biobox/target/executable/fastp/.config.vsh.yaml

name: "fastp"
version: "main"
authors:
- name: "Robrecht Cannoodt"
  roles:
  - "author"
  - "maintainer"
  info:
    links:
      email: "robrecht@data-intuitive.com"
      github: "rcannood"
      orcid: "0000-0003-3641-729X"
      linkedin: "robrechtcannoodt"
    organizations:
    - name: "Data Intuitive"
      href: "https://www.data-intuitive.com"
      role: "Data Science Engineer"
    - name: "Open Problems"
      href: "https://openproblems.bio"
      role: "Core Member"
argument_groups:
- name: "Inputs"
  description: "`fastp` supports both single-end (SE) and paired-end (PE) input.\n\
    \n- for SE data, you only have to specify read1 input by `-i` or `--in1`.\n- for\
    \ PE data, you should also specify read2 input by `-I` or `--in2`.\n"
  arguments:
  - type: "file"
    name: "--in1"
    alternatives:
    - "-i"
    description: "Input FastQ file. Must be single-end or paired-end R1. Can be gzipped."
    info: null
    example:
    - "in.R1.fq.gz"
    must_exist: true
    create_parent: true
    required: true
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "file"
    name: "--in2"
    alternatives:
    - "-I"
    description: "Input FastQ file. Must be paired-end R2. Can be gzipped."
    info: null
    example:
    - "in.R2.fq.gz"
    must_exist: true
    create_parent: true
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Outputs"
  description: "\n- for SE data, you only have to specify read1 output by `-o` or\
    \ `--out1`.\n- for PE data, you should also specify read2 output by `-O` or `--out2`.\n\
    - if you don't specify the output file names, no output files will be written,\
    \ but the QC will still be done for both data before and after filtering.\n- the\
    \ output will be gzip-compressed if its file name ends with `.gz`\n"
  arguments:
  - type: "file"
    name: "--out1"
    alternatives:
    - "-o"
    description: "The single-end or paired-end R1 reads that pass QC. Will be gzipped\
      \ if its file name ends with `.gz`."
    info: null
    example:
    - "out.R1.fq.gz"
    must_exist: true
    create_parent: true
    required: true
    direction: "output"
    multiple: false
    multiple_sep: ";"
  - type: "file"
    name: "--out2"
    alternatives:
    - "-O"
    description: "The paired-end R2 reads that pass QC. Will be gzipped if its file\
      \ name ends with `.gz`."
    info: null
    example:
    - "out.R2.fq.gz"
    must_exist: true
    create_parent: true
    required: false
    direction: "output"
    multiple: false
    multiple_sep: ";"
  - type: "file"
    name: "--unpaired1"
    description: "Store the reads that `read1` passes filters but its paired `read2`\
      \ doesn't."
    info: null
    example:
    - "unpaired.R1.fq.gz"
    must_exist: true
    create_parent: true
    required: false
    direction: "output"
    multiple: false
    multiple_sep: ";"
  - type: "file"
    name: "--unpaired2"
    description: "Store the reads that `read2` passes filters but its paired `read1`\
      \ doesn't."
    info: null
    example:
    - "unpaired.R2.fq.gz"
    must_exist: true
    create_parent: true
    required: false
    direction: "output"
    multiple: false
    multiple_sep: ";"
  - type: "file"
    name: "--failed_out"
    description: "Store the reads that fail filters.\n\nIf one read failed and is\
      \ written to --failed_out, its failure reason will be appended to its read name.\
      \ For example, failed_quality_filter, failed_too_short etc.\nFor PE data, if\
      \ unpaired reads are not stored (by giving --unpaired1 or --unpaired2), the\
      \ failed pair of reads will be put together. If one read passes the filters\
      \ but its pair doesn't, the failure reason will be paired_read_is_failing.\n"
    info: null
    example:
    - "failed.fq.gz"
    must_exist: true
    create_parent: true
    required: false
    direction: "output"
    multiple: false
    multiple_sep: ";"
  - type: "file"
    name: "--overlapped_out"
    description: "For each read pair, output the overlapped region if it has no any\
      \ mismatched base.\n"
    info: null
    must_exist: true
    create_parent: true
    required: false
    direction: "output"
    multiple: false
    multiple_sep: ";"
- name: "Report output arguments"
  arguments:
  - type: "file"
    name: "--json"
    alternatives:
    - "-j"
    description: "The json format report file name\n"
    info: null
    example:
    - "out.json"
    must_exist: true
    create_parent: true
    required: false
    direction: "output"
    multiple: false
    multiple_sep: ";"
  - type: "file"
    name: "--html"
    description: "The html format report file name\n"
    info: null
    example:
    - "out.html"
    must_exist: true
    create_parent: true
    required: false
    direction: "output"
    multiple: false
    multiple_sep: ";"
  - type: "string"
    name: "--report_title"
    description: "The title of the html report, default is \"fastp report\".\n"
    info: null
    example:
    - "fastp report"
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Adapter trimming"
  description: "Adapter trimming is enabled by default, but you can disable it by\
    \ `-A` or `--disable_adapter_trimming`. Adapter sequences can be automatically\
    \ detected for both PE/SE data.\n\n- For SE data, the adapters are evaluated by\
    \ analyzing the tails of first ~1M reads. This evaluation may be inacurrate, and\
    \ you can specify the adapter sequence by `-a` or `--adapter_sequence` option.\
    \ If adapter sequence is specified, the auto detection for SE data will be disabled.\n\
    - For PE data, the adapters can be detected by per-read overlap analysis, which\
    \ seeks for the overlap of each pair of reads. This method is robust and fast,\
    \ so normally you don't have to input the adapter sequence even you know it. But\
    \ you can still specify the adapter sequences for read1 by `--adapter_sequence`,\
    \ and for read2 by `--adapter_sequence_r2`. If `fastp` fails to find an overlap\
    \ (i.e. due to low quality bases), it will use these sequences to trim adapters\
    \ for read1 and read2 respectively.\n- For PE data, the adapter sequence auto-detection\
    \ is disabled by default since the adapters can be trimmed by overlap analysis.\
    \ However, you can specify `--detect_adapter_for_pe` to enable it.\n- For PE data,\
    \ `fastp` will run a little slower if you specify the sequence adapters or enable\
    \ adapter auto-detection, but usually result in a slightly cleaner output, since\
    \ the overlap analysis may fail due to sequencing errors or adapter dimers.\n\
    - The most widely used adapter is the Illumina TruSeq adapters. If your data is\
    \ from the TruSeq library, you can add `--adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA\
    \ --adapter_sequence_r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT` to your command lines,\
    \ or enable auto detection for PE data by specifing `detect_adapter_for_pe`.\n\
    - `fastp` contains some built-in known adapter sequences for better auto-detection.\
    \ If you want to make some adapters to be a part of the built-in adapters, please\
    \ file an issue.\n\nYou can also specify --adapter_fasta to give a FASTA file\
    \ to tell fastp to trim multiple adapters in this FASTA file. Here is a sample\
    \ of such adapter FASTA file:\n\n```\n>Illumina TruSeq Adapter Read 1\nAGATCGGAAGAGCACACGTCTGAACTCCAGTCA\n\
    >Illumina TruSeq Adapter Read 2\nAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\n>polyA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\n\
    ```\n\nThe adapter sequence in this file should be at least 6bp long, otherwise\
    \ it will be skipped. And you can give whatever you want to trim, rather than\
    \ regular sequencing adapters (i.e. polyA).\n\n`fastp` first trims the auto-detected\
    \ adapter or the adapter sequences given by `--adapter_sequence | --adapter_sequence_r2`,\
    \ then trims the adapters given by `--adapter_fasta` one by one.\n\nThe sequence\
    \ distribution of trimmed adapters can be found at the HTML/JSON reports.\n"
  arguments:
  - type: "boolean_true"
    name: "--disable_adapter_trimming"
    alternatives:
    - "-A"
    description: "Disable adapter trimming.\n"
    info: null
    direction: "input"
  - type: "boolean_true"
    name: "--detect_adapter_for_pe"
    description: "By default, the auto-detection for adapter is for SE data input\
      \ only, turn on this option to enable it for PE data.\n"
    info: null
    direction: "input"
  - type: "string"
    name: "--adapter_sequence"
    alternatives:
    - "-a"
    description: "The adapter sequences to be trimmed. For SE data, if not specified,\
      \ the adapters will be auto-detected. For PE data, this is used if R1/R2 are\
      \ found not overlapped\n"
    info: null
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "string"
    name: "--adapter_sequence_r2"
    description: "The adapter sequences to be trimmed for R2. This is used for PE\
      \ data if R1/R2 are found overlapped.\n"
    info: null
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "file"
    name: "--adapter_fasta"
    description: "A FASTA file containing all the adapter sequences to be trimmed.\
      \ For SE data, if not specified, the adapters will be auto-detected. For PE\
      \ data, this is used if R1/R2 are found not overlapped.\n"
    info: null
    must_exist: true
    create_parent: true
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Base trimming"
  arguments:
  - type: "integer"
    name: "--trim_front1"
    alternatives:
    - "-f"
    description: "Trimming how many bases in front for read1, default is 0.\n"
    info: null
    example:
    - 0
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--trim_tail1"
    alternatives:
    - "-t"
    description: "Trimming how many bases in tail for read1, default is 0.\n"
    info: null
    example:
    - 0
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--max_len1"
    alternatives:
    - "-b"
    description: "If read1 is longer than max_len1, then trim read1 at its tail to\
      \ make it as long as max_len1. Default 0 means no limitation.\n"
    info: null
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--trim_front2"
    alternatives:
    - "-F"
    description: "Trimming how many bases in front for read2, default is 0.\n"
    info: null
    example:
    - 0
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--trim_tail2"
    alternatives:
    - "-T"
    description: "Trimming how many bases in tail for read2, default is 0.\n"
    info: null
    example:
    - 0
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--max_len2"
    alternatives:
    - "-B"
    description: "If read2 is longer than max_len2, then trim read2 at its tail to\
      \ make it as long as max_len2. Default 0 means no limitation.\n"
    info: null
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Merging mode"
  description: "Allows merging paired-end reads into a single longer read if they\
    \ are overlapping."
  arguments:
  - type: "boolean_true"
    name: "--merge"
    alternatives:
    - "-m"
    description: "For paired-end input, merge each pair of reads into a single read\
      \ if they are overlapped. The merged reads will be written to the file given\
      \ by --merged_out, the unmerged reads will be written to the files specified\
      \ by --out1 and --out2. The merging mode is disabled by default.\n"
    info: null
    direction: "input"
  - type: "file"
    name: "--merged_out"
    description: "In the merging mode, specify the file name to store merged output,\
      \ or specify --stdout to stream the merged output.\n"
    info: null
    example:
    - "merged.fq.gz"
    must_exist: true
    create_parent: true
    required: false
    direction: "output"
    multiple: false
    multiple_sep: ";"
  - type: "boolean_true"
    name: "--include_unmerged"
    description: "In the merging mode, write the unmerged or unpaired reads to the\
      \ file specified by --merge. Disabled by default.\n"
    info: null
    direction: "input"
- name: "Additional input arguments"
  description: "Affects how the input is read."
  arguments:
  - type: "boolean_true"
    name: "--interleaved_in"
    description: "Indicate that <in1> is an interleaved FASTQ which contains both\
      \ read1 and read2. Disabled by default.\n"
    info: null
    direction: "input"
  - type: "boolean_true"
    name: "--fix_mgi_id"
    description: "The MGI FASTQ ID format is not compatible with many BAM operation\
      \ tools, enable this option to fix it.\n"
    info: null
    direction: "input"
  - type: "boolean_true"
    name: "--phred64"
    alternatives:
    - "-6"
    description: "Indicate the input is using phred64 scoring (it'll be converted\
      \ to phred33, so the output will still be phred33)\n"
    info: null
    direction: "input"
- name: "Additional output arguments"
  description: "Affects how the output is written."
  arguments:
  - type: "integer"
    name: "--compression"
    alternatives:
    - "-z"
    description: "Compression level for gzip output (1 ~ 9). 1 is fastest, 9 is smallest,\
      \ default is 4.\n"
    info: null
    example:
    - 4
    required: false
    min: 1
    max: 9
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "boolean_true"
    name: "--dont_overwrite"
    description: "Don't overwrite existing files. Overwritting is allowed by default.\n"
    info: null
    direction: "input"
- name: "Logging arguments"
  arguments:
  - type: "boolean_true"
    name: "--verbose"
    alternatives:
    - "-V"
    description: "Output verbose log information (i.e. when every 1M reads are processed)."
    info: null
    direction: "input"
- name: "Processing arguments"
  arguments:
  - type: "long"
    name: "--reads_to_process"
    description: "Specify how many reads/pairs to be processed. Default 0 means process\
      \ all reads.\n"
    info: null
    example:
    - 1000000
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Deduplication arguments"
  arguments:
  - type: "boolean_true"
    name: "--dedup"
    description: "Enable deduplication to drop the duplicated reads/pairs\n"
    info: null
    direction: "input"
  - type: "integer"
    name: "--dup_calc_accuracy"
    description: "Accuracy level to calculate duplication (1~6). Higher level uses\
      \ more memory (1G, 2G, 4G, 8G, 16G, 24G). Default 1 for no-dedup mode, and 3\
      \ for dedup mode.\n"
    info: null
    example:
    - 3
    required: false
    min: 1
    max: 6
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "boolean_true"
    name: "--dont_eval_duplication"
    description: "Don't evaluate duplication rate to save time and use less memory.\n"
    info: null
    direction: "input"
- name: "PolyG tail trimming arguments"
  arguments:
  - type: "boolean_true"
    name: "--trim_poly_g"
    alternatives:
    - "-g"
    description: "Force polyG tail trimming, by default trimming is automatically\
      \ enabled for Illumina NextSeq/NovaSeq data\n"
    info: null
    direction: "input"
  - type: "integer"
    name: "--poly_g_min_len"
    description: "The minimum length to detect polyG in the read tail. 10 by default.\n"
    info: null
    example:
    - 10
    required: false
    min: 1
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "boolean_true"
    name: "--disable_trim_poly_g"
    alternatives:
    - "-G"
    description: "Disable polyG tail trimming, by default trimming is automatically\
      \ enabled for Illumina NextSeq/NovaSeq data\n"
    info: null
    direction: "input"
- name: "PolyX tail trimming arguments"
  arguments:
  - type: "boolean_true"
    name: "--trim_poly_x"
    alternatives:
    - "-x"
    description: "Enable polyX trimming in 3' ends.\n"
    info: null
    direction: "input"
  - type: "integer"
    name: "--poly_x_min_len"
    description: "The minimum length to detect polyX in the read tail. 10 by default.\n"
    info: null
    example:
    - 10
    required: false
    min: 1
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Cut arguments"
  arguments:
  - type: "integer"
    name: "--cut_front"
    alternatives:
    - "-5"
    description: "Move a sliding window from front (5') to tail, drop the bases in\
      \ the window if its mean quality < threshold, stop otherwise.\n"
    info: null
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_tail"
    alternatives:
    - "-3"
    description: "Move a sliding window from tail (3') to front, drop the bases in\
      \ the window if its mean quality < threshold, stop otherwise.\n"
    info: null
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_right"
    alternatives:
    - "-r"
    description: "Move a sliding window from front to tail, if meet one window with\
      \ mean quality < threshold, drop the bases in the window and the right part,\
      \ and then stop.\n"
    info: null
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_window_size"
    alternatives:
    - "-W"
    description: "The window size option shared by cut_front, cut_tail or cut_sliding.\
      \ Range: 1~1000, default: 4.\n"
    info: null
    example:
    - 4
    required: false
    min: 1
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_mean_quality"
    alternatives:
    - "-M"
    description: "The mean quality requirement option shared by cut_front, cut_tail\
      \ or cut_sliding. Range: 1~36 default: 20 (Q20)\n"
    info: null
    example:
    - 20
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_front_window_size"
    description: "The window size option of cut_front, default to cut_window_size\
      \ if not specified.\n"
    info: null
    example:
    - 4
    required: false
    min: 1
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_front_mean_quality"
    description: "The mean quality requirement option of cut_front, default to cut_mean_quality\
      \ if not specified.\n"
    info: null
    example:
    - 20
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_tail_window_size"
    description: "The window size option of cut_tail, default to cut_window_size if\
      \ not specified.\n"
    info: null
    example:
    - 4
    required: false
    min: 1
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_tail_mean_quality"
    description: "The mean quality requirement option of cut_tail, default to cut_mean_quality\
      \ if not specified.\n"
    info: null
    example:
    - 20
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_right_window_size"
    description: "The window size option of cut_right, default to cut_window_size\
      \ if not specified.\n"
    info: null
    example:
    - 4
    required: false
    min: 1
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--cut_right_mean_quality"
    description: "The mean quality requirement option of cut_right, default to cut_mean_quality\
      \ if not specified.\n"
    info: null
    example:
    - 20
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Quality filtering arguments"
  arguments:
  - type: "boolean_true"
    name: "--disable_quality_filtering"
    alternatives:
    - "-Q"
    description: "Quality filtering is enabled by default. If this option is specified,\
      \ quality filtering is disabled.\n"
    info: null
    direction: "input"
  - type: "integer"
    name: "--qualified_quality_phred"
    alternatives:
    - "-q"
    description: "The quality value that a base is qualified. Default 15 means phred\
      \ quality >=Q15 is qualified.\n"
    info: null
    example:
    - 15
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--unqualified_percent_limit"
    alternatives:
    - "-u"
    description: "How many percents of bases are allowed to be unqualified (0~100).\
      \ Default 40 means 40%.\n"
    info: null
    example:
    - 40
    required: false
    min: 0
    max: 100
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--n_base_limit"
    alternatives:
    - "-n"
    description: "If one read's number of N base is >n_base_limit, then this read/pair\
      \ is discarded. Default is 5.\n"
    info: null
    example:
    - 5
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--average_qual"
    alternatives:
    - "-e"
    description: "If one read's average quality score <avg_qual, then this read/pair\
      \ is discarded. Default 0 means no requirement.\n"
    info: null
    example:
    - 0
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Length filtering arguments"
  arguments:
  - type: "boolean_true"
    name: "--disable_length_filtering"
    alternatives:
    - "-L"
    description: "Length filtering is enabled by default. If this option is specified,\
      \ length filtering is disabled.\n"
    info: null
    direction: "input"
  - type: "integer"
    name: "--length_required"
    alternatives:
    - "-l"
    description: "Reads shorter than length_required will be discarded, default is\
      \ 15.\n"
    info: null
    example:
    - 15
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--length_limit"
    description: "Reads longer than length_limit will be discarded, default 0 means\
      \ no limitation.\n"
    info: null
    example:
    - 0
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Low complexity filtering arguments"
  arguments:
  - type: "boolean_true"
    name: "--low_complexity_filter"
    alternatives:
    - "-y"
    description: "Enable low complexity filter. The complexity is defined as the percentage\
      \ of base that is different from its next base (base[i] != base[i+1]).\n"
    info: null
    direction: "input"
  - type: "integer"
    name: "--complexity_threshold"
    alternatives:
    - "-Y"
    description: "The threshold for low complexity filter (0~100). Default is 30,\
      \ which means 30% complexity is required.\n"
    info: null
    example:
    - 30
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Index filtering arguments"
  arguments:
  - type: "file"
    name: "--filter_by_index1"
    description: "Specify a file contains a list of barcodes of index1 to be filtered\
      \ out, one barcode per line.\n"
    info: null
    must_exist: true
    create_parent: true
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "file"
    name: "--filter_by_index2"
    description: "Specify a file contains a list of barcodes of index2 to be filtered\
      \ out, one barcode per line.\n"
    info: null
    must_exist: true
    create_parent: true
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--filter_by_index_threshold"
    description: "The allowed difference of index barcode for index filtering, default\
      \ 0 means completely identical.\n"
    info: null
    example:
    - 0
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Overlapped region correction"
  arguments:
  - type: "boolean_true"
    name: "--correction"
    alternatives:
    - "-c"
    description: "Enable base correction in overlapped regions (only for PE data),\
      \ default is disabled.\n"
    info: null
    direction: "input"
  - type: "integer"
    name: "--overlap_len_require"
    description: "The minimum length to detect overlapped region of PE reads. This\
      \ will affect overlap analysis based PE merge, adapter trimming and correction.\
      \ 30 by default.\n"
    info: null
    example:
    - 30
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--overlap_diff_limit"
    description: "The maximum number of mismatched bases to detect overlapped region\
      \ of PE reads. This will affect overlap analysis based PE merge, adapter trimming\
      \ and correction. 5 by default.\n"
    info: null
    example:
    - 5
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--overlap_diff_percent_limit"
    description: "The maximum percentage of mismatched bases to detect overlapped\
      \ region of PE reads. This will affect overlap analysis based PE merge, adapter\
      \ trimming and correction. Default 20 means 20%.\n"
    info: null
    example:
    - 20
    required: false
    min: 0
    max: 100
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "UMI arguments"
  arguments:
  - type: "boolean_true"
    name: "--umi"
    alternatives:
    - "-U"
    description: "Enable unique molecular identifier (UMI) preprocessing.\n"
    info: null
    direction: "input"
  - type: "string"
    name: "--umi_loc"
    description: "Specify the location of UMI, can be (index1/index2/read1/read2/per_index/per_read,\
      \ default is none.\n"
    info: null
    required: false
    choices:
    - "index1"
    - "index2"
    - "read1"
    - "read2"
    - "per_index"
    - "per_read"
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--umi_len"
    description: "If the UMI is in read1/read2, its length should be provided.\n"
    info: null
    example:
    - 0
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "string"
    name: "--umi_prefix"
    description: "If specified, an underline will be used to connect prefix and UMI\
      \ (i.e. prefix=UMI, UMI=AATTCG, final=UMI_AATTCG). No prefix by default.\n"
    info: null
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "integer"
    name: "--umi_skip"
    description: "If the UMI is in read1/read2, fastp can skip several bases following\
      \ UMI, default is 0.\n"
    info: null
    example:
    - 0
    required: false
    min: 0
    direction: "input"
    multiple: false
    multiple_sep: ";"
  - type: "string"
    name: "--umi_delim"
    description: "If the UMI is in index1/index2, fastp can use a delimiter to separate\
      \ UMI from the read sequence, default is none.\n"
    info: null
    required: false
    direction: "input"
    multiple: false
    multiple_sep: ";"
- name: "Overrepresentation analysis arguments"
  arguments:
  - type: "boolean_true"
    name: "--overrepresentation_analysis"
    alternatives:
    - "-p"
    description: "Enable overrepresentation analysis.\n"
    info: null
    direction: "input"
  - type: "integer"
    name: "--overrepresentation_sampling"
    description: "One in (--overrepresentation_sampling) reads will be computed for\
      \ overrepresentation analysis (1~10000), smaller is slower, default is 20.\n"
    info: null
    example:
    - 20
    required: false
    min: 1
    direction: "input"
    multiple: false
    multiple_sep: ";"
resources:
- type: "bash_script"
  path: "script.sh"
  is_executable: true
description: "An ultra-fast all-in-one FASTQ preprocessor (QC/adapters/trimming/filtering/splitting/merging...).\n\
  \nFeatures:\n\n  - comprehensive quality profiling for both before and after filtering\
  \ data (quality curves, base contents, KMER, Q20/Q30, GC Ratio, duplication, adapter\
  \ contents...)\n  - filter out bad reads (too low quality, too short, or too many\
  \ N...)\n  - cut low quality bases for per read in its 5' and 3' by evaluating the\
  \ mean quality from a sliding window (like Trimmomatic but faster).\n  - trim all\
  \ reads in front and tail\n  - cut adapters. Adapter sequences can be automatically\
  \ detected, which means you don't have to input the adapter sequences to trim them.\n\
  \  - correct mismatched base pairs in overlapped regions of paired end reads, if\
  \ one base is with high quality while the other is with ultra low quality\n  - trim\
  \ polyG in 3' ends, which is commonly seen in NovaSeq/NextSeq data. Trim polyX in\
  \ 3' ends to remove unwanted polyX tailing (i.e. polyA tailing for mRNA-Seq data)\n\
  \  - preprocess unique molecular identifier (UMI) enabled data, shift UMI to sequence\
  \ name.\n  - report JSON format result for further interpreting.\n  - visualize\
  \ quality control and filtering results on a single HTML page (like FASTQC but faster\
  \ and more informative).\n  - split the output to multiple files (0001.R1.gz, 0002.R1.gz...)\
  \ to support parallel processing. Two modes can be used, limiting the total split\
  \ file number, or limitting the lines of each split file.\n  - support long reads\
  \ (data from PacBio / Nanopore devices).\n  - support reading from STDIN and writing\
  \ to STDOUT\n  - support interleaved input\n  - support ultra-fast FASTQ-level deduplication\n"
test_resources:
- type: "bash_script"
  path: "test.sh"
  is_executable: true
- type: "file"
  path: "test_data"
info: null
status: "enabled"
requirements:
  commands:
  - "ps"
keywords:
- "RNA-Seq"
- "Trimming"
- "Quality control"
license: "MIT"
references:
  doi:
  - "10.1093/bioinformatics/bty560"
links:
  repository: "https://github.com/OpenGene/fastp"
  documentation: "https://github.com/OpenGene/fastp/blob/master/README.md"
runners:
- type: "executable"
  id: "executable"
  docker_setup_strategy: "ifneedbepullelsecachedbuild"
- type: "nextflow"
  id: "nextflow"
  directives:
    tag: "$id"
  auto:
    simplifyInput: true
    simplifyOutput: false
    transcript: false
    publish: false
  config:
    labels:
      mem1gb: "memory = 1000000000.B"
      mem2gb: "memory = 2000000000.B"
      mem5gb: "memory = 5000000000.B"
      mem10gb: "memory = 10000000000.B"
      mem20gb: "memory = 20000000000.B"
      mem50gb: "memory = 50000000000.B"
      mem100gb: "memory = 100000000000.B"
      mem200gb: "memory = 200000000000.B"
      mem500gb: "memory = 500000000000.B"
      mem1tb: "memory = 1000000000000.B"
      mem2tb: "memory = 2000000000000.B"
      mem5tb: "memory = 5000000000000.B"
      mem10tb: "memory = 10000000000000.B"
      mem20tb: "memory = 20000000000000.B"
      mem50tb: "memory = 50000000000000.B"
      mem100tb: "memory = 100000000000000.B"
      mem200tb: "memory = 200000000000000.B"
      mem500tb: "memory = 500000000000000.B"
      mem1gib: "memory = 1073741824.B"
      mem2gib: "memory = 2147483648.B"
      mem4gib: "memory = 4294967296.B"
      mem8gib: "memory = 8589934592.B"
      mem16gib: "memory = 17179869184.B"
      mem32gib: "memory = 34359738368.B"
      mem64gib: "memory = 68719476736.B"
      mem128gib: "memory = 137438953472.B"
      mem256gib: "memory = 274877906944.B"
      mem512gib: "memory = 549755813888.B"
      mem1tib: "memory = 1099511627776.B"
      mem2tib: "memory = 2199023255552.B"
      mem4tib: "memory = 4398046511104.B"
      mem8tib: "memory = 8796093022208.B"
      mem16tib: "memory = 17592186044416.B"
      mem32tib: "memory = 35184372088832.B"
      mem64tib: "memory = 70368744177664.B"
      mem128tib: "memory = 140737488355328.B"
      mem256tib: "memory = 281474976710656.B"
      mem512tib: "memory = 562949953421312.B"
      cpu1: "cpus = 1"
      cpu2: "cpus = 2"
      cpu5: "cpus = 5"
      cpu10: "cpus = 10"
      cpu20: "cpus = 20"
      cpu50: "cpus = 50"
      cpu100: "cpus = 100"
      cpu200: "cpus = 200"
      cpu500: "cpus = 500"
      cpu1000: "cpus = 1000"
  debug: false
  container: "docker"
engines:
- type: "docker"
  id: "docker"
  image: "quay.io/biocontainers/fastp:0.23.4--hadf994f_2"
  target_registry: "images.viash-hub.com"
  target_tag: "main"
  namespace_separator: "/"
  setup:
  - type: "docker"
    run:
    - "fastp --version 2>&1 | sed 's# #: \"#;s#$#\"#' > /var/software_versions.txt\n"
  entrypoint: []
  cmd: null
- type: "native"
  id: "native"
build_info:
  config: "src/fastp/config.vsh.yaml"
  runner: "executable"
  engine: "docker|native"
  output: "target/executable/fastp"
  executable: "target/executable/fastp/fastp"
  viash_version: "0.9.0-RC6"
  git_commit: "766ab6c9c3059004c7c3f205621909b2d8b0b26d"
  git_remote: "https://github.com/viash-hub/biobox"
package_config:
  name: "biobox"
  version: "main"
  description: "A collection of bioinformatics tools for working with sequence data.\n"
  info: null
  viash_version: "0.9.0-RC6"
  source: "src"
  target: "target"
  config_mods:
  - ".requirements.commands := ['ps']\n"
  - ".engines += { type: \"native\" }"
  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
  - ".engines[.type == 'docker'].target_tag := 'main'"
  keywords:
  - "bioinformatics"
  - "modules"
  - "sequencing"
  license: "MIT"
  organization: "vsh"
  links:
    repository: "https://github.com/viash-hub/biobox"
    issue_tracker: "https://github.com/viash-hub/biobox/issues"