+  "version" : "main",
+  "authors" : [
+    {
+      "name" : "Theodoro Gasperin Terra Camargo",
+      "roles" : [
+        "author",
+        "maintainer"
+      ],
+      "info" : {
+        "links" : {
+          "email" : "theodorogtc@gmail.com",
+          "github" : "tgaspe",
+          "linkedin" : "theodoro-gasperin-terra-camargo"
+        },
+        "organizations" : [
+          {
+            "name" : "Data Intuitive",
+            "href" : "https://www.data-intuitive.com",
+            "role" : "Bioinformatician"
+          }
+        ]
+      }
+    }
+  ],
+  "argument_groups" : [
+    {
+      "name" : "Inputs",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--input",
+          "alternatives" : [
+            "-i"
+          ],
+          "description" : "Input BAM file.",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Outputs",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--output",
+          "alternatives" : [
+            "-o"
+          ],
+          "description" : "Output BED file.",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Options",
+      "arguments" : [
+        {
+          "type" : "boolean_true",
+          "name" : "--bedpe",
+          "description" : "Write BEDPE format. Requires BAM to be grouped or sorted by query.\n",
+          "direction" : "input"
+        },
+        {
+          "type" : "boolean_true",
+          "name" : "--mate1",
+          "description" : "When writing BEDPE (-bedpe) format, always report mate one as the first BEDPE \\"block\\".\n",
+          "direction" : "input"
+        },
+        {
+          "type" : "boolean_true",
+          "name" : "--bed12",
+          "description" : "Write \\"blocked\\" BED format (aka \\"BED12\\"). Forces -split.\nSee http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1\n",
+          "direction" : "input"
+        },
+        {
+          "type" : "boolean_true",
+          "name" : "--split",
+          "description" : "Report \\"split\\" BAM alignments as separate BED entries.\nSplits only on N CIGAR operations.\n",
+          "direction" : "input"
+        },
+        {
+          "type" : "boolean_true",
+          "name" : "--splitD",
+          "description" : "Split alignments based on N and D CIGAR operators.\nForces -split.\n",
+          "direction" : "input"
+        },
+        {
+          "type" : "boolean_true",
+          "name" : "--edit_distance",
+          "alternatives" : [
+            "-ed"
+          ],
+          "description" : "Use BAM edit distance (NM tag) for BED score.\n- Default for BED is to use mapping quality.\n- Default for BEDPE is to use the minimum of\n  the two mapping qualities for the pair.\n- When -ed is used with -bedpe, the total edit\n  distance from the two mates is reported.\n",
+          "direction" : "input"
+        },
+        {
+          "type" : "string",
+          "name" : "--tag",
+          "description" : "Use other NUMERIC BAM alignment tag for BED score.\nDefault for BED is to use mapping quality. Disallowed with BEDPE output.\n",
+          "example" : [
+            "SM"
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "string",
+          "name" : "--color",
+          "description" : "An R,G,B string for the color used with BED12 format.\nDefault is (255,0,0).\n",
+          "example" : [
+            "250,250,250"
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "boolean_true",
+          "name" : "--cigar",
+          "description" : "Add the CIGAR string to the BED entry as a 7th column.\n",
+          "direction" : "input"
+        }
+      ]
+    }
+  ],
+  "resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "script.sh",
+      "is_executable" : true
+    }
+  ],
+  "description" : "Converts BAM alignments to BED6 or BEDPE format.",
+  "test_resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "test.sh",
+      "is_executable" : true
+    },
+    {
+      "type" : "file",
+      "path" : "test_data"
+    }
+  ],
+  "status" : "enabled",
+  "requirements" : {
+    "commands" : [
+      "ps"
+    ]
+  },
+  "keywords" : [
+    "Converts",
+    "BAM",
+    "BED",
+    "BED6",
+    "BEDPE"
+  ],
+  "license" : "MIT",
+  "references" : {
+    "doi" : [
+      "10.1093/bioinformatics/btq033"
+    ]
+  },
+  "links" : {
+    "repository" : "https://github.com/arq5x/bedtools2",
+    "homepage" : "https://bedtools.readthedocs.io/en/latest/#",
+    "documentation" : "https://bedtools.readthedocs.io/en/latest/content/tools/bamtobed.html",
+    "issue_tracker" : "https://github.com/arq5x/bedtools2/issues"
+  },
+  "runners" : [
+    {
+      "type" : "executable",
+      "id" : "executable",
+      "docker_setup_strategy" : "ifneedbepullelsecachedbuild"
+    },
+    {
+      "type" : "nextflow",
+      "id" : "nextflow",
+      "directives" : {
+        "tag" : "$id"
+      },
+      "auto" : {
+        "simplifyInput" : true,
+        "simplifyOutput" : false,
+        "transcript" : false,
+        "publish" : false
+      },
+      "config" : {
+        "labels" : {
+          "mem1gb" : "memory = 1000000000.B",
+          "mem2gb" : "memory = 2000000000.B",
+          "mem5gb" : "memory = 5000000000.B",
+          "mem10gb" : "memory = 10000000000.B",
+          "mem20gb" : "memory = 20000000000.B",
+          "mem50gb" : "memory = 50000000000.B",
+          "mem100gb" : "memory = 100000000000.B",
+          "mem200gb" : "memory = 200000000000.B",
+          "mem500gb" : "memory = 500000000000.B",
+          "mem1tb" : "memory = 1000000000000.B",
+          "mem2tb" : "memory = 2000000000000.B",
+          "mem5tb" : "memory = 5000000000000.B",
+          "mem10tb" : "memory = 10000000000000.B",
+          "mem20tb" : "memory = 20000000000000.B",
+          "mem50tb" : "memory = 50000000000000.B",
+          "mem100tb" : "memory = 100000000000000.B",
+          "mem200tb" : "memory = 200000000000000.B",
+          "mem500tb" : "memory = 500000000000000.B",
+          "mem1gib" : "memory = 1073741824.B",
+          "mem2gib" : "memory = 2147483648.B",
+          "mem4gib" : "memory = 4294967296.B",
+          "mem8gib" : "memory = 8589934592.B",
+          "mem16gib" : "memory = 17179869184.B",
+          "mem32gib" : "memory = 34359738368.B",
+          "mem64gib" : "memory = 68719476736.B",
+          "mem128gib" : "memory = 137438953472.B",
+          "mem256gib" : "memory = 274877906944.B",
+          "mem512gib" : "memory = 549755813888.B",
+          "mem1tib" : "memory = 1099511627776.B",
+          "mem2tib" : "memory = 2199023255552.B",
+          "mem4tib" : "memory = 4398046511104.B",
+          "mem8tib" : "memory = 8796093022208.B",
+          "mem16tib" : "memory = 17592186044416.B",
+          "mem32tib" : "memory = 35184372088832.B",
+          "mem64tib" : "memory = 70368744177664.B",
+          "mem128tib" : "memory = 140737488355328.B",
+          "mem256tib" : "memory = 281474976710656.B",
+          "mem512tib" : "memory = 562949953421312.B",
+          "cpu1" : "cpus = 1",
+          "cpu2" : "cpus = 2",
+          "cpu5" : "cpus = 5",
+          "cpu10" : "cpus = 10",
+          "cpu20" : "cpus = 20",
+          "cpu50" : "cpus = 50",
+          "cpu100" : "cpus = 100",
+          "cpu200" : "cpus = 200",
+          "cpu500" : "cpus = 500",
+          "cpu1000" : "cpus = 1000"
+        }
+      },
+      "debug" : false,
+      "container" : "docker"
+    }
+  ],
+  "engines" : [
+    {
+      "type" : "docker",
+      "id" : "docker",
+      "image" : "debian:stable-slim",
+      "target_registry" : "images.viash-hub.com",
+      "target_tag" : "main",
+      "namespace_separator" : "/",
+      "setup" : [
+        {
+          "type" : "apt",
+          "packages" : [
+            "bedtools",
+            "procps"
+          ],
+          "interactive" : false
+        },
+        {
+          "type" : "docker",
+          "run" : [
+            "echo \\"bedtools: \\\\\\"$(bedtools --version | sed -n 's/^bedtools //p')\\\\\\"\\" > /var/software_versions.txt\n"
+          ]
+        }
+      ]
+    },
+    {
+      "type" : "native",
+      "id" : "native"
+    }
+  ],
+  "build_info" : {
+    "config" : "/workdir/root/repo/src/bedtools/bedtools_bamtobed/config.vsh.yaml",
+    "runner" : "nextflow",
+    "engine" : "docker|native",
+    "output" : "target/nextflow/bedtools/bedtools_bamtobed",
+    "viash_version" : "0.9.0",
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
+  },
+  "package_config" : {
+    "name" : "biobox",
+    "version" : "main",
+    "description" : "A collection of bioinformatics tools for working with sequence data.\n",
+    "viash_version" : "0.9.0",
+    "source" : "src",
+    "target" : "target",
+    "config_mods" : [
+      ".requirements.commands := ['ps']\n",
+      ".engines += { type: \\"native\\" }",
+      ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
+      ".engines[.type == 'docker'].target_tag := 'main'"
+    ],
+    "keywords" : [
+      "bioinformatics",
+      "modules",
+      "sequencing"
+    ],
+    "license" : "MIT",
+    "organization" : "vsh",
+    "links" : {
+      "repository" : "https://github.com/viash-hub/biobox",
+      "issue_tracker" : "https://github.com/viash-hub/biobox/issues"
+    }
+  }
+}'''))
+]
+
+// resolve dependencies dependencies (if any)
+
+
+// inner workflow
+// inner workflow hook
+def innerWorkflowFactory(args) {
+  def rawScript = '''set -e
+tempscript=".viash_script.sh"
+cat > "$tempscript" << VIASHMAIN
+#!/bin/bash
+
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_INPUT+x} ]; then echo "${VIASH_PAR_INPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input='&'#" ; else echo "# par_input="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_PAR_BEDPE+x} ]; then echo "${VIASH_PAR_BEDPE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_bedpe='&'#" ; else echo "# par_bedpe="; fi )
+$( if [ ! -z ${VIASH_PAR_MATE1+x} ]; then echo "${VIASH_PAR_MATE1}" | sed "s#'#'\\"'\\"'#g;s#.*#par_mate1='&'#" ; else echo "# par_mate1="; fi )
+$( if [ ! -z ${VIASH_PAR_BED12+x} ]; then echo "${VIASH_PAR_BED12}" | sed "s#'#'\\"'\\"'#g;s#.*#par_bed12='&'#" ; else echo "# par_bed12="; fi )
+$( if [ ! -z ${VIASH_PAR_SPLIT+x} ]; then echo "${VIASH_PAR_SPLIT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_split='&'#" ; else echo "# par_split="; fi )
+$( if [ ! -z ${VIASH_PAR_SPLITD+x} ]; then echo "${VIASH_PAR_SPLITD}" | sed "s#'#'\\"'\\"'#g;s#.*#par_splitD='&'#" ; else echo "# par_splitD="; fi )
+$( if [ ! -z ${VIASH_PAR_EDIT_DISTANCE+x} ]; then echo "${VIASH_PAR_EDIT_DISTANCE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_edit_distance='&'#" ; else echo "# par_edit_distance="; fi )
+$( if [ ! -z ${VIASH_PAR_TAG+x} ]; then echo "${VIASH_PAR_TAG}" | sed "s#'#'\\"'\\"'#g;s#.*#par_tag='&'#" ; else echo "# par_tag="; fi )
+$( if [ ! -z ${VIASH_PAR_COLOR+x} ]; then echo "${VIASH_PAR_COLOR}" | sed "s#'#'\\"'\\"'#g;s#.*#par_color='&'#" ; else echo "# par_color="; fi )
+$( if [ ! -z ${VIASH_PAR_CIGAR+x} ]; then echo "${VIASH_PAR_CIGAR}" | sed "s#'#'\\"'\\"'#g;s#.*#par_cigar='&'#" ; else echo "# par_cigar="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+
+set -eo pipefail
+
+# Unset parameters
+unset_if_false=( 
+  par_bedpe
+  par_mate1
+  par_bed12
+  par_split
+  par_splitD
+  par_edit_distance
+  par_tag
+  par_color
+  par_cigar
+)
+
+for par in \\${unset_if_false[@]}; do
+    test_val="\\${!par}"
+    [[ "\\$test_val" == "false" ]] && unset \\$par
+done
+
+# Execute bedtools sort with the provided arguments
+bedtools bamtobed \\\\
+    \\${par_bedpe:+-bedpe} \\\\
+    \\${par_mate1:+-mate1} \\\\
+    \\${par_bed12:+-bed12} \\\\
+    \\${par_split:+-split} \\\\
+    \\${par_splitD:+-splitD} \\\\
+    \\${par_edit_distance:+-ed} \\\\
+    \\${par_tag:+-tag "\\$par_tag"} \\\\
+    \\${par_cigar:+-cigar} \\\\
+    \\${par_color:+-color "\\$par_color"} \\\\
+    -i "\\$par_input" \\\\
+    > "\\$par_output"
+VIASHMAIN
+bash "$tempscript"
+'''
+  
+  return vdsl3WorkflowFactory(args, meta, rawScript)
+}
+
+
+
+/**
+  * Generate a workflow for VDSL3 modules.
+  * 
+  * This function is called by the workflowFactory() function.
+  * 
+  * Input channel: [id, input_map]
+  * Output channel: [id, output_map]
+  * 
+  * Internally, this workflow will convert the input channel
+  * to a format which the Nextflow module will be able to handle.
+  */
+def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) {
+  def key = args["key"]
+  def processObj = null
+
+  workflow processWf {
+    take: input_
+    main:
+
+    if (processObj == null) {
+      processObj = _vdsl3ProcessFactory(args, meta, rawScript)
+    }
+    
+    output_ = input_
+      | map { tuple ->
+        def id = tuple[0]
+        def data_ = tuple[1]
+
+        if (workflow.stubRun) {
+          // add id if missing
+          data_ = [id: 'stub'] + data_
+        }
+
+        // process input files separately
+        def inputPaths = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "input" }
+          .collect { par ->
+            def val = data_.containsKey(par.plainName) ? data_[par.plainName] : []
+            def inputFiles = []
+            if (val == null) {
+              inputFiles = []
+            } else if (val instanceof List) {
+              inputFiles = val
+            } else if (val instanceof Path) {
+              inputFiles = [ val ]
+            } else {
+              inputFiles = []
+            }
+            if (!workflow.stubRun) {
+              // throw error when an input file doesn't exist
+              inputFiles.each{ file -> 
+                assert file.exists() :
+                  "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" +
+                  "  Required input file does not exist.\n" +
+                  "  Path: '$file'.\n" +
+                  "  Expected input file to exist"
+              }
+            }
+            inputFiles 
+          } 
+
+        // remove input files
+        def argsExclInputFiles = meta.config.allArguments
+          .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) }
+          .collectEntries { par ->
+            def parName = par.plainName
+            def val = data_[parName]
+            if (par.multiple && val instanceof Collection) {
+              val = val.join(par.multiple_sep)
+            }
+            if (par.direction == "output" && par.type == "file") {
+              val = val
+                .replaceAll('\\$id', id)
+                .replaceAll('\\$\\{id\\}', id)
+                .replaceAll('\\$key', key)
+                .replaceAll('\\$\\{key\\}', key)
+            }
+            [parName, val]
+          }
+
+        [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ]
+      }
+      | processObj
+      | map { output ->
+        def outputFiles = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "output" }
+          .indexed()
+          .collectEntries{ index, par ->
+            def out = output[index + 1]
+            // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678)
+            if (!out instanceof List || out.size() <= 1) {
+              if (par.multiple) {
+                out = []
+              } else {
+                assert !par.required :
+                    "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" +
+                    "  Required output file is missing"
+                out = null
+              }
+            } else if (out.size() == 2 && !par.multiple) {
+              out = out[1]
+            } else {
+              out = out.drop(1)
+            }
+            [ par.plainName, out ]
+          }
+        
+        // drop null outputs
+        outputFiles.removeAll{it.value == null}
+
+        [ output[0], outputFiles ]
+      }
+    emit: output_
+  }
+
+  return processWf
+}
+
+// depends on: session?
+def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) {
+  // autodetect process key
+  def wfKey = workflowArgs["key"]
+  def procKeyPrefix = "${wfKey}_process"
+  def scriptMeta = nextflow.script.ScriptMeta.current()
+  def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)}
+  def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()}
+  def newNumber = (numbers + [-1]).max() + 1
+
+  def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber"
+
+  if (newNumber > 0) {
+    log.warn "Key for module '${wfKey}' is duplicated.\n",
+      "If you run a component multiple times in the same workflow,\n" +
+      "it's recommended you set a unique key for every call,\n" +
+      "for example: ${wfKey}.run(key: \"foo\")."
+  }
+
+  // subset directives and convert to list of tuples
+  def drctv = workflowArgs.directives
+
+  // TODO: unit test the two commands below
+  // convert publish array into tags
+  def valueToStr = { val ->
+    // ignore closures
+    if (val instanceof CharSequence) {
+      if (!val.matches('^[{].*[}]$')) {
+        '"' + val + '"'
+      } else {
+        val
+      }
+    } else if (val instanceof List) {
+      "[" + val.collect{valueToStr(it)}.join(", ") + "]"
+    } else if (val instanceof Map) {
+      "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]"
+    } else {
+      val.inspect()
+    }
+  }
+
+  // multiple entries allowed: label, publishdir
+  def drctvStrs = drctv.collect { key, value ->
+    if (key in ["label", "publishDir"]) {
+      value.collect{ val ->
+        if (val instanceof Map) {
+          "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+        } else if (val == null) {
+          ""
+        } else {
+          "\n$key " + valueToStr(val)
+        }
+      }.join()
+    } else if (value instanceof Map) {
+      "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+    } else {
+      "\n$key " + valueToStr(value)
+    }
+  }.join()
+
+  def inputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "input" }
+    .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' }
+    .join()
+
+  def outputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par ->
+      // insert dummy into every output (see nextflow-io/nextflow#2678)
+      if (!par.multiple) {
+        ', path{[".exitcode", args.' + par.plainName + ']}'
+      } else {
+        ', path{[".exitcode"] + args.' + par.plainName + '}'
+      }
+    }
+    .join()
+
+  // TODO: move this functionality somewhere else?
+  if (workflowArgs.auto.transcript) {
+    outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}'
+  } else {
+    outputPaths = outputPaths + ', path{[".exitcode"]}'
+  }
+
+  // create dirs for output files (based on BashWrapper.createParentFiles)
+  def createParentStr = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" && it.create_parent }
+    .collect { par -> 
+      def contents = "args[\"${par.plainName}\"] instanceof List ? args[\"${par.plainName}\"].join('\" \"') : args[\"${par.plainName}\"]"
+      "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent '\" + escapeText(${contents}) + \"'\" : \"\" }"
+    }
+    .join("\n")
+
+  // construct inputFileExports
+  def inputFileExports = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction.toLowerCase() == "input" }
+    .collect { par ->
+      def contents = "viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName}"
+      "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}='\" + escapeText(${contents}) + \"'\"}"
+    }
+
+  // NOTE: if using docker, use /tmp instead of tmpDir!
+  def tmpDir = java.nio.file.Paths.get(
+    System.getenv('NXF_TEMP') ?: 
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('VIASH_TMPDIR') ?: 
+    System.getenv('VIASH_TEMPDIR') ?: 
+    System.getenv('VIASH_TMP') ?: 
+    System.getenv('TEMP') ?: 
+    System.getenv('TMPDIR') ?: 
+    System.getenv('TEMPDIR') ?:
+    System.getenv('TMP') ?: 
+    '/tmp'
+  ).toAbsolutePath()
+
+  // construct stub
+  def stub = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par -> 
+      "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }"
+    }
+    .join("\n")
+
+  // escape script
+  def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"')
+
+  // publishdir assert
+  def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? 
+    """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n  Example: --publish_dir './output/'" """ :
+    ""
+
+  // generate process string
+  def procStr = 
+  """nextflow.enable.dsl=2
+  |
+  |def escapeText = { s -> s.toString().replaceAll("'", "'\\\"'\\\"'") }
+  |process $procKey {$drctvStrs
+  |input:
+  |  tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources")
+  |output:
+  |  tuple val("\$id")$outputPaths, optional: true
+  |stub:
+  |\"\"\"
+  |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; }
+  |$stub
+  |\"\"\"
+  |script:$assertStr
+  |def parInject = args
+  |  .findAll{key, value -> value != null}
+  |  .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}='\${escapeText(value)}'"}
+  |  .join("\\n")
+  |\"\"\"
+  |# meta exports
+  |export VIASH_META_RESOURCES_DIR="\${resourcesDir}"
+  |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}"
+  |export VIASH_META_NAME="${meta.config.name}"
+  |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME"
+  |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+  |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" }
+  |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" }
+  |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then
+  |  export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 ))
+  |  export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  |fi
+  |
+  |# meta synonyms
+  |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR"
+  |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR"
+  |
+  |# create output dirs if need be
+  |function mkdir_parent {
+  |  for file in "\\\$@"; do 
+  |    mkdir -p "\\\$(dirname "\\\$file")"
+  |  done
+  |}
+  |$createParentStr
+  |
+  |# argument exports${inputFileExports.join()}
+  |\$parInject
+  |
+  |# process script
+  |${escapedScript}
+  |\"\"\"
+  |}
+  |""".stripMargin()
+
+  // TODO: print on debug
+  // if (workflowArgs.debug == true) {
+  //   println("######################\n$procStr\n######################")
+  // }
+
+  // write process to temp file
+  def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf")
+  addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) }
+  tempFile.text = procStr
+
+  // create process from temp file
+  def binding = new nextflow.script.ScriptBinding([:])
+  def session = nextflow.Nextflow.getSession()
+  def parser = new nextflow.script.ScriptParser(session)
+    .setModule(true)
+    .setBinding(binding)
+  def moduleScript = parser.runScript(tempFile)
+    .getScript()
+
+  // register module in meta
+  def module = new nextflow.script.IncludeDef.Module(name: procKey)
+  scriptMeta.addModule(moduleScript, module.name, module.alias)
+
+  // retrieve and return process from meta
+  return scriptMeta.getProcess(procKey)
+}
+
+// defaults
+meta["defaults"] = [
+  // key to be used to trace the process and determine output names
+  key: null,
+
+  // fixed arguments to be passed to script
+  args: [:],
+
+  // default directives
+  directives: readJsonBlob('''{
+  "container" : {
+    "registry" : "images.viash-hub.com",
+    "image" : "vsh/biobox/bedtools/bedtools_bamtobed",
+    "tag" : "main"
+  },
+  "tag" : "$id"
+}'''),
+
+  // auto settings
+  auto: readJsonBlob('''{
+  "simplifyInput" : true,
+  "simplifyOutput" : false,
+  "transcript" : false,
+  "publish" : false
+}'''),
+
+  // Apply a map over the incoming tuple
+  // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }`
+  map: null,
+
+  // Apply a map over the ID element of a tuple (i.e. the first element)
+  // Example: `{ id -> id + "_foo" }`
+  mapId: null,
+
+  // Apply a map over the data element of a tuple (i.e. the second element)
+  // Example: `{ data -> [ input: data.output ] }`
+  mapData: null,
+
+  // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements)
+  // Example: `{ pt -> pt.drop(1) }`
+  mapPassthrough: null,
+
+  // Filter the channel
+  // Example: `{ tup -> tup[0] == "foo" }`
+  filter: null,
+
+  // Choose whether or not to run the component on the tuple if the condition is true.
+  // Otherwise, the tuple will be passed through.
+  // Example: `{ tup -> tup[0] != "skip_this" }`
+  runIf: null,
+
+  // Rename keys in the data field of the tuple (i.e. the second element)
+  // Will likely be deprecated in favour of `fromState`.
+  // Example: `[ "new_key": "old_key" ]`
+  renameKeys: null,
+
+  // Fetch data from the state and pass it to the module without altering the current state.
+  // 
+  // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. 
+  // 
+  // - If it is `null`, the state will be passed to the module as is.
+  // - If it is a `List[String]`, the data will be the values of the state at the given keys.
+  // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map.
+  // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data.
+  // 
+  // Example: `{ id, state -> [input: state.fastq_file] }`
+  // Default: `null`
+  fromState: null,
+
+  // Determine how the state should be updated after the module has been run.
+  // 
+  // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function.
+  // 
+  // - If it is `null`, the state will be replaced with the output of the module.
+  // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys.
+  // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map.
+  // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state.
+  //
+  // Example: `{ id, output, state -> state + [counts: state.output] }`
+  // Default: `{ id, output, state -> output }`
+  toState: null,
+
+  // Whether or not to print debug messages
+  // Default: `false`
+  debug: false
+]
+
+// initialise default workflow
+meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta)
+
+// add workflow to environment
+nextflow.script.ScriptMeta.current().addDefinition(meta.workflow)
+
+// anonymous workflow for running this module as a standalone
+workflow {
+  // add id argument if it's not already in the config
+  // TODO: deep copy
+  def newConfig = deepClone(meta.config)
+  def newParams = deepClone(params)
+
+  def argsContainsId = newConfig.allArguments.any{it.plainName == "id"}
+  if (!argsContainsId) {
+    def idArg = [
+      'name': '--id',
+      'required': false,
+      'type': 'string',
+      'description': 'A unique id for every entry.',
+      'multiple': false
+    ]
+    newConfig.arguments.add(0, idArg)
+    newConfig = processConfig(newConfig)
+  }
+  if (!newParams.containsKey("id")) {
+    newParams.id = "run"
+  }
+
+  helpMessage(newConfig)
+
+  channelFromParams(newParams, newConfig)
+    // make sure id is not in the state if id is not in the args
+    | map {id, state ->
+      if (!argsContainsId) {
+        [id, state.findAll{k, v -> k != "id"}]
+      } else {
+        [id, state]
+      }
+    }
+    | meta.workflow.run(
+      auto: [ publish: "state" ]
+    )
+}
+
+// END COMPONENT-SPECIFIC CODE
diff --git a/target/nextflow/bedtools/bedtools_bamtobed/nextflow.config b/target/nextflow/bedtools/bedtools_bamtobed/nextflow.config
new file mode 100644
index 00000000..131c419d
--- /dev/null
+++ b/target/nextflow/bedtools/bedtools_bamtobed/nextflow.config
@@ -0,0 +1,126 @@
+manifest {
+  name = 'bedtools/bedtools_bamtobed'
+  mainScript = 'main.nf'
+  nextflowVersion = '!>=20.12.1-edge'
+  version = 'main'
+  description = 'Converts BAM alignments to BED6 or BEDPE format.'
+  author = 'Theodoro Gasperin Terra Camargo'
+}
+
+process.container = 'nextflow/bash:latest'
+
+// detect tempdir
+tempDir = java.nio.file.Paths.get(
+  System.getenv('NXF_TEMP') ?:
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('TEMPDIR') ?: 
+    System.getenv('TMPDIR') ?: 
+    '/tmp'
+).toAbsolutePath()
+
+profiles {
+  no_publish {
+    process {
+      withName: '.*' {
+        publishDir = [
+          enabled: false
+        ]
+      }
+    }
+  }
+  mount_temp {
+    docker.temp            = tempDir
+    podman.temp            = tempDir
+    charliecloud.temp      = tempDir
+  }
+  docker {
+    docker.enabled         = true
+    // docker.userEmulation   = true
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  singularity {
+    singularity.enabled    = true
+    singularity.autoMounts = true
+    docker.enabled         = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  podman {
+    podman.enabled         = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  shifter {
+    shifter.enabled        = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    charliecloud.enabled   = false
+  }
+  charliecloud {
+    charliecloud.enabled   = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+  }
+}
+
+process{
+  withLabel: mem1gb { memory = 1000000000.B }
+  withLabel: mem2gb { memory = 2000000000.B }
+  withLabel: mem5gb { memory = 5000000000.B }
+  withLabel: mem10gb { memory = 10000000000.B }
+  withLabel: mem20gb { memory = 20000000000.B }
+  withLabel: mem50gb { memory = 50000000000.B }
+  withLabel: mem100gb { memory = 100000000000.B }
+  withLabel: mem200gb { memory = 200000000000.B }
+  withLabel: mem500gb { memory = 500000000000.B }
+  withLabel: mem1tb { memory = 1000000000000.B }
+  withLabel: mem2tb { memory = 2000000000000.B }
+  withLabel: mem5tb { memory = 5000000000000.B }
+  withLabel: mem10tb { memory = 10000000000000.B }
+  withLabel: mem20tb { memory = 20000000000000.B }
+  withLabel: mem50tb { memory = 50000000000000.B }
+  withLabel: mem100tb { memory = 100000000000000.B }
+  withLabel: mem200tb { memory = 200000000000000.B }
+  withLabel: mem500tb { memory = 500000000000000.B }
+  withLabel: mem1gib { memory = 1073741824.B }
+  withLabel: mem2gib { memory = 2147483648.B }
+  withLabel: mem4gib { memory = 4294967296.B }
+  withLabel: mem8gib { memory = 8589934592.B }
+  withLabel: mem16gib { memory = 17179869184.B }
+  withLabel: mem32gib { memory = 34359738368.B }
+  withLabel: mem64gib { memory = 68719476736.B }
+  withLabel: mem128gib { memory = 137438953472.B }
+  withLabel: mem256gib { memory = 274877906944.B }
+  withLabel: mem512gib { memory = 549755813888.B }
+  withLabel: mem1tib { memory = 1099511627776.B }
+  withLabel: mem2tib { memory = 2199023255552.B }
+  withLabel: mem4tib { memory = 4398046511104.B }
+  withLabel: mem8tib { memory = 8796093022208.B }
+  withLabel: mem16tib { memory = 17592186044416.B }
+  withLabel: mem32tib { memory = 35184372088832.B }
+  withLabel: mem64tib { memory = 70368744177664.B }
+  withLabel: mem128tib { memory = 140737488355328.B }
+  withLabel: mem256tib { memory = 281474976710656.B }
+  withLabel: mem512tib { memory = 562949953421312.B }
+  withLabel: cpu1 { cpus = 1 }
+  withLabel: cpu2 { cpus = 2 }
+  withLabel: cpu5 { cpus = 5 }
+  withLabel: cpu10 { cpus = 10 }
+  withLabel: cpu20 { cpus = 20 }
+  withLabel: cpu50 { cpus = 50 }
+  withLabel: cpu100 { cpus = 100 }
+  withLabel: cpu200 { cpus = 200 }
+  withLabel: cpu500 { cpus = 500 }
+  withLabel: cpu1000 { cpus = 1000 }
+}
+
+
diff --git a/target/nextflow/bedtools/bedtools_bamtobed/nextflow_schema.json b/target/nextflow/bedtools/bedtools_bamtobed/nextflow_schema.json
new file mode 100644
index 00000000..733d2a87
--- /dev/null
+++ b/target/nextflow/bedtools/bedtools_bamtobed/nextflow_schema.json
@@ -0,0 +1,206 @@
+{
+"$schema": "http://json-schema.org/draft-07/schema",
+"title": "bedtools_bamtobed",
+"description": "Converts BAM alignments to BED6 or BEDPE format.",
+"type": "object",
+"definitions": {
+
+    
+    
+    "inputs" : {
+    "title": "Inputs",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "input": {
+                "type":
+                "string",
+                "description": "Type: `file`, required. Input BAM file",
+                "help_text": "Type: `file`, required. Input BAM file."
+            
+            }
+    
+
+}
+},
+    
+    
+    "outputs" : {
+    "title": "Outputs",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "output": {
+                "type":
+                "string",
+                "description": "Type: `file`, required, default: `$id.$key.output.output`. Output BED file",
+                "help_text": "Type: `file`, required, default: `$id.$key.output.output`. Output BED file."
+            ,
+                "default": "$id.$key.output.output"
+            }
+    
+
+}
+},
+    
+    
+    "options" : {
+    "title": "Options",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "bedpe": {
+                "type":
+                "boolean",
+                "description": "Type: `boolean_true`, default: `false`. Write BEDPE format",
+                "help_text": "Type: `boolean_true`, default: `false`. Write BEDPE format. Requires BAM to be grouped or sorted by query.\n"
+            ,
+                "default": "False"
+            }
+    
+
+        ,
+                "mate1": {
+                "type":
+                "boolean",
+                "description": "Type: `boolean_true`, default: `false`. When writing BEDPE (-bedpe) format, always report mate one as the first BEDPE \"block\"",
+                "help_text": "Type: `boolean_true`, default: `false`. When writing BEDPE (-bedpe) format, always report mate one as the first BEDPE \"block\".\n"
+            ,
+                "default": "False"
+            }
+    
+
+        ,
+                "bed12": {
+                "type":
+                "boolean",
+                "description": "Type: `boolean_true`, default: `false`. Write \"blocked\" BED format (aka \"BED12\")",
+                "help_text": "Type: `boolean_true`, default: `false`. Write \"blocked\" BED format (aka \"BED12\"). Forces -split.\nSee http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1\n"
+            ,
+                "default": "False"
+            }
+    
+
+        ,
+                "split": {
+                "type":
+                "boolean",
+                "description": "Type: `boolean_true`, default: `false`. Report \"split\" BAM alignments as separate BED entries",
+                "help_text": "Type: `boolean_true`, default: `false`. Report \"split\" BAM alignments as separate BED entries.\nSplits only on N CIGAR operations.\n"
+            ,
+                "default": "False"
+            }
+    
+
+        ,
+                "splitD": {
+                "type":
+                "boolean",
+                "description": "Type: `boolean_true`, default: `false`. Split alignments based on N and D CIGAR operators",
+                "help_text": "Type: `boolean_true`, default: `false`. Split alignments based on N and D CIGAR operators.\nForces -split.\n"
+            ,
+                "default": "False"
+            }
+    
+
+        ,
+                "edit_distance": {
+                "type":
+                "boolean",
+                "description": "Type: `boolean_true`, default: `false`. Use BAM edit distance (NM tag) for BED score",
+                "help_text": "Type: `boolean_true`, default: `false`. Use BAM edit distance (NM tag) for BED score.\n- Default for BED is to use mapping quality.\n- Default for BEDPE is to use the minimum of\n  the two mapping qualities for the pair.\n- When -ed is used with -bedpe, the total edit\n  distance from the two mates is reported.\n"
+            ,
+                "default": "False"
+            }
+    
+
+        ,
+                "tag": {
+                "type":
+                "string",
+                "description": "Type: `string`, example: `SM`. Use other NUMERIC BAM alignment tag for BED score",
+                "help_text": "Type: `string`, example: `SM`. Use other NUMERIC BAM alignment tag for BED score.\nDefault for BED is to use mapping quality. Disallowed with BEDPE output.\n"
+            
+            }
+    
+
+        ,
+                "color": {
+                "type":
+                "string",
+                "description": "Type: `string`, example: `250,250,250`. An R,G,B string for the color used with BED12 format",
+                "help_text": "Type: `string`, example: `250,250,250`. An R,G,B string for the color used with BED12 format.\nDefault is (255,0,0).\n"
+            
+            }
+    
+
+        ,
+                "cigar": {
+                "type":
+                "boolean",
+                "description": "Type: `boolean_true`, default: `false`. Add the CIGAR string to the BED entry as a 7th column",
+                "help_text": "Type: `boolean_true`, default: `false`. Add the CIGAR string to the BED entry as a 7th column.\n"
+            ,
+                "default": "False"
+            }
+    
+
+}
+},
+    
+    
+    "nextflow input-output arguments" : {
+    "title": "Nextflow input-output arguments",
+    "type": "object",
+    "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+    "properties": {
+    
+        
+                "publish_dir": {
+                "type":
+                "string",
+                "description": "Type: `string`, required, example: `output/`. Path to an output directory",
+                "help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
+            
+            }
+    
+
+        ,
+                "param_list": {
+                "type":
+                "string",
+                "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
+                "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
+                "hidden": true
+            
+            }
+    
+
+}
+}
+},
+"allOf": [
+
+    {
+    "$ref": "#/definitions/inputs"
+    },
+
+    {
+    "$ref": "#/definitions/outputs"
+    },
+
+    {
+    "$ref": "#/definitions/options"
+    },
+
+    {
+    "$ref": "#/definitions/nextflow input-output arguments"
+    }
+]
+}
diff --git a/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml
index 8009a09a..5ed71e60 100644
--- a/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_bamtofastq/.config.vsh.yaml
@@ -187,9 +187,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_bamtofastq"
   executable: "target/nextflow/bedtools/bedtools_bamtofastq/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_bamtofastq/main.nf b/target/nextflow/bedtools/bedtools_bamtofastq/main.nf
index 9ac5aa0f..d80a14a7 100644
--- a/target/nextflow/bedtools/bedtools_bamtofastq/main.nf
+++ b/target/nextflow/bedtools/bedtools_bamtofastq/main.nf
@@ -3050,9 +3050,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_bamtofastq",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml
index b30c7594..52354569 100644
--- a/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_bed12tobed6/.config.vsh.yaml
@@ -176,9 +176,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_bed12tobed6"
   executable: "target/nextflow/bedtools/bedtools_bed12tobed6/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf b/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf
index 49e51345..262d9a20 100644
--- a/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf
+++ b/target/nextflow/bedtools/bedtools_bed12tobed6/main.nf
@@ -3035,9 +3035,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_bed12tobed6",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml
index ccc69bcf..f68171c0 100644
--- a/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_bedtobam/.config.vsh.yaml
@@ -214,9 +214,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_bedtobam"
   executable: "target/nextflow/bedtools/bedtools_bedtobam/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_bedtobam/main.nf b/target/nextflow/bedtools/bedtools_bedtobam/main.nf
index b3cbde2a..0c09d6f4 100644
--- a/target/nextflow/bedtools/bedtools_bedtobam/main.nf
+++ b/target/nextflow/bedtools/bedtools_bedtobam/main.nf
@@ -3083,9 +3083,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_bedtobam",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml
index b679691b..bfb05453 100644
--- a/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_genomecov/.config.vsh.yaml
@@ -337,9 +337,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_genomecov"
   executable: "target/nextflow/bedtools/bedtools_genomecov/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_genomecov/main.nf b/target/nextflow/bedtools/bedtools_genomecov/main.nf
index 2d0cde48..29d326ab 100644
--- a/target/nextflow/bedtools/bedtools_genomecov/main.nf
+++ b/target/nextflow/bedtools/bedtools_genomecov/main.nf
@@ -3207,9 +3207,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_genomecov",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml
index f731a00d..1c02380e 100644
--- a/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml
@@ -232,9 +232,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_getfasta"
   executable: "target/nextflow/bedtools/bedtools_getfasta/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_getfasta/main.nf b/target/nextflow/bedtools/bedtools_getfasta/main.nf
index aefb0d81..208d7946 100644
--- a/target/nextflow/bedtools/bedtools_getfasta/main.nf
+++ b/target/nextflow/bedtools/bedtools_getfasta/main.nf
@@ -3086,9 +3086,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_getfasta",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml
index 6053c58f..20bd4b1a 100644
--- a/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_groupby/.config.vsh.yaml
@@ -273,9 +273,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_groupby"
   executable: "target/nextflow/bedtools/bedtools_groupby/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_groupby/main.nf b/target/nextflow/bedtools/bedtools_groupby/main.nf
index 878095c9..831b59f3 100644
--- a/target/nextflow/bedtools/bedtools_groupby/main.nf
+++ b/target/nextflow/bedtools/bedtools_groupby/main.nf
@@ -3130,9 +3130,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_groupby",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml
index aef995b5..9cd8ee94 100644
--- a/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_intersect/.config.vsh.yaml
@@ -410,9 +410,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_intersect"
   executable: "target/nextflow/bedtools/bedtools_intersect/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_intersect/main.nf b/target/nextflow/bedtools/bedtools_intersect/main.nf
index c1b69759..c61c7ffc 100644
--- a/target/nextflow/bedtools/bedtools_intersect/main.nf
+++ b/target/nextflow/bedtools/bedtools_intersect/main.nf
@@ -3282,9 +3282,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_intersect",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml
index 17095134..8b9d53bc 100644
--- a/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_links/.config.vsh.yaml
@@ -210,9 +210,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_links"
   executable: "target/nextflow/bedtools/bedtools_links/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_links/main.nf b/target/nextflow/bedtools/bedtools_links/main.nf
index 68a7efbe..ae289cb9 100644
--- a/target/nextflow/bedtools/bedtools_links/main.nf
+++ b/target/nextflow/bedtools/bedtools_links/main.nf
@@ -3073,9 +3073,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_links",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml
index f31081cc..8a8233b7 100644
--- a/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_merge/.config.vsh.yaml
@@ -279,9 +279,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_merge"
   executable: "target/nextflow/bedtools/bedtools_merge/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_merge/main.nf b/target/nextflow/bedtools/bedtools_merge/main.nf
index d932a4ad..b7ff7c5d 100644
--- a/target/nextflow/bedtools/bedtools_merge/main.nf
+++ b/target/nextflow/bedtools/bedtools_merge/main.nf
@@ -3134,9 +3134,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_merge",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml b/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml
index e5a05df5..953b28d9 100644
--- a/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml
+++ b/target/nextflow/bedtools/bedtools_sort/.config.vsh.yaml
@@ -222,9 +222,9 @@ build_info:
   output: "target/nextflow/bedtools/bedtools_sort"
   executable: "target/nextflow/bedtools/bedtools_sort/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/bedtools/bedtools_sort/main.nf b/target/nextflow/bedtools/bedtools_sort/main.nf
index c0d09a63..b76a0121 100644
--- a/target/nextflow/bedtools/bedtools_sort/main.nf
+++ b/target/nextflow/bedtools/bedtools_sort/main.nf
@@ -3092,9 +3092,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/bedtools/bedtools_sort",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml b/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml
index f5095890..643a6832 100644
--- a/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml
+++ b/target/nextflow/busco/busco_download_datasets/.config.vsh.yaml
@@ -158,9 +158,9 @@ build_info:
   output: "target/nextflow/busco/busco_download_datasets"
   executable: "target/nextflow/busco/busco_download_datasets/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/busco/busco_download_datasets/main.nf b/target/nextflow/busco/busco_download_datasets/main.nf
index 75ddb55e..4c195aff 100644
--- a/target/nextflow/busco/busco_download_datasets/main.nf
+++ b/target/nextflow/busco/busco_download_datasets/main.nf
@@ -3011,9 +3011,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/busco/busco_download_datasets",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml b/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml
index 3185c80f..e7679ac8 100644
--- a/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml
+++ b/target/nextflow/busco/busco_list_datasets/.config.vsh.yaml
@@ -145,9 +145,9 @@ build_info:
   output: "target/nextflow/busco/busco_list_datasets"
   executable: "target/nextflow/busco/busco_list_datasets/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/busco/busco_list_datasets/main.nf b/target/nextflow/busco/busco_list_datasets/main.nf
index 95bf98d7..d1ca78ba 100644
--- a/target/nextflow/busco/busco_list_datasets/main.nf
+++ b/target/nextflow/busco/busco_list_datasets/main.nf
@@ -2997,9 +2997,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/busco/busco_list_datasets",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/busco/busco_run/.config.vsh.yaml b/target/nextflow/busco/busco_run/.config.vsh.yaml
index e81730a1..a993e3dd 100644
--- a/target/nextflow/busco/busco_run/.config.vsh.yaml
+++ b/target/nextflow/busco/busco_run/.config.vsh.yaml
@@ -423,9 +423,9 @@ build_info:
   output: "target/nextflow/busco/busco_run"
   executable: "target/nextflow/busco/busco_run/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/busco/busco_run/main.nf b/target/nextflow/busco/busco_run/main.nf
index 661b5db2..9d3f16ef 100644
--- a/target/nextflow/busco/busco_run/main.nf
+++ b/target/nextflow/busco/busco_run/main.nf
@@ -3309,9 +3309,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/busco/busco_run",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/cutadapt/.config.vsh.yaml b/target/nextflow/cutadapt/.config.vsh.yaml
index e181fac7..483469af 100644
--- a/target/nextflow/cutadapt/.config.vsh.yaml
+++ b/target/nextflow/cutadapt/.config.vsh.yaml
@@ -740,9 +740,9 @@ build_info:
   output: "target/nextflow/cutadapt"
   executable: "target/nextflow/cutadapt/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/cutadapt/main.nf b/target/nextflow/cutadapt/main.nf
index efaaba94..b1f71137 100644
--- a/target/nextflow/cutadapt/main.nf
+++ b/target/nextflow/cutadapt/main.nf
@@ -3619,9 +3619,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/cutadapt",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/falco/.config.vsh.yaml b/target/nextflow/falco/.config.vsh.yaml
index 0cc13a8e..9e5b0a45 100644
--- a/target/nextflow/falco/.config.vsh.yaml
+++ b/target/nextflow/falco/.config.vsh.yaml
@@ -317,9 +317,9 @@ build_info:
   output: "target/nextflow/falco"
   executable: "target/nextflow/falco/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/falco/main.nf b/target/nextflow/falco/main.nf
index 3cecbdde..7726536e 100644
--- a/target/nextflow/falco/main.nf
+++ b/target/nextflow/falco/main.nf
@@ -3170,9 +3170,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/falco",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/fastp/.config.vsh.yaml b/target/nextflow/fastp/.config.vsh.yaml
index 6186d865..ff74fb20 100644
--- a/target/nextflow/fastp/.config.vsh.yaml
+++ b/target/nextflow/fastp/.config.vsh.yaml
@@ -1083,9 +1083,9 @@ build_info:
   output: "target/nextflow/fastp"
   executable: "target/nextflow/fastp/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/fastp/main.nf b/target/nextflow/fastp/main.nf
index 2cab6a6f..4e53f73c 100644
--- a/target/nextflow/fastp/main.nf
+++ b/target/nextflow/fastp/main.nf
@@ -4023,9 +4023,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/fastp",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/fastqc/.config.vsh.yaml b/target/nextflow/fastqc/.config.vsh.yaml
index 2e7105e0..e452520f 100644
--- a/target/nextflow/fastqc/.config.vsh.yaml
+++ b/target/nextflow/fastqc/.config.vsh.yaml
@@ -340,9 +340,9 @@ build_info:
   output: "target/nextflow/fastqc"
   executable: "target/nextflow/fastqc/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/fastqc/main.nf b/target/nextflow/fastqc/main.nf
index 40db44fb..db3d6e05 100644
--- a/target/nextflow/fastqc/main.nf
+++ b/target/nextflow/fastqc/main.nf
@@ -3182,9 +3182,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/fastqc",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/featurecounts/.config.vsh.yaml b/target/nextflow/featurecounts/.config.vsh.yaml
index 92f0b820..1a78e19f 100644
--- a/target/nextflow/featurecounts/.config.vsh.yaml
+++ b/target/nextflow/featurecounts/.config.vsh.yaml
@@ -645,9 +645,9 @@ build_info:
   output: "target/nextflow/featurecounts"
   executable: "target/nextflow/featurecounts/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/featurecounts/main.nf b/target/nextflow/featurecounts/main.nf
index 70b8fd3d..96d1548d 100644
--- a/target/nextflow/featurecounts/main.nf
+++ b/target/nextflow/featurecounts/main.nf
@@ -3549,9 +3549,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/featurecounts",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/fq_subsample/.config.vsh.yaml b/target/nextflow/fq_subsample/.config.vsh.yaml
index 93310c6f..4e800eb6 100644
--- a/target/nextflow/fq_subsample/.config.vsh.yaml
+++ b/target/nextflow/fq_subsample/.config.vsh.yaml
@@ -190,9 +190,9 @@ build_info:
   output: "target/nextflow/fq_subsample"
   executable: "target/nextflow/fq_subsample/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/fq_subsample/main.nf b/target/nextflow/fq_subsample/main.nf
index b263b064..b98d7bb4 100644
--- a/target/nextflow/fq_subsample/main.nf
+++ b/target/nextflow/fq_subsample/main.nf
@@ -3032,9 +3032,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/fq_subsample",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/gffread/.config.vsh.yaml b/target/nextflow/gffread/.config.vsh.yaml
index 53e8a38c..b1940e11 100644
--- a/target/nextflow/gffread/.config.vsh.yaml
+++ b/target/nextflow/gffread/.config.vsh.yaml
@@ -685,9 +685,9 @@ build_info:
   output: "target/nextflow/gffread"
   executable: "target/nextflow/gffread/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/gffread/main.nf b/target/nextflow/gffread/main.nf
index 2c814c0f..6006a931 100644
--- a/target/nextflow/gffread/main.nf
+++ b/target/nextflow/gffread/main.nf
@@ -3606,9 +3606,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/gffread",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml b/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml
index e376deb9..cab2c353 100644
--- a/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml
+++ b/target/nextflow/kallisto/kallisto_index/.config.vsh.yaml
@@ -218,9 +218,9 @@ build_info:
   output: "target/nextflow/kallisto/kallisto_index"
   executable: "target/nextflow/kallisto/kallisto_index/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/kallisto/kallisto_index/main.nf b/target/nextflow/kallisto/kallisto_index/main.nf
index 7b9e3c35..402fe9b8 100644
--- a/target/nextflow/kallisto/kallisto_index/main.nf
+++ b/target/nextflow/kallisto/kallisto_index/main.nf
@@ -3071,9 +3071,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/kallisto/kallisto_index",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml b/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml
index e0a3ec9e..643a4ced 100644
--- a/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml
+++ b/target/nextflow/kallisto/kallisto_quant/.config.vsh.yaml
@@ -234,9 +234,9 @@ build_info:
   output: "target/nextflow/kallisto/kallisto_quant"
   executable: "target/nextflow/kallisto/kallisto_quant/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/kallisto/kallisto_quant/main.nf b/target/nextflow/kallisto/kallisto_quant/main.nf
index 7f859e2a..6f55f1e8 100644
--- a/target/nextflow/kallisto/kallisto_quant/main.nf
+++ b/target/nextflow/kallisto/kallisto_quant/main.nf
@@ -3092,9 +3092,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/kallisto/kallisto_quant",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml b/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml
index 3421e6cb..dc1f0017 100644
--- a/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml
+++ b/target/nextflow/lofreq/lofreq_call/.config.vsh.yaml
@@ -507,9 +507,9 @@ build_info:
   output: "target/nextflow/lofreq/lofreq_call"
   executable: "target/nextflow/lofreq/lofreq_call/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/lofreq/lofreq_call/main.nf b/target/nextflow/lofreq/lofreq_call/main.nf
index a3cab2bd..5646710b 100644
--- a/target/nextflow/lofreq/lofreq_call/main.nf
+++ b/target/nextflow/lofreq/lofreq_call/main.nf
@@ -3414,9 +3414,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/lofreq/lofreq_call",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml b/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml
index 22be4f92..4d42f045 100644
--- a/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml
+++ b/target/nextflow/lofreq/lofreq_indelqual/.config.vsh.yaml
@@ -215,9 +215,9 @@ build_info:
   output: "target/nextflow/lofreq/lofreq_indelqual"
   executable: "target/nextflow/lofreq/lofreq_indelqual/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/lofreq/lofreq_indelqual/main.nf b/target/nextflow/lofreq/lofreq_indelqual/main.nf
index f0c88079..56b19630 100644
--- a/target/nextflow/lofreq/lofreq_indelqual/main.nf
+++ b/target/nextflow/lofreq/lofreq_indelqual/main.nf
@@ -3077,9 +3077,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/lofreq/lofreq_indelqual",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/multiqc/.config.vsh.yaml b/target/nextflow/multiqc/.config.vsh.yaml
index ff7a5d19..0cb194c9 100644
--- a/target/nextflow/multiqc/.config.vsh.yaml
+++ b/target/nextflow/multiqc/.config.vsh.yaml
@@ -456,9 +456,9 @@ build_info:
   output: "target/nextflow/multiqc"
   executable: "target/nextflow/multiqc/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/multiqc/main.nf b/target/nextflow/multiqc/main.nf
index 2bb46281..bf304714 100644
--- a/target/nextflow/multiqc/main.nf
+++ b/target/nextflow/multiqc/main.nf
@@ -3366,9 +3366,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/multiqc",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/nanoplot/.config.vsh.yaml b/target/nextflow/nanoplot/.config.vsh.yaml
index 3344e9e7..53b8ee23 100644
--- a/target/nextflow/nanoplot/.config.vsh.yaml
+++ b/target/nextflow/nanoplot/.config.vsh.yaml
@@ -492,9 +492,9 @@ build_info:
   output: "target/nextflow/nanoplot"
   executable: "target/nextflow/nanoplot/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/nanoplot/main.nf b/target/nextflow/nanoplot/main.nf
index 1979783b..77ef76a0 100644
--- a/target/nextflow/nanoplot/main.nf
+++ b/target/nextflow/nanoplot/main.nf
@@ -3397,9 +3397,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/nanoplot",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/pear/.config.vsh.yaml b/target/nextflow/pear/.config.vsh.yaml
index 4af49547..47d4eafd 100644
--- a/target/nextflow/pear/.config.vsh.yaml
+++ b/target/nextflow/pear/.config.vsh.yaml
@@ -398,9 +398,9 @@ build_info:
   output: "target/nextflow/pear"
   executable: "target/nextflow/pear/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/pear/main.nf b/target/nextflow/pear/main.nf
index d59f5338..be34e640 100644
--- a/target/nextflow/pear/main.nf
+++ b/target/nextflow/pear/main.nf
@@ -3259,9 +3259,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/pear",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml b/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml
index 836cd753..c8416da8 100644
--- a/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml
+++ b/target/nextflow/qualimap/qualimap_rnaseq/.config.vsh.yaml
@@ -264,9 +264,9 @@ build_info:
   output: "target/nextflow/qualimap/qualimap_rnaseq"
   executable: "target/nextflow/qualimap/qualimap_rnaseq/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/qualimap/qualimap_rnaseq/main.nf b/target/nextflow/qualimap/qualimap_rnaseq/main.nf
index 0405ecde..502efc68 100644
--- a/target/nextflow/qualimap/qualimap_rnaseq/main.nf
+++ b/target/nextflow/qualimap/qualimap_rnaseq/main.nf
@@ -3129,9 +3129,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/qualimap/qualimap_rnaseq",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml b/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml
index 9f5dd35e..12804391 100644
--- a/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml
+++ b/target/nextflow/rsem/rsem_calculate_expression/.config.vsh.yaml
@@ -852,9 +852,9 @@ build_info:
   output: "target/nextflow/rsem/rsem_calculate_expression"
   executable: "target/nextflow/rsem/rsem_calculate_expression/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/rsem/rsem_calculate_expression/main.nf b/target/nextflow/rsem/rsem_calculate_expression/main.nf
index 71dc940b..f4476aed 100644
--- a/target/nextflow/rsem/rsem_calculate_expression/main.nf
+++ b/target/nextflow/rsem/rsem_calculate_expression/main.nf
@@ -3661,9 +3661,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/rsem/rsem_calculate_expression",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml b/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml
index b5b8c58c..82a6bee2 100644
--- a/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml
+++ b/target/nextflow/rsem/rsem_prepare_reference/.config.vsh.yaml
@@ -416,9 +416,9 @@ build_info:
   output: "target/nextflow/rsem/rsem_prepare_reference"
   executable: "target/nextflow/rsem/rsem_prepare_reference/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/rsem/rsem_prepare_reference/main.nf b/target/nextflow/rsem/rsem_prepare_reference/main.nf
index f395c2a9..3b34d47c 100644
--- a/target/nextflow/rsem/rsem_prepare_reference/main.nf
+++ b/target/nextflow/rsem/rsem_prepare_reference/main.nf
@@ -3245,9 +3245,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/rsem/rsem_prepare_reference",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/rseqc/rseqc_bamstat/.config.vsh.yaml b/target/nextflow/rseqc/rseqc_bamstat/.config.vsh.yaml
new file mode 100644
index 00000000..25e87f31
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_bamstat/.config.vsh.yaml
@@ -0,0 +1,202 @@
+name: "rseqc_bamstat"
+namespace: "rseqc"
+version: "main"
+authors:
+- name: "Emma Rousseau"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "emma@data-intuitive.com"
+      github: "emmarousseau"
+      linkedin: "emmarousseau1"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Input"
+  arguments:
+  - type: "file"
+    name: "--input_file"
+    alternatives:
+    - "-i"
+    description: "Input alignment file in BAM or SAM format."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--mapq"
+    alternatives:
+    - "-q"
+    description: "Minimum mapping quality (phred scaled) to determine uniquely mapped\
+      \ reads. Default: '30'.\n"
+    info: null
+    example:
+    - 30
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Output"
+  arguments:
+  - type: "file"
+    name: "--output"
+    description: "Output file (txt) with mapping quality statistics."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Generate statistics from a bam file."
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "rnaseq"
+- "genomics"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.1093/bioinformatics/bts356"
+links:
+  repository: "https://github.com/MonashBioinformaticsPlatform/RSeQC"
+  homepage: "https://rseqc.sourceforge.net/"
+  documentation: "https://rseqc.sourceforge.net/#bam-stat-py"
+  issue_tracker: "https://github.com/MonashBioinformaticsPlatform/RSeQC/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "python:3.10"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "python"
+    user: false
+    packages:
+    - "RSeQC"
+    upgrade: true
+  - type: "docker"
+    run:
+    - "echo \"RSeQC bam_stat.py: $(bam_stat.py --version | cut -d' ' -f2-)\" > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/rseqc/rseqc_bamstat/config.vsh.yaml"
+  runner: "nextflow"
+  engine: "docker|native"
+  output: "target/nextflow/rseqc/rseqc_bamstat"
+  executable: "target/nextflow/rseqc/rseqc_bamstat/main.nf"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/nextflow/rseqc/rseqc_bamstat/main.nf b/target/nextflow/rseqc/rseqc_bamstat/main.nf
new file mode 100644
index 00000000..1e545087
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_bamstat/main.nf
@@ -0,0 +1,3594 @@
+// rseqc_bamstat main
+// 
+// This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+// work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+// Intuitive.
+// 
+// The component may contain files which fall under a different license. The
+// authors of this component should specify the license in the header of such
+// files, or include a separate license file detailing the licenses of all included
+// files.
+// 
+// Component authors:
+//  * Emma Rousseau (author, maintainer)
+
+////////////////////////////
+// VDSL3 helper functions //
+////////////////////////////
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf'
+class UnexpectedArgumentTypeException extends Exception {
+  String errorIdentifier
+  String stage
+  String plainName
+  String expectedClass
+  String foundClass
+  
+  // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""}
+  UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) {
+    super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " +
+      "Expected type: ${expectedClass}. Found type: ${foundClass}")
+    this.errorIdentifier = errorIdentifier
+    this.stage = stage
+    this.plainName = plainName
+    this.expectedClass = expectedClass
+    this.foundClass = foundClass
+  }
+}
+
+/**
+  * Checks if the given value is of the expected type. If not, an exception is thrown.
+  *
+  * @param stage The stage of the argument (input or output)
+  * @param par The parameter definition
+  * @param value The value to check
+  * @param errorIdentifier The identifier to use in the error message
+  * @return The value, if it is of the expected type
+  * @throws UnexpectedArgumentTypeException If the value is not of the expected type
+*/
+def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) {
+  // expectedClass will only be != null if value is not of the expected type
+  def expectedClass = null
+  def foundClass = null
+  
+  // todo: split if need be
+  
+  if (!par.required && value == null) {
+    expectedClass = null
+  } else if (par.multiple) {
+    if (value !instanceof Collection) {
+      value = [value]
+    }
+    
+    // split strings
+    value = value.collectMany{ val ->
+      if (val instanceof String) {
+        // collect() to ensure that the result is a List and not simply an array
+        val.split(par.multiple_sep).collect()
+      } else {
+        [val]
+      }
+    }
+
+    // process globs
+    if (par.type == "file" && par.direction == "input") {
+      value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten()
+    }
+
+    // check types of elements in list
+    try {
+      value = value.collect { listVal ->
+        _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier)
+      }
+    } catch (UnexpectedArgumentTypeException e) {
+      expectedClass = "List[${e.expectedClass}]"
+      foundClass = "List[${e.foundClass}]"
+    }
+  } else if (par.type == "string") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else if (par.type == "integer") {
+    // cast to integer if need be
+    if (value instanceof String) {
+      try {
+        value = value.toInteger()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigInteger) {
+      value = value.intValue()
+    }
+    expectedClass = value instanceof Integer ? null : "Integer"
+  } else if (par.type == "long") {
+    // cast to long if need be
+    if (value instanceof String) {
+      try {
+        value = value.toLong()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof Integer) {
+      value = value.toLong()
+    }
+    expectedClass = value instanceof Long ? null : "Long"
+  } else if (par.type == "double") {
+    // cast to double if need be
+    if (value instanceof String) {
+      try {
+        value = value.toDouble()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigDecimal) {
+      value = value.doubleValue()
+    }
+    if (value instanceof Float) {
+      value = value.toDouble()
+    }
+    expectedClass = value instanceof Double ? null : "Double"
+  } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") {
+    // cast to boolean if need be
+    if (value instanceof String) {
+      def valueLower = value.toLowerCase()
+      if (valueLower == "true") {
+        value = true
+      } else if (valueLower == "false") {
+        value = false
+      }
+    }
+    expectedClass = value instanceof Boolean ? null : "Boolean"
+  } else if (par.type == "file" && (par.direction == "input" || stage == "output")) {
+    // cast to path if need be
+    if (value instanceof String) {
+      value = file(value, hidden: true)
+    }
+    if (value instanceof File) {
+      value = value.toPath()
+    }
+    expectedClass = value instanceof Path ? null : "Path"
+  } else if (par.type == "file" && stage == "input" && par.direction == "output") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else {
+    // didn't find a match for par.type
+    expectedClass = par.type
+  }
+
+  if (expectedClass != null) {
+    if (foundClass == null) {
+      foundClass = value.getClass().getName()
+    }
+    throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass)
+  }
+  
+  return value
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf'
+Map _processInputValues(Map inputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.required) {
+        assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing"
+      }
+    }
+
+    inputs = inputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument"
+
+      value = _checkArgumentType("input", par, value, "in module '$key' id '$id'")
+
+      [ name, value ]
+    }
+  }
+  return inputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf'
+Map _processOutputValues(Map outputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.direction == "output" && arg.required) {
+        assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing"
+      }
+    }
+
+    outputs = outputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && it.direction == "output" }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument"
+      
+      value = _checkArgumentType("output", par, value, "in module '$key' id '$id'")
+      
+      [ name, value ]
+    }
+  }
+  return outputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf'
+class IDChecker {
+  final def items = [] as Set
+
+  @groovy.transform.WithWriteLock
+  boolean observe(String item) {
+    if (items.contains(item)) {
+      return false
+    } else {
+      items << item
+      return true
+    }
+  }
+
+  @groovy.transform.WithReadLock
+  boolean contains(String item) {
+    return items.contains(item)
+  }
+
+  @groovy.transform.WithReadLock
+  Set getItems() {
+    return items.clone()
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf'
+
+/**
+ * Check if the ids are unique across parameter sets
+ *
+ * @param parameterSets a list of parameter sets.
+ */
+private void _checkUniqueIds(List<Tuple2<String, Map<String, Object>>> parameterSets) {
+  def ppIds = parameterSets.collect{it[0]}
+  assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds"
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf'
+
+// helper functions for reading params from file //
+def _getChild(parent, child) {
+  if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) {
+    child
+  } else {
+    def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString()
+    parentAbsolute.replaceAll('/[^/]*$', "/") + child
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf'
+/**
+  * Figure out the param list format based on the file extension
+  *
+  * @param param_list A String containing the path to the parameter list file.
+  *
+  * @return A String containing the format of the parameter list file.
+  */
+def _paramListGuessFormat(param_list) {
+  if (param_list !instanceof String) {
+    "asis"
+  } else if (param_list.endsWith(".csv")) {
+    "csv"
+  } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) {
+    "json"
+  } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) {
+    "yaml"
+  } else {
+    "yaml_blob"
+  }
+}
+
+
+/**
+  * Read the param list
+  * 
+  * @param param_list One of the following:
+  *   - A String containing the path to the parameter list file (csv, json or yaml),
+  *   - A yaml blob of a list of maps (yaml_blob),
+  *   - Or a groovy list of maps (asis).
+  * @param config A Map of the Viash configuration.
+  * 
+  * @return A List of Maps containing the parameters.
+  */
+def _parseParamList(param_list, Map config) {
+  // first determine format by extension
+  def paramListFormat = _paramListGuessFormat(param_list)
+
+  def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ?
+    file(param_list, hidden: true) :
+    null
+
+  // get the correct parser function for the detected params_list format
+  def paramSets = []
+  if (paramListFormat == "asis") {
+    paramSets = param_list
+  } else if (paramListFormat == "yaml_blob") {
+    paramSets = readYamlBlob(param_list)
+  } else if (paramListFormat == "yaml") {
+    paramSets = readYaml(paramListPath)
+  } else if (paramListFormat == "json") {
+    paramSets = readJson(paramListPath)
+  } else if (paramListFormat == "csv") {
+    paramSets = readCsv(paramListPath)
+  } else {
+    error "Format of provided --param_list not recognised.\n" +
+    "Found: '$paramListFormat'.\n" +
+    "Expected: a csv file, a json file, a yaml file,\n" +
+    "a yaml blob or a groovy list of maps."
+  }
+
+  // data checks
+  assert paramSets instanceof List: "--param_list should contain a list of maps"
+  for (value in paramSets) {
+    assert value instanceof Map: "--param_list should contain a list of maps"
+  }
+
+  // id is argument
+  def idIsArgument = config.allArguments.any{it.plainName == "id"}
+
+  // Reformat from List<Map> to List<Tuple2<String, Map>> by adding the ID as first element of a Tuple2
+  paramSets = paramSets.collect({ data ->
+    def id = data.id
+    if (!idIsArgument) {
+      data = data.findAll{k, v -> k != "id"}
+    }
+    [id, data]
+  })
+
+  // Split parameters with 'multiple: true'
+  paramSets = paramSets.collect({ id, data ->
+    data = _splitParams(data, config)
+    [id, data]
+  })
+  
+  // The paths of input files inside a param_list file may have been specified relatively to the
+  // location of the param_list file. These paths must be made absolute.
+  if (paramListPath) {
+    paramSets = paramSets.collect({ id, data ->
+      def new_data = data.collectEntries{ parName, parValue ->
+        def par = config.allArguments.find{it.plainName == parName}
+        if (par && par.type == "file" && par.direction == "input") {
+          if (parValue instanceof Collection) {
+            parValue = parValue.collectMany{path -> 
+              def x = _resolveSiblingIfNotAbsolute(path, paramListPath)
+              x instanceof Collection ? x : [x]
+            }
+          } else {
+            parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) 
+          }
+        }
+        [parName, parValue]
+      }
+      [id, new_data]
+    })
+  }
+
+  return paramSets
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf'
+/**
+ * Split parameters for arguments that accept multiple values using their separator
+ *
+ * @param paramList A Map containing parameters to split.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ *
+ * @return A Map of parameters where the parameter values have been split into a list using
+ *         their seperator.
+ */
+Map<String, Object> _splitParams(Map<String, Object> parValues, Map config){
+  def parsedParamValues = parValues.collectEntries { parName, parValue ->
+    def parameterSettings = config.allArguments.find({it.plainName == parName})
+
+    if (!parameterSettings) {
+      // if argument is not found, do not alter 
+      return [parName, parValue]
+    }
+    if (parameterSettings.multiple) { // Check if parameter can accept multiple values
+      if (parValue instanceof Collection) {
+        parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it }
+      } else if (parValue instanceof String) {
+        parValue = parValue.split(parameterSettings.multiple_sep)
+      } else if (parValue == null) {
+        parValue = []
+      } else {
+        parValue = [ parValue ]
+      }
+      parValue = parValue.flatten()
+    }
+    // For all parameters check if multiple values are only passed for
+    // arguments that allow it. Quietly simplify lists of length 1.
+    if (!parameterSettings.multiple && parValue instanceof Collection) {
+      assert parValue.size() == 1 : 
+      "Error: argument ${parName} has too many values.\n" +
+      "  Expected amount: 1. Found: ${parValue.size()}"
+      parValue = parValue[0]
+    }
+    [parName, parValue]
+  }
+  return parsedParamValues
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf'
+/**
+ * Parse nextflow parameters based on settings defined in a viash config.
+ * Return a list of parameter sets, each parameter set corresponding to 
+ * an event in a nextflow channel. The output from this function can be used
+ * with Channel.fromList to create a nextflow channel with Vdsl3 formatted 
+ * events.
+ *
+ * This function performs:
+ *   - A filtering of the params which can be found in the config file.
+ *   - Process the params_list argument which allows a user to to initialise 
+ *     a Vsdl3 channel with multiple parameter sets. Possible formats are 
+ *     csv, json, yaml, or simply a yaml_blob. A csv should have column names 
+ *     which correspond to the different arguments of this pipeline. A json or a yaml
+ *     file should be a list of maps, each of which has keys corresponding to the
+ *     arguments of the pipeline. A yaml blob can also be passed directly as a parameter.
+ *     When passing a csv, json or yaml, relative path names are relativized to the
+ *     location of the parameter file.
+ *   - Combine the parameter sets into a vdsl3 Channel.
+ *
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A list of parameters with the first element of the event being
+ *         the event ID and the second element containing a map of the parsed parameters.
+ */
+ 
+private List<Tuple2<String, Map<String, Object>>> _paramsToParamSets(Map params, Map config){
+  // todo: fetch key from run args
+  def key_ = config.name
+  
+  /* parse regular parameters (not in param_list)  */
+  /*************************************************/
+  def globalParams = config.allArguments
+    .findAll { params.containsKey(it.plainName) }
+    .collectEntries { [ it.plainName, params[it.plainName] ] }
+  def globalID = params.get("id", null)
+
+  /* process params_list arguments */
+  /*********************************/
+  def paramList = params.containsKey("param_list") && params.param_list != null ?
+    params.param_list : []
+  // if (paramList instanceof String) {
+  //   paramList = [paramList]
+  // }
+  // def paramSets = paramList.collectMany{ _parseParamList(it, config) }
+  // TODO: be able to process param_list when it is a list of strings
+  def paramSets = _parseParamList(paramList, config)
+  if (paramSets.isEmpty()) {
+    paramSets = [[null, [:]]]
+  }
+
+  /* combine arguments into channel */
+  /**********************************/
+  def processedParams = paramSets.indexed().collect{ index, tup ->
+    // Process ID
+    def id = tup[0] ?: globalID
+  
+    if (workflow.stubRun && !id) {
+      // if stub run, explicitly add an id if missing
+      id = "stub${index}"
+    }
+    assert id != null: "Each parameter set should have at least an 'id'"
+
+    // Process params
+    def parValues = globalParams + tup[1]
+    // // Remove parameters which are null, if the default is also null
+    // parValues = parValues.collectEntries{paramName, paramValue ->
+    //   parameterSettings = config.functionality.allArguments.find({it.plainName == paramName})
+    //   if ( paramValue != null || parameterSettings.get("default", null) != null ) {
+    //     [paramName, paramValue]
+    //   }
+    // }
+    parValues = parValues.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument"
+
+      if (par == null) {
+        return [:]
+      }
+      value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+
+      [ name, value ]
+    }
+
+    [id, parValues]
+  }
+
+  // Check if ids (first element of each list) is unique
+  _checkUniqueIds(processedParams)
+  return processedParams
+}
+
+/**
+ * Parse nextflow parameters based on settings defined in a viash config 
+ * and return a nextflow channel.
+ * 
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A nextflow Channel with events. Events are formatted as a tuple that contains 
+ *         first contains the ID of the event and as second element holds a parameter map.
+ *       
+ *
+ */
+def channelFromParams(Map params, Map config) {
+  def processedParams = _paramsToParamSets(params, config)
+  return Channel.fromList(processedParams)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf'
+def checkUniqueIds(Map args) {
+  def stopOnError = args.stopOnError == null ? args.stopOnError : true
+
+  def idChecker = new IDChecker()
+
+  return filter { tup ->
+    if (!idChecker.observe(tup[0])) {
+      if (stopOnError) {
+        error "Duplicate id: ${tup[0]}"
+      } else {
+        log.warn "Duplicate id: ${tup[0]}, removing duplicate entry"
+        return false
+      }
+    }
+    return true
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf'
+// This helper file will be deprecated soon
+preprocessInputsDeprecationWarningPrinted = false
+
+def preprocessInputsDeprecationWarning() {
+  if (!preprocessInputsDeprecationWarningPrinted) {
+    preprocessInputsDeprecationWarningPrinted = true
+    System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.")
+  }
+}
+
+/**
+ * Generate a nextflow Workflow that allows processing a channel of 
+ * Vdsl3 formatted events and apply a Viash config to them:
+ *    - Gather default parameters from the Viash config and make 
+ *      sure that they are correctly formatted (see applyConfig method).
+ *    - Format the input parameters (also using the applyConfig method).
+ *    - Apply the default parameter to the input parameters.
+ *    - Do some assertions:
+ *        ~ Check if the event IDs in the channel are unique.
+ * 
+ * The events in the channel are formatted as tuples, with the 
+ * first element of the tuples being a unique id of the parameter set, 
+ * and the second element containg the the parameters themselves.
+ * Optional extra elements of the tuples will be passed to the output as is.
+ *
+ * @param args A map that must contain a 'config' key that points
+ *              to a parsed config (see readConfig()). Optionally, a
+ *              'key' key can be provided which can be used to create a unique
+ *              name for the workflow process.
+ *
+ * @return A workflow that allows processing a channel of Vdsl3 formatted events
+ * and apply a Viash config to them.
+ */
+def preprocessInputs(Map args) {
+  preprocessInputsDeprecationWarning()
+
+  def config = args.config
+  assert config instanceof Map : 
+    "Error in preprocessInputs: config must be a map. " +
+    "Expected class: Map. Found: config.getClass() is ${config.getClass()}"
+  def key_ = args.key ?: config.name
+
+  // Get different parameter types (used throughout this function)
+  def defaultArgs = config.allArguments
+    .findAll { it.containsKey("default") }
+    .collectEntries { [ it.plainName, it.default ] }
+
+  map { tup ->
+    def id = tup[0]
+    def data = tup[1]
+    def passthrough = tup.drop(2)
+
+    def new_data = (defaultArgs + data).collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      
+      if (par != null) {
+        value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+      }
+
+      [ name, value ]
+    }
+
+    [ id, new_data ] + passthrough
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component config.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component config.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runComponents(Map args) {
+  log.warn("runComponents is deprecated, use runEach instead")
+  assert args.components: "runComponents should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runComponents"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def id_ = args.id
+
+  workflow runComponentsWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def comp_config = comp_.config
+
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_config)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          // def new_id = id_(tup[0], tup[1], comp_config)
+          def new_id = tup[0]
+          if (id_ instanceof String) {
+            new_id = id_
+          } else if (id_ instanceof Closure) {
+            new_id = id_(new_id, tup[1], comp_config)
+          }
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def data_ch = id_ch | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_config)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_config)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+      
+      post_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runComponentsWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component itself.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component itself.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runEach(Map args) {
+  assert args.components: "runEach should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runEach"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def runIf_ = args.runIf
+  def id_ = args.id
+
+  assert !runIf_ || runIf_ instanceof Closure: "runEach: must pass a Closure to runIf."
+
+  workflow runEachWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          def new_id = id_
+          if (new_id instanceof Closure) {
+            new_id = new_id(tup[0], tup[1], comp_)
+          }
+          assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}"
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def chPassthrough = null
+      def chRun = null
+      if (runIf_) {
+        def idRunIfBranch = id_ch.branch{ tup ->
+          run: runIf_(tup[0], tup[1], comp_)
+          passthrough: true
+        }
+        chPassthrough = idRunIfBranch.passthrough
+        chRun = idRunIfBranch.run
+      } else {
+        chRun = id_ch
+        chPassthrough = Channel.empty()
+      }
+      def data_ch = chRun | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+
+      def return_ch = post_ch
+        | concat(chPassthrough)
+      
+      return_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runEachWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf'
+/**
+ * Join sourceChannel to targetChannel
+ * 
+ * This function joins the sourceChannel to the targetChannel. 
+ * However, each id in the targetChannel must be present in the
+ * sourceChannel. If _meta.join_id exists in the targetChannel, that is 
+ * used as an id instead. If the id doesn't match any id in the sourceChannel,
+ * an error is thrown.
+ */
+
+def safeJoin(targetChannel, sourceChannel, key) {
+  def sourceIDs = new IDChecker()
+
+  def sourceCheck = sourceChannel
+    | map { tup ->
+      sourceIDs.observe(tup[0])
+      tup
+    }
+  def targetCheck = targetChannel
+    | map { tup ->
+      def id = tup[0]
+      
+      if (!sourceIDs.contains(id)) {
+        error (
+          "Error in module '${key}' when merging output with original state.\n" +
+          "  Reason: output with id '${id}' could not be joined with source channel.\n" +
+          "    If the IDs in the output channel differ from the input channel,\n" + 
+          "    please set `tup[1]._meta.join_id to the original ID.\n" +
+          "  Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + 
+          "  Unexpected ID in the output channel: '${id}'.\n" +
+          "  Example input event: [\"id\", [input: file(...)]],\n" +
+          "  Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]"
+        )
+      }
+      // TODO: add link to our documentation on how to fix this
+
+      tup
+    }
+  
+  sourceCheck.cross(targetChannel)
+    | map{ left, right ->
+      right + left.drop(1)
+    }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf'
+def _processArgument(arg) {
+  arg.multiple = arg.multiple != null ? arg.multiple : false
+  arg.required = arg.required != null ? arg.required : false
+  arg.direction = arg.direction != null ? arg.direction : "input"
+  arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";"
+  arg.plainName = arg.name.replaceAll("^-*", "")
+
+  if (arg.type == "file") {
+    arg.must_exist = arg.must_exist != null ? arg.must_exist : true
+    arg.create_parent = arg.create_parent != null ? arg.create_parent : true
+  }
+
+  // add default values to output files which haven't already got a default
+  if (arg.type == "file" && arg.direction == "output" && arg.default == null) {
+    def mult = arg.multiple ? "_*" : ""
+    def extSearch = ""
+    if (arg.default != null) {
+      extSearch = arg.default
+    } else if (arg.example != null) {
+      extSearch = arg.example
+    }
+    if (extSearch instanceof List) {
+      extSearch = extSearch[0]
+    }
+    def extSearchResult = extSearch.find("\\.[^\\.]+\$")
+    def ext = extSearchResult != null ? extSearchResult : ""
+    arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}"
+    if (arg.multiple) {
+      arg.default = [arg.default]
+    }
+  }
+
+  if (!arg.multiple) {
+    if (arg.default != null && arg.default instanceof List) {
+      arg.default = arg.default[0]
+    }
+    if (arg.example != null && arg.example instanceof List) {
+      arg.example = arg.example[0]
+    }
+  }
+
+  if (arg.type == "boolean_true") {
+    arg.default = false
+  }
+  if (arg.type == "boolean_false") {
+    arg.default = true
+  }
+
+  arg
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf'
+def addGlobalArguments(config) {
+  def localConfig = [
+    "argument_groups": [
+      [
+        "name": "Nextflow input-output arguments",
+        "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+        "arguments" : [
+          [
+            'name': '--publish_dir',
+            'required': true,
+            'type': 'string',
+            'description': 'Path to an output directory.',
+            'example': 'output/',
+            'multiple': false
+          ],
+          [
+            'name': '--param_list',
+            'required': false,
+            'type': 'string',
+            'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.
+            |
+            |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`.
+            |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.
+            |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`.
+            |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`.
+            |
+            |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(),
+            'example': 'my_params.yaml',
+            'multiple': false,
+            'hidden': true
+          ]
+          // TODO: allow multiple: true in param_list?
+          // TODO: allow to specify a --param_list_regex to filter the param_list?
+          // TODO: allow to specify a --param_list_from_state to remap entries in the param_list?
+        ]
+      ]
+    ]
+  ]
+
+  return processConfig(_mergeMap(config, localConfig))
+}
+
+def _mergeMap(Map lhs, Map rhs) {
+  return rhs.inject(lhs.clone()) { map, entry ->
+    if (map[entry.key] instanceof Map && entry.value instanceof Map) {
+      map[entry.key] = _mergeMap(map[entry.key], entry.value)
+    } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) {
+      map[entry.key] += entry.value
+    } else {
+      map[entry.key] = entry.value
+    }
+    return map
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf'
+def _generateArgumentHelp(param) {
+  // alternatives are not supported
+  // def names = param.alternatives ::: List(param.name)
+
+  def unnamedProps = [
+    ["required parameter", param.required],
+    ["multiple values allowed", param.multiple],
+    ["output", param.direction.toLowerCase() == "output"],
+    ["file must exist", param.type == "file" && param.must_exist]
+  ].findAll{it[1]}.collect{it[0]}
+  
+  def dflt = null
+  if (param.default != null) {
+    if (param.default instanceof List) {
+      dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      dflt = param.default.toString()
+    }
+  }
+  def example = null
+  if (param.example != null) {
+    if (param.example instanceof List) {
+      example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      example = param.example.toString()
+    }
+  }
+  def min = param.min?.toString()
+  def max = param.max?.toString()
+
+  def escapeChoice = { choice ->
+    def s1 = choice.replaceAll("\\n", "\\\\n")
+    def s2 = s1.replaceAll("\"", """\\\"""")
+    s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2
+  }
+  def choices = param.choices == null ? 
+    null : 
+    "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]"
+
+  def namedPropsStr = [
+    ["type", ([param.type] + unnamedProps).join(", ")],
+    ["default", dflt],
+    ["example", example],
+    ["choices", choices],
+    ["min", min],
+    ["max", max]
+  ]
+    .findAll{it[1]}
+    .collect{"\n        " + it[0] + ": " + it[1].replaceAll("\n", "\\n")}
+    .join("")
+  
+  def descStr = param.description == null ?
+    "" :
+    _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n        ")
+  
+  "\n    --" + param.plainName +
+    namedPropsStr +
+    descStr
+}
+
+// Based on Helper.generateHelp() in Helper.scala
+def _generateHelp(config) {
+  def fun = config
+
+  // PART 1: NAME AND VERSION
+  def nameStr = fun.name + 
+    (fun.version == null ? "" : " " + fun.version)
+
+  // PART 2: DESCRIPTION
+  def descrStr = fun.description == null ? 
+    "" :
+    "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n")
+
+  // PART 3: Usage
+  def usageStr = fun.usage == null ? 
+    "" :
+    "\n\nUsage:\n" + fun.usage.trim()
+
+  // PART 4: Options
+  def argGroupStrs = fun.allArgumentGroups.collect{argGroup ->
+    def name = argGroup.name
+    def descriptionStr = argGroup.description == null ?
+      "" :
+      "\n    " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n    ") + "\n"
+    def arguments = argGroup.arguments.collect{arg -> 
+      arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg
+    }.findAll{it != null}
+    def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)}
+    
+    "\n\n$name:" +
+      descriptionStr +
+      argumentStrs.join("\n")
+  }
+
+  // FINAL: combine
+  def out = nameStr + 
+    descrStr +
+    usageStr + 
+    argGroupStrs.join("")
+
+  return out
+}
+
+// based on Format._paragraphWrap
+def _paragraphWrap(str, maxLength) {
+  def outLines = []
+  str.split("\n").each{par ->
+    def words = par.split("\\s").toList()
+
+    def word = null
+    def line = words.pop()
+    while(!words.isEmpty()) {
+      word = words.pop()
+      if (line.length() + word.length() + 1 <= maxLength) {
+        line = line + " " + word
+      } else {
+        outLines.add(line)
+        line = word
+      }
+    }
+    if (words.isEmpty()) {
+      outLines.add(line)
+    }
+  }
+  return outLines
+}
+
+def helpMessage(config) {
+  if (params.containsKey("help") && params.help) {
+    def mergedConfig = addGlobalArguments(config)
+    def helpStr = _generateHelp(mergedConfig)
+    println(helpStr)
+    exit 0
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf'
+def processConfig(config) {
+  // set defaults for arguments
+  config.arguments = 
+    (config.arguments ?: []).collect{_processArgument(it)}
+
+  // set defaults for argument_group arguments
+  config.argument_groups =
+    (config.argument_groups ?: []).collect{grp ->
+      grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)}
+      grp
+    }
+
+  // create combined arguments list
+  config.allArguments = 
+    config.arguments +
+    config.argument_groups.collectMany{it.arguments}
+
+  // add missing argument groups (based on Functionality::allArgumentGroups())
+  def argGroups = config.argument_groups
+  if (argGroups.any{it.name.toLowerCase() == "arguments"}) {
+    argGroups = argGroups.collect{ grp ->
+      if (grp.name.toLowerCase() == "arguments") {
+        grp = grp + [
+          arguments: grp.arguments + config.arguments
+        ]
+      }
+      grp
+    }
+  } else {
+    argGroups = argGroups + [
+      name: "Arguments",
+      arguments: config.arguments
+    ]
+  }
+  config.allArgumentGroups = argGroups
+
+  config
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf'
+
+def readConfig(file) {
+  def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml"))
+  processConfig(config)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf'
+/**
+  * Resolve a path relative to the current file.
+  * 
+  * @param str The path to resolve, as a String.
+  * @param parentPath The path to resolve relative to, as a Path.
+  *
+  * @return The path that may have been resovled, as a Path.
+  */
+def _resolveSiblingIfNotAbsolute(str, parentPath) {
+  if (str !instanceof String) {
+    return str
+  }
+  if (!_stringIsAbsolutePath(str)) {
+    return parentPath.resolveSibling(str)
+  } else {
+    return file(str, hidden: true)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf'
+/**
+  * Check whether a path as a string is absolute.
+  *
+  * In the past, we tried using `file(., relative: true).isAbsolute()`,
+  * but the 'relative' option was added in 22.10.0.
+  *
+  * @param path The path to check, as a String.
+  *
+  * @return Whether the path is absolute, as a boolean.
+  */
+def _stringIsAbsolutePath(path) {
+  def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/
+
+  assert path instanceof String
+  return _resolve_URL_PROTOCOL.matcher(path).matches()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf'
+class CustomTraceObserver implements nextflow.trace.TraceObserver {
+  List traces
+
+  CustomTraceObserver(List traces) {
+    this.traces = traces
+  }
+
+  @Override
+  void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+
+  @Override
+  void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+}
+
+def collectTraces() {
+  def traces = Collections.synchronizedList([])
+
+  // add custom trace observer which stores traces in the traces object
+  session.observers.add(new CustomTraceObserver(traces))
+
+  traces
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf'
+/**
+  * Performs a deep clone of the given object.
+  * @param x an object
+  */
+def deepClone(x) {
+  iterateMap(x, {it instanceof Cloneable ? it.clone() : it})
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf'
+def getPublishDir() {
+  return params.containsKey("publish_dir") ? params.publish_dir : 
+    params.containsKey("publishDir") ? params.publishDir : 
+    null
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf'
+
+// Recurse upwards until we find a '.build.yaml' file
+def _findBuildYamlFile(pathPossiblySymlink) {
+  def path = pathPossiblySymlink.toRealPath()
+  def child = path.resolve(".build.yaml")
+  if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) {
+    return child
+  } else {
+    def parent = path.getParent()
+    if (parent == null) {
+      return null
+    } else {
+      return _findBuildYamlFile(parent)
+    }
+  }
+}
+
+// get the root of the target folder
+def getRootDir() {
+  def dir = _findBuildYamlFile(meta.resources_dir)
+  assert dir != null: "Could not find .build.yaml in the folder structure"
+  dir.getParent()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf'
+/**
+  * Recursively apply a function over the leaves of an object.
+  * @param obj The object to iterate over.
+  * @param fun The function to apply to each value.
+  * @return The object with the function applied to each value.
+  */
+def iterateMap(obj, fun) {
+  if (obj instanceof List && obj !instanceof String) {
+    return obj.collect{item ->
+      iterateMap(item, fun)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectEntries{key, item ->
+      [key.toString(), iterateMap(item, fun)]
+    }
+  } else {
+    return fun(obj)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf'
+/**
+  * A view for printing the event of each channel as a YAML blob.
+  * This is useful for debugging.
+  */
+def niceView() {
+  workflow niceViewWf {
+    take: input
+    main:
+      output = input
+        | view{toYamlBlob(it)}
+    emit: output
+  }
+  return niceViewWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf'
+
+def readCsv(file_path) {
+  def output = []
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+
+  // todo: allow escaped quotes in string
+  // todo: allow single quotes?
+  def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''')
+  def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''')
+
+  def br = java.nio.file.Files.newBufferedReader(inputFile)
+
+  def row = -1
+  def header = null
+  while (br.ready() && header == null) {
+    def line = br.readLine()
+    row++
+    if (!line.startsWith("#")) {
+      header = splitRegex.split(line, -1).collect{field ->
+        m = removeQuote.matcher(field)
+        m.find() ? m.replaceFirst('$1') : field
+      }
+    }
+  }
+  assert header != null: "CSV file should contain a header"
+
+  while (br.ready()) {
+    def line = br.readLine()
+    row++
+    if (line == null) {
+      br.close()
+      break
+    }
+
+    if (!line.startsWith("#")) {
+      def predata = splitRegex.split(line, -1)
+      def data = predata.collect{field ->
+        if (field == "") {
+          return null
+        }
+        def m = removeQuote.matcher(field)
+        if (m.find()) {
+          return m.replaceFirst('$1')
+        } else {
+          return field
+        }
+      }
+      assert header.size() == data.size(): "Row $row should contain the same number as fields as the header"
+      
+      def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null}
+      output.add(dataMap)
+    }
+  }
+
+  output
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf'
+def readJson(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parse(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf'
+def readJsonBlob(str) {
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parseText(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf'
+// Custom constructor to modify how certain objects are parsed from YAML
+class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor {
+  Path root
+
+  class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct {
+    public Object construct(org.yaml.snakeyaml.nodes.Node node) {
+      String filename = (String) constructScalar(node);
+      if (root != null) {
+        return root.resolve(filename);
+      }
+      return java.nio.file.Paths.get(filename);
+    }
+  }
+
+  CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) {
+    super(options)
+    this.root = root
+    // Handling !file tag and parse it back to a File type
+    this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath())
+  }
+}
+
+def readTaggedYaml(Path path) {
+  def options = new org.yaml.snakeyaml.LoaderOptions()
+  def constructor = new CustomConstructor(options, path.getParent())
+  def yaml = new org.yaml.snakeyaml.Yaml(constructor)
+  return yaml.load(path.text)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf'
+def readYaml(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf'
+def readYamlBlob(str) {
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf'
+String toJsonBlob(data) {
+  return groovy.json.JsonOutput.toJson(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf'
+// Custom representer to modify how certain objects are represented in YAML
+class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer {
+  Path relativizer
+
+  class RepresentPath implements org.yaml.snakeyaml.representer.Represent {
+    public String getFileName(Object obj) {
+      if (obj instanceof File) {
+        obj = ((File) obj).toPath();
+      }
+      if (obj !instanceof Path) {
+        throw new IllegalArgumentException("Object: " + obj + " is not a Path or File");
+      }
+      def path = (Path) obj;
+
+      if (relativizer != null) {
+        return relativizer.relativize(path).toString()
+      } else {
+        return path.toString()
+      }
+    }
+
+    public org.yaml.snakeyaml.nodes.Node representData(Object data) {
+      String filename = getFileName(data);
+      def tag = new org.yaml.snakeyaml.nodes.Tag("!file");
+      return representScalar(tag, filename);
+    }
+  }
+  CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) {
+    super(options)
+    this.relativizer = relativizer
+    this.representers.put(sun.nio.fs.UnixPath, new RepresentPath())
+    this.representers.put(Path, new RepresentPath())
+    this.representers.put(File, new RepresentPath())
+  }
+}
+
+String toTaggedYamlBlob(data) {
+  return toRelativeTaggedYamlBlob(data, null)
+}
+String toRelativeTaggedYamlBlob(data, Path relativizer) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  def representer = new CustomRepresenter(options, relativizer)
+  def yaml = new org.yaml.snakeyaml.Yaml(representer, options)
+  return yaml.dump(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf'
+String toYamlBlob(data) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  options.setPrettyFlow(true)
+  def yaml = new org.yaml.snakeyaml.Yaml(options)
+  def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it })
+  return yaml.dump(cleanData)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf'
+void writeJson(data, file) {
+  assert data: "writeJson: data should not be null"
+  assert file: "writeJson: file should not be null"
+  file.write(toJsonBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf'
+void writeYaml(data, file) {
+  assert data: "writeYaml: data should not be null"
+  assert file: "writeYaml: file should not be null"
+  file.write(toYamlBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf'
+def findStates(Map params, Map config) {
+  def auto_config = deepClone(config)
+  def auto_params = deepClone(params)
+
+  auto_config = auto_config.clone()
+  // override arguments
+  auto_config.argument_groups = []
+  auto_config.arguments = [
+    [
+      type: "string",
+      name: "--id",
+      description: "A dummy identifier",
+      required: false
+    ],
+    [
+      type: "file",
+      name: "--input_states",
+      example: "/path/to/input/directory/**/state.yaml",
+      description: "Path to input directory containing the datasets to be integrated.",
+      required: true,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--filter",
+      example: "foo/.*/state.yaml",
+      description: "Regex to filter state files by path.",
+      required: false
+    ],
+    // to do: make this a yaml blob?
+    [
+      type: "string",
+      name: "--rename_keys",
+      example: ["newKey1:oldKey1", "newKey2:oldKey2"],
+      description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.",
+      required: false,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--settings",
+      example: '{"output_dataset": "dataset.h5ad", "k": 10}',
+      description: "Global arguments as a JSON glob to be passed to all components.",
+      required: false
+    ]
+  ]
+  if (!(auto_params.containsKey("id"))) {
+    auto_params["id"] = "auto"
+  }
+
+  // run auto config through processConfig once more
+  auto_config = processConfig(auto_config)
+
+  workflow findStatesWf {
+    helpMessage(auto_config)
+
+    output_ch = 
+      channelFromParams(auto_params, auto_config)
+        | flatMap { autoId, args ->
+
+          def globalSettings = args.settings ? readYamlBlob(args.settings) : [:]
+
+          // look for state files in input dir
+          def stateFiles = args.input_states
+
+          // filter state files by regex
+          if (args.filter) {
+            stateFiles = stateFiles.findAll{ stateFile ->
+              def stateFileStr = stateFile.toString()
+              def matcher = stateFileStr =~ args.filter
+              matcher.matches()}
+          }
+
+          // read in states
+          def states = stateFiles.collect { stateFile ->
+            def state_ = readTaggedYaml(stateFile)
+            [state_.id, state_]
+          }
+
+          // construct renameMap
+          if (args.rename_keys) {
+            def renameMap = args.rename_keys.collectEntries{renameString ->
+              def split = renameString.split(":")
+              assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey', or 'newKey:oldKey;newKey:oldKey' in case of multiple values"
+              split
+            }
+
+            // rename keys in state, only let states through which have all keys
+            // also add global settings
+            states = states.collectMany{id, state ->
+              def newState = [:]
+
+              for (key in renameMap.keySet()) {
+                def origKey = renameMap[key]
+                if (!(state.containsKey(origKey))) {
+                  return []
+                }
+                newState[key] = state[origKey]
+              }
+
+              [[id, globalSettings + newState]]
+            }
+          }
+
+          states
+        }
+    emit:
+    output_ch
+  }
+
+  return findStatesWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf'
+def joinStates(Closure apply_) {
+  workflow joinStatesWf {
+    take: input_ch
+    main:
+    output_ch = input_ch
+      | toSortedList
+      | filter{ it.size() > 0 }
+      | map{ tups ->
+        def ids = tups.collect{it[0]}
+        def states = tups.collect{it[1]}
+        apply_(ids, states)
+      }
+
+    emit: output_ch
+  }
+  return joinStatesWf
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf'
+def collectFiles(obj) {
+  if (obj instanceof java.io.File || obj instanceof Path)  {
+    return [obj]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.collectMany{item ->
+      collectFiles(item)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectFiles(item)
+    }
+  } else {
+    return []
+  }
+}
+
+/**
+ * Recurse through a state and collect all input files and their target output filenames.
+ * @param obj The state to recurse through.
+ * @param prefix The prefix to prepend to the output filenames.
+ */
+def collectInputOutputPaths(obj, prefix) {
+  if (obj instanceof File || obj instanceof Path)  {
+    def path = obj instanceof Path ? obj : obj.toPath()
+    def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: ""
+    def newFilename = prefix + ext
+    return [[obj, newFilename]]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.withIndex().collectMany{item, ix ->
+      collectInputOutputPaths(item, prefix + "_" + ix)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectInputOutputPaths(item, prefix + "." + key)
+    }
+  } else {
+    return []
+  }
+}
+
+def publishStates(Map args) {
+  def key_ = args.get("key")
+  def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml'))
+
+  assert key_ != null : "publishStates: key must be specified"
+  
+  workflow publishStatesWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1]
+
+          // the input files and the target output filenames
+          def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose()
+          def inputFiles_ = inputoutputFilenames_[0]
+          def outputFilenames_ = inputoutputFilenames_[1]
+
+          def yamlFilename = yamlTemplate_
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+
+            // TODO: do the pathnames in state_ match up with the outputFilenames_?
+
+          // convert state to yaml blob
+          def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename))
+
+          [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesWf
+}
+process publishStatesProc {
+  // todo: check publishpath?
+  publishDir path: "${getPublishDir()}/", mode: "copy"
+  tag "$id"
+  input:
+    tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles)
+  output:
+    tuple val(id), path{[yamlFile] + outputFiles}
+  script:
+  def copyCommands = [
+    inputFiles instanceof List ? inputFiles : [inputFiles],
+    outputFiles instanceof List ? outputFiles : [outputFiles]
+  ]
+    .transpose()
+    .collectMany{infile, outfile ->
+      if (infile.toString() != outfile.toString()) {
+        [
+          "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"",
+          "cp -r '${infile.toString()}' '${outfile.toString()}'"
+        ]
+      } else {
+        // no need to copy if infile is the same as outfile
+        []
+      }
+    }
+  """
+mkdir -p "\$(dirname '${yamlFile}')"
+echo "Storing state as yaml"
+echo '${yamlBlob}' > '${yamlFile}'
+echo "Copying output files to destination folder"
+${copyCommands.join("\n  ")}
+"""
+}
+
+
+// this assumes that the state contains no other values other than those specified in the config
+def publishStatesByConfig(Map args) {
+  def config = args.get("config")
+  assert config != null : "publishStatesByConfig: config must be specified"
+
+  def key_ = args.get("key", config.name)
+  assert key_ != null : "publishStatesByConfig: key must be specified"
+  
+  workflow publishStatesSimpleWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10]
+          def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad']
+
+          // TODO: allow overriding the state.yaml template
+          // TODO TODO: if auto.publish == "state", add output_state as an argument
+          def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml'
+          def yamlFilename = yamlTemplate
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+          def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent()
+
+          // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where
+          //   - key is a String
+          //   - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path)
+          //   - inputPath is a List[Path]
+          //   - outputFilename is a List[String]
+          //   - (key, value) are the tuples that will be saved to the state.yaml file
+          //   - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml)
+          def processedState =
+            config.allArguments
+              .findAll { it.direction == "output" }
+              .collectMany { par ->
+                def plainName_ = par.plainName
+                // if the state does not contain the key, it's an
+                // optional argument for which the component did 
+                // not generate any output
+                if (!state_.containsKey(plainName_)) {
+                  return []
+                }
+                def value = state_[plainName_]
+                // if the parameter is not a file, it should be stored
+                // in the state as-is, but is not something that needs 
+                // to be copied from the source path to the dest path
+                if (par.type != "file") {
+                  return [[key: plainName_, value: value, inputPath: [], outputFilename: []]]
+                }
+                // if the orig state does not contain this filename,
+                // it's an optional argument for which the user specified
+                // that it should not be returned as a state
+                if (!origState_.containsKey(plainName_)) {
+                  return []
+                }
+                def filenameTemplate = origState_[plainName_]
+                // if the pararameter is multiple: true, fetch the template
+                if (par.multiple && filenameTemplate instanceof List) {
+                  filenameTemplate = filenameTemplate[0]
+                }
+                // instantiate the template
+                def filename = filenameTemplate
+                  .replaceAll('\\$id', id_)
+                  .replaceAll('\\$\\{id\\}', id_)
+                  .replaceAll('\\$key', key_)
+                  .replaceAll('\\$\\{key\\}', key_)
+                if (par.multiple) {
+                  // if the parameter is multiple: true, the filename
+                  // should contain a wildcard '*' that is replaced with
+                  // the index of the file
+                  assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}"
+                  def outputPerFile = value.withIndex().collect{ val, ix ->
+                    def filename_ix = filename.replace("*", ix.toString())
+                    def value_ = java.nio.file.Paths.get(filename_ix)
+                    // if id contains a slash
+                    if (yamlDir != null) {
+                      value_ = yamlDir.relativize(value_)
+                    }
+                    def inputPath = val instanceof File ? val.toPath() : val
+                    [value: value_, inputPath: inputPath, outputFilename: filename_ix]
+                  }
+                  def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> 
+                    [key, outputPerFile.collect{dic -> dic[key]}]
+                  }
+                  return [[key: plainName_] + transposedOutputs]
+                } else {
+                  def value_ = java.nio.file.Paths.get(filename)
+                  // if id contains a slash
+                  if (yamlDir != null) {
+                    value_ = yamlDir.relativize(value_)
+                  }
+                  def inputPath = value instanceof File ? value.toPath() : value
+                  return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]]
+                }
+              }
+          
+          def updatedState_ = processedState.collectEntries{[it.key, it.value]}
+          def inputPaths = processedState.collectMany{it.inputPath}
+          def outputFilenames = processedState.collectMany{it.outputFilename}
+          
+          // convert state to yaml blob
+          def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_)
+
+          [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesSimpleWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf'
+def setState(fun) {
+  assert fun instanceof Closure || fun instanceof Map || fun instanceof List :
+    "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}"
+
+  // if fun is a List, convert to map
+  if (fun instanceof List) {
+    // check whether fun is a list[string]
+    assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings"
+    fun = fun.collectEntries{[it, it]}
+  }
+
+  // if fun is a map, convert to closure
+  if (fun instanceof Map) {
+    // check whether fun is a map[string, string]
+    assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings"
+    assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings"
+    def funMap = fun.clone()
+    // turn the map into a closure to be used later on
+    fun = { id_, state_ ->
+      assert state_ instanceof Map : "Error in setState: the state is not a Map"
+      funMap.collectMany{newkey, origkey ->
+        if (state_.containsKey(origkey)) {
+          [[newkey, state_[origkey]]]
+        } else {
+          []
+        }
+      }.collectEntries()
+    }
+  }
+
+  map { tup ->
+    def id = tup[0]
+    def state = tup[1]
+    def unfilteredState = fun(id, state)
+    def newState = unfilteredState.findAll{key, val -> val != null}
+    [id, newState] + tup.drop(2)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf'
+// TODO: unit test processAuto
+def processAuto(Map auto) {
+  // remove null values
+  auto = auto.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"]
+  def unexpectedKeys = auto.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'"
+
+  // check auto.simplifyInput
+  assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean"
+
+  // check auto.simplifyOutput
+  assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean"
+
+  // check auto.transcript
+  assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean"
+
+  // check auto.publish
+  assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'"
+
+  return auto.subMap(expectedKeys)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf'
+def assertMapKeys(map, expectedKeys, requiredKeys, mapName) {
+  assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}"
+  map.forEach { key, val -> 
+    assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+  requiredKeys.forEach { requiredKey -> 
+    assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+}
+
+// TODO: unit test processDirectives
+def processDirectives(Map drctv) {
+  // remove null values
+  drctv = drctv.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = [
+    "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time"
+  ]
+  def unexpectedKeys = drctv.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'"
+
+  /* DIRECTIVE accelerator
+    accepted examples:
+    - [ limit: 4, type: "nvidia-tesla-k80" ]
+  */
+  if (drctv.containsKey("accelerator")) {
+    assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator")
+  }
+
+  /* DIRECTIVE afterScript
+    accepted examples:
+    - "source /cluster/bin/cleanup"
+  */
+  if (drctv.containsKey("afterScript")) {
+    assert drctv["afterScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE beforeScript
+    accepted examples:
+    - "source /cluster/bin/setup"
+  */
+  if (drctv.containsKey("beforeScript")) {
+    assert drctv["beforeScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cache
+    accepted examples:
+    - true
+    - false
+    - "deep"
+    - "lenient"
+  */
+  if (drctv.containsKey("cache")) {
+    assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean
+    if (drctv["cache"] instanceof CharSequence) {
+      assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache"
+    }
+  }
+
+  /* DIRECTIVE conda
+    accepted examples:
+    - "bwa=0.7.15"
+    - "bwa=0.7.15 fastqc=0.11.5"
+    - ["bwa=0.7.15", "fastqc=0.11.5"]
+  */
+  if (drctv.containsKey("conda")) {
+    if (drctv["conda"] instanceof List) {
+      drctv["conda"] = drctv["conda"].join(" ")
+    }
+    assert drctv["conda"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE container
+    accepted examples:
+    - "foo/bar:tag"
+    - [ registry: "reg", image: "im", tag: "ta" ]
+      is transformed to "reg/im:ta"
+    - [ image: "im" ] 
+      is transformed to "im:latest"
+  */
+  if (drctv.containsKey("container")) {
+    assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence
+    if (drctv["container"] instanceof Map) {
+      def m = drctv["container"]
+      assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container")
+      def part1 = 
+        System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : 
+        params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove?
+        m.registry ? m.registry + "/" : 
+        ""
+      def part2 = m.image
+      def part3 = m.tag ? ":" + m.tag : ":latest"
+      drctv["container"] = part1 + part2 + part3
+    }
+  }
+
+  /* DIRECTIVE containerOptions
+    accepted examples:
+    - "--foo bar"
+    - ["--foo bar", "-f b"]
+  */
+  if (drctv.containsKey("containerOptions")) {
+    if (drctv["containerOptions"] instanceof List) {
+      drctv["containerOptions"] = drctv["containerOptions"].join(" ")
+    }
+    assert drctv["containerOptions"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cpus
+    accepted examples:
+    - 1
+    - 10
+  */
+  if (drctv.containsKey("cpus")) {
+    assert drctv["cpus"] instanceof Integer
+  }
+
+  /* DIRECTIVE disk
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("disk")) {
+    assert drctv["disk"] instanceof CharSequence
+    // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE echo
+    accepted examples:
+    - true
+    - false
+  */
+  if (drctv.containsKey("echo")) {
+    assert drctv["echo"] instanceof Boolean
+  }
+
+  /* DIRECTIVE errorStrategy
+    accepted examples:
+    - "terminate"
+    - "finish"
+  */
+  if (drctv.containsKey("errorStrategy")) {
+    assert drctv["errorStrategy"] instanceof CharSequence
+    assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy"
+  }
+
+  /* DIRECTIVE executor
+    accepted examples:
+    - "local"
+    - "sge"
+  */
+  if (drctv.containsKey("executor")) {
+    assert drctv["executor"] instanceof CharSequence
+    assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor"
+  }
+
+  /* DIRECTIVE machineType
+    accepted examples:
+    - "n1-highmem-8"
+  */
+  if (drctv.containsKey("machineType")) {
+    assert drctv["machineType"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE maxErrors
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxErrors")) {
+    assert drctv["maxErrors"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxForks
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxForks")) {
+    assert drctv["maxForks"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxRetries
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxRetries")) {
+    assert drctv["maxRetries"] instanceof Integer
+  }
+
+  /* DIRECTIVE memory
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("memory")) {
+    assert drctv["memory"] instanceof CharSequence
+    // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE module
+    accepted examples:
+    - "ncbi-blast/2.2.27"
+    - "ncbi-blast/2.2.27:t_coffee/10.0"
+    - ["ncbi-blast/2.2.27", "t_coffee/10.0"]
+  */
+  if (drctv.containsKey("module")) {
+    if (drctv["module"] instanceof List) {
+      drctv["module"] = drctv["module"].join(":")
+    }
+    assert drctv["module"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE penv
+    accepted examples:
+    - "smp"
+  */
+  if (drctv.containsKey("penv")) {
+    assert drctv["penv"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE pod
+    accepted examples:
+    - [ label: "key", value: "val" ]
+    - [ annotation: "key", value: "val" ]
+    - [ env: "key", value: "val" ]
+    - [ [label: "l", value: "v"], [env: "e", value: "v"]]
+  */
+  if (drctv.containsKey("pod")) {
+    if (drctv["pod"] instanceof Map) {
+      drctv["pod"] = [ drctv["pod"] ]
+    }
+    assert drctv["pod"] instanceof List
+    drctv["pod"].forEach { pod ->
+      assert pod instanceof Map
+      // TODO: should more checks be added?
+      // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod
+      // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...?
+    }
+  }
+
+  /* DIRECTIVE publishDir
+    accepted examples:
+    - []
+    - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ]
+    - "/path/to/dir" 
+      is transformed to [[ path: "/path/to/dir" ]]
+    - [ path: "/path/to/dir", mode: "cache" ]
+      is transformed to [[ path: "/path/to/dir", mode: "cache" ]]
+  */
+  // TODO: should we also look at params["publishDir"]?
+  if (drctv.containsKey("publishDir")) {
+    def pblsh = drctv["publishDir"]
+    
+    // check different options
+    assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence
+    
+    // turn into list if not already so
+    // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work.
+    pblsh = pblsh instanceof List ? pblsh : [ pblsh ]
+
+    // check elements of publishDir
+    pblsh = pblsh.collect{ elem ->
+      // turn into map if not already so
+      elem = elem instanceof CharSequence ? [ path: elem ] : elem
+
+      // check types and keys
+      assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}"
+      assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir")
+
+      // check elements in map
+      assert elem.containsKey("path")
+      assert elem["path"] instanceof CharSequence
+      if (elem.containsKey("mode")) {
+        assert elem["mode"] instanceof CharSequence
+        assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ]
+      }
+      if (elem.containsKey("overwrite")) {
+        assert elem["overwrite"] instanceof Boolean
+      }
+      if (elem.containsKey("pattern")) {
+        assert elem["pattern"] instanceof CharSequence
+      }
+      if (elem.containsKey("saveAs")) {
+        assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'"
+      }
+      if (elem.containsKey("enabled")) {
+        assert elem["enabled"] instanceof Boolean
+      }
+
+      // return final result
+      elem
+    }
+    // store final directive
+    drctv["publishDir"] = pblsh
+  }
+
+  /* DIRECTIVE queue
+    accepted examples:
+    - "long"
+    - "short,long"
+    - ["short", "long"]
+  */
+  if (drctv.containsKey("queue")) {
+    if (drctv["queue"] instanceof List) {
+      drctv["queue"] = drctv["queue"].join(",")
+    }
+    assert drctv["queue"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE label
+    accepted examples:
+    - "big_mem"
+    - "big_cpu"
+    - ["big_mem", "big_cpu"]
+  */
+  if (drctv.containsKey("label")) {
+    if (drctv["label"] instanceof CharSequence) {
+      drctv["label"] = [ drctv["label"] ]
+    }
+    assert drctv["label"] instanceof List
+    drctv["label"].forEach { label ->
+      assert label instanceof CharSequence
+      // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?")
+      // ^ does not allow closures
+    }
+  }
+
+  /* DIRECTIVE scratch
+    accepted examples:
+    - true
+    - "/path/to/scratch"
+    - '$MY_PATH_TO_SCRATCH'
+    - "ram-disk"
+  */
+  if (drctv.containsKey("scratch")) {
+    assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE storeDir
+    accepted examples:
+    - "/path/to/storeDir"
+  */
+  if (drctv.containsKey("storeDir")) {
+    assert drctv["storeDir"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE stageInMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageInMode")) {
+    assert drctv["stageInMode"] instanceof CharSequence
+    assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"]
+  }
+
+  /* DIRECTIVE stageOutMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageOutMode")) {
+    assert drctv["stageOutMode"] instanceof CharSequence
+    assert drctv["stageOutMode"] in ["copy", "move", "rsync"]
+  }
+
+  /* DIRECTIVE tag
+    accepted examples:
+    - "foo"
+    - '$id'
+  */
+  if (drctv.containsKey("tag")) {
+    assert drctv["tag"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE time
+    accepted examples:
+    - "1h"
+    - "2days"
+    - "1day 6hours 3minutes 30seconds"
+  */
+  if (drctv.containsKey("time")) {
+    assert drctv["time"] instanceof CharSequence
+    // todo: validation regex?
+  }
+
+  return drctv
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf'
+def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) {
+  // override defaults with args
+  def workflowArgs = defaultWfArgs + args
+
+  // check whether 'key' exists
+  assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument"
+
+  // if 'key' is a closure, apply it to the original key
+  if (workflowArgs["key"] instanceof Closure) {
+    workflowArgs["key"] = workflowArgs["key"](meta.config.name)
+  }
+  def key = workflowArgs["key"]
+  assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}"
+  assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}"
+
+  // check for any unexpected keys
+  def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"]
+  def unexpectedKeys = workflowArgs.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'"
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument"
+  assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}"
+  workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"])
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument"
+  assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}"
+  workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"])
+
+  // auto define publish, if so desired
+  if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.publish_dir = \"./output/\""
+    def publishDir = getPublishDir()
+    
+    if (publishDir != null) {
+      workflowArgs.directives.publishDir = [[ 
+        path: publishDir, 
+        saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default
+        mode: "copy"
+      ]]
+    }
+  }
+
+  // auto define transcript, if so desired
+  if (workflowArgs.auto.transcript == true) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.transcripts_dir = \"./transcripts/\""
+    def transcriptsDir = 
+      params.containsKey("transcripts_dir") ? params.transcripts_dir : 
+      params.containsKey("transcriptsDir") ? params.transcriptsDir : 
+      params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" :
+      params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : 
+      null
+    if (transcriptsDir != null) {
+      def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss')
+      def transcriptsPublishDir = [ 
+        path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/",
+        saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", 
+        mode: "copy"
+      ]
+      def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : []
+      workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir
+    }
+  }
+
+  // if this is a stubrun, remove certain directives?
+  if (workflow.stubRun) {
+    workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"])
+  }
+
+  for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam]) {
+      assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}"
+    }
+  }
+
+  // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well?
+  for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) {
+      log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead."
+    }
+  }
+
+  // check fromState
+  workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config)
+
+  // check toState
+  workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config)
+
+  // return output
+  return workflowArgs
+}
+
+def _processFromState(fromState, key_, config_) {
+  assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List :
+    "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}"
+  if (fromState == null) {
+    return null
+  }
+  
+  // if fromState is a List, convert to map
+  if (fromState instanceof List) {
+    // check whether fromstate is a list[string]
+    assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings"
+    fromState = fromState.collectEntries{[it, it]}
+  }
+
+  // if fromState is a map, convert to closure
+  if (fromState instanceof Map) {
+    // check whether fromstate is a map[string, string]
+    assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings"
+    assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings"
+    def fromStateMap = fromState.clone()
+    def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    fromState = { it ->
+      def state = it[1]
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def data = fromStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (state.containsKey(origkey)) {
+          [[newkey, state[origkey]]]
+        } else if (!requiredInputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state")
+        }
+      }.collectEntries()
+      data
+    }
+  }
+  
+  return fromState
+}
+
+def _processToState(toState, key_, config_) {
+  if (toState == null) {
+    toState = { tup -> tup[1] }
+  }
+
+  // toState should be a closure, map[string, string], or list[string]
+  assert toState instanceof Closure || toState instanceof Map || toState instanceof List :
+    "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}"
+
+  // if toState is a List, convert to map
+  if (toState instanceof List) {
+    // check whether toState is a list[string]
+    assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings"
+    toState = toState.collectEntries{[it, it]}
+  }
+
+  // if toState is a map, convert to closure
+  if (toState instanceof Map) {
+    // check whether toState is a map[string, string]
+    assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings"
+    assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings"
+    def toStateMap = toState.clone()
+    def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    toState = { it ->
+      def output = it[1]
+      def state = it[2]
+      assert output instanceof Map : "Error in module '$key_': the output is not a Map"
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def extraEntries = toStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (output.containsKey(origkey)) {
+          [[newkey, output[origkey]]]
+        } else if (!requiredOutputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output")
+        }
+      }.collectEntries()
+      state + extraEntries
+    }
+  }
+
+  return toState
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf'
+def _debug(workflowArgs, debugKey) {
+  if (workflowArgs.debug) {
+    view { "process '${workflowArgs.key}' $debugKey tuple: $it"  }
+  } else {
+    map { it }
+  }
+}
+
+// depends on: innerWorkflowFactory
+def workflowFactory(Map args, Map defaultWfArgs, Map meta) {
+  def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta)
+  def key_ = workflowArgs["key"]
+  
+  workflow workflowInstance {
+    take: input_
+
+    main:
+    def chModified = input_
+      | checkUniqueIds([:])
+      | _debug(workflowArgs, "input")
+      | map { tuple ->
+        tuple = deepClone(tuple)
+        
+        if (workflowArgs.map) {
+          tuple = workflowArgs.map(tuple)
+        }
+        if (workflowArgs.mapId) {
+          tuple[0] = workflowArgs.mapId(tuple[0])
+        }
+        if (workflowArgs.mapData) {
+          tuple[1] = workflowArgs.mapData(tuple[1])
+        }
+        if (workflowArgs.mapPassthrough) {
+          tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2))
+        }
+
+        // check tuple
+        assert tuple instanceof List : 
+          "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}"
+        assert tuple.size() >= 2 : 
+          "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: tuple.size() == ${tuple.size()}"
+        
+        // check id field
+        if (tuple[0] instanceof GString) {
+          tuple[0] = tuple[0].toString()
+        }
+        assert tuple[0] instanceof CharSequence : 
+          "Error in module '${key_}': first element of tuple in channel should be a String\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: ${tuple[0]}"
+        
+        // match file to input file
+        if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) {
+          def inputFiles = meta.config.allArguments
+            .findAll { it.type == "file" && it.direction == "input" }
+          
+          assert inputFiles.size() == 1 : 
+              "Error in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Anonymous file inputs are only allowed when the process has exactly one file input.\n" +
+              "  Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}"
+
+          tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries()
+        }
+
+        // check data field
+        assert tuple[1] instanceof Map : 
+          "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+        // rename keys of data field in tuple
+        if (workflowArgs.renameKeys) {
+          assert workflowArgs.renameKeys instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}"
+          assert tuple[1] instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+          // TODO: allow renameKeys to be a function?
+          workflowArgs.renameKeys.each { newKey, oldKey ->
+            assert newKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}"
+            assert oldKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}"
+            assert tuple[1].containsKey(oldKey) : 
+              "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" +
+              "  Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'"
+            tuple[1].put(newKey, tuple[1][oldKey])
+          }
+          tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey })
+        }
+        tuple
+      }
+
+
+    def chRun = null
+    def chPassthrough = null
+    if (workflowArgs.runIf) {
+      def runIfBranch = chModified.branch{ tup ->
+        run: workflowArgs.runIf(tup[0], tup[1])
+        passthrough: true
+      }
+      chRun = runIfBranch.run
+      chPassthrough = runIfBranch.passthrough
+    } else {
+      chRun = chModified
+      chPassthrough = Channel.empty()
+    }
+
+    def chRunFiltered = workflowArgs.filter ?
+      chRun | filter{workflowArgs.filter(it)} :
+      chRun
+
+    def chArgs = workflowArgs.fromState ? 
+      chRunFiltered | map{
+        def new_data = workflowArgs.fromState(it.take(2))
+        [it[0], new_data]
+      } :
+      chRunFiltered | map {tup -> tup.take(2)}
+
+    // fill in defaults
+    def chArgsWithDefaults = chArgs
+      | map { tuple ->
+        def id_ = tuple[0]
+        def data_ = tuple[1]
+
+        // TODO: could move fromState to here
+
+        // fetch default params from functionality
+        def defaultArgs = meta.config.allArguments
+          .findAll { it.containsKey("default") }
+          .collectEntries { [ it.plainName, it.default ] }
+
+        // fetch overrides in params
+        def paramArgs = meta.config.allArguments
+          .findAll { par ->
+            def argKey = key_ + "__" + par.plainName
+            params.containsKey(argKey)
+          }
+          .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] }
+        
+        // fetch overrides in data
+        def dataArgs = meta.config.allArguments
+          .findAll { data_.containsKey(it.plainName) }
+          .collectEntries { [ it.plainName, data_[it.plainName] ] }
+        
+        // combine params
+        def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs
+
+        // remove arguments with explicit null values
+        combinedArgs
+          .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"}
+
+        combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_)
+
+        [id_, combinedArgs] + tuple.drop(2)
+      }
+
+    // TODO: move some of the _meta.join_id wrangling to the safeJoin() function.
+    def chInitialOutput = chArgsWithDefaults
+      | _debug(workflowArgs, "processed")
+      // run workflow
+      | innerWorkflowFactory(workflowArgs)
+      // check output tuple
+      | map { id_, output_ ->
+
+        // see if output map contains metadata
+        def meta_ =
+          output_ instanceof Map && output_.containsKey("_meta") ? 
+          output_["_meta"] :
+          [:]
+        def join_id = meta_.join_id ?: id_
+        
+        // remove metadata
+        output_ = output_.findAll{k, v -> k != "_meta"}
+
+        // check value types
+        output_ = _processOutputValues(output_, meta.config, id_, key_)
+
+        // simplify output if need be
+        if (workflowArgs.auto.simplifyOutput && output_.size() == 1) {
+          output_ = output_.values()[0]
+        }
+
+        [join_id, id_, output_]
+      }
+      // | view{"chInitialOutput: ${it.take(3)}"}
+
+    // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...]
+    def chNewState = safeJoin(chInitialOutput, chRunFiltered, key_)
+      // input tuple format: [join_id, id, output, prev_state, ...]
+      // output tuple format: [join_id, id, new_state, ...]
+      | map{ tup ->
+        def new_state = workflowArgs.toState(tup.drop(1).take(3))
+        tup.take(2) + [new_state] + tup.drop(4)
+      }
+
+    if (workflowArgs.auto.publish == "state") {
+      def chPublish = chNewState
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [join_id, id, new_state]
+        | map{ tup ->
+          tup.take(3)
+        }
+
+      safeJoin(chPublish, chArgsWithDefaults, key_)
+        // input tuple format: [join_id, id, new_state, orig_state, ...]
+        // output tuple format: [id, new_state, orig_state]
+        | map { tup ->
+          tup.drop(1).take(3)
+      }
+        | publishStatesByConfig(key: key_, config: meta.config)
+    }
+
+    // remove join_id and meta
+    chReturn = chNewState
+      | map { tup ->
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [id, new_state, ...]
+        tup.drop(1)
+      }
+      | _debug(workflowArgs, "output")
+      | concat(chPassthrough)
+
+    emit: chReturn
+  }
+
+  def wf = workflowInstance.cloneWithName(key_)
+
+  // add factory function
+  wf.metaClass.run = { runArgs ->
+    workflowFactory(runArgs, workflowArgs, meta)
+  }
+  // add config to module for later introspection
+  wf.metaClass.config = meta.config
+
+  return wf
+}
+
+nextflow.enable.dsl=2
+
+// START COMPONENT-SPECIFIC CODE
+
+// create meta object
+meta = [
+  "resources_dir": moduleDir.toRealPath().normalize(),
+  "config": processConfig(readJsonBlob('''{
+  "name" : "rseqc_bamstat",
+  "namespace" : "rseqc",
+  "version" : "main",
+  "authors" : [
+    {
+      "name" : "Emma Rousseau",
+      "roles" : [
+        "author",
+        "maintainer"
+      ],
+      "info" : {
+        "links" : {
+          "email" : "emma@data-intuitive.com",
+          "github" : "emmarousseau",
+          "linkedin" : "emmarousseau1"
+        },
+        "organizations" : [
+          {
+            "name" : "Data Intuitive",
+            "href" : "https://www.data-intuitive.com",
+            "role" : "Bioinformatician"
+          }
+        ]
+      }
+    }
+  ],
+  "argument_groups" : [
+    {
+      "name" : "Input",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--input_file",
+          "alternatives" : [
+            "-i"
+          ],
+          "description" : "Input alignment file in BAM or SAM format.",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "integer",
+          "name" : "--mapq",
+          "alternatives" : [
+            "-q"
+          ],
+          "description" : "Minimum mapping quality (phred scaled) to determine uniquely mapped reads. Default: '30'.\n",
+          "example" : [
+            30
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Output",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--output",
+          "description" : "Output file (txt) with mapping quality statistics.",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : false,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    }
+  ],
+  "resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "script.sh",
+      "is_executable" : true
+    }
+  ],
+  "description" : "Generate statistics from a bam file.",
+  "test_resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "test.sh",
+      "is_executable" : true
+    },
+    {
+      "type" : "file",
+      "path" : "test_data"
+    }
+  ],
+  "status" : "enabled",
+  "requirements" : {
+    "commands" : [
+      "ps"
+    ]
+  },
+  "keywords" : [
+    "rnaseq",
+    "genomics"
+  ],
+  "license" : "GPL-3.0",
+  "references" : {
+    "doi" : [
+      "10.1093/bioinformatics/bts356"
+    ]
+  },
+  "links" : {
+    "repository" : "https://github.com/MonashBioinformaticsPlatform/RSeQC",
+    "homepage" : "https://rseqc.sourceforge.net/",
+    "documentation" : "https://rseqc.sourceforge.net/#bam-stat-py",
+    "issue_tracker" : "https://github.com/MonashBioinformaticsPlatform/RSeQC/issues"
+  },
+  "runners" : [
+    {
+      "type" : "executable",
+      "id" : "executable",
+      "docker_setup_strategy" : "ifneedbepullelsecachedbuild"
+    },
+    {
+      "type" : "nextflow",
+      "id" : "nextflow",
+      "directives" : {
+        "tag" : "$id"
+      },
+      "auto" : {
+        "simplifyInput" : true,
+        "simplifyOutput" : false,
+        "transcript" : false,
+        "publish" : false
+      },
+      "config" : {
+        "labels" : {
+          "mem1gb" : "memory = 1000000000.B",
+          "mem2gb" : "memory = 2000000000.B",
+          "mem5gb" : "memory = 5000000000.B",
+          "mem10gb" : "memory = 10000000000.B",
+          "mem20gb" : "memory = 20000000000.B",
+          "mem50gb" : "memory = 50000000000.B",
+          "mem100gb" : "memory = 100000000000.B",
+          "mem200gb" : "memory = 200000000000.B",
+          "mem500gb" : "memory = 500000000000.B",
+          "mem1tb" : "memory = 1000000000000.B",
+          "mem2tb" : "memory = 2000000000000.B",
+          "mem5tb" : "memory = 5000000000000.B",
+          "mem10tb" : "memory = 10000000000000.B",
+          "mem20tb" : "memory = 20000000000000.B",
+          "mem50tb" : "memory = 50000000000000.B",
+          "mem100tb" : "memory = 100000000000000.B",
+          "mem200tb" : "memory = 200000000000000.B",
+          "mem500tb" : "memory = 500000000000000.B",
+          "mem1gib" : "memory = 1073741824.B",
+          "mem2gib" : "memory = 2147483648.B",
+          "mem4gib" : "memory = 4294967296.B",
+          "mem8gib" : "memory = 8589934592.B",
+          "mem16gib" : "memory = 17179869184.B",
+          "mem32gib" : "memory = 34359738368.B",
+          "mem64gib" : "memory = 68719476736.B",
+          "mem128gib" : "memory = 137438953472.B",
+          "mem256gib" : "memory = 274877906944.B",
+          "mem512gib" : "memory = 549755813888.B",
+          "mem1tib" : "memory = 1099511627776.B",
+          "mem2tib" : "memory = 2199023255552.B",
+          "mem4tib" : "memory = 4398046511104.B",
+          "mem8tib" : "memory = 8796093022208.B",
+          "mem16tib" : "memory = 17592186044416.B",
+          "mem32tib" : "memory = 35184372088832.B",
+          "mem64tib" : "memory = 70368744177664.B",
+          "mem128tib" : "memory = 140737488355328.B",
+          "mem256tib" : "memory = 281474976710656.B",
+          "mem512tib" : "memory = 562949953421312.B",
+          "cpu1" : "cpus = 1",
+          "cpu2" : "cpus = 2",
+          "cpu5" : "cpus = 5",
+          "cpu10" : "cpus = 10",
+          "cpu20" : "cpus = 20",
+          "cpu50" : "cpus = 50",
+          "cpu100" : "cpus = 100",
+          "cpu200" : "cpus = 200",
+          "cpu500" : "cpus = 500",
+          "cpu1000" : "cpus = 1000"
+        }
+      },
+      "debug" : false,
+      "container" : "docker"
+    }
+  ],
+  "engines" : [
+    {
+      "type" : "docker",
+      "id" : "docker",
+      "image" : "python:3.10",
+      "target_registry" : "images.viash-hub.com",
+      "target_tag" : "main",
+      "namespace_separator" : "/",
+      "setup" : [
+        {
+          "type" : "python",
+          "user" : false,
+          "packages" : [
+            "RSeQC"
+          ],
+          "upgrade" : true
+        },
+        {
+          "type" : "docker",
+          "run" : [
+            "echo \\"RSeQC bam_stat.py: $(bam_stat.py --version | cut -d' ' -f2-)\\" > /var/software_versions.txt\n"
+          ]
+        }
+      ]
+    },
+    {
+      "type" : "native",
+      "id" : "native"
+    }
+  ],
+  "build_info" : {
+    "config" : "/workdir/root/repo/src/rseqc/rseqc_bamstat/config.vsh.yaml",
+    "runner" : "nextflow",
+    "engine" : "docker|native",
+    "output" : "target/nextflow/rseqc/rseqc_bamstat",
+    "viash_version" : "0.9.0",
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
+  },
+  "package_config" : {
+    "name" : "biobox",
+    "version" : "main",
+    "description" : "A collection of bioinformatics tools for working with sequence data.\n",
+    "viash_version" : "0.9.0",
+    "source" : "src",
+    "target" : "target",
+    "config_mods" : [
+      ".requirements.commands := ['ps']\n",
+      ".engines += { type: \\"native\\" }",
+      ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
+      ".engines[.type == 'docker'].target_tag := 'main'"
+    ],
+    "keywords" : [
+      "bioinformatics",
+      "modules",
+      "sequencing"
+    ],
+    "license" : "MIT",
+    "organization" : "vsh",
+    "links" : {
+      "repository" : "https://github.com/viash-hub/biobox",
+      "issue_tracker" : "https://github.com/viash-hub/biobox/issues"
+    }
+  }
+}'''))
+]
+
+// resolve dependencies dependencies (if any)
+
+
+// inner workflow
+// inner workflow hook
+def innerWorkflowFactory(args) {
+  def rawScript = '''set -e
+tempscript=".viash_script.sh"
+cat > "$tempscript" << VIASHMAIN
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_INPUT_FILE+x} ]; then echo "${VIASH_PAR_INPUT_FILE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input_file='&'#" ; else echo "# par_input_file="; fi )
+$( if [ ! -z ${VIASH_PAR_MAPQ+x} ]; then echo "${VIASH_PAR_MAPQ}" | sed "s#'#'\\"'\\"'#g;s#.*#par_mapq='&'#" ; else echo "# par_mapq="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+#!/bin/bash
+
+
+set -eo pipefail 
+
+bam_stat.py \\\\
+    --input-file "\\${par_input_file}" \\\\
+    \\${par_mapq:+--mapq "\\${par_mapq}"} \\\\
+> \\$par_output
+VIASHMAIN
+bash "$tempscript"
+'''
+  
+  return vdsl3WorkflowFactory(args, meta, rawScript)
+}
+
+
+
+/**
+  * Generate a workflow for VDSL3 modules.
+  * 
+  * This function is called by the workflowFactory() function.
+  * 
+  * Input channel: [id, input_map]
+  * Output channel: [id, output_map]
+  * 
+  * Internally, this workflow will convert the input channel
+  * to a format which the Nextflow module will be able to handle.
+  */
+def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) {
+  def key = args["key"]
+  def processObj = null
+
+  workflow processWf {
+    take: input_
+    main:
+
+    if (processObj == null) {
+      processObj = _vdsl3ProcessFactory(args, meta, rawScript)
+    }
+    
+    output_ = input_
+      | map { tuple ->
+        def id = tuple[0]
+        def data_ = tuple[1]
+
+        if (workflow.stubRun) {
+          // add id if missing
+          data_ = [id: 'stub'] + data_
+        }
+
+        // process input files separately
+        def inputPaths = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "input" }
+          .collect { par ->
+            def val = data_.containsKey(par.plainName) ? data_[par.plainName] : []
+            def inputFiles = []
+            if (val == null) {
+              inputFiles = []
+            } else if (val instanceof List) {
+              inputFiles = val
+            } else if (val instanceof Path) {
+              inputFiles = [ val ]
+            } else {
+              inputFiles = []
+            }
+            if (!workflow.stubRun) {
+              // throw error when an input file doesn't exist
+              inputFiles.each{ file -> 
+                assert file.exists() :
+                  "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" +
+                  "  Required input file does not exist.\n" +
+                  "  Path: '$file'.\n" +
+                  "  Expected input file to exist"
+              }
+            }
+            inputFiles 
+          } 
+
+        // remove input files
+        def argsExclInputFiles = meta.config.allArguments
+          .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) }
+          .collectEntries { par ->
+            def parName = par.plainName
+            def val = data_[parName]
+            if (par.multiple && val instanceof Collection) {
+              val = val.join(par.multiple_sep)
+            }
+            if (par.direction == "output" && par.type == "file") {
+              val = val
+                .replaceAll('\\$id', id)
+                .replaceAll('\\$\\{id\\}', id)
+                .replaceAll('\\$key', key)
+                .replaceAll('\\$\\{key\\}', key)
+            }
+            [parName, val]
+          }
+
+        [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ]
+      }
+      | processObj
+      | map { output ->
+        def outputFiles = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "output" }
+          .indexed()
+          .collectEntries{ index, par ->
+            def out = output[index + 1]
+            // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678)
+            if (!out instanceof List || out.size() <= 1) {
+              if (par.multiple) {
+                out = []
+              } else {
+                assert !par.required :
+                    "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" +
+                    "  Required output file is missing"
+                out = null
+              }
+            } else if (out.size() == 2 && !par.multiple) {
+              out = out[1]
+            } else {
+              out = out.drop(1)
+            }
+            [ par.plainName, out ]
+          }
+        
+        // drop null outputs
+        outputFiles.removeAll{it.value == null}
+
+        [ output[0], outputFiles ]
+      }
+    emit: output_
+  }
+
+  return processWf
+}
+
+// depends on: session?
+def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) {
+  // autodetect process key
+  def wfKey = workflowArgs["key"]
+  def procKeyPrefix = "${wfKey}_process"
+  def scriptMeta = nextflow.script.ScriptMeta.current()
+  def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)}
+  def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()}
+  def newNumber = (numbers + [-1]).max() + 1
+
+  def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber"
+
+  if (newNumber > 0) {
+    log.warn "Key for module '${wfKey}' is duplicated.\n",
+      "If you run a component multiple times in the same workflow,\n" +
+      "it's recommended you set a unique key for every call,\n" +
+      "for example: ${wfKey}.run(key: \"foo\")."
+  }
+
+  // subset directives and convert to list of tuples
+  def drctv = workflowArgs.directives
+
+  // TODO: unit test the two commands below
+  // convert publish array into tags
+  def valueToStr = { val ->
+    // ignore closures
+    if (val instanceof CharSequence) {
+      if (!val.matches('^[{].*[}]$')) {
+        '"' + val + '"'
+      } else {
+        val
+      }
+    } else if (val instanceof List) {
+      "[" + val.collect{valueToStr(it)}.join(", ") + "]"
+    } else if (val instanceof Map) {
+      "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]"
+    } else {
+      val.inspect()
+    }
+  }
+
+  // multiple entries allowed: label, publishdir
+  def drctvStrs = drctv.collect { key, value ->
+    if (key in ["label", "publishDir"]) {
+      value.collect{ val ->
+        if (val instanceof Map) {
+          "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+        } else if (val == null) {
+          ""
+        } else {
+          "\n$key " + valueToStr(val)
+        }
+      }.join()
+    } else if (value instanceof Map) {
+      "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+    } else {
+      "\n$key " + valueToStr(value)
+    }
+  }.join()
+
+  def inputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "input" }
+    .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' }
+    .join()
+
+  def outputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par ->
+      // insert dummy into every output (see nextflow-io/nextflow#2678)
+      if (!par.multiple) {
+        ', path{[".exitcode", args.' + par.plainName + ']}'
+      } else {
+        ', path{[".exitcode"] + args.' + par.plainName + '}'
+      }
+    }
+    .join()
+
+  // TODO: move this functionality somewhere else?
+  if (workflowArgs.auto.transcript) {
+    outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}'
+  } else {
+    outputPaths = outputPaths + ', path{[".exitcode"]}'
+  }
+
+  // create dirs for output files (based on BashWrapper.createParentFiles)
+  def createParentStr = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" && it.create_parent }
+    .collect { par -> 
+      def contents = "args[\"${par.plainName}\"] instanceof List ? args[\"${par.plainName}\"].join('\" \"') : args[\"${par.plainName}\"]"
+      "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent '\" + escapeText(${contents}) + \"'\" : \"\" }"
+    }
+    .join("\n")
+
+  // construct inputFileExports
+  def inputFileExports = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction.toLowerCase() == "input" }
+    .collect { par ->
+      def contents = "viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName}"
+      "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}='\" + escapeText(${contents}) + \"'\"}"
+    }
+
+  // NOTE: if using docker, use /tmp instead of tmpDir!
+  def tmpDir = java.nio.file.Paths.get(
+    System.getenv('NXF_TEMP') ?: 
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('VIASH_TMPDIR') ?: 
+    System.getenv('VIASH_TEMPDIR') ?: 
+    System.getenv('VIASH_TMP') ?: 
+    System.getenv('TEMP') ?: 
+    System.getenv('TMPDIR') ?: 
+    System.getenv('TEMPDIR') ?:
+    System.getenv('TMP') ?: 
+    '/tmp'
+  ).toAbsolutePath()
+
+  // construct stub
+  def stub = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par -> 
+      "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }"
+    }
+    .join("\n")
+
+  // escape script
+  def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"')
+
+  // publishdir assert
+  def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? 
+    """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n  Example: --publish_dir './output/'" """ :
+    ""
+
+  // generate process string
+  def procStr = 
+  """nextflow.enable.dsl=2
+  |
+  |def escapeText = { s -> s.toString().replaceAll("'", "'\\\"'\\\"'") }
+  |process $procKey {$drctvStrs
+  |input:
+  |  tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources")
+  |output:
+  |  tuple val("\$id")$outputPaths, optional: true
+  |stub:
+  |\"\"\"
+  |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; }
+  |$stub
+  |\"\"\"
+  |script:$assertStr
+  |def parInject = args
+  |  .findAll{key, value -> value != null}
+  |  .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}='\${escapeText(value)}'"}
+  |  .join("\\n")
+  |\"\"\"
+  |# meta exports
+  |export VIASH_META_RESOURCES_DIR="\${resourcesDir}"
+  |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}"
+  |export VIASH_META_NAME="${meta.config.name}"
+  |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME"
+  |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+  |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" }
+  |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" }
+  |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then
+  |  export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 ))
+  |  export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  |fi
+  |
+  |# meta synonyms
+  |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR"
+  |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR"
+  |
+  |# create output dirs if need be
+  |function mkdir_parent {
+  |  for file in "\\\$@"; do 
+  |    mkdir -p "\\\$(dirname "\\\$file")"
+  |  done
+  |}
+  |$createParentStr
+  |
+  |# argument exports${inputFileExports.join()}
+  |\$parInject
+  |
+  |# process script
+  |${escapedScript}
+  |\"\"\"
+  |}
+  |""".stripMargin()
+
+  // TODO: print on debug
+  // if (workflowArgs.debug == true) {
+  //   println("######################\n$procStr\n######################")
+  // }
+
+  // write process to temp file
+  def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf")
+  addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) }
+  tempFile.text = procStr
+
+  // create process from temp file
+  def binding = new nextflow.script.ScriptBinding([:])
+  def session = nextflow.Nextflow.getSession()
+  def parser = new nextflow.script.ScriptParser(session)
+    .setModule(true)
+    .setBinding(binding)
+  def moduleScript = parser.runScript(tempFile)
+    .getScript()
+
+  // register module in meta
+  def module = new nextflow.script.IncludeDef.Module(name: procKey)
+  scriptMeta.addModule(moduleScript, module.name, module.alias)
+
+  // retrieve and return process from meta
+  return scriptMeta.getProcess(procKey)
+}
+
+// defaults
+meta["defaults"] = [
+  // key to be used to trace the process and determine output names
+  key: null,
+
+  // fixed arguments to be passed to script
+  args: [:],
+
+  // default directives
+  directives: readJsonBlob('''{
+  "container" : {
+    "registry" : "images.viash-hub.com",
+    "image" : "vsh/biobox/rseqc/rseqc_bamstat",
+    "tag" : "main"
+  },
+  "tag" : "$id"
+}'''),
+
+  // auto settings
+  auto: readJsonBlob('''{
+  "simplifyInput" : true,
+  "simplifyOutput" : false,
+  "transcript" : false,
+  "publish" : false
+}'''),
+
+  // Apply a map over the incoming tuple
+  // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }`
+  map: null,
+
+  // Apply a map over the ID element of a tuple (i.e. the first element)
+  // Example: `{ id -> id + "_foo" }`
+  mapId: null,
+
+  // Apply a map over the data element of a tuple (i.e. the second element)
+  // Example: `{ data -> [ input: data.output ] }`
+  mapData: null,
+
+  // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements)
+  // Example: `{ pt -> pt.drop(1) }`
+  mapPassthrough: null,
+
+  // Filter the channel
+  // Example: `{ tup -> tup[0] == "foo" }`
+  filter: null,
+
+  // Choose whether or not to run the component on the tuple if the condition is true.
+  // Otherwise, the tuple will be passed through.
+  // Example: `{ tup -> tup[0] != "skip_this" }`
+  runIf: null,
+
+  // Rename keys in the data field of the tuple (i.e. the second element)
+  // Will likely be deprecated in favour of `fromState`.
+  // Example: `[ "new_key": "old_key" ]`
+  renameKeys: null,
+
+  // Fetch data from the state and pass it to the module without altering the current state.
+  // 
+  // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. 
+  // 
+  // - If it is `null`, the state will be passed to the module as is.
+  // - If it is a `List[String]`, the data will be the values of the state at the given keys.
+  // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map.
+  // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data.
+  // 
+  // Example: `{ id, state -> [input: state.fastq_file] }`
+  // Default: `null`
+  fromState: null,
+
+  // Determine how the state should be updated after the module has been run.
+  // 
+  // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function.
+  // 
+  // - If it is `null`, the state will be replaced with the output of the module.
+  // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys.
+  // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map.
+  // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state.
+  //
+  // Example: `{ id, output, state -> state + [counts: state.output] }`
+  // Default: `{ id, output, state -> output }`
+  toState: null,
+
+  // Whether or not to print debug messages
+  // Default: `false`
+  debug: false
+]
+
+// initialise default workflow
+meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta)
+
+// add workflow to environment
+nextflow.script.ScriptMeta.current().addDefinition(meta.workflow)
+
+// anonymous workflow for running this module as a standalone
+workflow {
+  // add id argument if it's not already in the config
+  // TODO: deep copy
+  def newConfig = deepClone(meta.config)
+  def newParams = deepClone(params)
+
+  def argsContainsId = newConfig.allArguments.any{it.plainName == "id"}
+  if (!argsContainsId) {
+    def idArg = [
+      'name': '--id',
+      'required': false,
+      'type': 'string',
+      'description': 'A unique id for every entry.',
+      'multiple': false
+    ]
+    newConfig.arguments.add(0, idArg)
+    newConfig = processConfig(newConfig)
+  }
+  if (!newParams.containsKey("id")) {
+    newParams.id = "run"
+  }
+
+  helpMessage(newConfig)
+
+  channelFromParams(newParams, newConfig)
+    // make sure id is not in the state if id is not in the args
+    | map {id, state ->
+      if (!argsContainsId) {
+        [id, state.findAll{k, v -> k != "id"}]
+      } else {
+        [id, state]
+      }
+    }
+    | meta.workflow.run(
+      auto: [ publish: "state" ]
+    )
+}
+
+// END COMPONENT-SPECIFIC CODE
diff --git a/target/nextflow/rseqc/rseqc_bamstat/nextflow.config b/target/nextflow/rseqc/rseqc_bamstat/nextflow.config
new file mode 100644
index 00000000..b9cffed1
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_bamstat/nextflow.config
@@ -0,0 +1,126 @@
+manifest {
+  name = 'rseqc/rseqc_bamstat'
+  mainScript = 'main.nf'
+  nextflowVersion = '!>=20.12.1-edge'
+  version = 'main'
+  description = 'Generate statistics from a bam file.'
+  author = 'Emma Rousseau'
+}
+
+process.container = 'nextflow/bash:latest'
+
+// detect tempdir
+tempDir = java.nio.file.Paths.get(
+  System.getenv('NXF_TEMP') ?:
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('TEMPDIR') ?: 
+    System.getenv('TMPDIR') ?: 
+    '/tmp'
+).toAbsolutePath()
+
+profiles {
+  no_publish {
+    process {
+      withName: '.*' {
+        publishDir = [
+          enabled: false
+        ]
+      }
+    }
+  }
+  mount_temp {
+    docker.temp            = tempDir
+    podman.temp            = tempDir
+    charliecloud.temp      = tempDir
+  }
+  docker {
+    docker.enabled         = true
+    // docker.userEmulation   = true
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  singularity {
+    singularity.enabled    = true
+    singularity.autoMounts = true
+    docker.enabled         = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  podman {
+    podman.enabled         = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  shifter {
+    shifter.enabled        = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    charliecloud.enabled   = false
+  }
+  charliecloud {
+    charliecloud.enabled   = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+  }
+}
+
+process{
+  withLabel: mem1gb { memory = 1000000000.B }
+  withLabel: mem2gb { memory = 2000000000.B }
+  withLabel: mem5gb { memory = 5000000000.B }
+  withLabel: mem10gb { memory = 10000000000.B }
+  withLabel: mem20gb { memory = 20000000000.B }
+  withLabel: mem50gb { memory = 50000000000.B }
+  withLabel: mem100gb { memory = 100000000000.B }
+  withLabel: mem200gb { memory = 200000000000.B }
+  withLabel: mem500gb { memory = 500000000000.B }
+  withLabel: mem1tb { memory = 1000000000000.B }
+  withLabel: mem2tb { memory = 2000000000000.B }
+  withLabel: mem5tb { memory = 5000000000000.B }
+  withLabel: mem10tb { memory = 10000000000000.B }
+  withLabel: mem20tb { memory = 20000000000000.B }
+  withLabel: mem50tb { memory = 50000000000000.B }
+  withLabel: mem100tb { memory = 100000000000000.B }
+  withLabel: mem200tb { memory = 200000000000000.B }
+  withLabel: mem500tb { memory = 500000000000000.B }
+  withLabel: mem1gib { memory = 1073741824.B }
+  withLabel: mem2gib { memory = 2147483648.B }
+  withLabel: mem4gib { memory = 4294967296.B }
+  withLabel: mem8gib { memory = 8589934592.B }
+  withLabel: mem16gib { memory = 17179869184.B }
+  withLabel: mem32gib { memory = 34359738368.B }
+  withLabel: mem64gib { memory = 68719476736.B }
+  withLabel: mem128gib { memory = 137438953472.B }
+  withLabel: mem256gib { memory = 274877906944.B }
+  withLabel: mem512gib { memory = 549755813888.B }
+  withLabel: mem1tib { memory = 1099511627776.B }
+  withLabel: mem2tib { memory = 2199023255552.B }
+  withLabel: mem4tib { memory = 4398046511104.B }
+  withLabel: mem8tib { memory = 8796093022208.B }
+  withLabel: mem16tib { memory = 17592186044416.B }
+  withLabel: mem32tib { memory = 35184372088832.B }
+  withLabel: mem64tib { memory = 70368744177664.B }
+  withLabel: mem128tib { memory = 140737488355328.B }
+  withLabel: mem256tib { memory = 281474976710656.B }
+  withLabel: mem512tib { memory = 562949953421312.B }
+  withLabel: cpu1 { cpus = 1 }
+  withLabel: cpu2 { cpus = 2 }
+  withLabel: cpu5 { cpus = 5 }
+  withLabel: cpu10 { cpus = 10 }
+  withLabel: cpu20 { cpus = 20 }
+  withLabel: cpu50 { cpus = 50 }
+  withLabel: cpu100 { cpus = 100 }
+  withLabel: cpu200 { cpus = 200 }
+  withLabel: cpu500 { cpus = 500 }
+  withLabel: cpu1000 { cpus = 1000 }
+}
+
+
diff --git a/target/nextflow/rseqc/rseqc_bamstat/nextflow_schema.json b/target/nextflow/rseqc/rseqc_bamstat/nextflow_schema.json
new file mode 100644
index 00000000..21b1df1b
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_bamstat/nextflow_schema.json
@@ -0,0 +1,105 @@
+{
+"$schema": "http://json-schema.org/draft-07/schema",
+"title": "rseqc_bamstat",
+"description": "Generate statistics from a bam file.",
+"type": "object",
+"definitions": {
+
+    
+    
+    "input" : {
+    "title": "Input",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "input_file": {
+                "type":
+                "string",
+                "description": "Type: `file`, required. Input alignment file in BAM or SAM format",
+                "help_text": "Type: `file`, required. Input alignment file in BAM or SAM format."
+            
+            }
+    
+
+        ,
+                "mapq": {
+                "type":
+                "integer",
+                "description": "Type: `integer`, example: `30`. Minimum mapping quality (phred scaled) to determine uniquely mapped reads",
+                "help_text": "Type: `integer`, example: `30`. Minimum mapping quality (phred scaled) to determine uniquely mapped reads. Default: \u002730\u0027.\n"
+            
+            }
+    
+
+}
+},
+    
+    
+    "output" : {
+    "title": "Output",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "output": {
+                "type":
+                "string",
+                "description": "Type: `file`, default: `$id.$key.output.output`. Output file (txt) with mapping quality statistics",
+                "help_text": "Type: `file`, default: `$id.$key.output.output`. Output file (txt) with mapping quality statistics."
+            ,
+                "default": "$id.$key.output.output"
+            }
+    
+
+}
+},
+    
+    
+    "nextflow input-output arguments" : {
+    "title": "Nextflow input-output arguments",
+    "type": "object",
+    "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+    "properties": {
+    
+        
+                "publish_dir": {
+                "type":
+                "string",
+                "description": "Type: `string`, required, example: `output/`. Path to an output directory",
+                "help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
+            
+            }
+    
+
+        ,
+                "param_list": {
+                "type":
+                "string",
+                "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
+                "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
+                "hidden": true
+            
+            }
+    
+
+}
+}
+},
+"allOf": [
+
+    {
+    "$ref": "#/definitions/input"
+    },
+
+    {
+    "$ref": "#/definitions/output"
+    },
+
+    {
+    "$ref": "#/definitions/nextflow input-output arguments"
+    }
+]
+}
diff --git a/target/nextflow/rseqc/rseqc_inferexperiment/.config.vsh.yaml b/target/nextflow/rseqc/rseqc_inferexperiment/.config.vsh.yaml
new file mode 100644
index 00000000..2b628405
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_inferexperiment/.config.vsh.yaml
@@ -0,0 +1,228 @@
+name: "rseqc_inferexperiment"
+namespace: "rseqc"
+version: "main"
+authors:
+- name: "Emma Rousseau"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "emma@data-intuitive.com"
+      github: "emmarousseau"
+      linkedin: "emmarousseau1"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Input"
+  arguments:
+  - type: "file"
+    name: "--input_file"
+    alternatives:
+    - "-i"
+    description: "input alignment file in BAM or SAM format"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--refgene"
+    alternatives:
+    - "-r"
+    description: "Reference gene model in bed format"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Output"
+  arguments:
+  - type: "file"
+    name: "--output"
+    description: "Output file (txt) of strandness report."
+    info: null
+    example:
+    - "$id.strandedness.txt"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Options"
+  arguments:
+  - type: "integer"
+    name: "--sample_size"
+    alternatives:
+    - "-s"
+    description: "Number of reads sampled from SAM/BAM file. Default: 200000\n"
+    info: null
+    example:
+    - 200000
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--mapq"
+    alternatives:
+    - "-q"
+    description: "Minimum mapping quality (phred scaled) to determine uniquely mapped\
+      \ reads. Default: 30\n"
+    info: null
+    example:
+    - 30
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Infer strandedness from sequencing reads\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.1093/bioinformatics/bts356"
+links:
+  repository: "https://github.com/MonashBioinformaticsPlatform/RSeQC"
+  homepage: "https://rseqc.sourceforge.net/"
+  documentation: "https://rseqc.sourceforge.net/#infer-experiment-py"
+  issue_tracker: "https://github.com/MonashBioinformaticsPlatform/RSeQC/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "python:3.10"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "python"
+    user: false
+    packages:
+    - "RSeQC"
+    upgrade: true
+  - type: "docker"
+    run:
+    - "echo \"RSeQC - infer_experiment.py: $(infer_experiment.py --version | cut -d'\
+      \ ' -f2)\" > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/rseqc/rseqc_inferexperiment/config.vsh.yaml"
+  runner: "nextflow"
+  engine: "docker|native"
+  output: "target/nextflow/rseqc/rseqc_inferexperiment"
+  executable: "target/nextflow/rseqc/rseqc_inferexperiment/main.nf"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/nextflow/rseqc/rseqc_inferexperiment/main.nf b/target/nextflow/rseqc/rseqc_inferexperiment/main.nf
new file mode 100644
index 00000000..308162e2
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_inferexperiment/main.nf
@@ -0,0 +1,3630 @@
+// rseqc_inferexperiment main
+// 
+// This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+// work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+// Intuitive.
+// 
+// The component may contain files which fall under a different license. The
+// authors of this component should specify the license in the header of such
+// files, or include a separate license file detailing the licenses of all included
+// files.
+// 
+// Component authors:
+//  * Emma Rousseau (author, maintainer)
+
+////////////////////////////
+// VDSL3 helper functions //
+////////////////////////////
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf'
+class UnexpectedArgumentTypeException extends Exception {
+  String errorIdentifier
+  String stage
+  String plainName
+  String expectedClass
+  String foundClass
+  
+  // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""}
+  UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) {
+    super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " +
+      "Expected type: ${expectedClass}. Found type: ${foundClass}")
+    this.errorIdentifier = errorIdentifier
+    this.stage = stage
+    this.plainName = plainName
+    this.expectedClass = expectedClass
+    this.foundClass = foundClass
+  }
+}
+
+/**
+  * Checks if the given value is of the expected type. If not, an exception is thrown.
+  *
+  * @param stage The stage of the argument (input or output)
+  * @param par The parameter definition
+  * @param value The value to check
+  * @param errorIdentifier The identifier to use in the error message
+  * @return The value, if it is of the expected type
+  * @throws UnexpectedArgumentTypeException If the value is not of the expected type
+*/
+def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) {
+  // expectedClass will only be != null if value is not of the expected type
+  def expectedClass = null
+  def foundClass = null
+  
+  // todo: split if need be
+  
+  if (!par.required && value == null) {
+    expectedClass = null
+  } else if (par.multiple) {
+    if (value !instanceof Collection) {
+      value = [value]
+    }
+    
+    // split strings
+    value = value.collectMany{ val ->
+      if (val instanceof String) {
+        // collect() to ensure that the result is a List and not simply an array
+        val.split(par.multiple_sep).collect()
+      } else {
+        [val]
+      }
+    }
+
+    // process globs
+    if (par.type == "file" && par.direction == "input") {
+      value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten()
+    }
+
+    // check types of elements in list
+    try {
+      value = value.collect { listVal ->
+        _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier)
+      }
+    } catch (UnexpectedArgumentTypeException e) {
+      expectedClass = "List[${e.expectedClass}]"
+      foundClass = "List[${e.foundClass}]"
+    }
+  } else if (par.type == "string") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else if (par.type == "integer") {
+    // cast to integer if need be
+    if (value instanceof String) {
+      try {
+        value = value.toInteger()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigInteger) {
+      value = value.intValue()
+    }
+    expectedClass = value instanceof Integer ? null : "Integer"
+  } else if (par.type == "long") {
+    // cast to long if need be
+    if (value instanceof String) {
+      try {
+        value = value.toLong()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof Integer) {
+      value = value.toLong()
+    }
+    expectedClass = value instanceof Long ? null : "Long"
+  } else if (par.type == "double") {
+    // cast to double if need be
+    if (value instanceof String) {
+      try {
+        value = value.toDouble()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigDecimal) {
+      value = value.doubleValue()
+    }
+    if (value instanceof Float) {
+      value = value.toDouble()
+    }
+    expectedClass = value instanceof Double ? null : "Double"
+  } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") {
+    // cast to boolean if need be
+    if (value instanceof String) {
+      def valueLower = value.toLowerCase()
+      if (valueLower == "true") {
+        value = true
+      } else if (valueLower == "false") {
+        value = false
+      }
+    }
+    expectedClass = value instanceof Boolean ? null : "Boolean"
+  } else if (par.type == "file" && (par.direction == "input" || stage == "output")) {
+    // cast to path if need be
+    if (value instanceof String) {
+      value = file(value, hidden: true)
+    }
+    if (value instanceof File) {
+      value = value.toPath()
+    }
+    expectedClass = value instanceof Path ? null : "Path"
+  } else if (par.type == "file" && stage == "input" && par.direction == "output") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else {
+    // didn't find a match for par.type
+    expectedClass = par.type
+  }
+
+  if (expectedClass != null) {
+    if (foundClass == null) {
+      foundClass = value.getClass().getName()
+    }
+    throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass)
+  }
+  
+  return value
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf'
+Map _processInputValues(Map inputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.required) {
+        assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing"
+      }
+    }
+
+    inputs = inputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument"
+
+      value = _checkArgumentType("input", par, value, "in module '$key' id '$id'")
+
+      [ name, value ]
+    }
+  }
+  return inputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf'
+Map _processOutputValues(Map outputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.direction == "output" && arg.required) {
+        assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing"
+      }
+    }
+
+    outputs = outputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && it.direction == "output" }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument"
+      
+      value = _checkArgumentType("output", par, value, "in module '$key' id '$id'")
+      
+      [ name, value ]
+    }
+  }
+  return outputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf'
+class IDChecker {
+  final def items = [] as Set
+
+  @groovy.transform.WithWriteLock
+  boolean observe(String item) {
+    if (items.contains(item)) {
+      return false
+    } else {
+      items << item
+      return true
+    }
+  }
+
+  @groovy.transform.WithReadLock
+  boolean contains(String item) {
+    return items.contains(item)
+  }
+
+  @groovy.transform.WithReadLock
+  Set getItems() {
+    return items.clone()
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf'
+
+/**
+ * Check if the ids are unique across parameter sets
+ *
+ * @param parameterSets a list of parameter sets.
+ */
+private void _checkUniqueIds(List<Tuple2<String, Map<String, Object>>> parameterSets) {
+  def ppIds = parameterSets.collect{it[0]}
+  assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds"
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf'
+
+// helper functions for reading params from file //
+def _getChild(parent, child) {
+  if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) {
+    child
+  } else {
+    def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString()
+    parentAbsolute.replaceAll('/[^/]*$', "/") + child
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf'
+/**
+  * Figure out the param list format based on the file extension
+  *
+  * @param param_list A String containing the path to the parameter list file.
+  *
+  * @return A String containing the format of the parameter list file.
+  */
+def _paramListGuessFormat(param_list) {
+  if (param_list !instanceof String) {
+    "asis"
+  } else if (param_list.endsWith(".csv")) {
+    "csv"
+  } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) {
+    "json"
+  } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) {
+    "yaml"
+  } else {
+    "yaml_blob"
+  }
+}
+
+
+/**
+  * Read the param list
+  * 
+  * @param param_list One of the following:
+  *   - A String containing the path to the parameter list file (csv, json or yaml),
+  *   - A yaml blob of a list of maps (yaml_blob),
+  *   - Or a groovy list of maps (asis).
+  * @param config A Map of the Viash configuration.
+  * 
+  * @return A List of Maps containing the parameters.
+  */
+def _parseParamList(param_list, Map config) {
+  // first determine format by extension
+  def paramListFormat = _paramListGuessFormat(param_list)
+
+  def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ?
+    file(param_list, hidden: true) :
+    null
+
+  // get the correct parser function for the detected params_list format
+  def paramSets = []
+  if (paramListFormat == "asis") {
+    paramSets = param_list
+  } else if (paramListFormat == "yaml_blob") {
+    paramSets = readYamlBlob(param_list)
+  } else if (paramListFormat == "yaml") {
+    paramSets = readYaml(paramListPath)
+  } else if (paramListFormat == "json") {
+    paramSets = readJson(paramListPath)
+  } else if (paramListFormat == "csv") {
+    paramSets = readCsv(paramListPath)
+  } else {
+    error "Format of provided --param_list not recognised.\n" +
+    "Found: '$paramListFormat'.\n" +
+    "Expected: a csv file, a json file, a yaml file,\n" +
+    "a yaml blob or a groovy list of maps."
+  }
+
+  // data checks
+  assert paramSets instanceof List: "--param_list should contain a list of maps"
+  for (value in paramSets) {
+    assert value instanceof Map: "--param_list should contain a list of maps"
+  }
+
+  // id is argument
+  def idIsArgument = config.allArguments.any{it.plainName == "id"}
+
+  // Reformat from List<Map> to List<Tuple2<String, Map>> by adding the ID as first element of a Tuple2
+  paramSets = paramSets.collect({ data ->
+    def id = data.id
+    if (!idIsArgument) {
+      data = data.findAll{k, v -> k != "id"}
+    }
+    [id, data]
+  })
+
+  // Split parameters with 'multiple: true'
+  paramSets = paramSets.collect({ id, data ->
+    data = _splitParams(data, config)
+    [id, data]
+  })
+  
+  // The paths of input files inside a param_list file may have been specified relatively to the
+  // location of the param_list file. These paths must be made absolute.
+  if (paramListPath) {
+    paramSets = paramSets.collect({ id, data ->
+      def new_data = data.collectEntries{ parName, parValue ->
+        def par = config.allArguments.find{it.plainName == parName}
+        if (par && par.type == "file" && par.direction == "input") {
+          if (parValue instanceof Collection) {
+            parValue = parValue.collectMany{path -> 
+              def x = _resolveSiblingIfNotAbsolute(path, paramListPath)
+              x instanceof Collection ? x : [x]
+            }
+          } else {
+            parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) 
+          }
+        }
+        [parName, parValue]
+      }
+      [id, new_data]
+    })
+  }
+
+  return paramSets
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf'
+/**
+ * Split parameters for arguments that accept multiple values using their separator
+ *
+ * @param paramList A Map containing parameters to split.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ *
+ * @return A Map of parameters where the parameter values have been split into a list using
+ *         their seperator.
+ */
+Map<String, Object> _splitParams(Map<String, Object> parValues, Map config){
+  def parsedParamValues = parValues.collectEntries { parName, parValue ->
+    def parameterSettings = config.allArguments.find({it.plainName == parName})
+
+    if (!parameterSettings) {
+      // if argument is not found, do not alter 
+      return [parName, parValue]
+    }
+    if (parameterSettings.multiple) { // Check if parameter can accept multiple values
+      if (parValue instanceof Collection) {
+        parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it }
+      } else if (parValue instanceof String) {
+        parValue = parValue.split(parameterSettings.multiple_sep)
+      } else if (parValue == null) {
+        parValue = []
+      } else {
+        parValue = [ parValue ]
+      }
+      parValue = parValue.flatten()
+    }
+    // For all parameters check if multiple values are only passed for
+    // arguments that allow it. Quietly simplify lists of length 1.
+    if (!parameterSettings.multiple && parValue instanceof Collection) {
+      assert parValue.size() == 1 : 
+      "Error: argument ${parName} has too many values.\n" +
+      "  Expected amount: 1. Found: ${parValue.size()}"
+      parValue = parValue[0]
+    }
+    [parName, parValue]
+  }
+  return parsedParamValues
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf'
+/**
+ * Parse nextflow parameters based on settings defined in a viash config.
+ * Return a list of parameter sets, each parameter set corresponding to 
+ * an event in a nextflow channel. The output from this function can be used
+ * with Channel.fromList to create a nextflow channel with Vdsl3 formatted 
+ * events.
+ *
+ * This function performs:
+ *   - A filtering of the params which can be found in the config file.
+ *   - Process the params_list argument which allows a user to to initialise 
+ *     a Vsdl3 channel with multiple parameter sets. Possible formats are 
+ *     csv, json, yaml, or simply a yaml_blob. A csv should have column names 
+ *     which correspond to the different arguments of this pipeline. A json or a yaml
+ *     file should be a list of maps, each of which has keys corresponding to the
+ *     arguments of the pipeline. A yaml blob can also be passed directly as a parameter.
+ *     When passing a csv, json or yaml, relative path names are relativized to the
+ *     location of the parameter file.
+ *   - Combine the parameter sets into a vdsl3 Channel.
+ *
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A list of parameters with the first element of the event being
+ *         the event ID and the second element containing a map of the parsed parameters.
+ */
+ 
+private List<Tuple2<String, Map<String, Object>>> _paramsToParamSets(Map params, Map config){
+  // todo: fetch key from run args
+  def key_ = config.name
+  
+  /* parse regular parameters (not in param_list)  */
+  /*************************************************/
+  def globalParams = config.allArguments
+    .findAll { params.containsKey(it.plainName) }
+    .collectEntries { [ it.plainName, params[it.plainName] ] }
+  def globalID = params.get("id", null)
+
+  /* process params_list arguments */
+  /*********************************/
+  def paramList = params.containsKey("param_list") && params.param_list != null ?
+    params.param_list : []
+  // if (paramList instanceof String) {
+  //   paramList = [paramList]
+  // }
+  // def paramSets = paramList.collectMany{ _parseParamList(it, config) }
+  // TODO: be able to process param_list when it is a list of strings
+  def paramSets = _parseParamList(paramList, config)
+  if (paramSets.isEmpty()) {
+    paramSets = [[null, [:]]]
+  }
+
+  /* combine arguments into channel */
+  /**********************************/
+  def processedParams = paramSets.indexed().collect{ index, tup ->
+    // Process ID
+    def id = tup[0] ?: globalID
+  
+    if (workflow.stubRun && !id) {
+      // if stub run, explicitly add an id if missing
+      id = "stub${index}"
+    }
+    assert id != null: "Each parameter set should have at least an 'id'"
+
+    // Process params
+    def parValues = globalParams + tup[1]
+    // // Remove parameters which are null, if the default is also null
+    // parValues = parValues.collectEntries{paramName, paramValue ->
+    //   parameterSettings = config.functionality.allArguments.find({it.plainName == paramName})
+    //   if ( paramValue != null || parameterSettings.get("default", null) != null ) {
+    //     [paramName, paramValue]
+    //   }
+    // }
+    parValues = parValues.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument"
+
+      if (par == null) {
+        return [:]
+      }
+      value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+
+      [ name, value ]
+    }
+
+    [id, parValues]
+  }
+
+  // Check if ids (first element of each list) is unique
+  _checkUniqueIds(processedParams)
+  return processedParams
+}
+
+/**
+ * Parse nextflow parameters based on settings defined in a viash config 
+ * and return a nextflow channel.
+ * 
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A nextflow Channel with events. Events are formatted as a tuple that contains 
+ *         first contains the ID of the event and as second element holds a parameter map.
+ *       
+ *
+ */
+def channelFromParams(Map params, Map config) {
+  def processedParams = _paramsToParamSets(params, config)
+  return Channel.fromList(processedParams)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf'
+def checkUniqueIds(Map args) {
+  def stopOnError = args.stopOnError == null ? args.stopOnError : true
+
+  def idChecker = new IDChecker()
+
+  return filter { tup ->
+    if (!idChecker.observe(tup[0])) {
+      if (stopOnError) {
+        error "Duplicate id: ${tup[0]}"
+      } else {
+        log.warn "Duplicate id: ${tup[0]}, removing duplicate entry"
+        return false
+      }
+    }
+    return true
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf'
+// This helper file will be deprecated soon
+preprocessInputsDeprecationWarningPrinted = false
+
+def preprocessInputsDeprecationWarning() {
+  if (!preprocessInputsDeprecationWarningPrinted) {
+    preprocessInputsDeprecationWarningPrinted = true
+    System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.")
+  }
+}
+
+/**
+ * Generate a nextflow Workflow that allows processing a channel of 
+ * Vdsl3 formatted events and apply a Viash config to them:
+ *    - Gather default parameters from the Viash config and make 
+ *      sure that they are correctly formatted (see applyConfig method).
+ *    - Format the input parameters (also using the applyConfig method).
+ *    - Apply the default parameter to the input parameters.
+ *    - Do some assertions:
+ *        ~ Check if the event IDs in the channel are unique.
+ * 
+ * The events in the channel are formatted as tuples, with the 
+ * first element of the tuples being a unique id of the parameter set, 
+ * and the second element containg the the parameters themselves.
+ * Optional extra elements of the tuples will be passed to the output as is.
+ *
+ * @param args A map that must contain a 'config' key that points
+ *              to a parsed config (see readConfig()). Optionally, a
+ *              'key' key can be provided which can be used to create a unique
+ *              name for the workflow process.
+ *
+ * @return A workflow that allows processing a channel of Vdsl3 formatted events
+ * and apply a Viash config to them.
+ */
+def preprocessInputs(Map args) {
+  preprocessInputsDeprecationWarning()
+
+  def config = args.config
+  assert config instanceof Map : 
+    "Error in preprocessInputs: config must be a map. " +
+    "Expected class: Map. Found: config.getClass() is ${config.getClass()}"
+  def key_ = args.key ?: config.name
+
+  // Get different parameter types (used throughout this function)
+  def defaultArgs = config.allArguments
+    .findAll { it.containsKey("default") }
+    .collectEntries { [ it.plainName, it.default ] }
+
+  map { tup ->
+    def id = tup[0]
+    def data = tup[1]
+    def passthrough = tup.drop(2)
+
+    def new_data = (defaultArgs + data).collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      
+      if (par != null) {
+        value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+      }
+
+      [ name, value ]
+    }
+
+    [ id, new_data ] + passthrough
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component config.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component config.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runComponents(Map args) {
+  log.warn("runComponents is deprecated, use runEach instead")
+  assert args.components: "runComponents should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runComponents"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def id_ = args.id
+
+  workflow runComponentsWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def comp_config = comp_.config
+
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_config)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          // def new_id = id_(tup[0], tup[1], comp_config)
+          def new_id = tup[0]
+          if (id_ instanceof String) {
+            new_id = id_
+          } else if (id_ instanceof Closure) {
+            new_id = id_(new_id, tup[1], comp_config)
+          }
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def data_ch = id_ch | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_config)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_config)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+      
+      post_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runComponentsWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component itself.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component itself.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runEach(Map args) {
+  assert args.components: "runEach should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runEach"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def runIf_ = args.runIf
+  def id_ = args.id
+
+  assert !runIf_ || runIf_ instanceof Closure: "runEach: must pass a Closure to runIf."
+
+  workflow runEachWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          def new_id = id_
+          if (new_id instanceof Closure) {
+            new_id = new_id(tup[0], tup[1], comp_)
+          }
+          assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}"
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def chPassthrough = null
+      def chRun = null
+      if (runIf_) {
+        def idRunIfBranch = id_ch.branch{ tup ->
+          run: runIf_(tup[0], tup[1], comp_)
+          passthrough: true
+        }
+        chPassthrough = idRunIfBranch.passthrough
+        chRun = idRunIfBranch.run
+      } else {
+        chRun = id_ch
+        chPassthrough = Channel.empty()
+      }
+      def data_ch = chRun | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+
+      def return_ch = post_ch
+        | concat(chPassthrough)
+      
+      return_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runEachWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf'
+/**
+ * Join sourceChannel to targetChannel
+ * 
+ * This function joins the sourceChannel to the targetChannel. 
+ * However, each id in the targetChannel must be present in the
+ * sourceChannel. If _meta.join_id exists in the targetChannel, that is 
+ * used as an id instead. If the id doesn't match any id in the sourceChannel,
+ * an error is thrown.
+ */
+
+def safeJoin(targetChannel, sourceChannel, key) {
+  def sourceIDs = new IDChecker()
+
+  def sourceCheck = sourceChannel
+    | map { tup ->
+      sourceIDs.observe(tup[0])
+      tup
+    }
+  def targetCheck = targetChannel
+    | map { tup ->
+      def id = tup[0]
+      
+      if (!sourceIDs.contains(id)) {
+        error (
+          "Error in module '${key}' when merging output with original state.\n" +
+          "  Reason: output with id '${id}' could not be joined with source channel.\n" +
+          "    If the IDs in the output channel differ from the input channel,\n" + 
+          "    please set `tup[1]._meta.join_id to the original ID.\n" +
+          "  Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + 
+          "  Unexpected ID in the output channel: '${id}'.\n" +
+          "  Example input event: [\"id\", [input: file(...)]],\n" +
+          "  Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]"
+        )
+      }
+      // TODO: add link to our documentation on how to fix this
+
+      tup
+    }
+  
+  sourceCheck.cross(targetChannel)
+    | map{ left, right ->
+      right + left.drop(1)
+    }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf'
+def _processArgument(arg) {
+  arg.multiple = arg.multiple != null ? arg.multiple : false
+  arg.required = arg.required != null ? arg.required : false
+  arg.direction = arg.direction != null ? arg.direction : "input"
+  arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";"
+  arg.plainName = arg.name.replaceAll("^-*", "")
+
+  if (arg.type == "file") {
+    arg.must_exist = arg.must_exist != null ? arg.must_exist : true
+    arg.create_parent = arg.create_parent != null ? arg.create_parent : true
+  }
+
+  // add default values to output files which haven't already got a default
+  if (arg.type == "file" && arg.direction == "output" && arg.default == null) {
+    def mult = arg.multiple ? "_*" : ""
+    def extSearch = ""
+    if (arg.default != null) {
+      extSearch = arg.default
+    } else if (arg.example != null) {
+      extSearch = arg.example
+    }
+    if (extSearch instanceof List) {
+      extSearch = extSearch[0]
+    }
+    def extSearchResult = extSearch.find("\\.[^\\.]+\$")
+    def ext = extSearchResult != null ? extSearchResult : ""
+    arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}"
+    if (arg.multiple) {
+      arg.default = [arg.default]
+    }
+  }
+
+  if (!arg.multiple) {
+    if (arg.default != null && arg.default instanceof List) {
+      arg.default = arg.default[0]
+    }
+    if (arg.example != null && arg.example instanceof List) {
+      arg.example = arg.example[0]
+    }
+  }
+
+  if (arg.type == "boolean_true") {
+    arg.default = false
+  }
+  if (arg.type == "boolean_false") {
+    arg.default = true
+  }
+
+  arg
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf'
+def addGlobalArguments(config) {
+  def localConfig = [
+    "argument_groups": [
+      [
+        "name": "Nextflow input-output arguments",
+        "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+        "arguments" : [
+          [
+            'name': '--publish_dir',
+            'required': true,
+            'type': 'string',
+            'description': 'Path to an output directory.',
+            'example': 'output/',
+            'multiple': false
+          ],
+          [
+            'name': '--param_list',
+            'required': false,
+            'type': 'string',
+            'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.
+            |
+            |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`.
+            |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.
+            |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`.
+            |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`.
+            |
+            |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(),
+            'example': 'my_params.yaml',
+            'multiple': false,
+            'hidden': true
+          ]
+          // TODO: allow multiple: true in param_list?
+          // TODO: allow to specify a --param_list_regex to filter the param_list?
+          // TODO: allow to specify a --param_list_from_state to remap entries in the param_list?
+        ]
+      ]
+    ]
+  ]
+
+  return processConfig(_mergeMap(config, localConfig))
+}
+
+def _mergeMap(Map lhs, Map rhs) {
+  return rhs.inject(lhs.clone()) { map, entry ->
+    if (map[entry.key] instanceof Map && entry.value instanceof Map) {
+      map[entry.key] = _mergeMap(map[entry.key], entry.value)
+    } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) {
+      map[entry.key] += entry.value
+    } else {
+      map[entry.key] = entry.value
+    }
+    return map
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf'
+def _generateArgumentHelp(param) {
+  // alternatives are not supported
+  // def names = param.alternatives ::: List(param.name)
+
+  def unnamedProps = [
+    ["required parameter", param.required],
+    ["multiple values allowed", param.multiple],
+    ["output", param.direction.toLowerCase() == "output"],
+    ["file must exist", param.type == "file" && param.must_exist]
+  ].findAll{it[1]}.collect{it[0]}
+  
+  def dflt = null
+  if (param.default != null) {
+    if (param.default instanceof List) {
+      dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      dflt = param.default.toString()
+    }
+  }
+  def example = null
+  if (param.example != null) {
+    if (param.example instanceof List) {
+      example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      example = param.example.toString()
+    }
+  }
+  def min = param.min?.toString()
+  def max = param.max?.toString()
+
+  def escapeChoice = { choice ->
+    def s1 = choice.replaceAll("\\n", "\\\\n")
+    def s2 = s1.replaceAll("\"", """\\\"""")
+    s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2
+  }
+  def choices = param.choices == null ? 
+    null : 
+    "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]"
+
+  def namedPropsStr = [
+    ["type", ([param.type] + unnamedProps).join(", ")],
+    ["default", dflt],
+    ["example", example],
+    ["choices", choices],
+    ["min", min],
+    ["max", max]
+  ]
+    .findAll{it[1]}
+    .collect{"\n        " + it[0] + ": " + it[1].replaceAll("\n", "\\n")}
+    .join("")
+  
+  def descStr = param.description == null ?
+    "" :
+    _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n        ")
+  
+  "\n    --" + param.plainName +
+    namedPropsStr +
+    descStr
+}
+
+// Based on Helper.generateHelp() in Helper.scala
+def _generateHelp(config) {
+  def fun = config
+
+  // PART 1: NAME AND VERSION
+  def nameStr = fun.name + 
+    (fun.version == null ? "" : " " + fun.version)
+
+  // PART 2: DESCRIPTION
+  def descrStr = fun.description == null ? 
+    "" :
+    "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n")
+
+  // PART 3: Usage
+  def usageStr = fun.usage == null ? 
+    "" :
+    "\n\nUsage:\n" + fun.usage.trim()
+
+  // PART 4: Options
+  def argGroupStrs = fun.allArgumentGroups.collect{argGroup ->
+    def name = argGroup.name
+    def descriptionStr = argGroup.description == null ?
+      "" :
+      "\n    " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n    ") + "\n"
+    def arguments = argGroup.arguments.collect{arg -> 
+      arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg
+    }.findAll{it != null}
+    def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)}
+    
+    "\n\n$name:" +
+      descriptionStr +
+      argumentStrs.join("\n")
+  }
+
+  // FINAL: combine
+  def out = nameStr + 
+    descrStr +
+    usageStr + 
+    argGroupStrs.join("")
+
+  return out
+}
+
+// based on Format._paragraphWrap
+def _paragraphWrap(str, maxLength) {
+  def outLines = []
+  str.split("\n").each{par ->
+    def words = par.split("\\s").toList()
+
+    def word = null
+    def line = words.pop()
+    while(!words.isEmpty()) {
+      word = words.pop()
+      if (line.length() + word.length() + 1 <= maxLength) {
+        line = line + " " + word
+      } else {
+        outLines.add(line)
+        line = word
+      }
+    }
+    if (words.isEmpty()) {
+      outLines.add(line)
+    }
+  }
+  return outLines
+}
+
+def helpMessage(config) {
+  if (params.containsKey("help") && params.help) {
+    def mergedConfig = addGlobalArguments(config)
+    def helpStr = _generateHelp(mergedConfig)
+    println(helpStr)
+    exit 0
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf'
+def processConfig(config) {
+  // set defaults for arguments
+  config.arguments = 
+    (config.arguments ?: []).collect{_processArgument(it)}
+
+  // set defaults for argument_group arguments
+  config.argument_groups =
+    (config.argument_groups ?: []).collect{grp ->
+      grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)}
+      grp
+    }
+
+  // create combined arguments list
+  config.allArguments = 
+    config.arguments +
+    config.argument_groups.collectMany{it.arguments}
+
+  // add missing argument groups (based on Functionality::allArgumentGroups())
+  def argGroups = config.argument_groups
+  if (argGroups.any{it.name.toLowerCase() == "arguments"}) {
+    argGroups = argGroups.collect{ grp ->
+      if (grp.name.toLowerCase() == "arguments") {
+        grp = grp + [
+          arguments: grp.arguments + config.arguments
+        ]
+      }
+      grp
+    }
+  } else {
+    argGroups = argGroups + [
+      name: "Arguments",
+      arguments: config.arguments
+    ]
+  }
+  config.allArgumentGroups = argGroups
+
+  config
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf'
+
+def readConfig(file) {
+  def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml"))
+  processConfig(config)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf'
+/**
+  * Resolve a path relative to the current file.
+  * 
+  * @param str The path to resolve, as a String.
+  * @param parentPath The path to resolve relative to, as a Path.
+  *
+  * @return The path that may have been resovled, as a Path.
+  */
+def _resolveSiblingIfNotAbsolute(str, parentPath) {
+  if (str !instanceof String) {
+    return str
+  }
+  if (!_stringIsAbsolutePath(str)) {
+    return parentPath.resolveSibling(str)
+  } else {
+    return file(str, hidden: true)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf'
+/**
+  * Check whether a path as a string is absolute.
+  *
+  * In the past, we tried using `file(., relative: true).isAbsolute()`,
+  * but the 'relative' option was added in 22.10.0.
+  *
+  * @param path The path to check, as a String.
+  *
+  * @return Whether the path is absolute, as a boolean.
+  */
+def _stringIsAbsolutePath(path) {
+  def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/
+
+  assert path instanceof String
+  return _resolve_URL_PROTOCOL.matcher(path).matches()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf'
+class CustomTraceObserver implements nextflow.trace.TraceObserver {
+  List traces
+
+  CustomTraceObserver(List traces) {
+    this.traces = traces
+  }
+
+  @Override
+  void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+
+  @Override
+  void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+}
+
+def collectTraces() {
+  def traces = Collections.synchronizedList([])
+
+  // add custom trace observer which stores traces in the traces object
+  session.observers.add(new CustomTraceObserver(traces))
+
+  traces
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf'
+/**
+  * Performs a deep clone of the given object.
+  * @param x an object
+  */
+def deepClone(x) {
+  iterateMap(x, {it instanceof Cloneable ? it.clone() : it})
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf'
+def getPublishDir() {
+  return params.containsKey("publish_dir") ? params.publish_dir : 
+    params.containsKey("publishDir") ? params.publishDir : 
+    null
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf'
+
+// Recurse upwards until we find a '.build.yaml' file
+def _findBuildYamlFile(pathPossiblySymlink) {
+  def path = pathPossiblySymlink.toRealPath()
+  def child = path.resolve(".build.yaml")
+  if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) {
+    return child
+  } else {
+    def parent = path.getParent()
+    if (parent == null) {
+      return null
+    } else {
+      return _findBuildYamlFile(parent)
+    }
+  }
+}
+
+// get the root of the target folder
+def getRootDir() {
+  def dir = _findBuildYamlFile(meta.resources_dir)
+  assert dir != null: "Could not find .build.yaml in the folder structure"
+  dir.getParent()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf'
+/**
+  * Recursively apply a function over the leaves of an object.
+  * @param obj The object to iterate over.
+  * @param fun The function to apply to each value.
+  * @return The object with the function applied to each value.
+  */
+def iterateMap(obj, fun) {
+  if (obj instanceof List && obj !instanceof String) {
+    return obj.collect{item ->
+      iterateMap(item, fun)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectEntries{key, item ->
+      [key.toString(), iterateMap(item, fun)]
+    }
+  } else {
+    return fun(obj)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf'
+/**
+  * A view for printing the event of each channel as a YAML blob.
+  * This is useful for debugging.
+  */
+def niceView() {
+  workflow niceViewWf {
+    take: input
+    main:
+      output = input
+        | view{toYamlBlob(it)}
+    emit: output
+  }
+  return niceViewWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf'
+
+def readCsv(file_path) {
+  def output = []
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+
+  // todo: allow escaped quotes in string
+  // todo: allow single quotes?
+  def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''')
+  def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''')
+
+  def br = java.nio.file.Files.newBufferedReader(inputFile)
+
+  def row = -1
+  def header = null
+  while (br.ready() && header == null) {
+    def line = br.readLine()
+    row++
+    if (!line.startsWith("#")) {
+      header = splitRegex.split(line, -1).collect{field ->
+        m = removeQuote.matcher(field)
+        m.find() ? m.replaceFirst('$1') : field
+      }
+    }
+  }
+  assert header != null: "CSV file should contain a header"
+
+  while (br.ready()) {
+    def line = br.readLine()
+    row++
+    if (line == null) {
+      br.close()
+      break
+    }
+
+    if (!line.startsWith("#")) {
+      def predata = splitRegex.split(line, -1)
+      def data = predata.collect{field ->
+        if (field == "") {
+          return null
+        }
+        def m = removeQuote.matcher(field)
+        if (m.find()) {
+          return m.replaceFirst('$1')
+        } else {
+          return field
+        }
+      }
+      assert header.size() == data.size(): "Row $row should contain the same number as fields as the header"
+      
+      def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null}
+      output.add(dataMap)
+    }
+  }
+
+  output
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf'
+def readJson(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parse(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf'
+def readJsonBlob(str) {
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parseText(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf'
+// Custom constructor to modify how certain objects are parsed from YAML
+class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor {
+  Path root
+
+  class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct {
+    public Object construct(org.yaml.snakeyaml.nodes.Node node) {
+      String filename = (String) constructScalar(node);
+      if (root != null) {
+        return root.resolve(filename);
+      }
+      return java.nio.file.Paths.get(filename);
+    }
+  }
+
+  CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) {
+    super(options)
+    this.root = root
+    // Handling !file tag and parse it back to a File type
+    this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath())
+  }
+}
+
+def readTaggedYaml(Path path) {
+  def options = new org.yaml.snakeyaml.LoaderOptions()
+  def constructor = new CustomConstructor(options, path.getParent())
+  def yaml = new org.yaml.snakeyaml.Yaml(constructor)
+  return yaml.load(path.text)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf'
+def readYaml(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf'
+def readYamlBlob(str) {
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf'
+String toJsonBlob(data) {
+  return groovy.json.JsonOutput.toJson(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf'
+// Custom representer to modify how certain objects are represented in YAML
+class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer {
+  Path relativizer
+
+  class RepresentPath implements org.yaml.snakeyaml.representer.Represent {
+    public String getFileName(Object obj) {
+      if (obj instanceof File) {
+        obj = ((File) obj).toPath();
+      }
+      if (obj !instanceof Path) {
+        throw new IllegalArgumentException("Object: " + obj + " is not a Path or File");
+      }
+      def path = (Path) obj;
+
+      if (relativizer != null) {
+        return relativizer.relativize(path).toString()
+      } else {
+        return path.toString()
+      }
+    }
+
+    public org.yaml.snakeyaml.nodes.Node representData(Object data) {
+      String filename = getFileName(data);
+      def tag = new org.yaml.snakeyaml.nodes.Tag("!file");
+      return representScalar(tag, filename);
+    }
+  }
+  CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) {
+    super(options)
+    this.relativizer = relativizer
+    this.representers.put(sun.nio.fs.UnixPath, new RepresentPath())
+    this.representers.put(Path, new RepresentPath())
+    this.representers.put(File, new RepresentPath())
+  }
+}
+
+String toTaggedYamlBlob(data) {
+  return toRelativeTaggedYamlBlob(data, null)
+}
+String toRelativeTaggedYamlBlob(data, Path relativizer) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  def representer = new CustomRepresenter(options, relativizer)
+  def yaml = new org.yaml.snakeyaml.Yaml(representer, options)
+  return yaml.dump(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf'
+String toYamlBlob(data) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  options.setPrettyFlow(true)
+  def yaml = new org.yaml.snakeyaml.Yaml(options)
+  def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it })
+  return yaml.dump(cleanData)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf'
+void writeJson(data, file) {
+  assert data: "writeJson: data should not be null"
+  assert file: "writeJson: file should not be null"
+  file.write(toJsonBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf'
+void writeYaml(data, file) {
+  assert data: "writeYaml: data should not be null"
+  assert file: "writeYaml: file should not be null"
+  file.write(toYamlBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf'
+def findStates(Map params, Map config) {
+  def auto_config = deepClone(config)
+  def auto_params = deepClone(params)
+
+  auto_config = auto_config.clone()
+  // override arguments
+  auto_config.argument_groups = []
+  auto_config.arguments = [
+    [
+      type: "string",
+      name: "--id",
+      description: "A dummy identifier",
+      required: false
+    ],
+    [
+      type: "file",
+      name: "--input_states",
+      example: "/path/to/input/directory/**/state.yaml",
+      description: "Path to input directory containing the datasets to be integrated.",
+      required: true,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--filter",
+      example: "foo/.*/state.yaml",
+      description: "Regex to filter state files by path.",
+      required: false
+    ],
+    // to do: make this a yaml blob?
+    [
+      type: "string",
+      name: "--rename_keys",
+      example: ["newKey1:oldKey1", "newKey2:oldKey2"],
+      description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.",
+      required: false,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--settings",
+      example: '{"output_dataset": "dataset.h5ad", "k": 10}',
+      description: "Global arguments as a JSON glob to be passed to all components.",
+      required: false
+    ]
+  ]
+  if (!(auto_params.containsKey("id"))) {
+    auto_params["id"] = "auto"
+  }
+
+  // run auto config through processConfig once more
+  auto_config = processConfig(auto_config)
+
+  workflow findStatesWf {
+    helpMessage(auto_config)
+
+    output_ch = 
+      channelFromParams(auto_params, auto_config)
+        | flatMap { autoId, args ->
+
+          def globalSettings = args.settings ? readYamlBlob(args.settings) : [:]
+
+          // look for state files in input dir
+          def stateFiles = args.input_states
+
+          // filter state files by regex
+          if (args.filter) {
+            stateFiles = stateFiles.findAll{ stateFile ->
+              def stateFileStr = stateFile.toString()
+              def matcher = stateFileStr =~ args.filter
+              matcher.matches()}
+          }
+
+          // read in states
+          def states = stateFiles.collect { stateFile ->
+            def state_ = readTaggedYaml(stateFile)
+            [state_.id, state_]
+          }
+
+          // construct renameMap
+          if (args.rename_keys) {
+            def renameMap = args.rename_keys.collectEntries{renameString ->
+              def split = renameString.split(":")
+              assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey', or 'newKey:oldKey;newKey:oldKey' in case of multiple values"
+              split
+            }
+
+            // rename keys in state, only let states through which have all keys
+            // also add global settings
+            states = states.collectMany{id, state ->
+              def newState = [:]
+
+              for (key in renameMap.keySet()) {
+                def origKey = renameMap[key]
+                if (!(state.containsKey(origKey))) {
+                  return []
+                }
+                newState[key] = state[origKey]
+              }
+
+              [[id, globalSettings + newState]]
+            }
+          }
+
+          states
+        }
+    emit:
+    output_ch
+  }
+
+  return findStatesWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf'
+def joinStates(Closure apply_) {
+  workflow joinStatesWf {
+    take: input_ch
+    main:
+    output_ch = input_ch
+      | toSortedList
+      | filter{ it.size() > 0 }
+      | map{ tups ->
+        def ids = tups.collect{it[0]}
+        def states = tups.collect{it[1]}
+        apply_(ids, states)
+      }
+
+    emit: output_ch
+  }
+  return joinStatesWf
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf'
+def collectFiles(obj) {
+  if (obj instanceof java.io.File || obj instanceof Path)  {
+    return [obj]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.collectMany{item ->
+      collectFiles(item)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectFiles(item)
+    }
+  } else {
+    return []
+  }
+}
+
+/**
+ * Recurse through a state and collect all input files and their target output filenames.
+ * @param obj The state to recurse through.
+ * @param prefix The prefix to prepend to the output filenames.
+ */
+def collectInputOutputPaths(obj, prefix) {
+  if (obj instanceof File || obj instanceof Path)  {
+    def path = obj instanceof Path ? obj : obj.toPath()
+    def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: ""
+    def newFilename = prefix + ext
+    return [[obj, newFilename]]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.withIndex().collectMany{item, ix ->
+      collectInputOutputPaths(item, prefix + "_" + ix)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectInputOutputPaths(item, prefix + "." + key)
+    }
+  } else {
+    return []
+  }
+}
+
+def publishStates(Map args) {
+  def key_ = args.get("key")
+  def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml'))
+
+  assert key_ != null : "publishStates: key must be specified"
+  
+  workflow publishStatesWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1]
+
+          // the input files and the target output filenames
+          def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose()
+          def inputFiles_ = inputoutputFilenames_[0]
+          def outputFilenames_ = inputoutputFilenames_[1]
+
+          def yamlFilename = yamlTemplate_
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+
+            // TODO: do the pathnames in state_ match up with the outputFilenames_?
+
+          // convert state to yaml blob
+          def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename))
+
+          [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesWf
+}
+process publishStatesProc {
+  // todo: check publishpath?
+  publishDir path: "${getPublishDir()}/", mode: "copy"
+  tag "$id"
+  input:
+    tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles)
+  output:
+    tuple val(id), path{[yamlFile] + outputFiles}
+  script:
+  def copyCommands = [
+    inputFiles instanceof List ? inputFiles : [inputFiles],
+    outputFiles instanceof List ? outputFiles : [outputFiles]
+  ]
+    .transpose()
+    .collectMany{infile, outfile ->
+      if (infile.toString() != outfile.toString()) {
+        [
+          "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"",
+          "cp -r '${infile.toString()}' '${outfile.toString()}'"
+        ]
+      } else {
+        // no need to copy if infile is the same as outfile
+        []
+      }
+    }
+  """
+mkdir -p "\$(dirname '${yamlFile}')"
+echo "Storing state as yaml"
+echo '${yamlBlob}' > '${yamlFile}'
+echo "Copying output files to destination folder"
+${copyCommands.join("\n  ")}
+"""
+}
+
+
+// this assumes that the state contains no other values other than those specified in the config
+def publishStatesByConfig(Map args) {
+  def config = args.get("config")
+  assert config != null : "publishStatesByConfig: config must be specified"
+
+  def key_ = args.get("key", config.name)
+  assert key_ != null : "publishStatesByConfig: key must be specified"
+  
+  workflow publishStatesSimpleWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10]
+          def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad']
+
+          // TODO: allow overriding the state.yaml template
+          // TODO TODO: if auto.publish == "state", add output_state as an argument
+          def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml'
+          def yamlFilename = yamlTemplate
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+          def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent()
+
+          // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where
+          //   - key is a String
+          //   - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path)
+          //   - inputPath is a List[Path]
+          //   - outputFilename is a List[String]
+          //   - (key, value) are the tuples that will be saved to the state.yaml file
+          //   - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml)
+          def processedState =
+            config.allArguments
+              .findAll { it.direction == "output" }
+              .collectMany { par ->
+                def plainName_ = par.plainName
+                // if the state does not contain the key, it's an
+                // optional argument for which the component did 
+                // not generate any output
+                if (!state_.containsKey(plainName_)) {
+                  return []
+                }
+                def value = state_[plainName_]
+                // if the parameter is not a file, it should be stored
+                // in the state as-is, but is not something that needs 
+                // to be copied from the source path to the dest path
+                if (par.type != "file") {
+                  return [[key: plainName_, value: value, inputPath: [], outputFilename: []]]
+                }
+                // if the orig state does not contain this filename,
+                // it's an optional argument for which the user specified
+                // that it should not be returned as a state
+                if (!origState_.containsKey(plainName_)) {
+                  return []
+                }
+                def filenameTemplate = origState_[plainName_]
+                // if the pararameter is multiple: true, fetch the template
+                if (par.multiple && filenameTemplate instanceof List) {
+                  filenameTemplate = filenameTemplate[0]
+                }
+                // instantiate the template
+                def filename = filenameTemplate
+                  .replaceAll('\\$id', id_)
+                  .replaceAll('\\$\\{id\\}', id_)
+                  .replaceAll('\\$key', key_)
+                  .replaceAll('\\$\\{key\\}', key_)
+                if (par.multiple) {
+                  // if the parameter is multiple: true, the filename
+                  // should contain a wildcard '*' that is replaced with
+                  // the index of the file
+                  assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}"
+                  def outputPerFile = value.withIndex().collect{ val, ix ->
+                    def filename_ix = filename.replace("*", ix.toString())
+                    def value_ = java.nio.file.Paths.get(filename_ix)
+                    // if id contains a slash
+                    if (yamlDir != null) {
+                      value_ = yamlDir.relativize(value_)
+                    }
+                    def inputPath = val instanceof File ? val.toPath() : val
+                    [value: value_, inputPath: inputPath, outputFilename: filename_ix]
+                  }
+                  def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> 
+                    [key, outputPerFile.collect{dic -> dic[key]}]
+                  }
+                  return [[key: plainName_] + transposedOutputs]
+                } else {
+                  def value_ = java.nio.file.Paths.get(filename)
+                  // if id contains a slash
+                  if (yamlDir != null) {
+                    value_ = yamlDir.relativize(value_)
+                  }
+                  def inputPath = value instanceof File ? value.toPath() : value
+                  return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]]
+                }
+              }
+          
+          def updatedState_ = processedState.collectEntries{[it.key, it.value]}
+          def inputPaths = processedState.collectMany{it.inputPath}
+          def outputFilenames = processedState.collectMany{it.outputFilename}
+          
+          // convert state to yaml blob
+          def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_)
+
+          [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesSimpleWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf'
+def setState(fun) {
+  assert fun instanceof Closure || fun instanceof Map || fun instanceof List :
+    "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}"
+
+  // if fun is a List, convert to map
+  if (fun instanceof List) {
+    // check whether fun is a list[string]
+    assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings"
+    fun = fun.collectEntries{[it, it]}
+  }
+
+  // if fun is a map, convert to closure
+  if (fun instanceof Map) {
+    // check whether fun is a map[string, string]
+    assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings"
+    assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings"
+    def funMap = fun.clone()
+    // turn the map into a closure to be used later on
+    fun = { id_, state_ ->
+      assert state_ instanceof Map : "Error in setState: the state is not a Map"
+      funMap.collectMany{newkey, origkey ->
+        if (state_.containsKey(origkey)) {
+          [[newkey, state_[origkey]]]
+        } else {
+          []
+        }
+      }.collectEntries()
+    }
+  }
+
+  map { tup ->
+    def id = tup[0]
+    def state = tup[1]
+    def unfilteredState = fun(id, state)
+    def newState = unfilteredState.findAll{key, val -> val != null}
+    [id, newState] + tup.drop(2)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf'
+// TODO: unit test processAuto
+def processAuto(Map auto) {
+  // remove null values
+  auto = auto.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"]
+  def unexpectedKeys = auto.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'"
+
+  // check auto.simplifyInput
+  assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean"
+
+  // check auto.simplifyOutput
+  assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean"
+
+  // check auto.transcript
+  assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean"
+
+  // check auto.publish
+  assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'"
+
+  return auto.subMap(expectedKeys)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf'
+def assertMapKeys(map, expectedKeys, requiredKeys, mapName) {
+  assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}"
+  map.forEach { key, val -> 
+    assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+  requiredKeys.forEach { requiredKey -> 
+    assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+}
+
+// TODO: unit test processDirectives
+def processDirectives(Map drctv) {
+  // remove null values
+  drctv = drctv.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = [
+    "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time"
+  ]
+  def unexpectedKeys = drctv.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'"
+
+  /* DIRECTIVE accelerator
+    accepted examples:
+    - [ limit: 4, type: "nvidia-tesla-k80" ]
+  */
+  if (drctv.containsKey("accelerator")) {
+    assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator")
+  }
+
+  /* DIRECTIVE afterScript
+    accepted examples:
+    - "source /cluster/bin/cleanup"
+  */
+  if (drctv.containsKey("afterScript")) {
+    assert drctv["afterScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE beforeScript
+    accepted examples:
+    - "source /cluster/bin/setup"
+  */
+  if (drctv.containsKey("beforeScript")) {
+    assert drctv["beforeScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cache
+    accepted examples:
+    - true
+    - false
+    - "deep"
+    - "lenient"
+  */
+  if (drctv.containsKey("cache")) {
+    assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean
+    if (drctv["cache"] instanceof CharSequence) {
+      assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache"
+    }
+  }
+
+  /* DIRECTIVE conda
+    accepted examples:
+    - "bwa=0.7.15"
+    - "bwa=0.7.15 fastqc=0.11.5"
+    - ["bwa=0.7.15", "fastqc=0.11.5"]
+  */
+  if (drctv.containsKey("conda")) {
+    if (drctv["conda"] instanceof List) {
+      drctv["conda"] = drctv["conda"].join(" ")
+    }
+    assert drctv["conda"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE container
+    accepted examples:
+    - "foo/bar:tag"
+    - [ registry: "reg", image: "im", tag: "ta" ]
+      is transformed to "reg/im:ta"
+    - [ image: "im" ] 
+      is transformed to "im:latest"
+  */
+  if (drctv.containsKey("container")) {
+    assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence
+    if (drctv["container"] instanceof Map) {
+      def m = drctv["container"]
+      assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container")
+      def part1 = 
+        System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : 
+        params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove?
+        m.registry ? m.registry + "/" : 
+        ""
+      def part2 = m.image
+      def part3 = m.tag ? ":" + m.tag : ":latest"
+      drctv["container"] = part1 + part2 + part3
+    }
+  }
+
+  /* DIRECTIVE containerOptions
+    accepted examples:
+    - "--foo bar"
+    - ["--foo bar", "-f b"]
+  */
+  if (drctv.containsKey("containerOptions")) {
+    if (drctv["containerOptions"] instanceof List) {
+      drctv["containerOptions"] = drctv["containerOptions"].join(" ")
+    }
+    assert drctv["containerOptions"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cpus
+    accepted examples:
+    - 1
+    - 10
+  */
+  if (drctv.containsKey("cpus")) {
+    assert drctv["cpus"] instanceof Integer
+  }
+
+  /* DIRECTIVE disk
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("disk")) {
+    assert drctv["disk"] instanceof CharSequence
+    // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE echo
+    accepted examples:
+    - true
+    - false
+  */
+  if (drctv.containsKey("echo")) {
+    assert drctv["echo"] instanceof Boolean
+  }
+
+  /* DIRECTIVE errorStrategy
+    accepted examples:
+    - "terminate"
+    - "finish"
+  */
+  if (drctv.containsKey("errorStrategy")) {
+    assert drctv["errorStrategy"] instanceof CharSequence
+    assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy"
+  }
+
+  /* DIRECTIVE executor
+    accepted examples:
+    - "local"
+    - "sge"
+  */
+  if (drctv.containsKey("executor")) {
+    assert drctv["executor"] instanceof CharSequence
+    assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor"
+  }
+
+  /* DIRECTIVE machineType
+    accepted examples:
+    - "n1-highmem-8"
+  */
+  if (drctv.containsKey("machineType")) {
+    assert drctv["machineType"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE maxErrors
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxErrors")) {
+    assert drctv["maxErrors"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxForks
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxForks")) {
+    assert drctv["maxForks"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxRetries
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxRetries")) {
+    assert drctv["maxRetries"] instanceof Integer
+  }
+
+  /* DIRECTIVE memory
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("memory")) {
+    assert drctv["memory"] instanceof CharSequence
+    // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE module
+    accepted examples:
+    - "ncbi-blast/2.2.27"
+    - "ncbi-blast/2.2.27:t_coffee/10.0"
+    - ["ncbi-blast/2.2.27", "t_coffee/10.0"]
+  */
+  if (drctv.containsKey("module")) {
+    if (drctv["module"] instanceof List) {
+      drctv["module"] = drctv["module"].join(":")
+    }
+    assert drctv["module"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE penv
+    accepted examples:
+    - "smp"
+  */
+  if (drctv.containsKey("penv")) {
+    assert drctv["penv"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE pod
+    accepted examples:
+    - [ label: "key", value: "val" ]
+    - [ annotation: "key", value: "val" ]
+    - [ env: "key", value: "val" ]
+    - [ [label: "l", value: "v"], [env: "e", value: "v"]]
+  */
+  if (drctv.containsKey("pod")) {
+    if (drctv["pod"] instanceof Map) {
+      drctv["pod"] = [ drctv["pod"] ]
+    }
+    assert drctv["pod"] instanceof List
+    drctv["pod"].forEach { pod ->
+      assert pod instanceof Map
+      // TODO: should more checks be added?
+      // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod
+      // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...?
+    }
+  }
+
+  /* DIRECTIVE publishDir
+    accepted examples:
+    - []
+    - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ]
+    - "/path/to/dir" 
+      is transformed to [[ path: "/path/to/dir" ]]
+    - [ path: "/path/to/dir", mode: "cache" ]
+      is transformed to [[ path: "/path/to/dir", mode: "cache" ]]
+  */
+  // TODO: should we also look at params["publishDir"]?
+  if (drctv.containsKey("publishDir")) {
+    def pblsh = drctv["publishDir"]
+    
+    // check different options
+    assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence
+    
+    // turn into list if not already so
+    // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work.
+    pblsh = pblsh instanceof List ? pblsh : [ pblsh ]
+
+    // check elements of publishDir
+    pblsh = pblsh.collect{ elem ->
+      // turn into map if not already so
+      elem = elem instanceof CharSequence ? [ path: elem ] : elem
+
+      // check types and keys
+      assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}"
+      assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir")
+
+      // check elements in map
+      assert elem.containsKey("path")
+      assert elem["path"] instanceof CharSequence
+      if (elem.containsKey("mode")) {
+        assert elem["mode"] instanceof CharSequence
+        assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ]
+      }
+      if (elem.containsKey("overwrite")) {
+        assert elem["overwrite"] instanceof Boolean
+      }
+      if (elem.containsKey("pattern")) {
+        assert elem["pattern"] instanceof CharSequence
+      }
+      if (elem.containsKey("saveAs")) {
+        assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'"
+      }
+      if (elem.containsKey("enabled")) {
+        assert elem["enabled"] instanceof Boolean
+      }
+
+      // return final result
+      elem
+    }
+    // store final directive
+    drctv["publishDir"] = pblsh
+  }
+
+  /* DIRECTIVE queue
+    accepted examples:
+    - "long"
+    - "short,long"
+    - ["short", "long"]
+  */
+  if (drctv.containsKey("queue")) {
+    if (drctv["queue"] instanceof List) {
+      drctv["queue"] = drctv["queue"].join(",")
+    }
+    assert drctv["queue"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE label
+    accepted examples:
+    - "big_mem"
+    - "big_cpu"
+    - ["big_mem", "big_cpu"]
+  */
+  if (drctv.containsKey("label")) {
+    if (drctv["label"] instanceof CharSequence) {
+      drctv["label"] = [ drctv["label"] ]
+    }
+    assert drctv["label"] instanceof List
+    drctv["label"].forEach { label ->
+      assert label instanceof CharSequence
+      // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?")
+      // ^ does not allow closures
+    }
+  }
+
+  /* DIRECTIVE scratch
+    accepted examples:
+    - true
+    - "/path/to/scratch"
+    - '$MY_PATH_TO_SCRATCH'
+    - "ram-disk"
+  */
+  if (drctv.containsKey("scratch")) {
+    assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE storeDir
+    accepted examples:
+    - "/path/to/storeDir"
+  */
+  if (drctv.containsKey("storeDir")) {
+    assert drctv["storeDir"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE stageInMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageInMode")) {
+    assert drctv["stageInMode"] instanceof CharSequence
+    assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"]
+  }
+
+  /* DIRECTIVE stageOutMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageOutMode")) {
+    assert drctv["stageOutMode"] instanceof CharSequence
+    assert drctv["stageOutMode"] in ["copy", "move", "rsync"]
+  }
+
+  /* DIRECTIVE tag
+    accepted examples:
+    - "foo"
+    - '$id'
+  */
+  if (drctv.containsKey("tag")) {
+    assert drctv["tag"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE time
+    accepted examples:
+    - "1h"
+    - "2days"
+    - "1day 6hours 3minutes 30seconds"
+  */
+  if (drctv.containsKey("time")) {
+    assert drctv["time"] instanceof CharSequence
+    // todo: validation regex?
+  }
+
+  return drctv
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf'
+def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) {
+  // override defaults with args
+  def workflowArgs = defaultWfArgs + args
+
+  // check whether 'key' exists
+  assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument"
+
+  // if 'key' is a closure, apply it to the original key
+  if (workflowArgs["key"] instanceof Closure) {
+    workflowArgs["key"] = workflowArgs["key"](meta.config.name)
+  }
+  def key = workflowArgs["key"]
+  assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}"
+  assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}"
+
+  // check for any unexpected keys
+  def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"]
+  def unexpectedKeys = workflowArgs.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'"
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument"
+  assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}"
+  workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"])
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument"
+  assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}"
+  workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"])
+
+  // auto define publish, if so desired
+  if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.publish_dir = \"./output/\""
+    def publishDir = getPublishDir()
+    
+    if (publishDir != null) {
+      workflowArgs.directives.publishDir = [[ 
+        path: publishDir, 
+        saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default
+        mode: "copy"
+      ]]
+    }
+  }
+
+  // auto define transcript, if so desired
+  if (workflowArgs.auto.transcript == true) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.transcripts_dir = \"./transcripts/\""
+    def transcriptsDir = 
+      params.containsKey("transcripts_dir") ? params.transcripts_dir : 
+      params.containsKey("transcriptsDir") ? params.transcriptsDir : 
+      params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" :
+      params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : 
+      null
+    if (transcriptsDir != null) {
+      def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss')
+      def transcriptsPublishDir = [ 
+        path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/",
+        saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", 
+        mode: "copy"
+      ]
+      def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : []
+      workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir
+    }
+  }
+
+  // if this is a stubrun, remove certain directives?
+  if (workflow.stubRun) {
+    workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"])
+  }
+
+  for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam]) {
+      assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}"
+    }
+  }
+
+  // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well?
+  for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) {
+      log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead."
+    }
+  }
+
+  // check fromState
+  workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config)
+
+  // check toState
+  workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config)
+
+  // return output
+  return workflowArgs
+}
+
+def _processFromState(fromState, key_, config_) {
+  assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List :
+    "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}"
+  if (fromState == null) {
+    return null
+  }
+  
+  // if fromState is a List, convert to map
+  if (fromState instanceof List) {
+    // check whether fromstate is a list[string]
+    assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings"
+    fromState = fromState.collectEntries{[it, it]}
+  }
+
+  // if fromState is a map, convert to closure
+  if (fromState instanceof Map) {
+    // check whether fromstate is a map[string, string]
+    assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings"
+    assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings"
+    def fromStateMap = fromState.clone()
+    def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    fromState = { it ->
+      def state = it[1]
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def data = fromStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (state.containsKey(origkey)) {
+          [[newkey, state[origkey]]]
+        } else if (!requiredInputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state")
+        }
+      }.collectEntries()
+      data
+    }
+  }
+  
+  return fromState
+}
+
+def _processToState(toState, key_, config_) {
+  if (toState == null) {
+    toState = { tup -> tup[1] }
+  }
+
+  // toState should be a closure, map[string, string], or list[string]
+  assert toState instanceof Closure || toState instanceof Map || toState instanceof List :
+    "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}"
+
+  // if toState is a List, convert to map
+  if (toState instanceof List) {
+    // check whether toState is a list[string]
+    assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings"
+    toState = toState.collectEntries{[it, it]}
+  }
+
+  // if toState is a map, convert to closure
+  if (toState instanceof Map) {
+    // check whether toState is a map[string, string]
+    assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings"
+    assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings"
+    def toStateMap = toState.clone()
+    def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    toState = { it ->
+      def output = it[1]
+      def state = it[2]
+      assert output instanceof Map : "Error in module '$key_': the output is not a Map"
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def extraEntries = toStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (output.containsKey(origkey)) {
+          [[newkey, output[origkey]]]
+        } else if (!requiredOutputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output")
+        }
+      }.collectEntries()
+      state + extraEntries
+    }
+  }
+
+  return toState
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf'
+def _debug(workflowArgs, debugKey) {
+  if (workflowArgs.debug) {
+    view { "process '${workflowArgs.key}' $debugKey tuple: $it"  }
+  } else {
+    map { it }
+  }
+}
+
+// depends on: innerWorkflowFactory
+def workflowFactory(Map args, Map defaultWfArgs, Map meta) {
+  def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta)
+  def key_ = workflowArgs["key"]
+  
+  workflow workflowInstance {
+    take: input_
+
+    main:
+    def chModified = input_
+      | checkUniqueIds([:])
+      | _debug(workflowArgs, "input")
+      | map { tuple ->
+        tuple = deepClone(tuple)
+        
+        if (workflowArgs.map) {
+          tuple = workflowArgs.map(tuple)
+        }
+        if (workflowArgs.mapId) {
+          tuple[0] = workflowArgs.mapId(tuple[0])
+        }
+        if (workflowArgs.mapData) {
+          tuple[1] = workflowArgs.mapData(tuple[1])
+        }
+        if (workflowArgs.mapPassthrough) {
+          tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2))
+        }
+
+        // check tuple
+        assert tuple instanceof List : 
+          "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}"
+        assert tuple.size() >= 2 : 
+          "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: tuple.size() == ${tuple.size()}"
+        
+        // check id field
+        if (tuple[0] instanceof GString) {
+          tuple[0] = tuple[0].toString()
+        }
+        assert tuple[0] instanceof CharSequence : 
+          "Error in module '${key_}': first element of tuple in channel should be a String\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: ${tuple[0]}"
+        
+        // match file to input file
+        if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) {
+          def inputFiles = meta.config.allArguments
+            .findAll { it.type == "file" && it.direction == "input" }
+          
+          assert inputFiles.size() == 1 : 
+              "Error in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Anonymous file inputs are only allowed when the process has exactly one file input.\n" +
+              "  Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}"
+
+          tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries()
+        }
+
+        // check data field
+        assert tuple[1] instanceof Map : 
+          "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+        // rename keys of data field in tuple
+        if (workflowArgs.renameKeys) {
+          assert workflowArgs.renameKeys instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}"
+          assert tuple[1] instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+          // TODO: allow renameKeys to be a function?
+          workflowArgs.renameKeys.each { newKey, oldKey ->
+            assert newKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}"
+            assert oldKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}"
+            assert tuple[1].containsKey(oldKey) : 
+              "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" +
+              "  Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'"
+            tuple[1].put(newKey, tuple[1][oldKey])
+          }
+          tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey })
+        }
+        tuple
+      }
+
+
+    def chRun = null
+    def chPassthrough = null
+    if (workflowArgs.runIf) {
+      def runIfBranch = chModified.branch{ tup ->
+        run: workflowArgs.runIf(tup[0], tup[1])
+        passthrough: true
+      }
+      chRun = runIfBranch.run
+      chPassthrough = runIfBranch.passthrough
+    } else {
+      chRun = chModified
+      chPassthrough = Channel.empty()
+    }
+
+    def chRunFiltered = workflowArgs.filter ?
+      chRun | filter{workflowArgs.filter(it)} :
+      chRun
+
+    def chArgs = workflowArgs.fromState ? 
+      chRunFiltered | map{
+        def new_data = workflowArgs.fromState(it.take(2))
+        [it[0], new_data]
+      } :
+      chRunFiltered | map {tup -> tup.take(2)}
+
+    // fill in defaults
+    def chArgsWithDefaults = chArgs
+      | map { tuple ->
+        def id_ = tuple[0]
+        def data_ = tuple[1]
+
+        // TODO: could move fromState to here
+
+        // fetch default params from functionality
+        def defaultArgs = meta.config.allArguments
+          .findAll { it.containsKey("default") }
+          .collectEntries { [ it.plainName, it.default ] }
+
+        // fetch overrides in params
+        def paramArgs = meta.config.allArguments
+          .findAll { par ->
+            def argKey = key_ + "__" + par.plainName
+            params.containsKey(argKey)
+          }
+          .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] }
+        
+        // fetch overrides in data
+        def dataArgs = meta.config.allArguments
+          .findAll { data_.containsKey(it.plainName) }
+          .collectEntries { [ it.plainName, data_[it.plainName] ] }
+        
+        // combine params
+        def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs
+
+        // remove arguments with explicit null values
+        combinedArgs
+          .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"}
+
+        combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_)
+
+        [id_, combinedArgs] + tuple.drop(2)
+      }
+
+    // TODO: move some of the _meta.join_id wrangling to the safeJoin() function.
+    def chInitialOutput = chArgsWithDefaults
+      | _debug(workflowArgs, "processed")
+      // run workflow
+      | innerWorkflowFactory(workflowArgs)
+      // check output tuple
+      | map { id_, output_ ->
+
+        // see if output map contains metadata
+        def meta_ =
+          output_ instanceof Map && output_.containsKey("_meta") ? 
+          output_["_meta"] :
+          [:]
+        def join_id = meta_.join_id ?: id_
+        
+        // remove metadata
+        output_ = output_.findAll{k, v -> k != "_meta"}
+
+        // check value types
+        output_ = _processOutputValues(output_, meta.config, id_, key_)
+
+        // simplify output if need be
+        if (workflowArgs.auto.simplifyOutput && output_.size() == 1) {
+          output_ = output_.values()[0]
+        }
+
+        [join_id, id_, output_]
+      }
+      // | view{"chInitialOutput: ${it.take(3)}"}
+
+    // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...]
+    def chNewState = safeJoin(chInitialOutput, chRunFiltered, key_)
+      // input tuple format: [join_id, id, output, prev_state, ...]
+      // output tuple format: [join_id, id, new_state, ...]
+      | map{ tup ->
+        def new_state = workflowArgs.toState(tup.drop(1).take(3))
+        tup.take(2) + [new_state] + tup.drop(4)
+      }
+
+    if (workflowArgs.auto.publish == "state") {
+      def chPublish = chNewState
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [join_id, id, new_state]
+        | map{ tup ->
+          tup.take(3)
+        }
+
+      safeJoin(chPublish, chArgsWithDefaults, key_)
+        // input tuple format: [join_id, id, new_state, orig_state, ...]
+        // output tuple format: [id, new_state, orig_state]
+        | map { tup ->
+          tup.drop(1).take(3)
+      }
+        | publishStatesByConfig(key: key_, config: meta.config)
+    }
+
+    // remove join_id and meta
+    chReturn = chNewState
+      | map { tup ->
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [id, new_state, ...]
+        tup.drop(1)
+      }
+      | _debug(workflowArgs, "output")
+      | concat(chPassthrough)
+
+    emit: chReturn
+  }
+
+  def wf = workflowInstance.cloneWithName(key_)
+
+  // add factory function
+  wf.metaClass.run = { runArgs ->
+    workflowFactory(runArgs, workflowArgs, meta)
+  }
+  // add config to module for later introspection
+  wf.metaClass.config = meta.config
+
+  return wf
+}
+
+nextflow.enable.dsl=2
+
+// START COMPONENT-SPECIFIC CODE
+
+// create meta object
+meta = [
+  "resources_dir": moduleDir.toRealPath().normalize(),
+  "config": processConfig(readJsonBlob('''{
+  "name" : "rseqc_inferexperiment",
+  "namespace" : "rseqc",
+  "version" : "main",
+  "authors" : [
+    {
+      "name" : "Emma Rousseau",
+      "roles" : [
+        "author",
+        "maintainer"
+      ],
+      "info" : {
+        "links" : {
+          "email" : "emma@data-intuitive.com",
+          "github" : "emmarousseau",
+          "linkedin" : "emmarousseau1"
+        },
+        "organizations" : [
+          {
+            "name" : "Data Intuitive",
+            "href" : "https://www.data-intuitive.com",
+            "role" : "Bioinformatician"
+          }
+        ]
+      }
+    }
+  ],
+  "argument_groups" : [
+    {
+      "name" : "Input",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--input_file",
+          "alternatives" : [
+            "-i"
+          ],
+          "description" : "input alignment file in BAM or SAM format",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "file",
+          "name" : "--refgene",
+          "alternatives" : [
+            "-r"
+          ],
+          "description" : "Reference gene model in bed format",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Output",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--output",
+          "description" : "Output file (txt) of strandness report.",
+          "example" : [
+            "$id.strandedness.txt"
+          ],
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Options",
+      "arguments" : [
+        {
+          "type" : "integer",
+          "name" : "--sample_size",
+          "alternatives" : [
+            "-s"
+          ],
+          "description" : "Number of reads sampled from SAM/BAM file. Default: 200000\n",
+          "example" : [
+            200000
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "integer",
+          "name" : "--mapq",
+          "alternatives" : [
+            "-q"
+          ],
+          "description" : "Minimum mapping quality (phred scaled) to determine uniquely mapped reads. Default: 30\n",
+          "example" : [
+            30
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    }
+  ],
+  "resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "script.sh",
+      "is_executable" : true
+    }
+  ],
+  "description" : "Infer strandedness from sequencing reads\n",
+  "test_resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "test.sh",
+      "is_executable" : true
+    },
+    {
+      "type" : "file",
+      "path" : "test_data"
+    }
+  ],
+  "status" : "enabled",
+  "requirements" : {
+    "commands" : [
+      "ps"
+    ]
+  },
+  "license" : "GPL-3.0",
+  "references" : {
+    "doi" : [
+      "10.1093/bioinformatics/bts356"
+    ]
+  },
+  "links" : {
+    "repository" : "https://github.com/MonashBioinformaticsPlatform/RSeQC",
+    "homepage" : "https://rseqc.sourceforge.net/",
+    "documentation" : "https://rseqc.sourceforge.net/#infer-experiment-py",
+    "issue_tracker" : "https://github.com/MonashBioinformaticsPlatform/RSeQC/issues"
+  },
+  "runners" : [
+    {
+      "type" : "executable",
+      "id" : "executable",
+      "docker_setup_strategy" : "ifneedbepullelsecachedbuild"
+    },
+    {
+      "type" : "nextflow",
+      "id" : "nextflow",
+      "directives" : {
+        "tag" : "$id"
+      },
+      "auto" : {
+        "simplifyInput" : true,
+        "simplifyOutput" : false,
+        "transcript" : false,
+        "publish" : false
+      },
+      "config" : {
+        "labels" : {
+          "mem1gb" : "memory = 1000000000.B",
+          "mem2gb" : "memory = 2000000000.B",
+          "mem5gb" : "memory = 5000000000.B",
+          "mem10gb" : "memory = 10000000000.B",
+          "mem20gb" : "memory = 20000000000.B",
+          "mem50gb" : "memory = 50000000000.B",
+          "mem100gb" : "memory = 100000000000.B",
+          "mem200gb" : "memory = 200000000000.B",
+          "mem500gb" : "memory = 500000000000.B",
+          "mem1tb" : "memory = 1000000000000.B",
+          "mem2tb" : "memory = 2000000000000.B",
+          "mem5tb" : "memory = 5000000000000.B",
+          "mem10tb" : "memory = 10000000000000.B",
+          "mem20tb" : "memory = 20000000000000.B",
+          "mem50tb" : "memory = 50000000000000.B",
+          "mem100tb" : "memory = 100000000000000.B",
+          "mem200tb" : "memory = 200000000000000.B",
+          "mem500tb" : "memory = 500000000000000.B",
+          "mem1gib" : "memory = 1073741824.B",
+          "mem2gib" : "memory = 2147483648.B",
+          "mem4gib" : "memory = 4294967296.B",
+          "mem8gib" : "memory = 8589934592.B",
+          "mem16gib" : "memory = 17179869184.B",
+          "mem32gib" : "memory = 34359738368.B",
+          "mem64gib" : "memory = 68719476736.B",
+          "mem128gib" : "memory = 137438953472.B",
+          "mem256gib" : "memory = 274877906944.B",
+          "mem512gib" : "memory = 549755813888.B",
+          "mem1tib" : "memory = 1099511627776.B",
+          "mem2tib" : "memory = 2199023255552.B",
+          "mem4tib" : "memory = 4398046511104.B",
+          "mem8tib" : "memory = 8796093022208.B",
+          "mem16tib" : "memory = 17592186044416.B",
+          "mem32tib" : "memory = 35184372088832.B",
+          "mem64tib" : "memory = 70368744177664.B",
+          "mem128tib" : "memory = 140737488355328.B",
+          "mem256tib" : "memory = 281474976710656.B",
+          "mem512tib" : "memory = 562949953421312.B",
+          "cpu1" : "cpus = 1",
+          "cpu2" : "cpus = 2",
+          "cpu5" : "cpus = 5",
+          "cpu10" : "cpus = 10",
+          "cpu20" : "cpus = 20",
+          "cpu50" : "cpus = 50",
+          "cpu100" : "cpus = 100",
+          "cpu200" : "cpus = 200",
+          "cpu500" : "cpus = 500",
+          "cpu1000" : "cpus = 1000"
+        }
+      },
+      "debug" : false,
+      "container" : "docker"
+    }
+  ],
+  "engines" : [
+    {
+      "type" : "docker",
+      "id" : "docker",
+      "image" : "python:3.10",
+      "target_registry" : "images.viash-hub.com",
+      "target_tag" : "main",
+      "namespace_separator" : "/",
+      "setup" : [
+        {
+          "type" : "python",
+          "user" : false,
+          "packages" : [
+            "RSeQC"
+          ],
+          "upgrade" : true
+        },
+        {
+          "type" : "docker",
+          "run" : [
+            "echo \\"RSeQC - infer_experiment.py: $(infer_experiment.py --version | cut -d' ' -f2)\\" > /var/software_versions.txt\n"
+          ]
+        }
+      ]
+    },
+    {
+      "type" : "native",
+      "id" : "native"
+    }
+  ],
+  "build_info" : {
+    "config" : "/workdir/root/repo/src/rseqc/rseqc_inferexperiment/config.vsh.yaml",
+    "runner" : "nextflow",
+    "engine" : "docker|native",
+    "output" : "target/nextflow/rseqc/rseqc_inferexperiment",
+    "viash_version" : "0.9.0",
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
+  },
+  "package_config" : {
+    "name" : "biobox",
+    "version" : "main",
+    "description" : "A collection of bioinformatics tools for working with sequence data.\n",
+    "viash_version" : "0.9.0",
+    "source" : "src",
+    "target" : "target",
+    "config_mods" : [
+      ".requirements.commands := ['ps']\n",
+      ".engines += { type: \\"native\\" }",
+      ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
+      ".engines[.type == 'docker'].target_tag := 'main'"
+    ],
+    "keywords" : [
+      "bioinformatics",
+      "modules",
+      "sequencing"
+    ],
+    "license" : "MIT",
+    "organization" : "vsh",
+    "links" : {
+      "repository" : "https://github.com/viash-hub/biobox",
+      "issue_tracker" : "https://github.com/viash-hub/biobox/issues"
+    }
+  }
+}'''))
+]
+
+// resolve dependencies dependencies (if any)
+
+
+// inner workflow
+// inner workflow hook
+def innerWorkflowFactory(args) {
+  def rawScript = '''set -e
+tempscript=".viash_script.sh"
+cat > "$tempscript" << VIASHMAIN
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_INPUT_FILE+x} ]; then echo "${VIASH_PAR_INPUT_FILE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input_file='&'#" ; else echo "# par_input_file="; fi )
+$( if [ ! -z ${VIASH_PAR_REFGENE+x} ]; then echo "${VIASH_PAR_REFGENE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_refgene='&'#" ; else echo "# par_refgene="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
+$( if [ ! -z ${VIASH_PAR_SAMPLE_SIZE+x} ]; then echo "${VIASH_PAR_SAMPLE_SIZE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_sample_size='&'#" ; else echo "# par_sample_size="; fi )
+$( if [ ! -z ${VIASH_PAR_MAPQ+x} ]; then echo "${VIASH_PAR_MAPQ}" | sed "s#'#'\\"'\\"'#g;s#.*#par_mapq='&'#" ; else echo "# par_mapq="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+#!/bin/bash
+
+set -eo pipefail 
+
+infer_experiment.py \\\\
+    -i \\$par_input_file \\\\
+    -r \\$par_refgene \\\\
+    \\${par_sample_size:+-s "\\${par_sample_size}"} \\\\
+    \\${par_mapq:+-q "\\${par_mapq}"} \\\\
+> \\$par_output
+VIASHMAIN
+bash "$tempscript"
+'''
+  
+  return vdsl3WorkflowFactory(args, meta, rawScript)
+}
+
+
+
+/**
+  * Generate a workflow for VDSL3 modules.
+  * 
+  * This function is called by the workflowFactory() function.
+  * 
+  * Input channel: [id, input_map]
+  * Output channel: [id, output_map]
+  * 
+  * Internally, this workflow will convert the input channel
+  * to a format which the Nextflow module will be able to handle.
+  */
+def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) {
+  def key = args["key"]
+  def processObj = null
+
+  workflow processWf {
+    take: input_
+    main:
+
+    if (processObj == null) {
+      processObj = _vdsl3ProcessFactory(args, meta, rawScript)
+    }
+    
+    output_ = input_
+      | map { tuple ->
+        def id = tuple[0]
+        def data_ = tuple[1]
+
+        if (workflow.stubRun) {
+          // add id if missing
+          data_ = [id: 'stub'] + data_
+        }
+
+        // process input files separately
+        def inputPaths = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "input" }
+          .collect { par ->
+            def val = data_.containsKey(par.plainName) ? data_[par.plainName] : []
+            def inputFiles = []
+            if (val == null) {
+              inputFiles = []
+            } else if (val instanceof List) {
+              inputFiles = val
+            } else if (val instanceof Path) {
+              inputFiles = [ val ]
+            } else {
+              inputFiles = []
+            }
+            if (!workflow.stubRun) {
+              // throw error when an input file doesn't exist
+              inputFiles.each{ file -> 
+                assert file.exists() :
+                  "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" +
+                  "  Required input file does not exist.\n" +
+                  "  Path: '$file'.\n" +
+                  "  Expected input file to exist"
+              }
+            }
+            inputFiles 
+          } 
+
+        // remove input files
+        def argsExclInputFiles = meta.config.allArguments
+          .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) }
+          .collectEntries { par ->
+            def parName = par.plainName
+            def val = data_[parName]
+            if (par.multiple && val instanceof Collection) {
+              val = val.join(par.multiple_sep)
+            }
+            if (par.direction == "output" && par.type == "file") {
+              val = val
+                .replaceAll('\\$id', id)
+                .replaceAll('\\$\\{id\\}', id)
+                .replaceAll('\\$key', key)
+                .replaceAll('\\$\\{key\\}', key)
+            }
+            [parName, val]
+          }
+
+        [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ]
+      }
+      | processObj
+      | map { output ->
+        def outputFiles = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "output" }
+          .indexed()
+          .collectEntries{ index, par ->
+            def out = output[index + 1]
+            // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678)
+            if (!out instanceof List || out.size() <= 1) {
+              if (par.multiple) {
+                out = []
+              } else {
+                assert !par.required :
+                    "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" +
+                    "  Required output file is missing"
+                out = null
+              }
+            } else if (out.size() == 2 && !par.multiple) {
+              out = out[1]
+            } else {
+              out = out.drop(1)
+            }
+            [ par.plainName, out ]
+          }
+        
+        // drop null outputs
+        outputFiles.removeAll{it.value == null}
+
+        [ output[0], outputFiles ]
+      }
+    emit: output_
+  }
+
+  return processWf
+}
+
+// depends on: session?
+def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) {
+  // autodetect process key
+  def wfKey = workflowArgs["key"]
+  def procKeyPrefix = "${wfKey}_process"
+  def scriptMeta = nextflow.script.ScriptMeta.current()
+  def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)}
+  def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()}
+  def newNumber = (numbers + [-1]).max() + 1
+
+  def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber"
+
+  if (newNumber > 0) {
+    log.warn "Key for module '${wfKey}' is duplicated.\n",
+      "If you run a component multiple times in the same workflow,\n" +
+      "it's recommended you set a unique key for every call,\n" +
+      "for example: ${wfKey}.run(key: \"foo\")."
+  }
+
+  // subset directives and convert to list of tuples
+  def drctv = workflowArgs.directives
+
+  // TODO: unit test the two commands below
+  // convert publish array into tags
+  def valueToStr = { val ->
+    // ignore closures
+    if (val instanceof CharSequence) {
+      if (!val.matches('^[{].*[}]$')) {
+        '"' + val + '"'
+      } else {
+        val
+      }
+    } else if (val instanceof List) {
+      "[" + val.collect{valueToStr(it)}.join(", ") + "]"
+    } else if (val instanceof Map) {
+      "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]"
+    } else {
+      val.inspect()
+    }
+  }
+
+  // multiple entries allowed: label, publishdir
+  def drctvStrs = drctv.collect { key, value ->
+    if (key in ["label", "publishDir"]) {
+      value.collect{ val ->
+        if (val instanceof Map) {
+          "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+        } else if (val == null) {
+          ""
+        } else {
+          "\n$key " + valueToStr(val)
+        }
+      }.join()
+    } else if (value instanceof Map) {
+      "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+    } else {
+      "\n$key " + valueToStr(value)
+    }
+  }.join()
+
+  def inputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "input" }
+    .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' }
+    .join()
+
+  def outputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par ->
+      // insert dummy into every output (see nextflow-io/nextflow#2678)
+      if (!par.multiple) {
+        ', path{[".exitcode", args.' + par.plainName + ']}'
+      } else {
+        ', path{[".exitcode"] + args.' + par.plainName + '}'
+      }
+    }
+    .join()
+
+  // TODO: move this functionality somewhere else?
+  if (workflowArgs.auto.transcript) {
+    outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}'
+  } else {
+    outputPaths = outputPaths + ', path{[".exitcode"]}'
+  }
+
+  // create dirs for output files (based on BashWrapper.createParentFiles)
+  def createParentStr = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" && it.create_parent }
+    .collect { par -> 
+      def contents = "args[\"${par.plainName}\"] instanceof List ? args[\"${par.plainName}\"].join('\" \"') : args[\"${par.plainName}\"]"
+      "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent '\" + escapeText(${contents}) + \"'\" : \"\" }"
+    }
+    .join("\n")
+
+  // construct inputFileExports
+  def inputFileExports = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction.toLowerCase() == "input" }
+    .collect { par ->
+      def contents = "viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName}"
+      "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}='\" + escapeText(${contents}) + \"'\"}"
+    }
+
+  // NOTE: if using docker, use /tmp instead of tmpDir!
+  def tmpDir = java.nio.file.Paths.get(
+    System.getenv('NXF_TEMP') ?: 
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('VIASH_TMPDIR') ?: 
+    System.getenv('VIASH_TEMPDIR') ?: 
+    System.getenv('VIASH_TMP') ?: 
+    System.getenv('TEMP') ?: 
+    System.getenv('TMPDIR') ?: 
+    System.getenv('TEMPDIR') ?:
+    System.getenv('TMP') ?: 
+    '/tmp'
+  ).toAbsolutePath()
+
+  // construct stub
+  def stub = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par -> 
+      "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }"
+    }
+    .join("\n")
+
+  // escape script
+  def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"')
+
+  // publishdir assert
+  def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? 
+    """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n  Example: --publish_dir './output/'" """ :
+    ""
+
+  // generate process string
+  def procStr = 
+  """nextflow.enable.dsl=2
+  |
+  |def escapeText = { s -> s.toString().replaceAll("'", "'\\\"'\\\"'") }
+  |process $procKey {$drctvStrs
+  |input:
+  |  tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources")
+  |output:
+  |  tuple val("\$id")$outputPaths, optional: true
+  |stub:
+  |\"\"\"
+  |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; }
+  |$stub
+  |\"\"\"
+  |script:$assertStr
+  |def parInject = args
+  |  .findAll{key, value -> value != null}
+  |  .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}='\${escapeText(value)}'"}
+  |  .join("\\n")
+  |\"\"\"
+  |# meta exports
+  |export VIASH_META_RESOURCES_DIR="\${resourcesDir}"
+  |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}"
+  |export VIASH_META_NAME="${meta.config.name}"
+  |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME"
+  |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+  |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" }
+  |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" }
+  |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then
+  |  export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 ))
+  |  export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  |fi
+  |
+  |# meta synonyms
+  |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR"
+  |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR"
+  |
+  |# create output dirs if need be
+  |function mkdir_parent {
+  |  for file in "\\\$@"; do 
+  |    mkdir -p "\\\$(dirname "\\\$file")"
+  |  done
+  |}
+  |$createParentStr
+  |
+  |# argument exports${inputFileExports.join()}
+  |\$parInject
+  |
+  |# process script
+  |${escapedScript}
+  |\"\"\"
+  |}
+  |""".stripMargin()
+
+  // TODO: print on debug
+  // if (workflowArgs.debug == true) {
+  //   println("######################\n$procStr\n######################")
+  // }
+
+  // write process to temp file
+  def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf")
+  addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) }
+  tempFile.text = procStr
+
+  // create process from temp file
+  def binding = new nextflow.script.ScriptBinding([:])
+  def session = nextflow.Nextflow.getSession()
+  def parser = new nextflow.script.ScriptParser(session)
+    .setModule(true)
+    .setBinding(binding)
+  def moduleScript = parser.runScript(tempFile)
+    .getScript()
+
+  // register module in meta
+  def module = new nextflow.script.IncludeDef.Module(name: procKey)
+  scriptMeta.addModule(moduleScript, module.name, module.alias)
+
+  // retrieve and return process from meta
+  return scriptMeta.getProcess(procKey)
+}
+
+// defaults
+meta["defaults"] = [
+  // key to be used to trace the process and determine output names
+  key: null,
+
+  // fixed arguments to be passed to script
+  args: [:],
+
+  // default directives
+  directives: readJsonBlob('''{
+  "container" : {
+    "registry" : "images.viash-hub.com",
+    "image" : "vsh/biobox/rseqc/rseqc_inferexperiment",
+    "tag" : "main"
+  },
+  "tag" : "$id"
+}'''),
+
+  // auto settings
+  auto: readJsonBlob('''{
+  "simplifyInput" : true,
+  "simplifyOutput" : false,
+  "transcript" : false,
+  "publish" : false
+}'''),
+
+  // Apply a map over the incoming tuple
+  // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }`
+  map: null,
+
+  // Apply a map over the ID element of a tuple (i.e. the first element)
+  // Example: `{ id -> id + "_foo" }`
+  mapId: null,
+
+  // Apply a map over the data element of a tuple (i.e. the second element)
+  // Example: `{ data -> [ input: data.output ] }`
+  mapData: null,
+
+  // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements)
+  // Example: `{ pt -> pt.drop(1) }`
+  mapPassthrough: null,
+
+  // Filter the channel
+  // Example: `{ tup -> tup[0] == "foo" }`
+  filter: null,
+
+  // Choose whether or not to run the component on the tuple if the condition is true.
+  // Otherwise, the tuple will be passed through.
+  // Example: `{ tup -> tup[0] != "skip_this" }`
+  runIf: null,
+
+  // Rename keys in the data field of the tuple (i.e. the second element)
+  // Will likely be deprecated in favour of `fromState`.
+  // Example: `[ "new_key": "old_key" ]`
+  renameKeys: null,
+
+  // Fetch data from the state and pass it to the module without altering the current state.
+  // 
+  // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. 
+  // 
+  // - If it is `null`, the state will be passed to the module as is.
+  // - If it is a `List[String]`, the data will be the values of the state at the given keys.
+  // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map.
+  // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data.
+  // 
+  // Example: `{ id, state -> [input: state.fastq_file] }`
+  // Default: `null`
+  fromState: null,
+
+  // Determine how the state should be updated after the module has been run.
+  // 
+  // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function.
+  // 
+  // - If it is `null`, the state will be replaced with the output of the module.
+  // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys.
+  // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map.
+  // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state.
+  //
+  // Example: `{ id, output, state -> state + [counts: state.output] }`
+  // Default: `{ id, output, state -> output }`
+  toState: null,
+
+  // Whether or not to print debug messages
+  // Default: `false`
+  debug: false
+]
+
+// initialise default workflow
+meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta)
+
+// add workflow to environment
+nextflow.script.ScriptMeta.current().addDefinition(meta.workflow)
+
+// anonymous workflow for running this module as a standalone
+workflow {
+  // add id argument if it's not already in the config
+  // TODO: deep copy
+  def newConfig = deepClone(meta.config)
+  def newParams = deepClone(params)
+
+  def argsContainsId = newConfig.allArguments.any{it.plainName == "id"}
+  if (!argsContainsId) {
+    def idArg = [
+      'name': '--id',
+      'required': false,
+      'type': 'string',
+      'description': 'A unique id for every entry.',
+      'multiple': false
+    ]
+    newConfig.arguments.add(0, idArg)
+    newConfig = processConfig(newConfig)
+  }
+  if (!newParams.containsKey("id")) {
+    newParams.id = "run"
+  }
+
+  helpMessage(newConfig)
+
+  channelFromParams(newParams, newConfig)
+    // make sure id is not in the state if id is not in the args
+    | map {id, state ->
+      if (!argsContainsId) {
+        [id, state.findAll{k, v -> k != "id"}]
+      } else {
+        [id, state]
+      }
+    }
+    | meta.workflow.run(
+      auto: [ publish: "state" ]
+    )
+}
+
+// END COMPONENT-SPECIFIC CODE
diff --git a/target/nextflow/rseqc/rseqc_inferexperiment/nextflow.config b/target/nextflow/rseqc/rseqc_inferexperiment/nextflow.config
new file mode 100644
index 00000000..d10d30e1
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_inferexperiment/nextflow.config
@@ -0,0 +1,126 @@
+manifest {
+  name = 'rseqc/rseqc_inferexperiment'
+  mainScript = 'main.nf'
+  nextflowVersion = '!>=20.12.1-edge'
+  version = 'main'
+  description = 'Infer strandedness from sequencing reads\n'
+  author = 'Emma Rousseau'
+}
+
+process.container = 'nextflow/bash:latest'
+
+// detect tempdir
+tempDir = java.nio.file.Paths.get(
+  System.getenv('NXF_TEMP') ?:
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('TEMPDIR') ?: 
+    System.getenv('TMPDIR') ?: 
+    '/tmp'
+).toAbsolutePath()
+
+profiles {
+  no_publish {
+    process {
+      withName: '.*' {
+        publishDir = [
+          enabled: false
+        ]
+      }
+    }
+  }
+  mount_temp {
+    docker.temp            = tempDir
+    podman.temp            = tempDir
+    charliecloud.temp      = tempDir
+  }
+  docker {
+    docker.enabled         = true
+    // docker.userEmulation   = true
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  singularity {
+    singularity.enabled    = true
+    singularity.autoMounts = true
+    docker.enabled         = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  podman {
+    podman.enabled         = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  shifter {
+    shifter.enabled        = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    charliecloud.enabled   = false
+  }
+  charliecloud {
+    charliecloud.enabled   = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+  }
+}
+
+process{
+  withLabel: mem1gb { memory = 1000000000.B }
+  withLabel: mem2gb { memory = 2000000000.B }
+  withLabel: mem5gb { memory = 5000000000.B }
+  withLabel: mem10gb { memory = 10000000000.B }
+  withLabel: mem20gb { memory = 20000000000.B }
+  withLabel: mem50gb { memory = 50000000000.B }
+  withLabel: mem100gb { memory = 100000000000.B }
+  withLabel: mem200gb { memory = 200000000000.B }
+  withLabel: mem500gb { memory = 500000000000.B }
+  withLabel: mem1tb { memory = 1000000000000.B }
+  withLabel: mem2tb { memory = 2000000000000.B }
+  withLabel: mem5tb { memory = 5000000000000.B }
+  withLabel: mem10tb { memory = 10000000000000.B }
+  withLabel: mem20tb { memory = 20000000000000.B }
+  withLabel: mem50tb { memory = 50000000000000.B }
+  withLabel: mem100tb { memory = 100000000000000.B }
+  withLabel: mem200tb { memory = 200000000000000.B }
+  withLabel: mem500tb { memory = 500000000000000.B }
+  withLabel: mem1gib { memory = 1073741824.B }
+  withLabel: mem2gib { memory = 2147483648.B }
+  withLabel: mem4gib { memory = 4294967296.B }
+  withLabel: mem8gib { memory = 8589934592.B }
+  withLabel: mem16gib { memory = 17179869184.B }
+  withLabel: mem32gib { memory = 34359738368.B }
+  withLabel: mem64gib { memory = 68719476736.B }
+  withLabel: mem128gib { memory = 137438953472.B }
+  withLabel: mem256gib { memory = 274877906944.B }
+  withLabel: mem512gib { memory = 549755813888.B }
+  withLabel: mem1tib { memory = 1099511627776.B }
+  withLabel: mem2tib { memory = 2199023255552.B }
+  withLabel: mem4tib { memory = 4398046511104.B }
+  withLabel: mem8tib { memory = 8796093022208.B }
+  withLabel: mem16tib { memory = 17592186044416.B }
+  withLabel: mem32tib { memory = 35184372088832.B }
+  withLabel: mem64tib { memory = 70368744177664.B }
+  withLabel: mem128tib { memory = 140737488355328.B }
+  withLabel: mem256tib { memory = 281474976710656.B }
+  withLabel: mem512tib { memory = 562949953421312.B }
+  withLabel: cpu1 { cpus = 1 }
+  withLabel: cpu2 { cpus = 2 }
+  withLabel: cpu5 { cpus = 5 }
+  withLabel: cpu10 { cpus = 10 }
+  withLabel: cpu20 { cpus = 20 }
+  withLabel: cpu50 { cpus = 50 }
+  withLabel: cpu100 { cpus = 100 }
+  withLabel: cpu200 { cpus = 200 }
+  withLabel: cpu500 { cpus = 500 }
+  withLabel: cpu1000 { cpus = 1000 }
+}
+
+
diff --git a/target/nextflow/rseqc/rseqc_inferexperiment/nextflow_schema.json b/target/nextflow/rseqc/rseqc_inferexperiment/nextflow_schema.json
new file mode 100644
index 00000000..5ac5937d
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_inferexperiment/nextflow_schema.json
@@ -0,0 +1,139 @@
+{
+"$schema": "http://json-schema.org/draft-07/schema",
+"title": "rseqc_inferexperiment",
+"description": "Infer strandedness from sequencing reads\n",
+"type": "object",
+"definitions": {
+
+    
+    
+    "input" : {
+    "title": "Input",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "input_file": {
+                "type":
+                "string",
+                "description": "Type: `file`, required. input alignment file in BAM or SAM format",
+                "help_text": "Type: `file`, required. input alignment file in BAM or SAM format"
+            
+            }
+    
+
+        ,
+                "refgene": {
+                "type":
+                "string",
+                "description": "Type: `file`, required. Reference gene model in bed format",
+                "help_text": "Type: `file`, required. Reference gene model in bed format"
+            
+            }
+    
+
+}
+},
+    
+    
+    "output" : {
+    "title": "Output",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "output": {
+                "type":
+                "string",
+                "description": "Type: `file`, required, default: `$id.$key.output.txt`, example: `$id.strandedness.txt`. Output file (txt) of strandness report",
+                "help_text": "Type: `file`, required, default: `$id.$key.output.txt`, example: `$id.strandedness.txt`. Output file (txt) of strandness report."
+            ,
+                "default": "$id.$key.output.txt"
+            }
+    
+
+}
+},
+    
+    
+    "options" : {
+    "title": "Options",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "sample_size": {
+                "type":
+                "integer",
+                "description": "Type: `integer`, example: `200000`. Number of reads sampled from SAM/BAM file",
+                "help_text": "Type: `integer`, example: `200000`. Number of reads sampled from SAM/BAM file. Default: 200000\n"
+            
+            }
+    
+
+        ,
+                "mapq": {
+                "type":
+                "integer",
+                "description": "Type: `integer`, example: `30`. Minimum mapping quality (phred scaled) to determine uniquely mapped reads",
+                "help_text": "Type: `integer`, example: `30`. Minimum mapping quality (phred scaled) to determine uniquely mapped reads. Default: 30\n"
+            
+            }
+    
+
+}
+},
+    
+    
+    "nextflow input-output arguments" : {
+    "title": "Nextflow input-output arguments",
+    "type": "object",
+    "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+    "properties": {
+    
+        
+                "publish_dir": {
+                "type":
+                "string",
+                "description": "Type: `string`, required, example: `output/`. Path to an output directory",
+                "help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
+            
+            }
+    
+
+        ,
+                "param_list": {
+                "type":
+                "string",
+                "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
+                "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
+                "hidden": true
+            
+            }
+    
+
+}
+}
+},
+"allOf": [
+
+    {
+    "$ref": "#/definitions/input"
+    },
+
+    {
+    "$ref": "#/definitions/output"
+    },
+
+    {
+    "$ref": "#/definitions/options"
+    },
+
+    {
+    "$ref": "#/definitions/nextflow input-output arguments"
+    }
+]
+}
diff --git a/target/nextflow/rseqc/rseqc_inner_distance/.config.vsh.yaml b/target/nextflow/rseqc/rseqc_inner_distance/.config.vsh.yaml
new file mode 100644
index 00000000..a2620a9e
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_inner_distance/.config.vsh.yaml
@@ -0,0 +1,321 @@
+name: "rseqc_inner_distance"
+namespace: "rseqc"
+version: "main"
+authors:
+- name: "Emma Rousseau"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "emma@data-intuitive.com"
+      github: "emmarousseau"
+      linkedin: "emmarousseau1"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Input"
+  arguments:
+  - type: "file"
+    name: "--input_file"
+    alternatives:
+    - "-i"
+    description: "input alignment file in BAM or SAM format"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--refgene"
+    alternatives:
+    - "-r"
+    description: "Reference gene model in bed format"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--sample_size"
+    alternatives:
+    - "-k"
+    description: "Numer of reads sampled from SAM/BAM file, default = 1000000."
+    info: null
+    example:
+    - 1000000
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--mapq"
+    alternatives:
+    - "-q"
+    description: "Minimum mapping quality (phred scaled) to determine uniquely mapped\
+      \ reads, default=30."
+    info: null
+    example:
+    - 30
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--lower_bound"
+    alternatives:
+    - "-l"
+    description: "Lower bound of inner distance (bp). This option is used for ploting\
+      \ histograme, default=-250."
+    info: null
+    example:
+    - -250
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--upper_bound"
+    alternatives:
+    - "-u"
+    description: "Upper bound of inner distance (bp). This option is used for ploting\
+      \ histograme, default=250."
+    info: null
+    example:
+    - 250
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--step"
+    alternatives:
+    - "-s"
+    description: "Step size (bp) of histograme. This option is used for plotting histogram,\
+      \ default=5."
+    info: null
+    example:
+    - 5
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Output"
+  arguments:
+  - type: "string"
+    name: "--output_prefix"
+    alternatives:
+    - "-o"
+    description: "Rrefix of output files."
+    info: null
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_stats"
+    description: "output file (txt) with summary statistics of inner distances of\
+      \ paired reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_dist"
+    description: "output file (txt) with inner distances of all paired reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_freq"
+    description: "output file (txt) with frequencies of inner distances of all paired\
+      \ reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_plot"
+    description: "output file (pdf) with histogram plot of of inner distances of all\
+      \ paired reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--output_plot_r"
+    description: "output file (R) with script of histogram plot of of inner distances\
+      \ of all paired reads"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Calculate inner distance between read pairs.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.1093/bioinformatics/bts356"
+links:
+  repository: "https://github.com/MonashBioinformaticsPlatform/RSeQC"
+  homepage: "https://rseqc.sourceforge.net/"
+  documentation: "https://rseqc.sourceforge.net/#inner-distance-py"
+  issue_tracker: "https://github.com/MonashBioinformaticsPlatform/RSeQC/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "python:3.10"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "apt"
+    packages:
+    - "r-base"
+    interactive: false
+  - type: "python"
+    user: false
+    packages:
+    - "RSeQC"
+    upgrade: true
+  - type: "docker"
+    run:
+    - "echo \"RSeQC - inner_distance.py: $(inner_distance.py --version | cut -d' '\
+      \ -f2)\" > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/rseqc/rseqc_inner_distance/config.vsh.yaml"
+  runner: "nextflow"
+  engine: "docker|native"
+  output: "target/nextflow/rseqc/rseqc_inner_distance"
+  executable: "target/nextflow/rseqc/rseqc_inner_distance/main.nf"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
diff --git a/target/nextflow/rseqc/rseqc_inner_distance/main.nf b/target/nextflow/rseqc/rseqc_inner_distance/main.nf
new file mode 100644
index 00000000..50bd7154
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_inner_distance/main.nf
@@ -0,0 +1,3753 @@
+// rseqc_inner_distance main
+// 
+// This wrapper script is auto-generated by viash 0.9.0 and is thus a derivative
+// work thereof. This software comes with ABSOLUTELY NO WARRANTY from Data
+// Intuitive.
+// 
+// The component may contain files which fall under a different license. The
+// authors of this component should specify the license in the header of such
+// files, or include a separate license file detailing the licenses of all included
+// files.
+// 
+// Component authors:
+//  * Emma Rousseau (author, maintainer)
+
+////////////////////////////
+// VDSL3 helper functions //
+////////////////////////////
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf'
+class UnexpectedArgumentTypeException extends Exception {
+  String errorIdentifier
+  String stage
+  String plainName
+  String expectedClass
+  String foundClass
+  
+  // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""}
+  UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) {
+    super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " +
+      "Expected type: ${expectedClass}. Found type: ${foundClass}")
+    this.errorIdentifier = errorIdentifier
+    this.stage = stage
+    this.plainName = plainName
+    this.expectedClass = expectedClass
+    this.foundClass = foundClass
+  }
+}
+
+/**
+  * Checks if the given value is of the expected type. If not, an exception is thrown.
+  *
+  * @param stage The stage of the argument (input or output)
+  * @param par The parameter definition
+  * @param value The value to check
+  * @param errorIdentifier The identifier to use in the error message
+  * @return The value, if it is of the expected type
+  * @throws UnexpectedArgumentTypeException If the value is not of the expected type
+*/
+def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) {
+  // expectedClass will only be != null if value is not of the expected type
+  def expectedClass = null
+  def foundClass = null
+  
+  // todo: split if need be
+  
+  if (!par.required && value == null) {
+    expectedClass = null
+  } else if (par.multiple) {
+    if (value !instanceof Collection) {
+      value = [value]
+    }
+    
+    // split strings
+    value = value.collectMany{ val ->
+      if (val instanceof String) {
+        // collect() to ensure that the result is a List and not simply an array
+        val.split(par.multiple_sep).collect()
+      } else {
+        [val]
+      }
+    }
+
+    // process globs
+    if (par.type == "file" && par.direction == "input") {
+      value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten()
+    }
+
+    // check types of elements in list
+    try {
+      value = value.collect { listVal ->
+        _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier)
+      }
+    } catch (UnexpectedArgumentTypeException e) {
+      expectedClass = "List[${e.expectedClass}]"
+      foundClass = "List[${e.foundClass}]"
+    }
+  } else if (par.type == "string") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else if (par.type == "integer") {
+    // cast to integer if need be
+    if (value instanceof String) {
+      try {
+        value = value.toInteger()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigInteger) {
+      value = value.intValue()
+    }
+    expectedClass = value instanceof Integer ? null : "Integer"
+  } else if (par.type == "long") {
+    // cast to long if need be
+    if (value instanceof String) {
+      try {
+        value = value.toLong()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof Integer) {
+      value = value.toLong()
+    }
+    expectedClass = value instanceof Long ? null : "Long"
+  } else if (par.type == "double") {
+    // cast to double if need be
+    if (value instanceof String) {
+      try {
+        value = value.toDouble()
+      } catch (NumberFormatException e) {
+        // do nothing
+      }
+    }
+    if (value instanceof java.math.BigDecimal) {
+      value = value.doubleValue()
+    }
+    if (value instanceof Float) {
+      value = value.toDouble()
+    }
+    expectedClass = value instanceof Double ? null : "Double"
+  } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") {
+    // cast to boolean if need be
+    if (value instanceof String) {
+      def valueLower = value.toLowerCase()
+      if (valueLower == "true") {
+        value = true
+      } else if (valueLower == "false") {
+        value = false
+      }
+    }
+    expectedClass = value instanceof Boolean ? null : "Boolean"
+  } else if (par.type == "file" && (par.direction == "input" || stage == "output")) {
+    // cast to path if need be
+    if (value instanceof String) {
+      value = file(value, hidden: true)
+    }
+    if (value instanceof File) {
+      value = value.toPath()
+    }
+    expectedClass = value instanceof Path ? null : "Path"
+  } else if (par.type == "file" && stage == "input" && par.direction == "output") {
+    // cast to string if need be
+    if (value instanceof GString) {
+      value = value.toString()
+    }
+    expectedClass = value instanceof String ? null : "String"
+  } else {
+    // didn't find a match for par.type
+    expectedClass = par.type
+  }
+
+  if (expectedClass != null) {
+    if (foundClass == null) {
+      foundClass = value.getClass().getName()
+    }
+    throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass)
+  }
+  
+  return value
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf'
+Map _processInputValues(Map inputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.required) {
+        assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing"
+      }
+    }
+
+    inputs = inputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument"
+
+      value = _checkArgumentType("input", par, value, "in module '$key' id '$id'")
+
+      [ name, value ]
+    }
+  }
+  return inputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf'
+Map _processOutputValues(Map outputs, Map config, String id, String key) {
+  if (!workflow.stubRun) {
+    config.allArguments.each { arg ->
+      if (arg.direction == "output" && arg.required) {
+        assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : 
+          "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing"
+      }
+    }
+
+    outputs = outputs.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && it.direction == "output" }
+      assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument"
+      
+      value = _checkArgumentType("output", par, value, "in module '$key' id '$id'")
+      
+      [ name, value ]
+    }
+  }
+  return outputs
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf'
+class IDChecker {
+  final def items = [] as Set
+
+  @groovy.transform.WithWriteLock
+  boolean observe(String item) {
+    if (items.contains(item)) {
+      return false
+    } else {
+      items << item
+      return true
+    }
+  }
+
+  @groovy.transform.WithReadLock
+  boolean contains(String item) {
+    return items.contains(item)
+  }
+
+  @groovy.transform.WithReadLock
+  Set getItems() {
+    return items.clone()
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf'
+
+/**
+ * Check if the ids are unique across parameter sets
+ *
+ * @param parameterSets a list of parameter sets.
+ */
+private void _checkUniqueIds(List<Tuple2<String, Map<String, Object>>> parameterSets) {
+  def ppIds = parameterSets.collect{it[0]}
+  assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds"
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf'
+
+// helper functions for reading params from file //
+def _getChild(parent, child) {
+  if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) {
+    child
+  } else {
+    def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString()
+    parentAbsolute.replaceAll('/[^/]*$', "/") + child
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf'
+/**
+  * Figure out the param list format based on the file extension
+  *
+  * @param param_list A String containing the path to the parameter list file.
+  *
+  * @return A String containing the format of the parameter list file.
+  */
+def _paramListGuessFormat(param_list) {
+  if (param_list !instanceof String) {
+    "asis"
+  } else if (param_list.endsWith(".csv")) {
+    "csv"
+  } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) {
+    "json"
+  } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) {
+    "yaml"
+  } else {
+    "yaml_blob"
+  }
+}
+
+
+/**
+  * Read the param list
+  * 
+  * @param param_list One of the following:
+  *   - A String containing the path to the parameter list file (csv, json or yaml),
+  *   - A yaml blob of a list of maps (yaml_blob),
+  *   - Or a groovy list of maps (asis).
+  * @param config A Map of the Viash configuration.
+  * 
+  * @return A List of Maps containing the parameters.
+  */
+def _parseParamList(param_list, Map config) {
+  // first determine format by extension
+  def paramListFormat = _paramListGuessFormat(param_list)
+
+  def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ?
+    file(param_list, hidden: true) :
+    null
+
+  // get the correct parser function for the detected params_list format
+  def paramSets = []
+  if (paramListFormat == "asis") {
+    paramSets = param_list
+  } else if (paramListFormat == "yaml_blob") {
+    paramSets = readYamlBlob(param_list)
+  } else if (paramListFormat == "yaml") {
+    paramSets = readYaml(paramListPath)
+  } else if (paramListFormat == "json") {
+    paramSets = readJson(paramListPath)
+  } else if (paramListFormat == "csv") {
+    paramSets = readCsv(paramListPath)
+  } else {
+    error "Format of provided --param_list not recognised.\n" +
+    "Found: '$paramListFormat'.\n" +
+    "Expected: a csv file, a json file, a yaml file,\n" +
+    "a yaml blob or a groovy list of maps."
+  }
+
+  // data checks
+  assert paramSets instanceof List: "--param_list should contain a list of maps"
+  for (value in paramSets) {
+    assert value instanceof Map: "--param_list should contain a list of maps"
+  }
+
+  // id is argument
+  def idIsArgument = config.allArguments.any{it.plainName == "id"}
+
+  // Reformat from List<Map> to List<Tuple2<String, Map>> by adding the ID as first element of a Tuple2
+  paramSets = paramSets.collect({ data ->
+    def id = data.id
+    if (!idIsArgument) {
+      data = data.findAll{k, v -> k != "id"}
+    }
+    [id, data]
+  })
+
+  // Split parameters with 'multiple: true'
+  paramSets = paramSets.collect({ id, data ->
+    data = _splitParams(data, config)
+    [id, data]
+  })
+  
+  // The paths of input files inside a param_list file may have been specified relatively to the
+  // location of the param_list file. These paths must be made absolute.
+  if (paramListPath) {
+    paramSets = paramSets.collect({ id, data ->
+      def new_data = data.collectEntries{ parName, parValue ->
+        def par = config.allArguments.find{it.plainName == parName}
+        if (par && par.type == "file" && par.direction == "input") {
+          if (parValue instanceof Collection) {
+            parValue = parValue.collectMany{path -> 
+              def x = _resolveSiblingIfNotAbsolute(path, paramListPath)
+              x instanceof Collection ? x : [x]
+            }
+          } else {
+            parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) 
+          }
+        }
+        [parName, parValue]
+      }
+      [id, new_data]
+    })
+  }
+
+  return paramSets
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf'
+/**
+ * Split parameters for arguments that accept multiple values using their separator
+ *
+ * @param paramList A Map containing parameters to split.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ *
+ * @return A Map of parameters where the parameter values have been split into a list using
+ *         their seperator.
+ */
+Map<String, Object> _splitParams(Map<String, Object> parValues, Map config){
+  def parsedParamValues = parValues.collectEntries { parName, parValue ->
+    def parameterSettings = config.allArguments.find({it.plainName == parName})
+
+    if (!parameterSettings) {
+      // if argument is not found, do not alter 
+      return [parName, parValue]
+    }
+    if (parameterSettings.multiple) { // Check if parameter can accept multiple values
+      if (parValue instanceof Collection) {
+        parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it }
+      } else if (parValue instanceof String) {
+        parValue = parValue.split(parameterSettings.multiple_sep)
+      } else if (parValue == null) {
+        parValue = []
+      } else {
+        parValue = [ parValue ]
+      }
+      parValue = parValue.flatten()
+    }
+    // For all parameters check if multiple values are only passed for
+    // arguments that allow it. Quietly simplify lists of length 1.
+    if (!parameterSettings.multiple && parValue instanceof Collection) {
+      assert parValue.size() == 1 : 
+      "Error: argument ${parName} has too many values.\n" +
+      "  Expected amount: 1. Found: ${parValue.size()}"
+      parValue = parValue[0]
+    }
+    [parName, parValue]
+  }
+  return parsedParamValues
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf'
+/**
+ * Parse nextflow parameters based on settings defined in a viash config.
+ * Return a list of parameter sets, each parameter set corresponding to 
+ * an event in a nextflow channel. The output from this function can be used
+ * with Channel.fromList to create a nextflow channel with Vdsl3 formatted 
+ * events.
+ *
+ * This function performs:
+ *   - A filtering of the params which can be found in the config file.
+ *   - Process the params_list argument which allows a user to to initialise 
+ *     a Vsdl3 channel with multiple parameter sets. Possible formats are 
+ *     csv, json, yaml, or simply a yaml_blob. A csv should have column names 
+ *     which correspond to the different arguments of this pipeline. A json or a yaml
+ *     file should be a list of maps, each of which has keys corresponding to the
+ *     arguments of the pipeline. A yaml blob can also be passed directly as a parameter.
+ *     When passing a csv, json or yaml, relative path names are relativized to the
+ *     location of the parameter file.
+ *   - Combine the parameter sets into a vdsl3 Channel.
+ *
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A list of parameters with the first element of the event being
+ *         the event ID and the second element containing a map of the parsed parameters.
+ */
+ 
+private List<Tuple2<String, Map<String, Object>>> _paramsToParamSets(Map params, Map config){
+  // todo: fetch key from run args
+  def key_ = config.name
+  
+  /* parse regular parameters (not in param_list)  */
+  /*************************************************/
+  def globalParams = config.allArguments
+    .findAll { params.containsKey(it.plainName) }
+    .collectEntries { [ it.plainName, params[it.plainName] ] }
+  def globalID = params.get("id", null)
+
+  /* process params_list arguments */
+  /*********************************/
+  def paramList = params.containsKey("param_list") && params.param_list != null ?
+    params.param_list : []
+  // if (paramList instanceof String) {
+  //   paramList = [paramList]
+  // }
+  // def paramSets = paramList.collectMany{ _parseParamList(it, config) }
+  // TODO: be able to process param_list when it is a list of strings
+  def paramSets = _parseParamList(paramList, config)
+  if (paramSets.isEmpty()) {
+    paramSets = [[null, [:]]]
+  }
+
+  /* combine arguments into channel */
+  /**********************************/
+  def processedParams = paramSets.indexed().collect{ index, tup ->
+    // Process ID
+    def id = tup[0] ?: globalID
+  
+    if (workflow.stubRun && !id) {
+      // if stub run, explicitly add an id if missing
+      id = "stub${index}"
+    }
+    assert id != null: "Each parameter set should have at least an 'id'"
+
+    // Process params
+    def parValues = globalParams + tup[1]
+    // // Remove parameters which are null, if the default is also null
+    // parValues = parValues.collectEntries{paramName, paramValue ->
+    //   parameterSettings = config.functionality.allArguments.find({it.plainName == paramName})
+    //   if ( paramValue != null || parameterSettings.get("default", null) != null ) {
+    //     [paramName, paramValue]
+    //   }
+    // }
+    parValues = parValues.collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument"
+
+      if (par == null) {
+        return [:]
+      }
+      value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+
+      [ name, value ]
+    }
+
+    [id, parValues]
+  }
+
+  // Check if ids (first element of each list) is unique
+  _checkUniqueIds(processedParams)
+  return processedParams
+}
+
+/**
+ * Parse nextflow parameters based on settings defined in a viash config 
+ * and return a nextflow channel.
+ * 
+ * @param params Input parameters. Can optionaly contain a 'param_list' key that
+ *               provides a list of arguments that can be split up into multiple events
+ *               in the output channel possible formats of param_lists are: a csv file, 
+ *               json file, a yaml file or a yaml blob. Each parameters set (event) must
+ *               have a unique ID.
+ * @param config A Map of the Viash configuration. This Map can be generated from the config file
+ *               using the readConfig() function.
+ * 
+ * @return A nextflow Channel with events. Events are formatted as a tuple that contains 
+ *         first contains the ID of the event and as second element holds a parameter map.
+ *       
+ *
+ */
+def channelFromParams(Map params, Map config) {
+  def processedParams = _paramsToParamSets(params, config)
+  return Channel.fromList(processedParams)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf'
+def checkUniqueIds(Map args) {
+  def stopOnError = args.stopOnError == null ? args.stopOnError : true
+
+  def idChecker = new IDChecker()
+
+  return filter { tup ->
+    if (!idChecker.observe(tup[0])) {
+      if (stopOnError) {
+        error "Duplicate id: ${tup[0]}"
+      } else {
+        log.warn "Duplicate id: ${tup[0]}, removing duplicate entry"
+        return false
+      }
+    }
+    return true
+  }
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf'
+// This helper file will be deprecated soon
+preprocessInputsDeprecationWarningPrinted = false
+
+def preprocessInputsDeprecationWarning() {
+  if (!preprocessInputsDeprecationWarningPrinted) {
+    preprocessInputsDeprecationWarningPrinted = true
+    System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.")
+  }
+}
+
+/**
+ * Generate a nextflow Workflow that allows processing a channel of 
+ * Vdsl3 formatted events and apply a Viash config to them:
+ *    - Gather default parameters from the Viash config and make 
+ *      sure that they are correctly formatted (see applyConfig method).
+ *    - Format the input parameters (also using the applyConfig method).
+ *    - Apply the default parameter to the input parameters.
+ *    - Do some assertions:
+ *        ~ Check if the event IDs in the channel are unique.
+ * 
+ * The events in the channel are formatted as tuples, with the 
+ * first element of the tuples being a unique id of the parameter set, 
+ * and the second element containg the the parameters themselves.
+ * Optional extra elements of the tuples will be passed to the output as is.
+ *
+ * @param args A map that must contain a 'config' key that points
+ *              to a parsed config (see readConfig()). Optionally, a
+ *              'key' key can be provided which can be used to create a unique
+ *              name for the workflow process.
+ *
+ * @return A workflow that allows processing a channel of Vdsl3 formatted events
+ * and apply a Viash config to them.
+ */
+def preprocessInputs(Map args) {
+  preprocessInputsDeprecationWarning()
+
+  def config = args.config
+  assert config instanceof Map : 
+    "Error in preprocessInputs: config must be a map. " +
+    "Expected class: Map. Found: config.getClass() is ${config.getClass()}"
+  def key_ = args.key ?: config.name
+
+  // Get different parameter types (used throughout this function)
+  def defaultArgs = config.allArguments
+    .findAll { it.containsKey("default") }
+    .collectEntries { [ it.plainName, it.default ] }
+
+  map { tup ->
+    def id = tup[0]
+    def data = tup[1]
+    def passthrough = tup.drop(2)
+
+    def new_data = (defaultArgs + data).collectEntries { name, value ->
+      def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") }
+      
+      if (par != null) {
+        value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'")
+      }
+
+      [ name, value ]
+    }
+
+    [ id, new_data ] + passthrough
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component config.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component config.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component config.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runComponents(Map args) {
+  log.warn("runComponents is deprecated, use runEach instead")
+  assert args.components: "runComponents should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runComponents"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def id_ = args.id
+
+  workflow runComponentsWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def comp_config = comp_.config
+
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_config)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          // def new_id = id_(tup[0], tup[1], comp_config)
+          def new_id = tup[0]
+          if (id_ instanceof String) {
+            new_id = id_
+          } else if (id_ instanceof Closure) {
+            new_id = id_(new_id, tup[1], comp_config)
+          }
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def data_ch = id_ch | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_config)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_config)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+      
+      post_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runComponentsWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf'
+/**
+ * Run a list of components on a stream of data.
+ * 
+ * @param components: list of Viash VDSL3 modules to run
+ * @param fromState: a closure, a map or a list of keys to extract from the input data.
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param toState: a closure, a map or a list of keys to extract from the output data
+ *   If a closure, it will be called with the id, the output data, the old state and the component itself.
+ * @param filter: filter function to apply to the input.
+ *   It will be called with the id, the data and the component itself.
+ * @param id: id to use for the output data
+ *   If a closure, it will be called with the id, the data and the component itself.
+ * @param auto: auto options to pass to the components
+ *
+ * @return: a workflow that runs the components
+ **/
+def runEach(Map args) {
+  assert args.components: "runEach should be passed a list of components to run"
+
+  def components_ = args.components
+  if (components_ !instanceof List) {
+    components_ = [ components_ ]
+  }
+  assert components_.size() > 0: "pass at least one component to runEach"
+
+  def fromState_ = args.fromState
+  def toState_ = args.toState
+  def filter_ = args.filter
+  def runIf_ = args.runIf
+  def id_ = args.id
+
+  assert !runIf_ || runIf_ instanceof Closure: "runEach: must pass a Closure to runIf."
+
+  workflow runEachWf {
+    take: input_ch
+    main:
+
+    // generate one channel per method
+    out_chs = components_.collect{ comp_ ->
+      def filter_ch = filter_
+        ? input_ch | filter{tup ->
+          filter_(tup[0], tup[1], comp_)
+        }
+        : input_ch
+      def id_ch = id_
+        ? filter_ch | map{tup ->
+          def new_id = id_
+          if (new_id instanceof Closure) {
+            new_id = new_id(tup[0], tup[1], comp_)
+          }
+          assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}"
+          [new_id] + tup.drop(1)
+        }
+        : filter_ch
+      def chPassthrough = null
+      def chRun = null
+      if (runIf_) {
+        def idRunIfBranch = id_ch.branch{ tup ->
+          run: runIf_(tup[0], tup[1], comp_)
+          passthrough: true
+        }
+        chPassthrough = idRunIfBranch.passthrough
+        chRun = idRunIfBranch.run
+      } else {
+        chRun = id_ch
+        chPassthrough = Channel.empty()
+      }
+      def data_ch = chRun | map{tup ->
+          def new_data = tup[1]
+          if (fromState_ instanceof Map) {
+            new_data = fromState_.collectEntries{ key0, key1 ->
+              [key0, new_data[key1]]
+            }
+          } else if (fromState_ instanceof List) {
+            new_data = fromState_.collectEntries{ key ->
+              [key, new_data[key]]
+            }
+          } else if (fromState_ instanceof Closure) {
+            new_data = fromState_(tup[0], new_data, comp_)
+          }
+          tup.take(1) + [new_data] + tup.drop(1)
+        }
+      def out_ch = data_ch
+        | comp_.run(
+          auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false]
+        )
+      def post_ch = toState_
+        ? out_ch | map{tup ->
+          def output = tup[1]
+          def old_state = tup[2]
+          def new_state = null
+          if (toState_ instanceof Map) {
+            new_state = old_state + toState_.collectEntries{ key0, key1 ->
+              [key0, output[key1]]
+            }
+          } else if (toState_ instanceof List) {
+            new_state = old_state + toState_.collectEntries{ key ->
+              [key, output[key]]
+            }
+          } else if (toState_ instanceof Closure) {
+            new_state = toState_(tup[0], output, old_state, comp_)
+          }
+          [tup[0], new_state] + tup.drop(3)
+        }
+        : out_ch
+
+      def return_ch = post_ch
+        | concat(chPassthrough)
+      
+      return_ch
+    }
+
+    // mix all results
+    output_ch =
+      (out_chs.size == 1)
+        ? out_chs[0]
+        : out_chs[0].mix(*out_chs.drop(1))
+
+    emit: output_ch
+  }
+
+  return runEachWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf'
+/**
+ * Join sourceChannel to targetChannel
+ * 
+ * This function joins the sourceChannel to the targetChannel. 
+ * However, each id in the targetChannel must be present in the
+ * sourceChannel. If _meta.join_id exists in the targetChannel, that is 
+ * used as an id instead. If the id doesn't match any id in the sourceChannel,
+ * an error is thrown.
+ */
+
+def safeJoin(targetChannel, sourceChannel, key) {
+  def sourceIDs = new IDChecker()
+
+  def sourceCheck = sourceChannel
+    | map { tup ->
+      sourceIDs.observe(tup[0])
+      tup
+    }
+  def targetCheck = targetChannel
+    | map { tup ->
+      def id = tup[0]
+      
+      if (!sourceIDs.contains(id)) {
+        error (
+          "Error in module '${key}' when merging output with original state.\n" +
+          "  Reason: output with id '${id}' could not be joined with source channel.\n" +
+          "    If the IDs in the output channel differ from the input channel,\n" + 
+          "    please set `tup[1]._meta.join_id to the original ID.\n" +
+          "  Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + 
+          "  Unexpected ID in the output channel: '${id}'.\n" +
+          "  Example input event: [\"id\", [input: file(...)]],\n" +
+          "  Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]"
+        )
+      }
+      // TODO: add link to our documentation on how to fix this
+
+      tup
+    }
+  
+  sourceCheck.cross(targetChannel)
+    | map{ left, right ->
+      right + left.drop(1)
+    }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf'
+def _processArgument(arg) {
+  arg.multiple = arg.multiple != null ? arg.multiple : false
+  arg.required = arg.required != null ? arg.required : false
+  arg.direction = arg.direction != null ? arg.direction : "input"
+  arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";"
+  arg.plainName = arg.name.replaceAll("^-*", "")
+
+  if (arg.type == "file") {
+    arg.must_exist = arg.must_exist != null ? arg.must_exist : true
+    arg.create_parent = arg.create_parent != null ? arg.create_parent : true
+  }
+
+  // add default values to output files which haven't already got a default
+  if (arg.type == "file" && arg.direction == "output" && arg.default == null) {
+    def mult = arg.multiple ? "_*" : ""
+    def extSearch = ""
+    if (arg.default != null) {
+      extSearch = arg.default
+    } else if (arg.example != null) {
+      extSearch = arg.example
+    }
+    if (extSearch instanceof List) {
+      extSearch = extSearch[0]
+    }
+    def extSearchResult = extSearch.find("\\.[^\\.]+\$")
+    def ext = extSearchResult != null ? extSearchResult : ""
+    arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}"
+    if (arg.multiple) {
+      arg.default = [arg.default]
+    }
+  }
+
+  if (!arg.multiple) {
+    if (arg.default != null && arg.default instanceof List) {
+      arg.default = arg.default[0]
+    }
+    if (arg.example != null && arg.example instanceof List) {
+      arg.example = arg.example[0]
+    }
+  }
+
+  if (arg.type == "boolean_true") {
+    arg.default = false
+  }
+  if (arg.type == "boolean_false") {
+    arg.default = true
+  }
+
+  arg
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf'
+def addGlobalArguments(config) {
+  def localConfig = [
+    "argument_groups": [
+      [
+        "name": "Nextflow input-output arguments",
+        "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+        "arguments" : [
+          [
+            'name': '--publish_dir',
+            'required': true,
+            'type': 'string',
+            'description': 'Path to an output directory.',
+            'example': 'output/',
+            'multiple': false
+          ],
+          [
+            'name': '--param_list',
+            'required': false,
+            'type': 'string',
+            'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.
+            |
+            |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`.
+            |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.
+            |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`.
+            |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`.
+            |
+            |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(),
+            'example': 'my_params.yaml',
+            'multiple': false,
+            'hidden': true
+          ]
+          // TODO: allow multiple: true in param_list?
+          // TODO: allow to specify a --param_list_regex to filter the param_list?
+          // TODO: allow to specify a --param_list_from_state to remap entries in the param_list?
+        ]
+      ]
+    ]
+  ]
+
+  return processConfig(_mergeMap(config, localConfig))
+}
+
+def _mergeMap(Map lhs, Map rhs) {
+  return rhs.inject(lhs.clone()) { map, entry ->
+    if (map[entry.key] instanceof Map && entry.value instanceof Map) {
+      map[entry.key] = _mergeMap(map[entry.key], entry.value)
+    } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) {
+      map[entry.key] += entry.value
+    } else {
+      map[entry.key] = entry.value
+    }
+    return map
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf'
+def _generateArgumentHelp(param) {
+  // alternatives are not supported
+  // def names = param.alternatives ::: List(param.name)
+
+  def unnamedProps = [
+    ["required parameter", param.required],
+    ["multiple values allowed", param.multiple],
+    ["output", param.direction.toLowerCase() == "output"],
+    ["file must exist", param.type == "file" && param.must_exist]
+  ].findAll{it[1]}.collect{it[0]}
+  
+  def dflt = null
+  if (param.default != null) {
+    if (param.default instanceof List) {
+      dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      dflt = param.default.toString()
+    }
+  }
+  def example = null
+  if (param.example != null) {
+    if (param.example instanceof List) {
+      example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ")
+    } else {
+      example = param.example.toString()
+    }
+  }
+  def min = param.min?.toString()
+  def max = param.max?.toString()
+
+  def escapeChoice = { choice ->
+    def s1 = choice.replaceAll("\\n", "\\\\n")
+    def s2 = s1.replaceAll("\"", """\\\"""")
+    s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2
+  }
+  def choices = param.choices == null ? 
+    null : 
+    "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]"
+
+  def namedPropsStr = [
+    ["type", ([param.type] + unnamedProps).join(", ")],
+    ["default", dflt],
+    ["example", example],
+    ["choices", choices],
+    ["min", min],
+    ["max", max]
+  ]
+    .findAll{it[1]}
+    .collect{"\n        " + it[0] + ": " + it[1].replaceAll("\n", "\\n")}
+    .join("")
+  
+  def descStr = param.description == null ?
+    "" :
+    _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n        ")
+  
+  "\n    --" + param.plainName +
+    namedPropsStr +
+    descStr
+}
+
+// Based on Helper.generateHelp() in Helper.scala
+def _generateHelp(config) {
+  def fun = config
+
+  // PART 1: NAME AND VERSION
+  def nameStr = fun.name + 
+    (fun.version == null ? "" : " " + fun.version)
+
+  // PART 2: DESCRIPTION
+  def descrStr = fun.description == null ? 
+    "" :
+    "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n")
+
+  // PART 3: Usage
+  def usageStr = fun.usage == null ? 
+    "" :
+    "\n\nUsage:\n" + fun.usage.trim()
+
+  // PART 4: Options
+  def argGroupStrs = fun.allArgumentGroups.collect{argGroup ->
+    def name = argGroup.name
+    def descriptionStr = argGroup.description == null ?
+      "" :
+      "\n    " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n    ") + "\n"
+    def arguments = argGroup.arguments.collect{arg -> 
+      arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg
+    }.findAll{it != null}
+    def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)}
+    
+    "\n\n$name:" +
+      descriptionStr +
+      argumentStrs.join("\n")
+  }
+
+  // FINAL: combine
+  def out = nameStr + 
+    descrStr +
+    usageStr + 
+    argGroupStrs.join("")
+
+  return out
+}
+
+// based on Format._paragraphWrap
+def _paragraphWrap(str, maxLength) {
+  def outLines = []
+  str.split("\n").each{par ->
+    def words = par.split("\\s").toList()
+
+    def word = null
+    def line = words.pop()
+    while(!words.isEmpty()) {
+      word = words.pop()
+      if (line.length() + word.length() + 1 <= maxLength) {
+        line = line + " " + word
+      } else {
+        outLines.add(line)
+        line = word
+      }
+    }
+    if (words.isEmpty()) {
+      outLines.add(line)
+    }
+  }
+  return outLines
+}
+
+def helpMessage(config) {
+  if (params.containsKey("help") && params.help) {
+    def mergedConfig = addGlobalArguments(config)
+    def helpStr = _generateHelp(mergedConfig)
+    println(helpStr)
+    exit 0
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf'
+def processConfig(config) {
+  // set defaults for arguments
+  config.arguments = 
+    (config.arguments ?: []).collect{_processArgument(it)}
+
+  // set defaults for argument_group arguments
+  config.argument_groups =
+    (config.argument_groups ?: []).collect{grp ->
+      grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)}
+      grp
+    }
+
+  // create combined arguments list
+  config.allArguments = 
+    config.arguments +
+    config.argument_groups.collectMany{it.arguments}
+
+  // add missing argument groups (based on Functionality::allArgumentGroups())
+  def argGroups = config.argument_groups
+  if (argGroups.any{it.name.toLowerCase() == "arguments"}) {
+    argGroups = argGroups.collect{ grp ->
+      if (grp.name.toLowerCase() == "arguments") {
+        grp = grp + [
+          arguments: grp.arguments + config.arguments
+        ]
+      }
+      grp
+    }
+  } else {
+    argGroups = argGroups + [
+      name: "Arguments",
+      arguments: config.arguments
+    ]
+  }
+  config.allArgumentGroups = argGroups
+
+  config
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf'
+
+def readConfig(file) {
+  def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml"))
+  processConfig(config)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf'
+/**
+  * Resolve a path relative to the current file.
+  * 
+  * @param str The path to resolve, as a String.
+  * @param parentPath The path to resolve relative to, as a Path.
+  *
+  * @return The path that may have been resovled, as a Path.
+  */
+def _resolveSiblingIfNotAbsolute(str, parentPath) {
+  if (str !instanceof String) {
+    return str
+  }
+  if (!_stringIsAbsolutePath(str)) {
+    return parentPath.resolveSibling(str)
+  } else {
+    return file(str, hidden: true)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf'
+/**
+  * Check whether a path as a string is absolute.
+  *
+  * In the past, we tried using `file(., relative: true).isAbsolute()`,
+  * but the 'relative' option was added in 22.10.0.
+  *
+  * @param path The path to check, as a String.
+  *
+  * @return Whether the path is absolute, as a boolean.
+  */
+def _stringIsAbsolutePath(path) {
+  def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/
+
+  assert path instanceof String
+  return _resolve_URL_PROTOCOL.matcher(path).matches()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf'
+class CustomTraceObserver implements nextflow.trace.TraceObserver {
+  List traces
+
+  CustomTraceObserver(List traces) {
+    this.traces = traces
+  }
+
+  @Override
+  void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+
+  @Override
+  void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) {
+    def trace2 = trace.store.clone()
+    trace2.script = null
+    traces.add(trace2)
+  }
+}
+
+def collectTraces() {
+  def traces = Collections.synchronizedList([])
+
+  // add custom trace observer which stores traces in the traces object
+  session.observers.add(new CustomTraceObserver(traces))
+
+  traces
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf'
+/**
+  * Performs a deep clone of the given object.
+  * @param x an object
+  */
+def deepClone(x) {
+  iterateMap(x, {it instanceof Cloneable ? it.clone() : it})
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf'
+def getPublishDir() {
+  return params.containsKey("publish_dir") ? params.publish_dir : 
+    params.containsKey("publishDir") ? params.publishDir : 
+    null
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf'
+
+// Recurse upwards until we find a '.build.yaml' file
+def _findBuildYamlFile(pathPossiblySymlink) {
+  def path = pathPossiblySymlink.toRealPath()
+  def child = path.resolve(".build.yaml")
+  if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) {
+    return child
+  } else {
+    def parent = path.getParent()
+    if (parent == null) {
+      return null
+    } else {
+      return _findBuildYamlFile(parent)
+    }
+  }
+}
+
+// get the root of the target folder
+def getRootDir() {
+  def dir = _findBuildYamlFile(meta.resources_dir)
+  assert dir != null: "Could not find .build.yaml in the folder structure"
+  dir.getParent()
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf'
+/**
+  * Recursively apply a function over the leaves of an object.
+  * @param obj The object to iterate over.
+  * @param fun The function to apply to each value.
+  * @return The object with the function applied to each value.
+  */
+def iterateMap(obj, fun) {
+  if (obj instanceof List && obj !instanceof String) {
+    return obj.collect{item ->
+      iterateMap(item, fun)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectEntries{key, item ->
+      [key.toString(), iterateMap(item, fun)]
+    }
+  } else {
+    return fun(obj)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf'
+/**
+  * A view for printing the event of each channel as a YAML blob.
+  * This is useful for debugging.
+  */
+def niceView() {
+  workflow niceViewWf {
+    take: input
+    main:
+      output = input
+        | view{toYamlBlob(it)}
+    emit: output
+  }
+  return niceViewWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf'
+
+def readCsv(file_path) {
+  def output = []
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+
+  // todo: allow escaped quotes in string
+  // todo: allow single quotes?
+  def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''')
+  def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''')
+
+  def br = java.nio.file.Files.newBufferedReader(inputFile)
+
+  def row = -1
+  def header = null
+  while (br.ready() && header == null) {
+    def line = br.readLine()
+    row++
+    if (!line.startsWith("#")) {
+      header = splitRegex.split(line, -1).collect{field ->
+        m = removeQuote.matcher(field)
+        m.find() ? m.replaceFirst('$1') : field
+      }
+    }
+  }
+  assert header != null: "CSV file should contain a header"
+
+  while (br.ready()) {
+    def line = br.readLine()
+    row++
+    if (line == null) {
+      br.close()
+      break
+    }
+
+    if (!line.startsWith("#")) {
+      def predata = splitRegex.split(line, -1)
+      def data = predata.collect{field ->
+        if (field == "") {
+          return null
+        }
+        def m = removeQuote.matcher(field)
+        if (m.find()) {
+          return m.replaceFirst('$1')
+        } else {
+          return field
+        }
+      }
+      assert header.size() == data.size(): "Row $row should contain the same number as fields as the header"
+      
+      def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null}
+      output.add(dataMap)
+    }
+  }
+
+  output
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf'
+def readJson(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parse(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf'
+def readJsonBlob(str) {
+  def jsonSlurper = new groovy.json.JsonSlurper()
+  jsonSlurper.parseText(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf'
+// Custom constructor to modify how certain objects are parsed from YAML
+class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor {
+  Path root
+
+  class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct {
+    public Object construct(org.yaml.snakeyaml.nodes.Node node) {
+      String filename = (String) constructScalar(node);
+      if (root != null) {
+        return root.resolve(filename);
+      }
+      return java.nio.file.Paths.get(filename);
+    }
+  }
+
+  CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) {
+    super(options)
+    this.root = root
+    // Handling !file tag and parse it back to a File type
+    this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath())
+  }
+}
+
+def readTaggedYaml(Path path) {
+  def options = new org.yaml.snakeyaml.LoaderOptions()
+  def constructor = new CustomConstructor(options, path.getParent())
+  def yaml = new org.yaml.snakeyaml.Yaml(constructor)
+  return yaml.load(path.text)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf'
+def readYaml(file_path) {
+  def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(inputFile)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf'
+def readYamlBlob(str) {
+  def yamlSlurper = new org.yaml.snakeyaml.Yaml()
+  yamlSlurper.load(str)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf'
+String toJsonBlob(data) {
+  return groovy.json.JsonOutput.toJson(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf'
+// Custom representer to modify how certain objects are represented in YAML
+class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer {
+  Path relativizer
+
+  class RepresentPath implements org.yaml.snakeyaml.representer.Represent {
+    public String getFileName(Object obj) {
+      if (obj instanceof File) {
+        obj = ((File) obj).toPath();
+      }
+      if (obj !instanceof Path) {
+        throw new IllegalArgumentException("Object: " + obj + " is not a Path or File");
+      }
+      def path = (Path) obj;
+
+      if (relativizer != null) {
+        return relativizer.relativize(path).toString()
+      } else {
+        return path.toString()
+      }
+    }
+
+    public org.yaml.snakeyaml.nodes.Node representData(Object data) {
+      String filename = getFileName(data);
+      def tag = new org.yaml.snakeyaml.nodes.Tag("!file");
+      return representScalar(tag, filename);
+    }
+  }
+  CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) {
+    super(options)
+    this.relativizer = relativizer
+    this.representers.put(sun.nio.fs.UnixPath, new RepresentPath())
+    this.representers.put(Path, new RepresentPath())
+    this.representers.put(File, new RepresentPath())
+  }
+}
+
+String toTaggedYamlBlob(data) {
+  return toRelativeTaggedYamlBlob(data, null)
+}
+String toRelativeTaggedYamlBlob(data, Path relativizer) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  def representer = new CustomRepresenter(options, relativizer)
+  def yaml = new org.yaml.snakeyaml.Yaml(representer, options)
+  return yaml.dump(data)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf'
+String toYamlBlob(data) {
+  def options = new org.yaml.snakeyaml.DumperOptions()
+  options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK)
+  options.setPrettyFlow(true)
+  def yaml = new org.yaml.snakeyaml.Yaml(options)
+  def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it })
+  return yaml.dump(cleanData)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf'
+void writeJson(data, file) {
+  assert data: "writeJson: data should not be null"
+  assert file: "writeJson: file should not be null"
+  file.write(toJsonBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf'
+void writeYaml(data, file) {
+  assert data: "writeYaml: data should not be null"
+  assert file: "writeYaml: file should not be null"
+  file.write(toYamlBlob(data))
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf'
+def findStates(Map params, Map config) {
+  def auto_config = deepClone(config)
+  def auto_params = deepClone(params)
+
+  auto_config = auto_config.clone()
+  // override arguments
+  auto_config.argument_groups = []
+  auto_config.arguments = [
+    [
+      type: "string",
+      name: "--id",
+      description: "A dummy identifier",
+      required: false
+    ],
+    [
+      type: "file",
+      name: "--input_states",
+      example: "/path/to/input/directory/**/state.yaml",
+      description: "Path to input directory containing the datasets to be integrated.",
+      required: true,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--filter",
+      example: "foo/.*/state.yaml",
+      description: "Regex to filter state files by path.",
+      required: false
+    ],
+    // to do: make this a yaml blob?
+    [
+      type: "string",
+      name: "--rename_keys",
+      example: ["newKey1:oldKey1", "newKey2:oldKey2"],
+      description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.",
+      required: false,
+      multiple: true,
+      multiple_sep: ";"
+    ],
+    [
+      type: "string",
+      name: "--settings",
+      example: '{"output_dataset": "dataset.h5ad", "k": 10}',
+      description: "Global arguments as a JSON glob to be passed to all components.",
+      required: false
+    ]
+  ]
+  if (!(auto_params.containsKey("id"))) {
+    auto_params["id"] = "auto"
+  }
+
+  // run auto config through processConfig once more
+  auto_config = processConfig(auto_config)
+
+  workflow findStatesWf {
+    helpMessage(auto_config)
+
+    output_ch = 
+      channelFromParams(auto_params, auto_config)
+        | flatMap { autoId, args ->
+
+          def globalSettings = args.settings ? readYamlBlob(args.settings) : [:]
+
+          // look for state files in input dir
+          def stateFiles = args.input_states
+
+          // filter state files by regex
+          if (args.filter) {
+            stateFiles = stateFiles.findAll{ stateFile ->
+              def stateFileStr = stateFile.toString()
+              def matcher = stateFileStr =~ args.filter
+              matcher.matches()}
+          }
+
+          // read in states
+          def states = stateFiles.collect { stateFile ->
+            def state_ = readTaggedYaml(stateFile)
+            [state_.id, state_]
+          }
+
+          // construct renameMap
+          if (args.rename_keys) {
+            def renameMap = args.rename_keys.collectEntries{renameString ->
+              def split = renameString.split(":")
+              assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey', or 'newKey:oldKey;newKey:oldKey' in case of multiple values"
+              split
+            }
+
+            // rename keys in state, only let states through which have all keys
+            // also add global settings
+            states = states.collectMany{id, state ->
+              def newState = [:]
+
+              for (key in renameMap.keySet()) {
+                def origKey = renameMap[key]
+                if (!(state.containsKey(origKey))) {
+                  return []
+                }
+                newState[key] = state[origKey]
+              }
+
+              [[id, globalSettings + newState]]
+            }
+          }
+
+          states
+        }
+    emit:
+    output_ch
+  }
+
+  return findStatesWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf'
+def joinStates(Closure apply_) {
+  workflow joinStatesWf {
+    take: input_ch
+    main:
+    output_ch = input_ch
+      | toSortedList
+      | filter{ it.size() > 0 }
+      | map{ tups ->
+        def ids = tups.collect{it[0]}
+        def states = tups.collect{it[1]}
+        apply_(ids, states)
+      }
+
+    emit: output_ch
+  }
+  return joinStatesWf
+}
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf'
+def collectFiles(obj) {
+  if (obj instanceof java.io.File || obj instanceof Path)  {
+    return [obj]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.collectMany{item ->
+      collectFiles(item)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectFiles(item)
+    }
+  } else {
+    return []
+  }
+}
+
+/**
+ * Recurse through a state and collect all input files and their target output filenames.
+ * @param obj The state to recurse through.
+ * @param prefix The prefix to prepend to the output filenames.
+ */
+def collectInputOutputPaths(obj, prefix) {
+  if (obj instanceof File || obj instanceof Path)  {
+    def path = obj instanceof Path ? obj : obj.toPath()
+    def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: ""
+    def newFilename = prefix + ext
+    return [[obj, newFilename]]
+  } else if (obj instanceof List && obj !instanceof String) {
+    return obj.withIndex().collectMany{item, ix ->
+      collectInputOutputPaths(item, prefix + "_" + ix)
+    }
+  } else if (obj instanceof Map) {
+    return obj.collectMany{key, item ->
+      collectInputOutputPaths(item, prefix + "." + key)
+    }
+  } else {
+    return []
+  }
+}
+
+def publishStates(Map args) {
+  def key_ = args.get("key")
+  def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml'))
+
+  assert key_ != null : "publishStates: key must be specified"
+  
+  workflow publishStatesWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1]
+
+          // the input files and the target output filenames
+          def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose()
+          def inputFiles_ = inputoutputFilenames_[0]
+          def outputFilenames_ = inputoutputFilenames_[1]
+
+          def yamlFilename = yamlTemplate_
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+
+            // TODO: do the pathnames in state_ match up with the outputFilenames_?
+
+          // convert state to yaml blob
+          def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename))
+
+          [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesWf
+}
+process publishStatesProc {
+  // todo: check publishpath?
+  publishDir path: "${getPublishDir()}/", mode: "copy"
+  tag "$id"
+  input:
+    tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles)
+  output:
+    tuple val(id), path{[yamlFile] + outputFiles}
+  script:
+  def copyCommands = [
+    inputFiles instanceof List ? inputFiles : [inputFiles],
+    outputFiles instanceof List ? outputFiles : [outputFiles]
+  ]
+    .transpose()
+    .collectMany{infile, outfile ->
+      if (infile.toString() != outfile.toString()) {
+        [
+          "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"",
+          "cp -r '${infile.toString()}' '${outfile.toString()}'"
+        ]
+      } else {
+        // no need to copy if infile is the same as outfile
+        []
+      }
+    }
+  """
+mkdir -p "\$(dirname '${yamlFile}')"
+echo "Storing state as yaml"
+echo '${yamlBlob}' > '${yamlFile}'
+echo "Copying output files to destination folder"
+${copyCommands.join("\n  ")}
+"""
+}
+
+
+// this assumes that the state contains no other values other than those specified in the config
+def publishStatesByConfig(Map args) {
+  def config = args.get("config")
+  assert config != null : "publishStatesByConfig: config must be specified"
+
+  def key_ = args.get("key", config.name)
+  assert key_ != null : "publishStatesByConfig: key must be specified"
+  
+  workflow publishStatesSimpleWf {
+    take: input_ch
+    main:
+      input_ch
+        | map { tup ->
+          def id_ = tup[0]
+          def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10]
+          def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad']
+
+          // TODO: allow overriding the state.yaml template
+          // TODO TODO: if auto.publish == "state", add output_state as an argument
+          def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml'
+          def yamlFilename = yamlTemplate
+            .replaceAll('\\$id', id_)
+            .replaceAll('\\$\\{id\\}', id_)
+            .replaceAll('\\$key', key_)
+            .replaceAll('\\$\\{key\\}', key_)
+          def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent()
+
+          // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where
+          //   - key is a String
+          //   - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path)
+          //   - inputPath is a List[Path]
+          //   - outputFilename is a List[String]
+          //   - (key, value) are the tuples that will be saved to the state.yaml file
+          //   - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml)
+          def processedState =
+            config.allArguments
+              .findAll { it.direction == "output" }
+              .collectMany { par ->
+                def plainName_ = par.plainName
+                // if the state does not contain the key, it's an
+                // optional argument for which the component did 
+                // not generate any output
+                if (!state_.containsKey(plainName_)) {
+                  return []
+                }
+                def value = state_[plainName_]
+                // if the parameter is not a file, it should be stored
+                // in the state as-is, but is not something that needs 
+                // to be copied from the source path to the dest path
+                if (par.type != "file") {
+                  return [[key: plainName_, value: value, inputPath: [], outputFilename: []]]
+                }
+                // if the orig state does not contain this filename,
+                // it's an optional argument for which the user specified
+                // that it should not be returned as a state
+                if (!origState_.containsKey(plainName_)) {
+                  return []
+                }
+                def filenameTemplate = origState_[plainName_]
+                // if the pararameter is multiple: true, fetch the template
+                if (par.multiple && filenameTemplate instanceof List) {
+                  filenameTemplate = filenameTemplate[0]
+                }
+                // instantiate the template
+                def filename = filenameTemplate
+                  .replaceAll('\\$id', id_)
+                  .replaceAll('\\$\\{id\\}', id_)
+                  .replaceAll('\\$key', key_)
+                  .replaceAll('\\$\\{key\\}', key_)
+                if (par.multiple) {
+                  // if the parameter is multiple: true, the filename
+                  // should contain a wildcard '*' that is replaced with
+                  // the index of the file
+                  assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}"
+                  def outputPerFile = value.withIndex().collect{ val, ix ->
+                    def filename_ix = filename.replace("*", ix.toString())
+                    def value_ = java.nio.file.Paths.get(filename_ix)
+                    // if id contains a slash
+                    if (yamlDir != null) {
+                      value_ = yamlDir.relativize(value_)
+                    }
+                    def inputPath = val instanceof File ? val.toPath() : val
+                    [value: value_, inputPath: inputPath, outputFilename: filename_ix]
+                  }
+                  def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> 
+                    [key, outputPerFile.collect{dic -> dic[key]}]
+                  }
+                  return [[key: plainName_] + transposedOutputs]
+                } else {
+                  def value_ = java.nio.file.Paths.get(filename)
+                  // if id contains a slash
+                  if (yamlDir != null) {
+                    value_ = yamlDir.relativize(value_)
+                  }
+                  def inputPath = value instanceof File ? value.toPath() : value
+                  return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]]
+                }
+              }
+          
+          def updatedState_ = processedState.collectEntries{[it.key, it.value]}
+          def inputPaths = processedState.collectMany{it.inputPath}
+          def outputFilenames = processedState.collectMany{it.outputFilename}
+          
+          // convert state to yaml blob
+          def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_)
+
+          [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames]
+        }
+        | publishStatesProc
+    emit: input_ch
+  }
+  return publishStatesSimpleWf
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf'
+def setState(fun) {
+  assert fun instanceof Closure || fun instanceof Map || fun instanceof List :
+    "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}"
+
+  // if fun is a List, convert to map
+  if (fun instanceof List) {
+    // check whether fun is a list[string]
+    assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings"
+    fun = fun.collectEntries{[it, it]}
+  }
+
+  // if fun is a map, convert to closure
+  if (fun instanceof Map) {
+    // check whether fun is a map[string, string]
+    assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings"
+    assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings"
+    def funMap = fun.clone()
+    // turn the map into a closure to be used later on
+    fun = { id_, state_ ->
+      assert state_ instanceof Map : "Error in setState: the state is not a Map"
+      funMap.collectMany{newkey, origkey ->
+        if (state_.containsKey(origkey)) {
+          [[newkey, state_[origkey]]]
+        } else {
+          []
+        }
+      }.collectEntries()
+    }
+  }
+
+  map { tup ->
+    def id = tup[0]
+    def state = tup[1]
+    def unfilteredState = fun(id, state)
+    def newState = unfilteredState.findAll{key, val -> val != null}
+    [id, newState] + tup.drop(2)
+  }
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf'
+// TODO: unit test processAuto
+def processAuto(Map auto) {
+  // remove null values
+  auto = auto.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"]
+  def unexpectedKeys = auto.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'"
+
+  // check auto.simplifyInput
+  assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean"
+
+  // check auto.simplifyOutput
+  assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean"
+
+  // check auto.transcript
+  assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean"
+
+  // check auto.publish
+  assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'"
+
+  return auto.subMap(expectedKeys)
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf'
+def assertMapKeys(map, expectedKeys, requiredKeys, mapName) {
+  assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}"
+  map.forEach { key, val -> 
+    assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+  requiredKeys.forEach { requiredKey -> 
+    assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map"
+  }
+}
+
+// TODO: unit test processDirectives
+def processDirectives(Map drctv) {
+  // remove null values
+  drctv = drctv.findAll{k, v -> v != null}
+
+  // check for unexpected keys
+  def expectedKeys = [
+    "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time"
+  ]
+  def unexpectedKeys = drctv.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'"
+
+  /* DIRECTIVE accelerator
+    accepted examples:
+    - [ limit: 4, type: "nvidia-tesla-k80" ]
+  */
+  if (drctv.containsKey("accelerator")) {
+    assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator")
+  }
+
+  /* DIRECTIVE afterScript
+    accepted examples:
+    - "source /cluster/bin/cleanup"
+  */
+  if (drctv.containsKey("afterScript")) {
+    assert drctv["afterScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE beforeScript
+    accepted examples:
+    - "source /cluster/bin/setup"
+  */
+  if (drctv.containsKey("beforeScript")) {
+    assert drctv["beforeScript"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cache
+    accepted examples:
+    - true
+    - false
+    - "deep"
+    - "lenient"
+  */
+  if (drctv.containsKey("cache")) {
+    assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean
+    if (drctv["cache"] instanceof CharSequence) {
+      assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache"
+    }
+  }
+
+  /* DIRECTIVE conda
+    accepted examples:
+    - "bwa=0.7.15"
+    - "bwa=0.7.15 fastqc=0.11.5"
+    - ["bwa=0.7.15", "fastqc=0.11.5"]
+  */
+  if (drctv.containsKey("conda")) {
+    if (drctv["conda"] instanceof List) {
+      drctv["conda"] = drctv["conda"].join(" ")
+    }
+    assert drctv["conda"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE container
+    accepted examples:
+    - "foo/bar:tag"
+    - [ registry: "reg", image: "im", tag: "ta" ]
+      is transformed to "reg/im:ta"
+    - [ image: "im" ] 
+      is transformed to "im:latest"
+  */
+  if (drctv.containsKey("container")) {
+    assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence
+    if (drctv["container"] instanceof Map) {
+      def m = drctv["container"]
+      assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container")
+      def part1 = 
+        System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : 
+        params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove?
+        m.registry ? m.registry + "/" : 
+        ""
+      def part2 = m.image
+      def part3 = m.tag ? ":" + m.tag : ":latest"
+      drctv["container"] = part1 + part2 + part3
+    }
+  }
+
+  /* DIRECTIVE containerOptions
+    accepted examples:
+    - "--foo bar"
+    - ["--foo bar", "-f b"]
+  */
+  if (drctv.containsKey("containerOptions")) {
+    if (drctv["containerOptions"] instanceof List) {
+      drctv["containerOptions"] = drctv["containerOptions"].join(" ")
+    }
+    assert drctv["containerOptions"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE cpus
+    accepted examples:
+    - 1
+    - 10
+  */
+  if (drctv.containsKey("cpus")) {
+    assert drctv["cpus"] instanceof Integer
+  }
+
+  /* DIRECTIVE disk
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("disk")) {
+    assert drctv["disk"] instanceof CharSequence
+    // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE echo
+    accepted examples:
+    - true
+    - false
+  */
+  if (drctv.containsKey("echo")) {
+    assert drctv["echo"] instanceof Boolean
+  }
+
+  /* DIRECTIVE errorStrategy
+    accepted examples:
+    - "terminate"
+    - "finish"
+  */
+  if (drctv.containsKey("errorStrategy")) {
+    assert drctv["errorStrategy"] instanceof CharSequence
+    assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy"
+  }
+
+  /* DIRECTIVE executor
+    accepted examples:
+    - "local"
+    - "sge"
+  */
+  if (drctv.containsKey("executor")) {
+    assert drctv["executor"] instanceof CharSequence
+    assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor"
+  }
+
+  /* DIRECTIVE machineType
+    accepted examples:
+    - "n1-highmem-8"
+  */
+  if (drctv.containsKey("machineType")) {
+    assert drctv["machineType"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE maxErrors
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxErrors")) {
+    assert drctv["maxErrors"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxForks
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxForks")) {
+    assert drctv["maxForks"] instanceof Integer
+  }
+
+  /* DIRECTIVE maxRetries
+    accepted examples:
+    - 1
+    - 3
+  */
+  if (drctv.containsKey("maxRetries")) {
+    assert drctv["maxRetries"] instanceof Integer
+  }
+
+  /* DIRECTIVE memory
+    accepted examples:
+    - "1 GB"
+    - "2TB"
+    - "3.2KB"
+    - "10.B"
+  */
+  if (drctv.containsKey("memory")) {
+    assert drctv["memory"] instanceof CharSequence
+    // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B")
+    // ^ does not allow closures
+  }
+
+  /* DIRECTIVE module
+    accepted examples:
+    - "ncbi-blast/2.2.27"
+    - "ncbi-blast/2.2.27:t_coffee/10.0"
+    - ["ncbi-blast/2.2.27", "t_coffee/10.0"]
+  */
+  if (drctv.containsKey("module")) {
+    if (drctv["module"] instanceof List) {
+      drctv["module"] = drctv["module"].join(":")
+    }
+    assert drctv["module"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE penv
+    accepted examples:
+    - "smp"
+  */
+  if (drctv.containsKey("penv")) {
+    assert drctv["penv"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE pod
+    accepted examples:
+    - [ label: "key", value: "val" ]
+    - [ annotation: "key", value: "val" ]
+    - [ env: "key", value: "val" ]
+    - [ [label: "l", value: "v"], [env: "e", value: "v"]]
+  */
+  if (drctv.containsKey("pod")) {
+    if (drctv["pod"] instanceof Map) {
+      drctv["pod"] = [ drctv["pod"] ]
+    }
+    assert drctv["pod"] instanceof List
+    drctv["pod"].forEach { pod ->
+      assert pod instanceof Map
+      // TODO: should more checks be added?
+      // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod
+      // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...?
+    }
+  }
+
+  /* DIRECTIVE publishDir
+    accepted examples:
+    - []
+    - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ]
+    - "/path/to/dir" 
+      is transformed to [[ path: "/path/to/dir" ]]
+    - [ path: "/path/to/dir", mode: "cache" ]
+      is transformed to [[ path: "/path/to/dir", mode: "cache" ]]
+  */
+  // TODO: should we also look at params["publishDir"]?
+  if (drctv.containsKey("publishDir")) {
+    def pblsh = drctv["publishDir"]
+    
+    // check different options
+    assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence
+    
+    // turn into list if not already so
+    // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work.
+    pblsh = pblsh instanceof List ? pblsh : [ pblsh ]
+
+    // check elements of publishDir
+    pblsh = pblsh.collect{ elem ->
+      // turn into map if not already so
+      elem = elem instanceof CharSequence ? [ path: elem ] : elem
+
+      // check types and keys
+      assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}"
+      assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir")
+
+      // check elements in map
+      assert elem.containsKey("path")
+      assert elem["path"] instanceof CharSequence
+      if (elem.containsKey("mode")) {
+        assert elem["mode"] instanceof CharSequence
+        assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ]
+      }
+      if (elem.containsKey("overwrite")) {
+        assert elem["overwrite"] instanceof Boolean
+      }
+      if (elem.containsKey("pattern")) {
+        assert elem["pattern"] instanceof CharSequence
+      }
+      if (elem.containsKey("saveAs")) {
+        assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'"
+      }
+      if (elem.containsKey("enabled")) {
+        assert elem["enabled"] instanceof Boolean
+      }
+
+      // return final result
+      elem
+    }
+    // store final directive
+    drctv["publishDir"] = pblsh
+  }
+
+  /* DIRECTIVE queue
+    accepted examples:
+    - "long"
+    - "short,long"
+    - ["short", "long"]
+  */
+  if (drctv.containsKey("queue")) {
+    if (drctv["queue"] instanceof List) {
+      drctv["queue"] = drctv["queue"].join(",")
+    }
+    assert drctv["queue"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE label
+    accepted examples:
+    - "big_mem"
+    - "big_cpu"
+    - ["big_mem", "big_cpu"]
+  */
+  if (drctv.containsKey("label")) {
+    if (drctv["label"] instanceof CharSequence) {
+      drctv["label"] = [ drctv["label"] ]
+    }
+    assert drctv["label"] instanceof List
+    drctv["label"].forEach { label ->
+      assert label instanceof CharSequence
+      // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?")
+      // ^ does not allow closures
+    }
+  }
+
+  /* DIRECTIVE scratch
+    accepted examples:
+    - true
+    - "/path/to/scratch"
+    - '$MY_PATH_TO_SCRATCH'
+    - "ram-disk"
+  */
+  if (drctv.containsKey("scratch")) {
+    assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE storeDir
+    accepted examples:
+    - "/path/to/storeDir"
+  */
+  if (drctv.containsKey("storeDir")) {
+    assert drctv["storeDir"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE stageInMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageInMode")) {
+    assert drctv["stageInMode"] instanceof CharSequence
+    assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"]
+  }
+
+  /* DIRECTIVE stageOutMode
+    accepted examples:
+    - "copy"
+    - "link"
+  */
+  if (drctv.containsKey("stageOutMode")) {
+    assert drctv["stageOutMode"] instanceof CharSequence
+    assert drctv["stageOutMode"] in ["copy", "move", "rsync"]
+  }
+
+  /* DIRECTIVE tag
+    accepted examples:
+    - "foo"
+    - '$id'
+  */
+  if (drctv.containsKey("tag")) {
+    assert drctv["tag"] instanceof CharSequence
+  }
+
+  /* DIRECTIVE time
+    accepted examples:
+    - "1h"
+    - "2days"
+    - "1day 6hours 3minutes 30seconds"
+  */
+  if (drctv.containsKey("time")) {
+    assert drctv["time"] instanceof CharSequence
+    // todo: validation regex?
+  }
+
+  return drctv
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf'
+def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) {
+  // override defaults with args
+  def workflowArgs = defaultWfArgs + args
+
+  // check whether 'key' exists
+  assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument"
+
+  // if 'key' is a closure, apply it to the original key
+  if (workflowArgs["key"] instanceof Closure) {
+    workflowArgs["key"] = workflowArgs["key"](meta.config.name)
+  }
+  def key = workflowArgs["key"]
+  assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}"
+  assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}"
+
+  // check for any unexpected keys
+  def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"]
+  def unexpectedKeys = workflowArgs.keySet() - expectedKeys
+  assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'"
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument"
+  assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}"
+  workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"])
+
+  // check whether directives exists and apply defaults
+  assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument"
+  assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}"
+  workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"])
+
+  // auto define publish, if so desired
+  if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.publish_dir = \"./output/\""
+    def publishDir = getPublishDir()
+    
+    if (publishDir != null) {
+      workflowArgs.directives.publishDir = [[ 
+        path: publishDir, 
+        saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default
+        mode: "copy"
+      ]]
+    }
+  }
+
+  // auto define transcript, if so desired
+  if (workflowArgs.auto.transcript == true) {
+    // can't assert at this level thanks to the no_publish profile
+    // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : 
+    //   "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" +
+    //   "  Example: params.transcripts_dir = \"./transcripts/\""
+    def transcriptsDir = 
+      params.containsKey("transcripts_dir") ? params.transcripts_dir : 
+      params.containsKey("transcriptsDir") ? params.transcriptsDir : 
+      params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" :
+      params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : 
+      null
+    if (transcriptsDir != null) {
+      def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss')
+      def transcriptsPublishDir = [ 
+        path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/",
+        saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", 
+        mode: "copy"
+      ]
+      def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : []
+      workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir
+    }
+  }
+
+  // if this is a stubrun, remove certain directives?
+  if (workflow.stubRun) {
+    workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"])
+  }
+
+  for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam]) {
+      assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}"
+    }
+  }
+
+  // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well?
+  for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) {
+    if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) {
+      log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead."
+    }
+  }
+
+  // check fromState
+  workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config)
+
+  // check toState
+  workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config)
+
+  // return output
+  return workflowArgs
+}
+
+def _processFromState(fromState, key_, config_) {
+  assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List :
+    "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}"
+  if (fromState == null) {
+    return null
+  }
+  
+  // if fromState is a List, convert to map
+  if (fromState instanceof List) {
+    // check whether fromstate is a list[string]
+    assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings"
+    fromState = fromState.collectEntries{[it, it]}
+  }
+
+  // if fromState is a map, convert to closure
+  if (fromState instanceof Map) {
+    // check whether fromstate is a map[string, string]
+    assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings"
+    assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings"
+    def fromStateMap = fromState.clone()
+    def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    fromState = { it ->
+      def state = it[1]
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def data = fromStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (state.containsKey(origkey)) {
+          [[newkey, state[origkey]]]
+        } else if (!requiredInputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state")
+        }
+      }.collectEntries()
+      data
+    }
+  }
+  
+  return fromState
+}
+
+def _processToState(toState, key_, config_) {
+  if (toState == null) {
+    toState = { tup -> tup[1] }
+  }
+
+  // toState should be a closure, map[string, string], or list[string]
+  assert toState instanceof Closure || toState instanceof Map || toState instanceof List :
+    "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}"
+
+  // if toState is a List, convert to map
+  if (toState instanceof List) {
+    // check whether toState is a list[string]
+    assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings"
+    toState = toState.collectEntries{[it, it]}
+  }
+
+  // if toState is a map, convert to closure
+  if (toState instanceof Map) {
+    // check whether toState is a map[string, string]
+    assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings"
+    assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings"
+    def toStateMap = toState.clone()
+    def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName}
+    // turn the map into a closure to be used later on
+    toState = { it ->
+      def output = it[1]
+      def state = it[2]
+      assert output instanceof Map : "Error in module '$key_': the output is not a Map"
+      assert state instanceof Map : "Error in module '$key_': the state is not a Map"
+      def extraEntries = toStateMap.collectMany{newkey, origkey ->
+        // check whether newkey corresponds to a required argument
+        if (output.containsKey(origkey)) {
+          [[newkey, output[origkey]]]
+        } else if (!requiredOutputNames.contains(origkey)) {
+          []
+        } else {
+          throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output")
+        }
+      }.collectEntries()
+      state + extraEntries
+    }
+  }
+
+  return toState
+}
+
+// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf'
+def _debug(workflowArgs, debugKey) {
+  if (workflowArgs.debug) {
+    view { "process '${workflowArgs.key}' $debugKey tuple: $it"  }
+  } else {
+    map { it }
+  }
+}
+
+// depends on: innerWorkflowFactory
+def workflowFactory(Map args, Map defaultWfArgs, Map meta) {
+  def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta)
+  def key_ = workflowArgs["key"]
+  
+  workflow workflowInstance {
+    take: input_
+
+    main:
+    def chModified = input_
+      | checkUniqueIds([:])
+      | _debug(workflowArgs, "input")
+      | map { tuple ->
+        tuple = deepClone(tuple)
+        
+        if (workflowArgs.map) {
+          tuple = workflowArgs.map(tuple)
+        }
+        if (workflowArgs.mapId) {
+          tuple[0] = workflowArgs.mapId(tuple[0])
+        }
+        if (workflowArgs.mapData) {
+          tuple[1] = workflowArgs.mapData(tuple[1])
+        }
+        if (workflowArgs.mapPassthrough) {
+          tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2))
+        }
+
+        // check tuple
+        assert tuple instanceof List : 
+          "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}"
+        assert tuple.size() >= 2 : 
+          "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: tuple.size() == ${tuple.size()}"
+        
+        // check id field
+        if (tuple[0] instanceof GString) {
+          tuple[0] = tuple[0].toString()
+        }
+        assert tuple[0] instanceof CharSequence : 
+          "Error in module '${key_}': first element of tuple in channel should be a String\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Found: ${tuple[0]}"
+        
+        // match file to input file
+        if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) {
+          def inputFiles = meta.config.allArguments
+            .findAll { it.type == "file" && it.direction == "input" }
+          
+          assert inputFiles.size() == 1 : 
+              "Error in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Anonymous file inputs are only allowed when the process has exactly one file input.\n" +
+              "  Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}"
+
+          tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries()
+        }
+
+        // check data field
+        assert tuple[1] instanceof Map : 
+          "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" +
+          "  Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" +
+          "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+        // rename keys of data field in tuple
+        if (workflowArgs.renameKeys) {
+          assert workflowArgs.renameKeys instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}"
+          assert tuple[1] instanceof Map : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}"
+
+          // TODO: allow renameKeys to be a function?
+          workflowArgs.renameKeys.each { newKey, oldKey ->
+            assert newKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}"
+            assert oldKey instanceof CharSequence : 
+              "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" +
+              "  Example: renameKeys: ['new_key': 'old_key'].\n" +
+              "  Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}"
+            assert tuple[1].containsKey(oldKey) : 
+              "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" +
+              "  Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'"
+            tuple[1].put(newKey, tuple[1][oldKey])
+          }
+          tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey })
+        }
+        tuple
+      }
+
+
+    def chRun = null
+    def chPassthrough = null
+    if (workflowArgs.runIf) {
+      def runIfBranch = chModified.branch{ tup ->
+        run: workflowArgs.runIf(tup[0], tup[1])
+        passthrough: true
+      }
+      chRun = runIfBranch.run
+      chPassthrough = runIfBranch.passthrough
+    } else {
+      chRun = chModified
+      chPassthrough = Channel.empty()
+    }
+
+    def chRunFiltered = workflowArgs.filter ?
+      chRun | filter{workflowArgs.filter(it)} :
+      chRun
+
+    def chArgs = workflowArgs.fromState ? 
+      chRunFiltered | map{
+        def new_data = workflowArgs.fromState(it.take(2))
+        [it[0], new_data]
+      } :
+      chRunFiltered | map {tup -> tup.take(2)}
+
+    // fill in defaults
+    def chArgsWithDefaults = chArgs
+      | map { tuple ->
+        def id_ = tuple[0]
+        def data_ = tuple[1]
+
+        // TODO: could move fromState to here
+
+        // fetch default params from functionality
+        def defaultArgs = meta.config.allArguments
+          .findAll { it.containsKey("default") }
+          .collectEntries { [ it.plainName, it.default ] }
+
+        // fetch overrides in params
+        def paramArgs = meta.config.allArguments
+          .findAll { par ->
+            def argKey = key_ + "__" + par.plainName
+            params.containsKey(argKey)
+          }
+          .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] }
+        
+        // fetch overrides in data
+        def dataArgs = meta.config.allArguments
+          .findAll { data_.containsKey(it.plainName) }
+          .collectEntries { [ it.plainName, data_[it.plainName] ] }
+        
+        // combine params
+        def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs
+
+        // remove arguments with explicit null values
+        combinedArgs
+          .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"}
+
+        combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_)
+
+        [id_, combinedArgs] + tuple.drop(2)
+      }
+
+    // TODO: move some of the _meta.join_id wrangling to the safeJoin() function.
+    def chInitialOutput = chArgsWithDefaults
+      | _debug(workflowArgs, "processed")
+      // run workflow
+      | innerWorkflowFactory(workflowArgs)
+      // check output tuple
+      | map { id_, output_ ->
+
+        // see if output map contains metadata
+        def meta_ =
+          output_ instanceof Map && output_.containsKey("_meta") ? 
+          output_["_meta"] :
+          [:]
+        def join_id = meta_.join_id ?: id_
+        
+        // remove metadata
+        output_ = output_.findAll{k, v -> k != "_meta"}
+
+        // check value types
+        output_ = _processOutputValues(output_, meta.config, id_, key_)
+
+        // simplify output if need be
+        if (workflowArgs.auto.simplifyOutput && output_.size() == 1) {
+          output_ = output_.values()[0]
+        }
+
+        [join_id, id_, output_]
+      }
+      // | view{"chInitialOutput: ${it.take(3)}"}
+
+    // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...]
+    def chNewState = safeJoin(chInitialOutput, chRunFiltered, key_)
+      // input tuple format: [join_id, id, output, prev_state, ...]
+      // output tuple format: [join_id, id, new_state, ...]
+      | map{ tup ->
+        def new_state = workflowArgs.toState(tup.drop(1).take(3))
+        tup.take(2) + [new_state] + tup.drop(4)
+      }
+
+    if (workflowArgs.auto.publish == "state") {
+      def chPublish = chNewState
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [join_id, id, new_state]
+        | map{ tup ->
+          tup.take(3)
+        }
+
+      safeJoin(chPublish, chArgsWithDefaults, key_)
+        // input tuple format: [join_id, id, new_state, orig_state, ...]
+        // output tuple format: [id, new_state, orig_state]
+        | map { tup ->
+          tup.drop(1).take(3)
+      }
+        | publishStatesByConfig(key: key_, config: meta.config)
+    }
+
+    // remove join_id and meta
+    chReturn = chNewState
+      | map { tup ->
+        // input tuple format: [join_id, id, new_state, ...]
+        // output tuple format: [id, new_state, ...]
+        tup.drop(1)
+      }
+      | _debug(workflowArgs, "output")
+      | concat(chPassthrough)
+
+    emit: chReturn
+  }
+
+  def wf = workflowInstance.cloneWithName(key_)
+
+  // add factory function
+  wf.metaClass.run = { runArgs ->
+    workflowFactory(runArgs, workflowArgs, meta)
+  }
+  // add config to module for later introspection
+  wf.metaClass.config = meta.config
+
+  return wf
+}
+
+nextflow.enable.dsl=2
+
+// START COMPONENT-SPECIFIC CODE
+
+// create meta object
+meta = [
+  "resources_dir": moduleDir.toRealPath().normalize(),
+  "config": processConfig(readJsonBlob('''{
+  "name" : "rseqc_inner_distance",
+  "namespace" : "rseqc",
+  "version" : "main",
+  "authors" : [
+    {
+      "name" : "Emma Rousseau",
+      "roles" : [
+        "author",
+        "maintainer"
+      ],
+      "info" : {
+        "links" : {
+          "email" : "emma@data-intuitive.com",
+          "github" : "emmarousseau",
+          "linkedin" : "emmarousseau1"
+        },
+        "organizations" : [
+          {
+            "name" : "Data Intuitive",
+            "href" : "https://www.data-intuitive.com",
+            "role" : "Bioinformatician"
+          }
+        ]
+      }
+    }
+  ],
+  "argument_groups" : [
+    {
+      "name" : "Input",
+      "arguments" : [
+        {
+          "type" : "file",
+          "name" : "--input_file",
+          "alternatives" : [
+            "-i"
+          ],
+          "description" : "input alignment file in BAM or SAM format",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "file",
+          "name" : "--refgene",
+          "alternatives" : [
+            "-r"
+          ],
+          "description" : "Reference gene model in bed format",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : true,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "integer",
+          "name" : "--sample_size",
+          "alternatives" : [
+            "-k"
+          ],
+          "description" : "Numer of reads sampled from SAM/BAM file, default = 1000000.",
+          "example" : [
+            1000000
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "integer",
+          "name" : "--mapq",
+          "alternatives" : [
+            "-q"
+          ],
+          "description" : "Minimum mapping quality (phred scaled) to determine uniquely mapped reads, default=30.",
+          "example" : [
+            30
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "integer",
+          "name" : "--lower_bound",
+          "alternatives" : [
+            "-l"
+          ],
+          "description" : "Lower bound of inner distance (bp). This option is used for ploting histograme, default=-250.",
+          "example" : [
+            -250
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "integer",
+          "name" : "--upper_bound",
+          "alternatives" : [
+            "-u"
+          ],
+          "description" : "Upper bound of inner distance (bp). This option is used for ploting histograme, default=250.",
+          "example" : [
+            250
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "integer",
+          "name" : "--step",
+          "alternatives" : [
+            "-s"
+          ],
+          "description" : "Step size (bp) of histograme. This option is used for plotting histogram, default=5.",
+          "example" : [
+            5
+          ],
+          "required" : false,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    },
+    {
+      "name" : "Output",
+      "arguments" : [
+        {
+          "type" : "string",
+          "name" : "--output_prefix",
+          "alternatives" : [
+            "-o"
+          ],
+          "description" : "Rrefix of output files.",
+          "required" : true,
+          "direction" : "input",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "file",
+          "name" : "--output_stats",
+          "description" : "output file (txt) with summary statistics of inner distances of paired reads",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : false,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "file",
+          "name" : "--output_dist",
+          "description" : "output file (txt) with inner distances of all paired reads",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : false,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "file",
+          "name" : "--output_freq",
+          "description" : "output file (txt) with frequencies of inner distances of all paired reads",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : false,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "file",
+          "name" : "--output_plot",
+          "description" : "output file (pdf) with histogram plot of of inner distances of all paired reads",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : false,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        },
+        {
+          "type" : "file",
+          "name" : "--output_plot_r",
+          "description" : "output file (R) with script of histogram plot of of inner distances of all paired reads",
+          "must_exist" : true,
+          "create_parent" : true,
+          "required" : false,
+          "direction" : "output",
+          "multiple" : false,
+          "multiple_sep" : ";"
+        }
+      ]
+    }
+  ],
+  "resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "script.sh",
+      "is_executable" : true
+    }
+  ],
+  "description" : "Calculate inner distance between read pairs.\n",
+  "test_resources" : [
+    {
+      "type" : "bash_script",
+      "path" : "test.sh",
+      "is_executable" : true
+    },
+    {
+      "type" : "file",
+      "path" : "test_data"
+    }
+  ],
+  "status" : "enabled",
+  "requirements" : {
+    "commands" : [
+      "ps"
+    ]
+  },
+  "license" : "GPL-3.0",
+  "references" : {
+    "doi" : [
+      "10.1093/bioinformatics/bts356"
+    ]
+  },
+  "links" : {
+    "repository" : "https://github.com/MonashBioinformaticsPlatform/RSeQC",
+    "homepage" : "https://rseqc.sourceforge.net/",
+    "documentation" : "https://rseqc.sourceforge.net/#inner-distance-py",
+    "issue_tracker" : "https://github.com/MonashBioinformaticsPlatform/RSeQC/issues"
+  },
+  "runners" : [
+    {
+      "type" : "executable",
+      "id" : "executable",
+      "docker_setup_strategy" : "ifneedbepullelsecachedbuild"
+    },
+    {
+      "type" : "nextflow",
+      "id" : "nextflow",
+      "directives" : {
+        "tag" : "$id"
+      },
+      "auto" : {
+        "simplifyInput" : true,
+        "simplifyOutput" : false,
+        "transcript" : false,
+        "publish" : false
+      },
+      "config" : {
+        "labels" : {
+          "mem1gb" : "memory = 1000000000.B",
+          "mem2gb" : "memory = 2000000000.B",
+          "mem5gb" : "memory = 5000000000.B",
+          "mem10gb" : "memory = 10000000000.B",
+          "mem20gb" : "memory = 20000000000.B",
+          "mem50gb" : "memory = 50000000000.B",
+          "mem100gb" : "memory = 100000000000.B",
+          "mem200gb" : "memory = 200000000000.B",
+          "mem500gb" : "memory = 500000000000.B",
+          "mem1tb" : "memory = 1000000000000.B",
+          "mem2tb" : "memory = 2000000000000.B",
+          "mem5tb" : "memory = 5000000000000.B",
+          "mem10tb" : "memory = 10000000000000.B",
+          "mem20tb" : "memory = 20000000000000.B",
+          "mem50tb" : "memory = 50000000000000.B",
+          "mem100tb" : "memory = 100000000000000.B",
+          "mem200tb" : "memory = 200000000000000.B",
+          "mem500tb" : "memory = 500000000000000.B",
+          "mem1gib" : "memory = 1073741824.B",
+          "mem2gib" : "memory = 2147483648.B",
+          "mem4gib" : "memory = 4294967296.B",
+          "mem8gib" : "memory = 8589934592.B",
+          "mem16gib" : "memory = 17179869184.B",
+          "mem32gib" : "memory = 34359738368.B",
+          "mem64gib" : "memory = 68719476736.B",
+          "mem128gib" : "memory = 137438953472.B",
+          "mem256gib" : "memory = 274877906944.B",
+          "mem512gib" : "memory = 549755813888.B",
+          "mem1tib" : "memory = 1099511627776.B",
+          "mem2tib" : "memory = 2199023255552.B",
+          "mem4tib" : "memory = 4398046511104.B",
+          "mem8tib" : "memory = 8796093022208.B",
+          "mem16tib" : "memory = 17592186044416.B",
+          "mem32tib" : "memory = 35184372088832.B",
+          "mem64tib" : "memory = 70368744177664.B",
+          "mem128tib" : "memory = 140737488355328.B",
+          "mem256tib" : "memory = 281474976710656.B",
+          "mem512tib" : "memory = 562949953421312.B",
+          "cpu1" : "cpus = 1",
+          "cpu2" : "cpus = 2",
+          "cpu5" : "cpus = 5",
+          "cpu10" : "cpus = 10",
+          "cpu20" : "cpus = 20",
+          "cpu50" : "cpus = 50",
+          "cpu100" : "cpus = 100",
+          "cpu200" : "cpus = 200",
+          "cpu500" : "cpus = 500",
+          "cpu1000" : "cpus = 1000"
+        }
+      },
+      "debug" : false,
+      "container" : "docker"
+    }
+  ],
+  "engines" : [
+    {
+      "type" : "docker",
+      "id" : "docker",
+      "image" : "python:3.10",
+      "target_registry" : "images.viash-hub.com",
+      "target_tag" : "main",
+      "namespace_separator" : "/",
+      "setup" : [
+        {
+          "type" : "apt",
+          "packages" : [
+            "r-base"
+          ],
+          "interactive" : false
+        },
+        {
+          "type" : "python",
+          "user" : false,
+          "packages" : [
+            "RSeQC"
+          ],
+          "upgrade" : true
+        },
+        {
+          "type" : "docker",
+          "run" : [
+            "echo \\"RSeQC - inner_distance.py: $(inner_distance.py --version | cut -d' ' -f2)\\" > /var/software_versions.txt\n"
+          ]
+        }
+      ]
+    },
+    {
+      "type" : "native",
+      "id" : "native"
+    }
+  ],
+  "build_info" : {
+    "config" : "/workdir/root/repo/src/rseqc/rseqc_inner_distance/config.vsh.yaml",
+    "runner" : "nextflow",
+    "engine" : "docker|native",
+    "output" : "target/nextflow/rseqc/rseqc_inner_distance",
+    "viash_version" : "0.9.0",
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
+  },
+  "package_config" : {
+    "name" : "biobox",
+    "version" : "main",
+    "description" : "A collection of bioinformatics tools for working with sequence data.\n",
+    "viash_version" : "0.9.0",
+    "source" : "src",
+    "target" : "target",
+    "config_mods" : [
+      ".requirements.commands := ['ps']\n",
+      ".engines += { type: \\"native\\" }",
+      ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
+      ".engines[.type == 'docker'].target_tag := 'main'"
+    ],
+    "keywords" : [
+      "bioinformatics",
+      "modules",
+      "sequencing"
+    ],
+    "license" : "MIT",
+    "organization" : "vsh",
+    "links" : {
+      "repository" : "https://github.com/viash-hub/biobox",
+      "issue_tracker" : "https://github.com/viash-hub/biobox/issues"
+    }
+  }
+}'''))
+]
+
+// resolve dependencies dependencies (if any)
+
+
+// inner workflow
+// inner workflow hook
+def innerWorkflowFactory(args) {
+  def rawScript = '''set -e
+tempscript=".viash_script.sh"
+cat > "$tempscript" << VIASHMAIN
+## VIASH START
+# The following code has been auto-generated by Viash.
+$( if [ ! -z ${VIASH_PAR_INPUT_FILE+x} ]; then echo "${VIASH_PAR_INPUT_FILE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input_file='&'#" ; else echo "# par_input_file="; fi )
+$( if [ ! -z ${VIASH_PAR_REFGENE+x} ]; then echo "${VIASH_PAR_REFGENE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_refgene='&'#" ; else echo "# par_refgene="; fi )
+$( if [ ! -z ${VIASH_PAR_SAMPLE_SIZE+x} ]; then echo "${VIASH_PAR_SAMPLE_SIZE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_sample_size='&'#" ; else echo "# par_sample_size="; fi )
+$( if [ ! -z ${VIASH_PAR_MAPQ+x} ]; then echo "${VIASH_PAR_MAPQ}" | sed "s#'#'\\"'\\"'#g;s#.*#par_mapq='&'#" ; else echo "# par_mapq="; fi )
+$( if [ ! -z ${VIASH_PAR_LOWER_BOUND+x} ]; then echo "${VIASH_PAR_LOWER_BOUND}" | sed "s#'#'\\"'\\"'#g;s#.*#par_lower_bound='&'#" ; else echo "# par_lower_bound="; fi )
+$( if [ ! -z ${VIASH_PAR_UPPER_BOUND+x} ]; then echo "${VIASH_PAR_UPPER_BOUND}" | sed "s#'#'\\"'\\"'#g;s#.*#par_upper_bound='&'#" ; else echo "# par_upper_bound="; fi )
+$( if [ ! -z ${VIASH_PAR_STEP+x} ]; then echo "${VIASH_PAR_STEP}" | sed "s#'#'\\"'\\"'#g;s#.*#par_step='&'#" ; else echo "# par_step="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_PREFIX+x} ]; then echo "${VIASH_PAR_OUTPUT_PREFIX}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output_prefix='&'#" ; else echo "# par_output_prefix="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_STATS+x} ]; then echo "${VIASH_PAR_OUTPUT_STATS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output_stats='&'#" ; else echo "# par_output_stats="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_DIST+x} ]; then echo "${VIASH_PAR_OUTPUT_DIST}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output_dist='&'#" ; else echo "# par_output_dist="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_FREQ+x} ]; then echo "${VIASH_PAR_OUTPUT_FREQ}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output_freq='&'#" ; else echo "# par_output_freq="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_PLOT+x} ]; then echo "${VIASH_PAR_OUTPUT_PLOT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output_plot='&'#" ; else echo "# par_output_plot="; fi )
+$( if [ ! -z ${VIASH_PAR_OUTPUT_PLOT_R+x} ]; then echo "${VIASH_PAR_OUTPUT_PLOT_R}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output_plot_r='&'#" ; else echo "# par_output_plot_r="; fi )
+$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
+$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
+$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
+$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi )
+$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi )
+$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi )
+$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi )
+$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
+
+## VIASH END
+#!/bin/bash
+
+set -exo pipefail 
+
+
+inner_distance.py \\\\
+    -i \\$par_input_file \\\\
+    -r \\$par_refgene \\\\
+    -o \\$par_output_prefix \\\\
+    \\${par_sample_size:+-k "\\${par_sample_size}"} \\\\
+    \\${par_lower_bound:+-l "\\${par_lower_bound}"} \\\\
+    \\${par_upper_bound:+-u "\\${par_upper_bound}"} \\\\
+    \\${par_step:+-s "\\${par_step}"} \\\\
+    \\${par_mapq:+-q "\\${par_mapq}"} \\\\
+> stdout.txt
+
+if [[ -n \\$par_output_stats ]]; then head -n 2 stdout.txt > \\$par_output_stats; fi
+
+
+[[ -n "\\$par_output_dist" && -f "\\$par_output_prefix.inner_distance.txt" ]] && mv \\$par_output_prefix.inner_distance.txt \\$par_output_dist
+[[ -n "\\$par_output_plot" && -f "\\$par_output_prefix.inner_distance_plot.pdf" ]] && mv \\$par_output_prefix.inner_distance_plot.pdf \\$par_output_plot
+[[ -n "\\$par_output_plot_r" && -f "\\$par_output_prefix.inner_distance_plot.r" ]] && mv \\$par_output_prefix.inner_distance_plot.r \\$par_output_plot_r
+[[ -n "\\$par_output_freq" && -f "\\$par_output_prefix.inner_distance_freq.txt" ]] && mv \\$par_output_prefix.inner_distance_freq.txt \\$par_output_freq
+
+exit 0
+VIASHMAIN
+bash "$tempscript"
+'''
+  
+  return vdsl3WorkflowFactory(args, meta, rawScript)
+}
+
+
+
+/**
+  * Generate a workflow for VDSL3 modules.
+  * 
+  * This function is called by the workflowFactory() function.
+  * 
+  * Input channel: [id, input_map]
+  * Output channel: [id, output_map]
+  * 
+  * Internally, this workflow will convert the input channel
+  * to a format which the Nextflow module will be able to handle.
+  */
+def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) {
+  def key = args["key"]
+  def processObj = null
+
+  workflow processWf {
+    take: input_
+    main:
+
+    if (processObj == null) {
+      processObj = _vdsl3ProcessFactory(args, meta, rawScript)
+    }
+    
+    output_ = input_
+      | map { tuple ->
+        def id = tuple[0]
+        def data_ = tuple[1]
+
+        if (workflow.stubRun) {
+          // add id if missing
+          data_ = [id: 'stub'] + data_
+        }
+
+        // process input files separately
+        def inputPaths = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "input" }
+          .collect { par ->
+            def val = data_.containsKey(par.plainName) ? data_[par.plainName] : []
+            def inputFiles = []
+            if (val == null) {
+              inputFiles = []
+            } else if (val instanceof List) {
+              inputFiles = val
+            } else if (val instanceof Path) {
+              inputFiles = [ val ]
+            } else {
+              inputFiles = []
+            }
+            if (!workflow.stubRun) {
+              // throw error when an input file doesn't exist
+              inputFiles.each{ file -> 
+                assert file.exists() :
+                  "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" +
+                  "  Required input file does not exist.\n" +
+                  "  Path: '$file'.\n" +
+                  "  Expected input file to exist"
+              }
+            }
+            inputFiles 
+          } 
+
+        // remove input files
+        def argsExclInputFiles = meta.config.allArguments
+          .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) }
+          .collectEntries { par ->
+            def parName = par.plainName
+            def val = data_[parName]
+            if (par.multiple && val instanceof Collection) {
+              val = val.join(par.multiple_sep)
+            }
+            if (par.direction == "output" && par.type == "file") {
+              val = val
+                .replaceAll('\\$id', id)
+                .replaceAll('\\$\\{id\\}', id)
+                .replaceAll('\\$key', key)
+                .replaceAll('\\$\\{key\\}', key)
+            }
+            [parName, val]
+          }
+
+        [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ]
+      }
+      | processObj
+      | map { output ->
+        def outputFiles = meta.config.allArguments
+          .findAll { it.type == "file" && it.direction == "output" }
+          .indexed()
+          .collectEntries{ index, par ->
+            def out = output[index + 1]
+            // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678)
+            if (!out instanceof List || out.size() <= 1) {
+              if (par.multiple) {
+                out = []
+              } else {
+                assert !par.required :
+                    "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" +
+                    "  Required output file is missing"
+                out = null
+              }
+            } else if (out.size() == 2 && !par.multiple) {
+              out = out[1]
+            } else {
+              out = out.drop(1)
+            }
+            [ par.plainName, out ]
+          }
+        
+        // drop null outputs
+        outputFiles.removeAll{it.value == null}
+
+        [ output[0], outputFiles ]
+      }
+    emit: output_
+  }
+
+  return processWf
+}
+
+// depends on: session?
+def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) {
+  // autodetect process key
+  def wfKey = workflowArgs["key"]
+  def procKeyPrefix = "${wfKey}_process"
+  def scriptMeta = nextflow.script.ScriptMeta.current()
+  def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)}
+  def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()}
+  def newNumber = (numbers + [-1]).max() + 1
+
+  def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber"
+
+  if (newNumber > 0) {
+    log.warn "Key for module '${wfKey}' is duplicated.\n",
+      "If you run a component multiple times in the same workflow,\n" +
+      "it's recommended you set a unique key for every call,\n" +
+      "for example: ${wfKey}.run(key: \"foo\")."
+  }
+
+  // subset directives and convert to list of tuples
+  def drctv = workflowArgs.directives
+
+  // TODO: unit test the two commands below
+  // convert publish array into tags
+  def valueToStr = { val ->
+    // ignore closures
+    if (val instanceof CharSequence) {
+      if (!val.matches('^[{].*[}]$')) {
+        '"' + val + '"'
+      } else {
+        val
+      }
+    } else if (val instanceof List) {
+      "[" + val.collect{valueToStr(it)}.join(", ") + "]"
+    } else if (val instanceof Map) {
+      "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]"
+    } else {
+      val.inspect()
+    }
+  }
+
+  // multiple entries allowed: label, publishdir
+  def drctvStrs = drctv.collect { key, value ->
+    if (key in ["label", "publishDir"]) {
+      value.collect{ val ->
+        if (val instanceof Map) {
+          "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+        } else if (val == null) {
+          ""
+        } else {
+          "\n$key " + valueToStr(val)
+        }
+      }.join()
+    } else if (value instanceof Map) {
+      "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ")
+    } else {
+      "\n$key " + valueToStr(value)
+    }
+  }.join()
+
+  def inputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "input" }
+    .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' }
+    .join()
+
+  def outputPaths = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par ->
+      // insert dummy into every output (see nextflow-io/nextflow#2678)
+      if (!par.multiple) {
+        ', path{[".exitcode", args.' + par.plainName + ']}'
+      } else {
+        ', path{[".exitcode"] + args.' + par.plainName + '}'
+      }
+    }
+    .join()
+
+  // TODO: move this functionality somewhere else?
+  if (workflowArgs.auto.transcript) {
+    outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}'
+  } else {
+    outputPaths = outputPaths + ', path{[".exitcode"]}'
+  }
+
+  // create dirs for output files (based on BashWrapper.createParentFiles)
+  def createParentStr = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" && it.create_parent }
+    .collect { par -> 
+      def contents = "args[\"${par.plainName}\"] instanceof List ? args[\"${par.plainName}\"].join('\" \"') : args[\"${par.plainName}\"]"
+      "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent '\" + escapeText(${contents}) + \"'\" : \"\" }"
+    }
+    .join("\n")
+
+  // construct inputFileExports
+  def inputFileExports = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction.toLowerCase() == "input" }
+    .collect { par ->
+      def contents = "viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName}"
+      "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}='\" + escapeText(${contents}) + \"'\"}"
+    }
+
+  // NOTE: if using docker, use /tmp instead of tmpDir!
+  def tmpDir = java.nio.file.Paths.get(
+    System.getenv('NXF_TEMP') ?: 
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('VIASH_TMPDIR') ?: 
+    System.getenv('VIASH_TEMPDIR') ?: 
+    System.getenv('VIASH_TMP') ?: 
+    System.getenv('TEMP') ?: 
+    System.getenv('TMPDIR') ?: 
+    System.getenv('TEMPDIR') ?:
+    System.getenv('TMP') ?: 
+    '/tmp'
+  ).toAbsolutePath()
+
+  // construct stub
+  def stub = meta.config.allArguments
+    .findAll { it.type == "file" && it.direction == "output" }
+    .collect { par -> 
+      "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }"
+    }
+    .join("\n")
+
+  // escape script
+  def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"')
+
+  // publishdir assert
+  def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? 
+    """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n  Example: --publish_dir './output/'" """ :
+    ""
+
+  // generate process string
+  def procStr = 
+  """nextflow.enable.dsl=2
+  |
+  |def escapeText = { s -> s.toString().replaceAll("'", "'\\\"'\\\"'") }
+  |process $procKey {$drctvStrs
+  |input:
+  |  tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources")
+  |output:
+  |  tuple val("\$id")$outputPaths, optional: true
+  |stub:
+  |\"\"\"
+  |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; }
+  |$stub
+  |\"\"\"
+  |script:$assertStr
+  |def parInject = args
+  |  .findAll{key, value -> value != null}
+  |  .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}='\${escapeText(value)}'"}
+  |  .join("\\n")
+  |\"\"\"
+  |# meta exports
+  |export VIASH_META_RESOURCES_DIR="\${resourcesDir}"
+  |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}"
+  |export VIASH_META_NAME="${meta.config.name}"
+  |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME"
+  |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
+  |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" }
+  |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" }
+  |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then
+  |  export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 ))
+  |  export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 ))
+  |  export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 ))
+  |  export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 ))
+  |fi
+  |
+  |# meta synonyms
+  |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR"
+  |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR"
+  |
+  |# create output dirs if need be
+  |function mkdir_parent {
+  |  for file in "\\\$@"; do 
+  |    mkdir -p "\\\$(dirname "\\\$file")"
+  |  done
+  |}
+  |$createParentStr
+  |
+  |# argument exports${inputFileExports.join()}
+  |\$parInject
+  |
+  |# process script
+  |${escapedScript}
+  |\"\"\"
+  |}
+  |""".stripMargin()
+
+  // TODO: print on debug
+  // if (workflowArgs.debug == true) {
+  //   println("######################\n$procStr\n######################")
+  // }
+
+  // write process to temp file
+  def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf")
+  addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) }
+  tempFile.text = procStr
+
+  // create process from temp file
+  def binding = new nextflow.script.ScriptBinding([:])
+  def session = nextflow.Nextflow.getSession()
+  def parser = new nextflow.script.ScriptParser(session)
+    .setModule(true)
+    .setBinding(binding)
+  def moduleScript = parser.runScript(tempFile)
+    .getScript()
+
+  // register module in meta
+  def module = new nextflow.script.IncludeDef.Module(name: procKey)
+  scriptMeta.addModule(moduleScript, module.name, module.alias)
+
+  // retrieve and return process from meta
+  return scriptMeta.getProcess(procKey)
+}
+
+// defaults
+meta["defaults"] = [
+  // key to be used to trace the process and determine output names
+  key: null,
+
+  // fixed arguments to be passed to script
+  args: [:],
+
+  // default directives
+  directives: readJsonBlob('''{
+  "container" : {
+    "registry" : "images.viash-hub.com",
+    "image" : "vsh/biobox/rseqc/rseqc_inner_distance",
+    "tag" : "main"
+  },
+  "tag" : "$id"
+}'''),
+
+  // auto settings
+  auto: readJsonBlob('''{
+  "simplifyInput" : true,
+  "simplifyOutput" : false,
+  "transcript" : false,
+  "publish" : false
+}'''),
+
+  // Apply a map over the incoming tuple
+  // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }`
+  map: null,
+
+  // Apply a map over the ID element of a tuple (i.e. the first element)
+  // Example: `{ id -> id + "_foo" }`
+  mapId: null,
+
+  // Apply a map over the data element of a tuple (i.e. the second element)
+  // Example: `{ data -> [ input: data.output ] }`
+  mapData: null,
+
+  // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements)
+  // Example: `{ pt -> pt.drop(1) }`
+  mapPassthrough: null,
+
+  // Filter the channel
+  // Example: `{ tup -> tup[0] == "foo" }`
+  filter: null,
+
+  // Choose whether or not to run the component on the tuple if the condition is true.
+  // Otherwise, the tuple will be passed through.
+  // Example: `{ tup -> tup[0] != "skip_this" }`
+  runIf: null,
+
+  // Rename keys in the data field of the tuple (i.e. the second element)
+  // Will likely be deprecated in favour of `fromState`.
+  // Example: `[ "new_key": "old_key" ]`
+  renameKeys: null,
+
+  // Fetch data from the state and pass it to the module without altering the current state.
+  // 
+  // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. 
+  // 
+  // - If it is `null`, the state will be passed to the module as is.
+  // - If it is a `List[String]`, the data will be the values of the state at the given keys.
+  // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map.
+  // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data.
+  // 
+  // Example: `{ id, state -> [input: state.fastq_file] }`
+  // Default: `null`
+  fromState: null,
+
+  // Determine how the state should be updated after the module has been run.
+  // 
+  // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function.
+  // 
+  // - If it is `null`, the state will be replaced with the output of the module.
+  // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys.
+  // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map.
+  // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state.
+  //
+  // Example: `{ id, output, state -> state + [counts: state.output] }`
+  // Default: `{ id, output, state -> output }`
+  toState: null,
+
+  // Whether or not to print debug messages
+  // Default: `false`
+  debug: false
+]
+
+// initialise default workflow
+meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta)
+
+// add workflow to environment
+nextflow.script.ScriptMeta.current().addDefinition(meta.workflow)
+
+// anonymous workflow for running this module as a standalone
+workflow {
+  // add id argument if it's not already in the config
+  // TODO: deep copy
+  def newConfig = deepClone(meta.config)
+  def newParams = deepClone(params)
+
+  def argsContainsId = newConfig.allArguments.any{it.plainName == "id"}
+  if (!argsContainsId) {
+    def idArg = [
+      'name': '--id',
+      'required': false,
+      'type': 'string',
+      'description': 'A unique id for every entry.',
+      'multiple': false
+    ]
+    newConfig.arguments.add(0, idArg)
+    newConfig = processConfig(newConfig)
+  }
+  if (!newParams.containsKey("id")) {
+    newParams.id = "run"
+  }
+
+  helpMessage(newConfig)
+
+  channelFromParams(newParams, newConfig)
+    // make sure id is not in the state if id is not in the args
+    | map {id, state ->
+      if (!argsContainsId) {
+        [id, state.findAll{k, v -> k != "id"}]
+      } else {
+        [id, state]
+      }
+    }
+    | meta.workflow.run(
+      auto: [ publish: "state" ]
+    )
+}
+
+// END COMPONENT-SPECIFIC CODE
diff --git a/target/nextflow/rseqc/rseqc_inner_distance/nextflow.config b/target/nextflow/rseqc/rseqc_inner_distance/nextflow.config
new file mode 100644
index 00000000..b7c9979a
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_inner_distance/nextflow.config
@@ -0,0 +1,126 @@
+manifest {
+  name = 'rseqc/rseqc_inner_distance'
+  mainScript = 'main.nf'
+  nextflowVersion = '!>=20.12.1-edge'
+  version = 'main'
+  description = 'Calculate inner distance between read pairs.\n'
+  author = 'Emma Rousseau'
+}
+
+process.container = 'nextflow/bash:latest'
+
+// detect tempdir
+tempDir = java.nio.file.Paths.get(
+  System.getenv('NXF_TEMP') ?:
+    System.getenv('VIASH_TEMP') ?: 
+    System.getenv('TEMPDIR') ?: 
+    System.getenv('TMPDIR') ?: 
+    '/tmp'
+).toAbsolutePath()
+
+profiles {
+  no_publish {
+    process {
+      withName: '.*' {
+        publishDir = [
+          enabled: false
+        ]
+      }
+    }
+  }
+  mount_temp {
+    docker.temp            = tempDir
+    podman.temp            = tempDir
+    charliecloud.temp      = tempDir
+  }
+  docker {
+    docker.enabled         = true
+    // docker.userEmulation   = true
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  singularity {
+    singularity.enabled    = true
+    singularity.autoMounts = true
+    docker.enabled         = false
+    podman.enabled         = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  podman {
+    podman.enabled         = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    shifter.enabled        = false
+    charliecloud.enabled   = false
+  }
+  shifter {
+    shifter.enabled        = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    charliecloud.enabled   = false
+  }
+  charliecloud {
+    charliecloud.enabled   = true
+    docker.enabled         = false
+    singularity.enabled    = false
+    podman.enabled         = false
+    shifter.enabled        = false
+  }
+}
+
+process{
+  withLabel: mem1gb { memory = 1000000000.B }
+  withLabel: mem2gb { memory = 2000000000.B }
+  withLabel: mem5gb { memory = 5000000000.B }
+  withLabel: mem10gb { memory = 10000000000.B }
+  withLabel: mem20gb { memory = 20000000000.B }
+  withLabel: mem50gb { memory = 50000000000.B }
+  withLabel: mem100gb { memory = 100000000000.B }
+  withLabel: mem200gb { memory = 200000000000.B }
+  withLabel: mem500gb { memory = 500000000000.B }
+  withLabel: mem1tb { memory = 1000000000000.B }
+  withLabel: mem2tb { memory = 2000000000000.B }
+  withLabel: mem5tb { memory = 5000000000000.B }
+  withLabel: mem10tb { memory = 10000000000000.B }
+  withLabel: mem20tb { memory = 20000000000000.B }
+  withLabel: mem50tb { memory = 50000000000000.B }
+  withLabel: mem100tb { memory = 100000000000000.B }
+  withLabel: mem200tb { memory = 200000000000000.B }
+  withLabel: mem500tb { memory = 500000000000000.B }
+  withLabel: mem1gib { memory = 1073741824.B }
+  withLabel: mem2gib { memory = 2147483648.B }
+  withLabel: mem4gib { memory = 4294967296.B }
+  withLabel: mem8gib { memory = 8589934592.B }
+  withLabel: mem16gib { memory = 17179869184.B }
+  withLabel: mem32gib { memory = 34359738368.B }
+  withLabel: mem64gib { memory = 68719476736.B }
+  withLabel: mem128gib { memory = 137438953472.B }
+  withLabel: mem256gib { memory = 274877906944.B }
+  withLabel: mem512gib { memory = 549755813888.B }
+  withLabel: mem1tib { memory = 1099511627776.B }
+  withLabel: mem2tib { memory = 2199023255552.B }
+  withLabel: mem4tib { memory = 4398046511104.B }
+  withLabel: mem8tib { memory = 8796093022208.B }
+  withLabel: mem16tib { memory = 17592186044416.B }
+  withLabel: mem32tib { memory = 35184372088832.B }
+  withLabel: mem64tib { memory = 70368744177664.B }
+  withLabel: mem128tib { memory = 140737488355328.B }
+  withLabel: mem256tib { memory = 281474976710656.B }
+  withLabel: mem512tib { memory = 562949953421312.B }
+  withLabel: cpu1 { cpus = 1 }
+  withLabel: cpu2 { cpus = 2 }
+  withLabel: cpu5 { cpus = 5 }
+  withLabel: cpu10 { cpus = 10 }
+  withLabel: cpu20 { cpus = 20 }
+  withLabel: cpu50 { cpus = 50 }
+  withLabel: cpu100 { cpus = 100 }
+  withLabel: cpu200 { cpus = 200 }
+  withLabel: cpu500 { cpus = 500 }
+  withLabel: cpu1000 { cpus = 1000 }
+}
+
+
diff --git a/target/nextflow/rseqc/rseqc_inner_distance/nextflow_schema.json b/target/nextflow/rseqc/rseqc_inner_distance/nextflow_schema.json
new file mode 100644
index 00000000..34e93183
--- /dev/null
+++ b/target/nextflow/rseqc/rseqc_inner_distance/nextflow_schema.json
@@ -0,0 +1,209 @@
+{
+"$schema": "http://json-schema.org/draft-07/schema",
+"title": "rseqc_inner_distance",
+"description": "Calculate inner distance between read pairs.\n",
+"type": "object",
+"definitions": {
+
+    
+    
+    "input" : {
+    "title": "Input",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "input_file": {
+                "type":
+                "string",
+                "description": "Type: `file`, required. input alignment file in BAM or SAM format",
+                "help_text": "Type: `file`, required. input alignment file in BAM or SAM format"
+            
+            }
+    
+
+        ,
+                "refgene": {
+                "type":
+                "string",
+                "description": "Type: `file`, required. Reference gene model in bed format",
+                "help_text": "Type: `file`, required. Reference gene model in bed format"
+            
+            }
+    
+
+        ,
+                "sample_size": {
+                "type":
+                "integer",
+                "description": "Type: `integer`, example: `1000000`. Numer of reads sampled from SAM/BAM file, default = 1000000",
+                "help_text": "Type: `integer`, example: `1000000`. Numer of reads sampled from SAM/BAM file, default = 1000000."
+            
+            }
+    
+
+        ,
+                "mapq": {
+                "type":
+                "integer",
+                "description": "Type: `integer`, example: `30`. Minimum mapping quality (phred scaled) to determine uniquely mapped reads, default=30",
+                "help_text": "Type: `integer`, example: `30`. Minimum mapping quality (phred scaled) to determine uniquely mapped reads, default=30."
+            
+            }
+    
+
+        ,
+                "lower_bound": {
+                "type":
+                "integer",
+                "description": "Type: `integer`, example: `-250`. Lower bound of inner distance (bp)",
+                "help_text": "Type: `integer`, example: `-250`. Lower bound of inner distance (bp). This option is used for ploting histograme, default=-250."
+            
+            }
+    
+
+        ,
+                "upper_bound": {
+                "type":
+                "integer",
+                "description": "Type: `integer`, example: `250`. Upper bound of inner distance (bp)",
+                "help_text": "Type: `integer`, example: `250`. Upper bound of inner distance (bp). This option is used for ploting histograme, default=250."
+            
+            }
+    
+
+        ,
+                "step": {
+                "type":
+                "integer",
+                "description": "Type: `integer`, example: `5`. Step size (bp) of histograme",
+                "help_text": "Type: `integer`, example: `5`. Step size (bp) of histograme. This option is used for plotting histogram, default=5."
+            
+            }
+    
+
+}
+},
+    
+    
+    "output" : {
+    "title": "Output",
+    "type": "object",
+    "description": "No description",
+    "properties": {
+    
+        
+                "output_prefix": {
+                "type":
+                "string",
+                "description": "Type: `string`, required. Rrefix of output files",
+                "help_text": "Type: `string`, required. Rrefix of output files."
+            
+            }
+    
+
+        ,
+                "output_stats": {
+                "type":
+                "string",
+                "description": "Type: `file`, default: `$id.$key.output_stats.output_stats`. output file (txt) with summary statistics of inner distances of paired reads",
+                "help_text": "Type: `file`, default: `$id.$key.output_stats.output_stats`. output file (txt) with summary statistics of inner distances of paired reads"
+            ,
+                "default": "$id.$key.output_stats.output_stats"
+            }
+    
+
+        ,
+                "output_dist": {
+                "type":
+                "string",
+                "description": "Type: `file`, default: `$id.$key.output_dist.output_dist`. output file (txt) with inner distances of all paired reads",
+                "help_text": "Type: `file`, default: `$id.$key.output_dist.output_dist`. output file (txt) with inner distances of all paired reads"
+            ,
+                "default": "$id.$key.output_dist.output_dist"
+            }
+    
+
+        ,
+                "output_freq": {
+                "type":
+                "string",
+                "description": "Type: `file`, default: `$id.$key.output_freq.output_freq`. output file (txt) with frequencies of inner distances of all paired reads",
+                "help_text": "Type: `file`, default: `$id.$key.output_freq.output_freq`. output file (txt) with frequencies of inner distances of all paired reads"
+            ,
+                "default": "$id.$key.output_freq.output_freq"
+            }
+    
+
+        ,
+                "output_plot": {
+                "type":
+                "string",
+                "description": "Type: `file`, default: `$id.$key.output_plot.output_plot`. output file (pdf) with histogram plot of of inner distances of all paired reads",
+                "help_text": "Type: `file`, default: `$id.$key.output_plot.output_plot`. output file (pdf) with histogram plot of of inner distances of all paired reads"
+            ,
+                "default": "$id.$key.output_plot.output_plot"
+            }
+    
+
+        ,
+                "output_plot_r": {
+                "type":
+                "string",
+                "description": "Type: `file`, default: `$id.$key.output_plot_r.output_plot_r`. output file (R) with script of histogram plot of of inner distances of all paired reads",
+                "help_text": "Type: `file`, default: `$id.$key.output_plot_r.output_plot_r`. output file (R) with script of histogram plot of of inner distances of all paired reads"
+            ,
+                "default": "$id.$key.output_plot_r.output_plot_r"
+            }
+    
+
+}
+},
+    
+    
+    "nextflow input-output arguments" : {
+    "title": "Nextflow input-output arguments",
+    "type": "object",
+    "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
+    "properties": {
+    
+        
+                "publish_dir": {
+                "type":
+                "string",
+                "description": "Type: `string`, required, example: `output/`. Path to an output directory",
+                "help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
+            
+            }
+    
+
+        ,
+                "param_list": {
+                "type":
+                "string",
+                "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
+                "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
+                "hidden": true
+            
+            }
+    
+
+}
+}
+},
+"allOf": [
+
+    {
+    "$ref": "#/definitions/input"
+    },
+
+    {
+    "$ref": "#/definitions/output"
+    },
+
+    {
+    "$ref": "#/definitions/nextflow input-output arguments"
+    }
+]
+}
diff --git a/target/nextflow/salmon/salmon_index/.config.vsh.yaml b/target/nextflow/salmon/salmon_index/.config.vsh.yaml
index 0e2f7745..9178942c 100644
--- a/target/nextflow/salmon/salmon_index/.config.vsh.yaml
+++ b/target/nextflow/salmon/salmon_index/.config.vsh.yaml
@@ -277,9 +277,9 @@ build_info:
   output: "target/nextflow/salmon/salmon_index"
   executable: "target/nextflow/salmon/salmon_index/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/salmon/salmon_index/main.nf b/target/nextflow/salmon/salmon_index/main.nf
index f0322fb6..71ccc050 100644
--- a/target/nextflow/salmon/salmon_index/main.nf
+++ b/target/nextflow/salmon/salmon_index/main.nf
@@ -3129,9 +3129,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/salmon/salmon_index",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/salmon/salmon_quant/.config.vsh.yaml b/target/nextflow/salmon/salmon_quant/.config.vsh.yaml
index 40d8c017..58b965db 100644
--- a/target/nextflow/salmon/salmon_quant/.config.vsh.yaml
+++ b/target/nextflow/salmon/salmon_quant/.config.vsh.yaml
@@ -1173,9 +1173,9 @@ build_info:
   output: "target/nextflow/salmon/salmon_quant"
   executable: "target/nextflow/salmon/salmon_quant/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/salmon/salmon_quant/main.nf b/target/nextflow/salmon/salmon_quant/main.nf
index 1f91c578..ea86078c 100644
--- a/target/nextflow/salmon/salmon_quant/main.nf
+++ b/target/nextflow/salmon/salmon_quant/main.nf
@@ -3964,9 +3964,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/salmon/salmon_quant",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_collate/.config.vsh.yaml b/target/nextflow/samtools/samtools_collate/.config.vsh.yaml
index 3fc26275..4f0d52ce 100644
--- a/target/nextflow/samtools/samtools_collate/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_collate/.config.vsh.yaml
@@ -264,9 +264,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_collate"
   executable: "target/nextflow/samtools/samtools_collate/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_collate/main.nf b/target/nextflow/samtools/samtools_collate/main.nf
index 30508e71..a5395a5f 100644
--- a/target/nextflow/samtools/samtools_collate/main.nf
+++ b/target/nextflow/samtools/samtools_collate/main.nf
@@ -3140,9 +3140,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_collate",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml b/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml
index 98d403fe..2865fe3c 100644
--- a/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_faidx/.config.vsh.yaml
@@ -243,9 +243,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_faidx"
   executable: "target/nextflow/samtools/samtools_faidx/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_faidx/main.nf b/target/nextflow/samtools/samtools_faidx/main.nf
index aaeda3f8..66182629 100644
--- a/target/nextflow/samtools/samtools_faidx/main.nf
+++ b/target/nextflow/samtools/samtools_faidx/main.nf
@@ -3112,9 +3112,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_faidx",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml b/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml
index eda1b294..1b66b116 100644
--- a/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_fasta/.config.vsh.yaml
@@ -433,9 +433,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_fasta"
   executable: "target/nextflow/samtools/samtools_fasta/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_fasta/main.nf b/target/nextflow/samtools/samtools_fasta/main.nf
index 66a7f022..1496e396 100644
--- a/target/nextflow/samtools/samtools_fasta/main.nf
+++ b/target/nextflow/samtools/samtools_fasta/main.nf
@@ -3304,9 +3304,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_fasta",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml b/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml
index 2320f91c..4124925c 100644
--- a/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_fastq/.config.vsh.yaml
@@ -433,9 +433,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_fastq"
   executable: "target/nextflow/samtools/samtools_fastq/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_fastq/main.nf b/target/nextflow/samtools/samtools_fastq/main.nf
index 7d638c43..dcac0a63 100644
--- a/target/nextflow/samtools/samtools_fastq/main.nf
+++ b/target/nextflow/samtools/samtools_fastq/main.nf
@@ -3304,9 +3304,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_fastq",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml b/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml
index 5638073e..9db4af4e 100644
--- a/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_flagstat/.config.vsh.yaml
@@ -173,9 +173,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_flagstat"
   executable: "target/nextflow/samtools/samtools_flagstat/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_flagstat/main.nf b/target/nextflow/samtools/samtools_flagstat/main.nf
index f12b54ae..1b87bd95 100644
--- a/target/nextflow/samtools/samtools_flagstat/main.nf
+++ b/target/nextflow/samtools/samtools_flagstat/main.nf
@@ -3028,9 +3028,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_flagstat",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml b/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml
index 89fad7c0..d92260ea 100644
--- a/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_idxstats/.config.vsh.yaml
@@ -183,9 +183,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_idxstats"
   executable: "target/nextflow/samtools/samtools_idxstats/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_idxstats/main.nf b/target/nextflow/samtools/samtools_idxstats/main.nf
index c5737dba..e70a99b9 100644
--- a/target/nextflow/samtools/samtools_idxstats/main.nf
+++ b/target/nextflow/samtools/samtools_idxstats/main.nf
@@ -3040,9 +3040,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_idxstats",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_index/.config.vsh.yaml b/target/nextflow/samtools/samtools_index/.config.vsh.yaml
index b6cf0f31..58bc5856 100644
--- a/target/nextflow/samtools/samtools_index/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_index/.config.vsh.yaml
@@ -189,9 +189,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_index"
   executable: "target/nextflow/samtools/samtools_index/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_index/main.nf b/target/nextflow/samtools/samtools_index/main.nf
index 9ff11d84..37d74d85 100644
--- a/target/nextflow/samtools/samtools_index/main.nf
+++ b/target/nextflow/samtools/samtools_index/main.nf
@@ -3053,9 +3053,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_index",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_sort/.config.vsh.yaml b/target/nextflow/samtools/samtools_sort/.config.vsh.yaml
index 4d531c4f..48348d75 100644
--- a/target/nextflow/samtools/samtools_sort/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_sort/.config.vsh.yaml
@@ -332,9 +332,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_sort"
   executable: "target/nextflow/samtools/samtools_sort/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_sort/main.nf b/target/nextflow/samtools/samtools_sort/main.nf
index c9c8ecea..f9b31557 100644
--- a/target/nextflow/samtools/samtools_sort/main.nf
+++ b/target/nextflow/samtools/samtools_sort/main.nf
@@ -3225,9 +3225,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_sort",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_stats/.config.vsh.yaml b/target/nextflow/samtools/samtools_stats/.config.vsh.yaml
index e155f70c..45f98e1e 100644
--- a/target/nextflow/samtools/samtools_stats/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_stats/.config.vsh.yaml
@@ -401,9 +401,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_stats"
   executable: "target/nextflow/samtools/samtools_stats/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_stats/main.nf b/target/nextflow/samtools/samtools_stats/main.nf
index 75f76daf..435ef291 100644
--- a/target/nextflow/samtools/samtools_stats/main.nf
+++ b/target/nextflow/samtools/samtools_stats/main.nf
@@ -3295,9 +3295,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_stats",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/samtools/samtools_view/.config.vsh.yaml b/target/nextflow/samtools/samtools_view/.config.vsh.yaml
index 1c64c3e7..dda15972 100644
--- a/target/nextflow/samtools/samtools_view/.config.vsh.yaml
+++ b/target/nextflow/samtools/samtools_view/.config.vsh.yaml
@@ -665,9 +665,9 @@ build_info:
   output: "target/nextflow/samtools/samtools_view"
   executable: "target/nextflow/samtools/samtools_view/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/samtools/samtools_view/main.nf b/target/nextflow/samtools/samtools_view/main.nf
index 1e326291..117ba5da 100644
--- a/target/nextflow/samtools/samtools_view/main.nf
+++ b/target/nextflow/samtools/samtools_view/main.nf
@@ -3476,9 +3476,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/samtools/samtools_view",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml b/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml
index ea45df49..295a9983 100644
--- a/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml
+++ b/target/nextflow/seqtk/seqtk_sample/.config.vsh.yaml
@@ -173,9 +173,9 @@ build_info:
   output: "target/nextflow/seqtk/seqtk_sample"
   executable: "target/nextflow/seqtk/seqtk_sample/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/seqtk/seqtk_sample/main.nf b/target/nextflow/seqtk/seqtk_sample/main.nf
index b4fdec0a..01065c2e 100644
--- a/target/nextflow/seqtk/seqtk_sample/main.nf
+++ b/target/nextflow/seqtk/seqtk_sample/main.nf
@@ -3030,9 +3030,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/seqtk/seqtk_sample",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml b/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml
index 5e09e498..884ce881 100644
--- a/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml
+++ b/target/nextflow/seqtk/seqtk_subseq/.config.vsh.yaml
@@ -196,9 +196,9 @@ build_info:
   output: "target/nextflow/seqtk/seqtk_subseq"
   executable: "target/nextflow/seqtk/seqtk_subseq/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/seqtk/seqtk_subseq/main.nf b/target/nextflow/seqtk/seqtk_subseq/main.nf
index 19a71312..cc8ab07b 100644
--- a/target/nextflow/seqtk/seqtk_subseq/main.nf
+++ b/target/nextflow/seqtk/seqtk_subseq/main.nf
@@ -3060,9 +3060,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/seqtk/seqtk_subseq",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/snpeff/.config.vsh.yaml b/target/nextflow/snpeff/.config.vsh.yaml
index 4cee3bcc..3ced6f4f 100644
--- a/target/nextflow/snpeff/.config.vsh.yaml
+++ b/target/nextflow/snpeff/.config.vsh.yaml
@@ -628,9 +628,9 @@ build_info:
   output: "target/nextflow/snpeff"
   executable: "target/nextflow/snpeff/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/snpeff/main.nf b/target/nextflow/snpeff/main.nf
index 10f456cc..47342a89 100644
--- a/target/nextflow/snpeff/main.nf
+++ b/target/nextflow/snpeff/main.nf
@@ -3555,9 +3555,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/snpeff",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/sortmerna/.config.vsh.yaml b/target/nextflow/sortmerna/.config.vsh.yaml
index 80eca719..dc619c1b 100644
--- a/target/nextflow/sortmerna/.config.vsh.yaml
+++ b/target/nextflow/sortmerna/.config.vsh.yaml
@@ -591,9 +591,9 @@ build_info:
   output: "target/nextflow/sortmerna"
   executable: "target/nextflow/sortmerna/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/sortmerna/main.nf b/target/nextflow/sortmerna/main.nf
index fa214093..9cc8d9b6 100644
--- a/target/nextflow/sortmerna/main.nf
+++ b/target/nextflow/sortmerna/main.nf
@@ -3456,9 +3456,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/sortmerna",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/star/star_align_reads/.config.vsh.yaml b/target/nextflow/star/star_align_reads/.config.vsh.yaml
index 1b8c3470..d89af70f 100644
--- a/target/nextflow/star/star_align_reads/.config.vsh.yaml
+++ b/target/nextflow/star/star_align_reads/.config.vsh.yaml
@@ -2663,9 +2663,9 @@ build_info:
   output: "target/nextflow/star/star_align_reads"
   executable: "target/nextflow/star/star_align_reads/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/star/star_align_reads/main.nf b/target/nextflow/star/star_align_reads/main.nf
index 4f294d92..a6377b73 100644
--- a/target/nextflow/star/star_align_reads/main.nf
+++ b/target/nextflow/star/star_align_reads/main.nf
@@ -5943,9 +5943,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/star/star_align_reads",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/star/star_genome_generate/.config.vsh.yaml b/target/nextflow/star/star_genome_generate/.config.vsh.yaml
index 3e2ca331..0f79a2dc 100644
--- a/target/nextflow/star/star_genome_generate/.config.vsh.yaml
+++ b/target/nextflow/star/star_genome_generate/.config.vsh.yaml
@@ -333,9 +333,9 @@ build_info:
   output: "target/nextflow/star/star_genome_generate"
   executable: "target/nextflow/star/star_genome_generate/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/star/star_genome_generate/main.nf b/target/nextflow/star/star_genome_generate/main.nf
index e3c5aa6b..2cc6bc08 100644
--- a/target/nextflow/star/star_genome_generate/main.nf
+++ b/target/nextflow/star/star_genome_generate/main.nf
@@ -3195,9 +3195,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/star/star_genome_generate",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/trimgalore/.config.vsh.yaml b/target/nextflow/trimgalore/.config.vsh.yaml
index 53f2ae4b..cbc68f4a 100644
--- a/target/nextflow/trimgalore/.config.vsh.yaml
+++ b/target/nextflow/trimgalore/.config.vsh.yaml
@@ -770,9 +770,9 @@ build_info:
   output: "target/nextflow/trimgalore"
   executable: "target/nextflow/trimgalore/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/trimgalore/main.nf b/target/nextflow/trimgalore/main.nf
index de770f0b..9325e6fc 100644
--- a/target/nextflow/trimgalore/main.nf
+++ b/target/nextflow/trimgalore/main.nf
@@ -3560,9 +3560,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/trimgalore",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml b/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml
index 694f6c1e..8f48bd65 100644
--- a/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml
+++ b/target/nextflow/umi_tools/umi_tools_dedup/.config.vsh.yaml
@@ -611,9 +611,9 @@ build_info:
   output: "target/nextflow/umi_tools/umi_tools_dedup"
   executable: "target/nextflow/umi_tools/umi_tools_dedup/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/umi_tools/umi_tools_dedup/main.nf b/target/nextflow/umi_tools/umi_tools_dedup/main.nf
index 70a361d4..0f3803b2 100644
--- a/target/nextflow/umi_tools/umi_tools_dedup/main.nf
+++ b/target/nextflow/umi_tools/umi_tools_dedup/main.nf
@@ -3487,9 +3487,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/umi_tools/umi_tools_dedup",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml b/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml
index 797ea610..e9c440ea 100644
--- a/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml
+++ b/target/nextflow/umi_tools/umi_tools_extract/.config.vsh.yaml
@@ -449,9 +449,9 @@ build_info:
   output: "target/nextflow/umi_tools/umi_tools_extract"
   executable: "target/nextflow/umi_tools/umi_tools_extract/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/umi_tools/umi_tools_extract/main.nf b/target/nextflow/umi_tools/umi_tools_extract/main.nf
index 0a781812..cf3722b9 100644
--- a/target/nextflow/umi_tools/umi_tools_extract/main.nf
+++ b/target/nextflow/umi_tools/umi_tools_extract/main.nf
@@ -3316,9 +3316,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/umi_tools/umi_tools_extract",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",
diff --git a/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml b/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml
index 467ecff2..142ac5c4 100644
--- a/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml
+++ b/target/nextflow/umi_tools/umi_tools_prepareforrsem/.config.vsh.yaml
@@ -256,9 +256,9 @@ build_info:
   output: "target/nextflow/umi_tools/umi_tools_prepareforrsem"
   executable: "target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf"
   viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
   name: "biobox"
   version: "main"
diff --git a/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf b/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf
index 2c74d881..b700b618 100644
--- a/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf
+++ b/target/nextflow/umi_tools/umi_tools_prepareforrsem/main.nf
@@ -3121,9 +3121,9 @@ meta = [
     "engine" : "docker|native",
     "output" : "target/nextflow/umi_tools/umi_tools_prepareforrsem",
     "viash_version" : "0.9.0",
-    "git_commit" : "52f44f5049606ac655154cf54ed53fa76b49896f",
-    "git_remote" : "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox",
-    "git_tag" : "v0.2.0-14-g52f44f5"
+    "git_commit" : "aa43543e1fb609901d09b7a9f0c5e72707cb47a4",
+    "git_remote" : "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox",
+    "git_tag" : "v0.2.0-20-gaa43543"
   },
   "package_config" : {
     "name" : "biobox",