From c439638095dc436bb51d72c635d3c22b5d2d1586 Mon Sep 17 00:00:00 2001 From: CI Date: Tue, 20 Aug 2024 14:02:33 +0000 Subject: [PATCH] Build branch unpack_genome with version unpack_genome (7c0705a) Build pipeline: viash-hub.htrnaseq.unpack-genome-5zk5c Source commit: https://github.com/viash-hub/htrnaseq/commit/7c0705a514b86c8d335f308abf7fb1b62d16aa2f Source message: Add ability to unpack input genome --- .gitignore | 7 + _viash.yaml | 13 + main.nf | 3 + nextflow.config | 6 + src/config/labels.config | 43 + src/config/tests.config | 38 + src/parallel_map/config.vsh.yaml | 101 + src/parallel_map/script.sh | 287 ++ src/parallel_map/test.sh | 356 ++ src/workflows/htrnaseq/config.vsh.yaml | 79 + src/workflows/htrnaseq/integration_test.sh | 32 + src/workflows/htrnaseq/main.nf | 184 + .../utils/groupLanes/config.vsh.yaml | 39 + src/workflows/utils/groupLanes/main.nf | 24 + .../utils/groupPairs/config.vsh.yaml | 32 + src/workflows/utils/groupPairs/main.nf | 26 + .../utils/groupWells/config.vsh.yaml | 48 + src/workflows/utils/groupWells/main.nf | 25 + .../utils/splitWells/config.vsh.yaml | 39 + src/workflows/utils/splitWells/main.nf | 31 + .../well_demultiplex/config.vsh.yaml | 52 + src/workflows/well_demultiplex/main.nf | 33 + .../well_demultiplex/nextflow.config | 9 + src/workflows/well_demultiplex/test.nf | 46 + target/.build.yaml | 0 .../v0.1.0/nextflow/cutadapt/.config.vsh.yaml | 733 +++ .../biobox/v0.1.0/nextflow/cutadapt/main.nf | 4371 +++++++++++++++++ .../v0.1.0/nextflow/cutadapt/nextflow.config | 125 + .../nextflow/cutadapt/nextflow_schema.json | 749 +++ .../nextflow/concat_text/.config.vsh.yaml | 197 + .../concat_text/nextflow/concat_text/main.nf | 3582 ++++++++++++++ .../nextflow/concat_text/nextflow.config | 126 + .../nextflow/concat_text/nextflow_schema.json | 106 + .../nextflow/untar/.config.vsh.yaml | 173 + .../concat_text/nextflow/untar/main.nf | 3545 +++++++++++++ .../nextflow/untar/nextflow.config | 125 + .../nextflow/untar/nextflow_schema.json | 119 + .../executable/parallel_map/.config.vsh.yaml | 260 + target/executable/parallel_map/parallel_map | 1625 ++++++ target/nextflow/parallel_map/.config.vsh.yaml | 260 + target/nextflow/parallel_map/main.nf | 3881 +++++++++++++++ target/nextflow/parallel_map/nextflow.config | 125 + .../parallel_map/nextflow_schema.json | 206 + .../workflows/htrnaseq/.config.vsh.yaml | 233 + target/nextflow/workflows/htrnaseq/main.nf | 3405 +++++++++++++ .../workflows/htrnaseq/nextflow.config | 124 + .../workflows/htrnaseq/nextflow_schema.json | 136 + .../utils/groupLanes/.config.vsh.yaml | 165 + .../workflows/utils/groupLanes/main.nf | 3141 ++++++++++++ .../utils/groupLanes/nextflow.config | 125 + .../utils/groupLanes/nextflow_schema.json | 116 + .../utils/groupPairs/.config.vsh.yaml | 153 + .../workflows/utils/groupPairs/main.nf | 3129 ++++++++++++ .../utils/groupPairs/nextflow.config | 125 + .../utils/groupPairs/nextflow_schema.json | 106 + .../utils/groupWells/.config.vsh.yaml | 185 + .../workflows/utils/groupWells/main.nf | 3166 ++++++++++++ .../utils/groupWells/nextflow.config | 125 + .../utils/groupWells/nextflow_schema.json | 136 + .../utils/splitWells/.config.vsh.yaml | 171 + .../workflows/utils/splitWells/main.nf | 3155 ++++++++++++ .../utils/splitWells/nextflow.config | 125 + .../utils/splitWells/nextflow_schema.json | 135 + .../well_demultiplex/.config.vsh.yaml | 182 + .../workflows/well_demultiplex/main.nf | 3178 ++++++++++++ .../well_demultiplex/nextflow.config | 125 + .../well_demultiplex/nextflow_schema.json | 115 + 67 files changed, 43617 insertions(+) create mode 100644 .gitignore create mode 100644 _viash.yaml create mode 100644 main.nf create mode 100644 nextflow.config create mode 100644 src/config/labels.config create mode 100644 src/config/tests.config create mode 100644 src/parallel_map/config.vsh.yaml create mode 100755 src/parallel_map/script.sh create mode 100755 src/parallel_map/test.sh create mode 100644 src/workflows/htrnaseq/config.vsh.yaml create mode 100755 src/workflows/htrnaseq/integration_test.sh create mode 100644 src/workflows/htrnaseq/main.nf create mode 100644 src/workflows/utils/groupLanes/config.vsh.yaml create mode 100644 src/workflows/utils/groupLanes/main.nf create mode 100644 src/workflows/utils/groupPairs/config.vsh.yaml create mode 100644 src/workflows/utils/groupPairs/main.nf create mode 100644 src/workflows/utils/groupWells/config.vsh.yaml create mode 100644 src/workflows/utils/groupWells/main.nf create mode 100644 src/workflows/utils/splitWells/config.vsh.yaml create mode 100644 src/workflows/utils/splitWells/main.nf create mode 100644 src/workflows/well_demultiplex/config.vsh.yaml create mode 100644 src/workflows/well_demultiplex/main.nf create mode 100644 src/workflows/well_demultiplex/nextflow.config create mode 100644 src/workflows/well_demultiplex/test.nf create mode 100644 target/.build.yaml create mode 100644 target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/.config.vsh.yaml create mode 100644 target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/main.nf create mode 100644 target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/nextflow.config create mode 100644 target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/nextflow_schema.json create mode 100644 target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/.config.vsh.yaml create mode 100644 target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/main.nf create mode 100644 target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/nextflow.config create mode 100644 target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/nextflow_schema.json create mode 100644 target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/.config.vsh.yaml create mode 100644 target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/main.nf create mode 100644 target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/nextflow.config create mode 100644 target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/nextflow_schema.json create mode 100644 target/executable/parallel_map/.config.vsh.yaml create mode 100755 target/executable/parallel_map/parallel_map create mode 100644 target/nextflow/parallel_map/.config.vsh.yaml create mode 100644 target/nextflow/parallel_map/main.nf create mode 100644 target/nextflow/parallel_map/nextflow.config create mode 100644 target/nextflow/parallel_map/nextflow_schema.json create mode 100644 target/nextflow/workflows/htrnaseq/.config.vsh.yaml create mode 100644 target/nextflow/workflows/htrnaseq/main.nf create mode 100644 target/nextflow/workflows/htrnaseq/nextflow.config create mode 100644 target/nextflow/workflows/htrnaseq/nextflow_schema.json create mode 100644 target/nextflow/workflows/utils/groupLanes/.config.vsh.yaml create mode 100644 target/nextflow/workflows/utils/groupLanes/main.nf create mode 100644 target/nextflow/workflows/utils/groupLanes/nextflow.config create mode 100644 target/nextflow/workflows/utils/groupLanes/nextflow_schema.json create mode 100644 target/nextflow/workflows/utils/groupPairs/.config.vsh.yaml create mode 100644 target/nextflow/workflows/utils/groupPairs/main.nf create mode 100644 target/nextflow/workflows/utils/groupPairs/nextflow.config create mode 100644 target/nextflow/workflows/utils/groupPairs/nextflow_schema.json create mode 100644 target/nextflow/workflows/utils/groupWells/.config.vsh.yaml create mode 100644 target/nextflow/workflows/utils/groupWells/main.nf create mode 100644 target/nextflow/workflows/utils/groupWells/nextflow.config create mode 100644 target/nextflow/workflows/utils/groupWells/nextflow_schema.json create mode 100644 target/nextflow/workflows/utils/splitWells/.config.vsh.yaml create mode 100644 target/nextflow/workflows/utils/splitWells/main.nf create mode 100644 target/nextflow/workflows/utils/splitWells/nextflow.config create mode 100644 target/nextflow/workflows/utils/splitWells/nextflow_schema.json create mode 100644 target/nextflow/workflows/well_demultiplex/.config.vsh.yaml create mode 100644 target/nextflow/workflows/well_demultiplex/main.nf create mode 100644 target/nextflow/workflows/well_demultiplex/nextflow.config create mode 100644 target/nextflow/workflows/well_demultiplex/nextflow_schema.json diff --git a/.gitignore b/.gitignore new file mode 100644 index 00000000..78db6998 --- /dev/null +++ b/.gitignore @@ -0,0 +1,7 @@ +target +testData + +# Nextflow related files +.nextflow +.nextflow.log* +work \ No newline at end of file diff --git a/_viash.yaml b/_viash.yaml new file mode 100644 index 00000000..cc361827 --- /dev/null +++ b/_viash.yaml @@ -0,0 +1,13 @@ +name: htrnaseq +description: | + Demultiplexing pipeline [WIP] +license: MIT +keywords: [bioinformatics, sequence, high-throughput, mapping, counting, pipeline] +links: + issue_tracker: https://github.com/viash-hub/htrnaseq/issues + repository: https://github.com/viash-hub/htrnaseq + +viash_version: 0.9.0-RC7 + +config_mods: | + .requirements.commands := ['ps'] diff --git a/main.nf b/main.nf new file mode 100644 index 00000000..5b3d280c --- /dev/null +++ b/main.nf @@ -0,0 +1,3 @@ +workflow { +print("This is a dummy placeholder for pipeline execution. Please use the corresponding nf files for running pipelines.") +} diff --git a/nextflow.config b/nextflow.config new file mode 100644 index 00000000..c28cd819 --- /dev/null +++ b/nextflow.config @@ -0,0 +1,6 @@ +manifest { + name = "htrnaseq" + version = "unpack_genome" + defaultBranch = "main" + nextflowVersion = "!>=20.12.1-edge" +} diff --git a/src/config/labels.config b/src/config/labels.config new file mode 100644 index 00000000..9ea88b1b --- /dev/null +++ b/src/config/labels.config @@ -0,0 +1,43 @@ +process { + // Default resources for components that hardly do any processing + memory = { 2.GB * task.attempt } + cpus = 1 + + // Retry for exit codes that have something to do with memory issues + errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' } + maxRetries = 3 + maxMemory = null + + // Resource labels + withLabel: singlecpu { cpus = 1 } + withLabel: lowcpu { cpus = 4 } + withLabel: midcpu { cpus = 10 } + withLabel: highcpu { cpus = 20 } + + withLabel: lowmem { memory = { get_memory( 4.GB * task.attempt ) } } + withLabel: midmem { memory = { get_memory( 25.GB * task.attempt ) } } + withLabel: highmem { memory = { get_memory( 50.GB * task.attempt ) } } + withLabel: veryhighmem { memory = { get_memory( 75.GB * task.attempt ) } } + +} + +def get_memory(to_compare) { + if (!process.containsKey("maxMemory") || !process.maxMemory) { + return to_compare + } + + try { + if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) { + return process.maxMemory + } + else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) { + return max_memory as nextflow.util.MemoryUnit + } + else { + return to_compare + } + } catch (all) { + println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!" + System.exit(1) + } + } diff --git a/src/config/tests.config b/src/config/tests.config new file mode 100644 index 00000000..3473a3dc --- /dev/null +++ b/src/config/tests.config @@ -0,0 +1,38 @@ + +process.container = 'nextflow/bash:latest' +profiles { + // detect tempdir + tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' + ).toAbsolutePath() + + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + + docker { + docker.fixOwnership = true + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } +} diff --git a/src/parallel_map/config.vsh.yaml b/src/parallel_map/config.vsh.yaml new file mode 100644 index 00000000..abaf8e57 --- /dev/null +++ b/src/parallel_map/config.vsh.yaml @@ -0,0 +1,101 @@ +name: parallel_map +description: | + Map wells in batch, using STAR + Spliced Transcripts Alignment to a Reference (C) Alexander Dobin + https://github.com/alexdobin/STAR +argument_groups: + - name: Input arguments + arguments: + - name: "--input_r1" + type: file + required: true + multiple: true + - name: "--input_r2" + type: file + required: true + multiple: true + - name: "--genomeDir" + type: file + required: true + description: STAR reference directory + - name: "--barcodes" + type: string + multiple: true + required: true + description: The barcodes/wells to process + - name: Barcode arguments + arguments: + - name: "--wellBarcodesLength" + type: integer + required: true + description: The length of the well barcodes + - name: "--umiLength" + type: integer + required: true + description: The length of the UMIs + - name: "--limitBAMsortRAM" + type: string + default: "10000000000" + - name: Runtime arguments + arguments: + - name: "--runThreadN" + description: "Number of threads to use for a single STAR execution." + type: integer + default: 1 + - name: Output arguments + arguments: + - name: "--output" + type: file + description: | + Location of the output folders, 1 folder per barcode. The value used + for this argument must contain a '*', which will be replaced with the + barcode to form the final output location for that barcode. + required: true + multiple: true + direction: output + default: './*' + - name: "--joblog" + type: file + description: Where to store the log file listing all the jobs. + required: false + direction: output + default: "execution_log.txt" + +resources: +- type: bash_script + path: script.sh + +test_resources: + - type: bash_script + path: test.sh + +engines: + - type: docker + image: debian:stable-slim + setup: + - type: apt + packages: + - procps + - gzip + - bzip2 + - parallel + - wget + - zlib1g-dev + - unzip + - xxd + - file + - type: docker + env: + - STAR_VERSION "2.7.11b" + - STAR_SOURCE "https://github.com/alexdobin/STAR/releases/download/$STAR_VERSION/STAR_$STAR_VERSION.zip" + - STAR_TARGET "/tmp/star.zip" + - STAR_BINARY "STAR" + run: | + wget -O $STAR_TARGET $STAR_SOURCE && \ + unzip $STAR_TARGET -d /tmp && \ + mv /tmp/STAR_$STAR_VERSION/Linux_x86_64_static/STAR /usr/local/bin/$STAR_BINARY && \ + chmod +x /usr/local/bin/$STAR_BINARY && \ + rm $STAR_TARGET && rm -rf /tmp/STAR_$STAR_VERSION +runners: + - type: executable + - type: nextflow diff --git a/src/parallel_map/script.sh b/src/parallel_map/script.sh new file mode 100755 index 00000000..989b563d --- /dev/null +++ b/src/parallel_map/script.sh @@ -0,0 +1,287 @@ +#!/bin/bash + +## VIASH START +par_input_r1="work/2c/5b8b3a2dd4a988b8838e3f72d38a37/_viash_par/input_r1_1/two__ACACCGAATT.concat_text_r1.output.txt" +par_input_r2="work/2c/5b8b3a2dd4a988b8838e3f72d38a37/_viash_par/input_r2_1/two__ACACCGAATT.concat_text_r2.output.txt" +par_barcodes="ACACCGAATT;GGCTATTGAT" +par_output="./*" +par_genomeDir="star" +par_wellBarcodesLength=10 +par_umiLength=10 +par_limitBAMsortRAM="10000000000" +meta_cpus=2 +par_runThreadN=1 +## VIASH END + +set -eo pipefail + +# Check if wildcard character is present in output folder template +printf "Checking if output folder template ($par_output) contains a single wildcard character '*'. " +output_glob_character="${par_output//[^\*]}" +if [[ "${#output_glob_character}" -ne "1" ]]; then + echo "The value for --output must contain exactly one '*' character. Exiting..." + exit 1 +else + echo "Done, wildcard character found!" +fi + +# Split the delimited strings into arrays +IFS=';' read -r -a barcodes <<< "$par_barcodes" +IFS=';' read -r -a input_r1 <<< "$par_input_r1" +IFS=';' read -r -a input_r2 <<< "$par_input_r2" + +# Check that the number of values provided for the barcodes and the fastq files are the same. +num_barcodes="${#barcodes[@]}" +num_r1_inputs="${#input_r1[@]}" +num_r2_inputs="${#input_r2[@]}" + +if [ ! "$num_barcodes" -eq "$num_r1_inputs" ] || [ ! "$num_r1_inputs" -eq "$num_r2_inputs" ]; then + echo "The number of values for arguments 'barcodes' ($num_barcodes), "\ + "'input_r1' ($num_r1_inputs) and 'input_r2' ($num_r2_inputs) "\ + "should be the same, and their order should match." + exit 1 +else + echo "Checked if length of barcodes input ($num_barcodes) is "\ + "the same as R1 reads ($num_r1_inputs) and R2 reads "\ + "($num_r2_inputs). Seems OK!" +fi + +# Function to test for unique values in array +function arrayContainsUniqueValues { + # Pass the argument by reference + local -n arr=$1 + # Create a temporary associative array + # in order to use its uniqueness of keys + # 'declare' in a function is automatically local + declare -A uniq_tmp + for item in "${arr[@]}"; do + uniq_tmp[$item]=0 # assigning a placeholder + done + local unique_array_values=(${!uniq_tmp[@]}) + if [ "${#unique_array_values[@]}" -eq "${#arr[@]}" ]; then + return + fi + false +} +arrayContainsUniqueValues barcodes +is_array_unique_exit_code=$? +if ! (exit $is_array_unique_exit_code); then + echo "The provided barcodes should be unique!" + echo "Values: $par_barcodes" + exit 1 +fi + +# Define the function that will be used to run a single job +function _run() { + local par_wellBarcodeLength="$1" + local par_UMIlength="$2" + local par_output="$3" + local par_genomeDir="$4" + local par_limitBAMsortRAM="$5" + local par_runThreadN="$6" + local barcode="$7" + local input_R1="$8" + local input_R2="$9" + local par_UMIstart=$(($par_wellBarcodeLength + 1)) + + set -eo pipefail + + echo <<-EOF + Processing $barcode + For the following inputs (lanes): + "$star_readFilesIn + EOF + + echo "Writing barcode '$barcode' to $barcode.txt and using it as input". + # Note that there is no possible conflict between jobs here + # because the barcodes are unique (and the barcode is part of the name + # of the file). + echo "$barcode" > "$barcode.txt" + + local dir="${par_output//\*/$barcode}/" + echo "Setting output for barcode '$barcode' to '$dir'." + mkdir -p "$dir" + + # check if files are compressed + local TMPDIR=$(mktemp -d "$meta_temp_dir/parallel_map-$barcode-XXXXXX") + function clean_up { + [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR" + } + trap clean_up RETURN + + # Decompress the input files when needed + # NOTE: for some reason, using STAR's --readFilesCommand does not always work + # This might be because STAR creates fifo files (see https://man7.org/linux/man-pages/man7/fifo.7.html) + # and this requires a filesystem that supports this. Another cause might be that the input files + # are symlinks. When testing this, using '--readFilesCommand "zcat"' + # always produced empty BAM files, but also a succesfull exit code (0) so the problem is not reported. + # However, the logs showed the following error: "gzip -: unexpected end of file". + + function is_gzipped { + printf "Checking if input '$1' (barcode '$barcode') is gzipped... " + if file "$1" | grep -q 'gzip'; then + echo "Done, detected compressed file." + return + fi + echo "Done, file does not need decompression." + false + } + + # Resolve symbolic links to actual file paths + input_R1=$(realpath $input_R1) + input_R2=$(realpath $input_R2) + + if is_gzipped $input_R1; then + local compressed_file_name_r1="$(basename -- $input_R1)" + local uncompressed_file_r1="$TMPDIR/${compressed_file_name_r1%.gz}" + printf "Unpacking input to $uncompressed_file_r1... " + zcat "$input_R1" > "$uncompressed_file_r1" + echo "Decompression done." + else + local uncompressed_file_r1="$input_R1" + fi + + if is_gzipped $input_R2; then + local compressed_file_name_r2="$(basename -- $input_R2)" + local uncompressed_file_r2="$TMPDIR/${compressed_file_name_r2%.gz}" + printf "Unpacking input to $uncompressed_file_r2... " + zcat "$input_R2" > "$uncompressed_file_r2" + echo "Decompression done." + else + local uncompressed_file_r2="$input_R2" + fi + + local n_input_lines_r1=$(wc -l < "$uncompressed_file_r1") + local n_input_lines_r2=$(wc -l < "$uncompressed_file_r2") + + printf "Checking if length of input file mates match. " + if (( $n_input_lines_r1 != n_input_lines_r2 )); then + echo "The length of file $input_R1 ($n_input_lines_r1) does not match with $input_R2 ($n_input_lines_r2)" + return 1 + else + echo "Seems OK, $n_input_lines_r1 input lines." + fi + echo "Starting STAR for barcode '$barcode'" + # soloType 'Droplet' is the same as 'CB_UMI_Simple': one UMI and one cell barcode of fixed length. + # By default in this mode, STAR will look for the cell barcode and the UMI int the last files specified with --readFilesIn + # So we need to specify R2 first and R1 second, because R1 contains the barcode and UMI. + # Also, you might be tempted to use '--soloBarcodeMate 1' to alter this behavior, but this requires the clipping + # the barcode from this mate by specifying --clip5pNbases and/or --clip3pNbases, which we do not want to do. + STAR \ + --readFilesIn "$uncompressed_file_r2" "$uncompressed_file_r1" \ + --soloType Droplet \ + --quantMode GeneCounts \ + --genomeLoad LoadAndKeep \ + --limitBAMsortRAM "$par_limitBAMsortRAM" \ + --runThreadN "$par_runThreadN" \ + --outFilterMultimapNmax 1 \ + --outSAMtype BAM SortedByCoordinate \ + --soloCBstart 1 \ + --readFilesType "Fastx" \ + --soloCBlen "$par_wellBarcodeLength" \ + --soloUMIstart "$par_UMIstart" \ + --soloUMIlen "$par_UMIlength" \ + --soloBarcodeReadLength 0 \ + --soloStrand Unstranded \ + --soloFeatures Gene \ + --genomeDir "$par_genomeDir" \ + --outReadsUnmapped Fastx \ + --outSAMunmapped Within \ + --outSAMattributes NH HI nM AS CR UR CB UB GX GN \ + --soloCBwhitelist "$barcode.txt" \ + --outFileNamePrefix "$dir" \ + --outTmpDir "$TMPDIR/STARtemp/" + + printf "Done running STAR. " + # Check if the number of processed reads is equal to the number of input reads + local n_input_reads=$(($n_input_lines_r1 / 4)) + local nr_output_reads=$(grep -Po "Number\ of\ input\ reads \\|\W*\K\d+" "$dir/Log.final.out") + if (( $nr_output_reads != $n_input_reads )); then + echo "Not all input reads were processed for barcode $barcode." + return 1 + else + echo "Processed $nr_output_reads reads for barcode $barcode". + fi +} + +# Export the function - requires bash +export -f _run + +# Load reference genome +echo "Loading reference genome" +STAR --genomeLoad LoadAndExit --genomeDir "$par_genomeDir" + +# Run the concurrent jobs using GNU parallel + +# Make sure that parallel uses the correct shell +export PARALLEL_SHELL="/bin/bash" + +# Some notes: +# --halt now,fail=1: instruct parallel to exit when a job has failed and kill remaining running jobs. +# +# ::: is a special syntax for GNU parallel to delineate inputs +# If multiple ::: are given, each group will be treated as an input source, and all combinations of input +# sources will be generated. E.g. ::: 1 2 ::: a b c will result in the combinations (1,a) (1,b) (1,c) (2,a) (2,b) (2,c) +# The delimiter :::+ (note the extra '+') links the argument to the previous argument, and one argument from each of the input +# sources will be read. +parallel_cmd=("parallel" "--jobs" "80%" "--verbose" "--memfree" "2G" + "--tmpdir" "$meta_temp_dir" + "--retry-failed" "--retries" "4" "--halt" "soon,fail=1" + "--joblog" "$par_joblog" "_run" "{}") + +# Arguments for which there is one value, so these will not create extra jobs +parallel_cmd+=(":::" "$par_wellBarcodesLength" ":::" "$par_umiLength" ":::" "$par_output" ":::" "$par_genomeDir" ":::" "$par_limitBAMsortRAM" ":::" "$par_runThreadN") + +# Argument which in fact will cause extra jobs to be spawned, per job one item from each argument will be selected +# Thus, these argument lists should have the same length. +parallel_cmd+=(":::" "${barcodes[@]}" ":::+" "${input_r1[@]}" ":::+" "${input_r2[@]}") + +set +eo pipefail +"${parallel_cmd[@]}" +exit_code=$? +set -eo pipefail + +echo "GNU parallel finished!" + +# Unload reference +printf "Unloading reference genome. " +STAR --genomeLoad Remove --genomeDir "$par_genomeDir" +echo "Done!" + +# Exit code from GNU parallel: +# If fail=1 is used, the exit status will be the exit status of the failing job. +echo "Checking exit code" +if ((exit_code>0)); then + # Note that the ending HERE must be indented with TAB characters (not spaces) + # in order to remove leading indentation + MESSAGE=$( + cat <<-HERE + ================================================================== + + !!! An error occurred for one of the jobs. + Exit code of the failing job: $exit_code. + + %s + + ================================================================== + + HERE + ) + printf "$MESSAGE" "$(<$par_joblog)" + exit 1 +else + cat <<-HERE + ================================================================== + + Mapping went fine (exit code '$exit_code'), zero errors occurred + + ================================================================== + HERE + +fi + + + + + + diff --git a/src/parallel_map/test.sh b/src/parallel_map/test.sh new file mode 100755 index 00000000..329e889b --- /dev/null +++ b/src/parallel_map/test.sh @@ -0,0 +1,356 @@ +set -eo pipefail + +## VIASH START +meta_executable="target/executable/parallel_map/parallel_map" +## VIASH END + +# Some helper functions +assert_directory_exists() { + [ -d "$1" ] || { echo "File '$1' does not exist" && exit 1; } +} + +assert_file_exists() { + [ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; } +} + +assert_file_contains() { + grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; } +} + +assert_file_contains_regex() { + grep -q -E "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; } +} + +echo "> Prepare test data in $meta_temp_dir" +TMPDIR=$(mktemp -d --tmpdir="$meta_temp_dir") +function clean_up { + [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR" +} +trap clean_up EXIT + +# Sample 1, barcode ACAGTCACAG, UMI CTACGGATGA +cat > "$TMPDIR/sample1_R1.fastq" <<'EOF' +@SAMPLE_1_SEQ_ID1 +ACAGTCACAGCTACGGATGAGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@SAMPLE_1_SEQ_ID2 +ACAGTCACAGCTACGGATGAGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAG ++ +!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! +EOF + +cat > "$TMPDIR/sample1_R2.fastq" <<'EOF' +@SAMPLE_1_SEQ_ID1 +CTCACAGAGAGTCACAACATAGGCGCGGATGTGTGAGGCTTATGAGGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@SAMPLE_1_SEQ_ID2 +CTCACAGAGAGTCACAACATAGGCGCGGATGTGTGAGGCTTATGAGGC ++ +!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! +EOF + +# Sample 2, barcode CGGGTTTACC, UMI GCTAGCTAGC +cat > "$TMPDIR/sample2_R1.fastq" << 'EOF' +@SAMPLE_2_SEQ_ID1 +CGGGTTTACCGCTAGCTAGCCACCACTATGGTTGGCCGGTTAGTAGTGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@SAMPLE_2_SEQ_ID2 +CGGGTTTACCGCTAGCTAGCCACCACTATGGTTGGCCGGTTAGTAGTGT ++ +!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! +EOF + +cat > "$TMPDIR/sample2_R2.fastq" <<'EOF' +@SAMPLE_2_SEQ_ID1 +ACACTACTAACCGGCCAACCATAGTGGTG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIII +@SAMPLE_2_SEQ_ID2 +ACACTACTAACCGGCCAACCATAGTGGTG ++ +!!!!!!!!!!!!!!!!!!!!!!!!!!!!! +EOF + +# Note that there is a sjdbGTFchrPrefix argument for STAR: +# prefix for chromosome names in a GTF file (default: '-') +cat > "$TMPDIR/genome.fasta" <<'EOF' +>1 +TGGCATGAGCCAACGAACGCTGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAGCGTTCGTGGG +GCTCGTCACCACTATGGTTGGCCGGTTAGTAGTGTGACTCCTGGTTTTCTGGAGCTTCTTTAAACCGTAGTCCAGTCAA +TGCGAATGGCACTTCACGACGGACTGTCCTTAGCTCAGGGGA +EOF + +cat > "$TMPDIR/genes.gtf" <<'EOF' +1 example_source gene 0 72 . + . gene_id "gene1"; gene_name: "GENE1; +1 example_source exon 20 71 . + . gene_id "gene1"; gene_name: "GENE1"; exon_id: gene1_exon1; +1 example_source gene 80 160 . + . gene_id "gene2"; gene_name: "GENE2; +1 example_source exon 80 159 . + . gene_id "gene2"; gene_name: "GENE2"; exon_id: gene2_exon1; + +EOF + +echo "> Generate index" +STAR \ + ${meta_cpus:+--runThreadN $meta_cpus} \ + --runMode genomeGenerate \ + --genomeDir "$TMPDIR/index/" \ + --genomeFastaFiles "$TMPDIR/genome.fasta" \ + --sjdbGTFfile "$TMPDIR/genes.gtf" \ + --genomeSAindexNbases 2 > /dev/null 2>&1 + + +echo "> Run test 1" +run_1_dir="$TMPDIR/run_1" +mkdir -p "$run_1_dir" +pushd "$run_1_dir" > /dev/null +"$meta_executable" \ + --input_r1 "$TMPDIR/sample1_R1.fastq;$TMPDIR/sample2_R1.fastq" \ + --input_r2 "$TMPDIR/sample1_R2.fastq;$TMPDIR/sample2_R2.fastq" \ + --genomeDir "$TMPDIR/index/" \ + --barcodes "ACAGTCACAG;CGGGTTTACC" \ + --wellBarcodesLength 10 \ + --umiLength 10 \ + --runThreadN 2 \ + --output "$TMPDIR/output_*" > /dev/null 2>&1 +popd + +echo ">> Check if output directories exists" +sample1_out="$TMPDIR/output_ACAGTCACAG" +sample2_out="$TMPDIR/output_CGGGTTTACC" +assert_directory_exists "$sample1_out" +assert_directory_exists "$sample2_out" + +echo ">> Check if output files have been created" +for sample in "$sample1_out" "$sample2_out"; do + assert_file_exists "$sample/Aligned.sortedByCoord.out.bam" + assert_file_exists "$sample/Unmapped.out.mate1" + assert_file_exists "$sample/Unmapped.out.mate2" + assert_file_exists "$sample/Log.out" + assert_file_exists "$sample/Log.final.out" + assert_file_exists "$sample/ReadsPerGene.out.tab" +done + + +echo ">> Check if Solo output is present" +for sample in "$sample1_out" "$sample2_out"; do + assert_directory_exists "$sample1_out/Solo.out" + assert_directory_exists "$sample1_out/Solo.out/Gene" + assert_file_exists "$sample1_out/Solo.out/Barcodes.stats" + assert_file_exists "$sample1_out/Solo.out/Gene/raw/barcodes.tsv" + assert_file_exists "$sample1_out/Solo.out/Gene/raw/features.tsv" + assert_file_exists "$sample1_out/Solo.out/Gene/raw/matrix.mtx" + assert_file_exists "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv" + assert_file_exists "$sample1_out/Solo.out/Gene/filtered/features.tsv" + assert_file_exists "$sample1_out/Solo.out/Gene/filtered/matrix.mtx" +done + +echo ">> Check contents of output" +echo ">>> Sample 1" +assert_file_contains "$sample1_out/Solo.out/Barcodes.stats" "yesWLmatchExact 2" +assert_file_contains "$sample1_out/Log.final.out" "Uniquely mapped reads number | 2" +assert_file_contains "$sample1_out/Log.final.out" "Number of input reads | 2" + +cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; } +ACAGTCACAG +EOF + +cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; } +gene1 gene1 Gene Expression +gene2 gene2 Gene Expression +EOF + +cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; } +%%MatrixMarket matrix coordinate integer general +% +2 1 1 +1 1 1 +EOF + +echo ">>> Sample 2" +assert_file_contains "$sample2_out/Solo.out/Barcodes.stats" "yesWLmatchExact 2" +assert_file_contains "$sample2_out/Log.final.out" "Uniquely mapped reads number | 2" +assert_file_contains "$sample2_out/Log.final.out" "Number of input reads | 2" + +cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; } +CGGGTTTACC +EOF + +cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; } +gene1 gene1 Gene Expression +gene2 gene2 Gene Expression +EOF + +cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; } +%%MatrixMarket matrix coordinate integer general +% +2 1 1 +2 1 1 +EOF + +echo "> Run test 2 (compressed input)" +gzip -c "$TMPDIR/sample1_R1.fastq" > "$TMPDIR/sample1_R1.fastq.gz" +gzip -c "$TMPDIR/sample2_R1.fastq" > "$TMPDIR/sample2_R1.fastq.gz" +gzip -c "$TMPDIR/sample1_R2.fastq" > "$TMPDIR/sample1_R2.fastq.gz" +gzip -c "$TMPDIR/sample2_R2.fastq" > "$TMPDIR/sample2_R2.fastq.gz" + +run_2_dir="$TMPDIR/run_2" +mkdir -p "$run_2_dir" +pushd "$run_2_dir" > /dev/null +"$meta_executable" \ + --input_r1 "$TMPDIR/sample1_R1.fastq.gz;$TMPDIR/sample2_R1.fastq.gz" \ + --input_r2 "$TMPDIR/sample1_R2.fastq.gz;$TMPDIR/sample2_R2.fastq.gz" \ + --genomeDir "$TMPDIR/index/" \ + --barcodes "ACAGTCACAG;CGGGTTTACC" \ + --wellBarcodesLength 10 \ + --umiLength 10 \ + --runThreadN 2 \ + --output "$TMPDIR/output_gz_*" > /dev/null 2>&1 +popd > /dev/null + +echo ">> Check if output directories exists" +sample1_out="$TMPDIR/output_gz_ACAGTCACAG" +sample2_out="$TMPDIR/output_gz_CGGGTTTACC" +assert_directory_exists "$sample1_out" +assert_directory_exists "$sample2_out" + +echo ">> Check if output files have been created" +for sample in "$sample1_out" "$sample2_out"; do + assert_file_exists "$sample/Aligned.sortedByCoord.out.bam" + assert_file_exists "$sample/Unmapped.out.mate1" + assert_file_exists "$sample/Unmapped.out.mate2" + assert_file_exists "$sample/Log.out" + assert_file_exists "$sample/Log.final.out" + assert_file_exists "$sample/ReadsPerGene.out.tab" +done + + +echo ">> Check if Solo output is present" +for sample in "$sample1_out" "$sample2_out"; do + assert_directory_exists "$sample1_out/Solo.out" + assert_directory_exists "$sample1_out/Solo.out/Gene" + assert_file_exists "$sample1_out/Solo.out/Barcodes.stats" + assert_file_exists "$sample1_out/Solo.out/Gene/raw/barcodes.tsv" + assert_file_exists "$sample1_out/Solo.out/Gene/raw/features.tsv" + assert_file_exists "$sample1_out/Solo.out/Gene/raw/matrix.mtx" + assert_file_exists "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv" + assert_file_exists "$sample1_out/Solo.out/Gene/filtered/features.tsv" + assert_file_exists "$sample1_out/Solo.out/Gene/filtered/matrix.mtx" +done + +echo ">> Check contents of output" +echo ">>> Sample 1" +assert_file_contains "$sample1_out/Solo.out/Barcodes.stats" "yesWLmatchExact 2" +assert_file_contains "$sample1_out/Log.final.out" "Uniquely mapped reads number | 2" +assert_file_contains "$sample1_out/Log.final.out" "Number of input reads | 2" + +cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; } +ACAGTCACAG +EOF + +cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; } +gene1 gene1 Gene Expression +gene2 gene2 Gene Expression +EOF + +cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; } +%%MatrixMarket matrix coordinate integer general +% +2 1 1 +1 1 1 +EOF + +echo ">>> Sample 2" +assert_file_contains "$sample2_out/Solo.out/Barcodes.stats" "yesWLmatchExact 2" +assert_file_contains "$sample2_out/Log.final.out" "Uniquely mapped reads number | 2" +assert_file_contains "$sample2_out/Log.final.out" "Number of input reads | 2" + +cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; } +CGGGTTTACC +EOF + +cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; } +gene1 gene1 Gene Expression +gene2 gene2 Gene Expression +EOF + +cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; } +%%MatrixMarket matrix coordinate integer general +% +2 1 1 +2 1 1 +EOF + + +echo "> Check that wrong number of barcodes are detected." +run_3_dir="$TMPDIR/run_3" +mkdir -p "$run_3_dir" +pushd "$run_3_dir" > /dev/null +set +eo pipefail +"$meta_executable" \ + --input_r1 "$TMPDIR/sample1_R1.fastq.gz;$TMPDIR/sample2_R1.fastq.gz" \ + --input_r2 "$TMPDIR/sample1_R2.fastq.gz;$TMPDIR/sample2_R2.fastq.gz" \ + --genomeDir "$TMPDIR/index/" \ + --barcodes "ACAGTCACAG" \ + --wellBarcodesLength 10 \ + --umiLength 10 \ + --runThreadN 2 \ + --output "$TMPDIR/output_gz_*" > /dev/null 2>&1 && echo "Expected non-zero exit code " && exit 1 +set -eo pipefail +popd > /dev/null + +echo "> Check that missing wildcard character is detected." +run_4_dir="$TMPDIR/run_4" +mkdir -p "$run_4_dir" +pushd "$run_4_dir" > /dev/null +set +eo pipefail +"$meta_executable" \ + --input_r1 "$TMPDIR/sample1_R1.fastq.gz;$TMPDIR/sample2_R1.fastq.gz" \ + --input_r2 "$TMPDIR/sample1_R2.fastq.gz;$TMPDIR/sample2_R2.fastq.gz" \ + --genomeDir "$TMPDIR/index/" \ + --barcodes "ACAGTCACAG;CGGGTTTACC" \ + --wellBarcodesLength 10 \ + --umiLength 10 \ + --runThreadN 2 \ + --output "$TMPDIR/output_run4" > /dev/null 2>&1 && echo "Expected non-zero exit code." && exit 1 +set -eo pipefail +popd > /dev/null + +echo "> Check that a mismatch in the length of the input mates is detected." +empty_input_file="$TMPDIR/empty.fastq" +touch "$empty_input_file" +run_5_dir="$TMPDIR/run_5" +mkdir -p "$run_5_dir" +pushd "$run_5_dir" > /dev/null +set +eo pipefail +"$meta_executable" \ + --input_r1 "$TMPDIR/sample1_R1.fastq;$empty_input_file" \ + --input_r2 "$TMPDIR/sample1_R2.fastq;$TMPDIR/sample2_R2.fastq" \ + --genomeDir "$TMPDIR/index/" \ + --barcodes "ACAGTCACAG;CGGGTTTACC" \ + --wellBarcodesLength 10 \ + --umiLength 10 \ + --runThreadN 2 \ + --output "$TMPDIR/output_run5_*" > /dev/null 2>&1 && echo "Expected non-zero exit code " && exit 1 +set -eo pipefail +popd > /dev/null + +echo "> Check that wrong number of input files is detected." +run_6_dir="$TMPDIR/run_6" +mkdir -p "$run_6_dir" +pushd "$run_6_dir" > /dev/null +set +eo pipefail +"$meta_executable" \ + --input_r1 "$TMPDIR/sample1_R1.fastq" \ + --input_r2 "$TMPDIR/sample1_R2.fastq;$TMPDIR/sample2_R2.fastq" \ + --genomeDir "$TMPDIR/index/" \ + --barcodes "ACAGTCACAG;CGGGTTTACC" \ + --wellBarcodesLength 10 \ + --umiLength 10 \ + --runThreadN 2 \ + --output "$TMPDIR/output_run_6_*" > /dev/null 2>&1 && echo "Expected non-zero exit code " && exit 1 +set -eo pipefail +popd > /dev/null + + diff --git a/src/workflows/htrnaseq/config.vsh.yaml b/src/workflows/htrnaseq/config.vsh.yaml new file mode 100644 index 00000000..627b4318 --- /dev/null +++ b/src/workflows/htrnaseq/config.vsh.yaml @@ -0,0 +1,79 @@ +name: htrnaseq +namespace: workflows +argument_groups: + - name: Input arguments + arguments: + - name: --input_r1 + description: R1 + type: file + required: true + - name: --input_r2 + description: R2 + type: file + required: true + - name: --barcodesFasta + type: file + required: true + - name: --genomeDir + type: file + required: true + - name: Output arguments + arguments: + - name: --fastq_output + description: List of demultiplexed fastq files + type: file + direction: output + multiple: true + required: true + default: "fastq/*_001.fastq" + - name: --star_output + description: Output from mapping with STAR + type: file + direction: output + multiple: true + required: true + default: $id/star/* +resources: + - type: nextflow_script + path: main.nf + entrypoint: run_wf + +# test_resources: +# - type: nextflow_script +# path: test.nf +# entrypoint: test_wf + +dependencies: + - name: workflows/well_demultiplex + repository: local + - name: untar + repository: cb + - name: parallel_map + repository: local + - name: workflows/utils/splitWells + repository: local + - name: workflows/utils/groupLanes + repository: local + - name: workflows/utils/groupPairs + repository: local + - name: workflows/utils/groupWells + repository: local + - name: concat_text + repository: cb +repositories: + - name: local + type: local + - name: bb + type: vsh + repo: biobox + tag: v0.1.0 + - name: cb + type: vsh + repo: craftbox + tag: concat_text + +runners: + - type: nextflow + +engines: + - type: native diff --git a/src/workflows/htrnaseq/integration_test.sh b/src/workflows/htrnaseq/integration_test.sh new file mode 100755 index 00000000..c82f95d9 --- /dev/null +++ b/src/workflows/htrnaseq/integration_test.sh @@ -0,0 +1,32 @@ +#!/bin/bash + +# get the root of the directory +REPO_ROOT=$(git rev-parse --show-toplevel) + +# ensure that the command below is run from the root of the repository +cd "$REPO_ROOT" + +# Make sure the workflow is built +viash ns build -q 'workflows|parallel_map' + +export NXF_VER=24.04.3 + +nextflow run . \ + -main-script target/nextflow/workflows/htrnaseq/main.nf \ + -params-file params1.yaml \ + -config ./src/config/tests.config \ + -profile docker \ + --publish_dir output \ + -resume + +# bin/nextflow run . \ +# -main-script src/workflows/htrnaseq_wf/test.nf \ +# -entry test_wf_NextSeq550 \ +# -profile docker,local \ +# -resume \ +# --mappingReferenceRoot testData/genomeDir/subset \ +# --barcodesReferenceRoot testData \ +# --compoundAnnotationRoot testData \ +# -ansi-log false \ +# --publish_dir htrnaseq_test_results +# diff --git a/src/workflows/htrnaseq/main.nf b/src/workflows/htrnaseq/main.nf new file mode 100644 index 00000000..5097f14d --- /dev/null +++ b/src/workflows/htrnaseq/main.nf @@ -0,0 +1,184 @@ +workflow run_wf { + take: + input_ch + + main: + // Untar input genome if needed + untar_ch = input_ch + | toSortedList() + | map {ids_and_states -> + def ids = ids_and_states.collect{it[0]} + def genomeDirs = ids_and_states.collect{it[1].genomeDir}.unique() + assert genomeDirs.size() == 1, "Only one value for 'genomeDirs' should have been defined across all inputs." + def genomeDir + genomeDirs.each { genomeDir = it } + ["unpack_genome", ["genomeDir": genomeDir, "original_ids": ids]] + } + | untar.run( + runIf: {id, state -> + def genomeDirStr = state.genomeDir.toString() + genomeDirStr.endsWith(".tar.gz") || \ + genomeDirStr.endsWith(".tar") || \ + genomeDirStr.endsWith(".tgz") ? true : false + }, + fromState: [ + "input": "genomeDir", + ], + toState: { id, result, state -> + state + ["genomeDir": result.output] + }, + ) + | flatMap{ id, state -> + state.original_ids.collect{[it, state.genomeDir]} + } + + output_ch = input_ch.join(untar_ch) + | niceView() + | map {id, state, genomeDir -> + def newState = state + ["genomeDir": genomeDir] + [id, newState] + } + | well_demultiplex.run( + fromState: { id, state -> + [ + input_r1: state.input_r1, + input_r2: state.input_r2, + barcodesFasta: state.barcodesFasta, + ] + }, + toState: { id, result, state -> + state + [ + fastq_output: result.output, + output: result.output, + ] + }, + directives: [label: ["midmem", "midcpu"]] + ) + + | splitWells.run( + fromState: { id, state -> + [ + input: state.output, + ] + }, + toState: { id, result, state -> + state + result + } + ) + | setState( + [ + "input": "barcode_path", + "barcode": "barcode", + "barcodesFasta": "barcodesFasta", + "genomeDir": "genomeDir", + "star_output": "star_output", + "fastq_output": "fastq_output", + ] + ) + + // TODO: Expand this into matching a whitelist/blacklist of barcodes + // ... and turn into separate component + | filter{ id, state -> state.barcode != "unknown" } + + | groupPairs.run( + fromState: { id, state -> + [ + input: state.input + ] + }, + toState: { id, result, state -> + state + result + } + ) + + // Does the sequencing platform use lanes? + // Should those lanes be discriminated over? + | groupLanes.run( + fromState: { id, state -> + [ + input_r1: state.r1, + input_r2: state.r2 + ] + }, + toState: { id, result, state -> + state + result + [ multiple_lanes: result.output_r1.size() > 1] + } + ) + + | setState( + [ + "input_r1": "r1", + "input_r2": "r2", + "barcodesFasta": "barcodesFasta", + "genomeDir": "genomeDir", + "barcode": "barcode", + "star_output": "star_output", + "fastq_output": "fastq_output", + ] + ) + | concat_text.run( + key: "concat_text_r1", + fromState: { id, state -> + [ + input: state.input_r1, + gzip_output: true + ] + }, + toState: { id, result, state -> + state + [ input_r1: result.output ] + } + ) + | concat_text.run( + key: "concat_text_r2", + fromState: { id, state -> + [ + input: state.input_r2, + gzip_output: true + ] + }, + toState: { id, result, state -> + state + [ input_r2: result.output ] + } + ) + + | groupWells.run( + fromState: { id, state -> + [ + input_r1: state.input_r1, + input_r2: state.input_r2, + well: state.barcode + ] + }, + toState: { id, result, state -> + state + [ "wells": result.wells, "input_r1": result.output_r1, "input_r2": result.output_r2] + } + ) + | parallel_map.run( + fromState: { id, state -> + [ + input_r1: state.input_r1, + input_r2: state.input_r2, + genomeDir: state.genomeDir, + barcodes: state.wells, + wellBarcodesLength: 10, + umiLength: 10, + output: state.star_output[0], + ] + }, + toState: { id, result, state -> + state + [ + star_output: result.output, + ] + }, + directives: [label: ["midmem", "midcpu"]] + ) + | niceView() + | setState(["star_output", "fastq_output"]) + + //| niceView() + // + //| setState( [ "output": "out" ] ) + + emit: + output_ch +} diff --git a/src/workflows/utils/groupLanes/config.vsh.yaml b/src/workflows/utils/groupLanes/config.vsh.yaml new file mode 100644 index 00000000..8635b08b --- /dev/null +++ b/src/workflows/utils/groupLanes/config.vsh.yaml @@ -0,0 +1,39 @@ +name: groupLanes +namespace: workflows/utils +description: | + N/A +argument_groups: + - name: Inputs + arguments: + - name: "--input_r1" + type: file + description: Path to the input for R1 + required: true + example: input.fastq.gz + - name: "--input_r2" + type: file + description: Path to the input for R2 + required: true + example: input.fastq.gz + + - name: Output + arguments: + - name: "--output_r1" + type: file + description: Path to output for R2 + multiple: true + required: true + direction: output + - name: "--output_r2" + type: file + description: Path to the output for R2 + multiple: true + required: true + direction: output +resources: + - type: nextflow_script + path: main.nf + entrypoint: run_wf + +runners: + - type: nextflow diff --git a/src/workflows/utils/groupLanes/main.nf b/src/workflows/utils/groupLanes/main.nf new file mode 100644 index 00000000..ae1e6687 --- /dev/null +++ b/src/workflows/utils/groupLanes/main.nf @@ -0,0 +1,24 @@ +workflow run_wf { + + take: in_ + + main: + + out_ = in_ + | map{ id, f -> [ id.replaceAll("_L00\\d", "").replaceAll("_lane\\d", ""), [ input_r1: f.input_r1, input_r2: f.input_r2 ] , id ] } + | groupTuple(sort: "hash") + | map{ new_id, inputs, ids -> + [ + new_id, + [ + output_r1: inputs.collect{it.input_r1}, + output_r2: inputs.collect{it.input_r2}, + _meta: [ join_id: ids[0] ] + ] + ] + } + + emit: out_ + +} + diff --git a/src/workflows/utils/groupPairs/config.vsh.yaml b/src/workflows/utils/groupPairs/config.vsh.yaml new file mode 100644 index 00000000..b89407c6 --- /dev/null +++ b/src/workflows/utils/groupPairs/config.vsh.yaml @@ -0,0 +1,32 @@ +name: groupPairs +namespace: workflows/utils +description: | + N/A +argument_groups: + - name: Inputs + arguments: + - name: "--input" + type: file + description: Path to the input for R1 + required: true + example: input.fastq.gz + + - name: Output + arguments: + - name: "--r1" + type: file + description: Path to output for R2 + required: true + direction: output + - name: "--r2" + type: file + description: Path to output for R2 + required: true + direction: output +resources: + - type: nextflow_script + path: main.nf + entrypoint: run_wf + +runners: + - type: nextflow diff --git a/src/workflows/utils/groupPairs/main.nf b/src/workflows/utils/groupPairs/main.nf new file mode 100644 index 00000000..7a8c5b3a --- /dev/null +++ b/src/workflows/utils/groupPairs/main.nf @@ -0,0 +1,26 @@ +workflow run_wf { + + take: in_ + + main: + + out_ = in_ + | map{ id, f -> [ id.replaceAll("__R[12]", ""), [ input: f.input ] , id ] } + | groupTuple(sort: "hash") + | map{ new_id, inputs, ids -> + r1 = inputs.collect{it.input}.findAll{it =~ "_R1_"}[0] + r2 = inputs.collect{it.input}.findAll{it =~ "_R2_"}[0] + [ + new_id, + [ + r1: r1, + r2: r2, + _meta: [ join_id: ids[0] ] + ] + ] + } + + emit: out_ + +} + diff --git a/src/workflows/utils/groupWells/config.vsh.yaml b/src/workflows/utils/groupWells/config.vsh.yaml new file mode 100644 index 00000000..ef411942 --- /dev/null +++ b/src/workflows/utils/groupWells/config.vsh.yaml @@ -0,0 +1,48 @@ +name: groupWells +namespace: workflows/utils +description: | + N/A +argument_groups: + - name: Inputs + arguments: + - name: "--well" + type: string + description: Barcode identifier for a well + required: true + example: input.fastq.gz + - name: "--input_r1" + type: file + description: Path to the input for R1 + required: true + example: input.fastq.gz + - name: "--input_r2" + type: file + description: Path to the input for R1 + required: true + example: input.fastq.gz + + - name: Output + arguments: + - name: "--wells" + type: string + description: List of grouped wells (by means of barcodes) + multiple: true + direction: output + example: input.fastq.gz + - name: "--output_r1" + type: file + description: Path to output for R2 + multiple: true + direction: output + - name: "--output_r2" + type: file + description: Path to the output for R2 + multiple: true + direction: output +resources: + - type: nextflow_script + path: main.nf + entrypoint: run_wf + +runners: + - type: nextflow diff --git a/src/workflows/utils/groupWells/main.nf b/src/workflows/utils/groupWells/main.nf new file mode 100644 index 00000000..e3269b3e --- /dev/null +++ b/src/workflows/utils/groupWells/main.nf @@ -0,0 +1,25 @@ +workflow run_wf { + + take: in_ + + main: + + out_ = in_ + | map{ id, f -> [ id.replaceAll("__[ACGT]+", ""), [ input_r1: f.input_r1, input_r2: f.input_r2, well: f.well ] , id ] } + | groupTuple(sort: "hash") + | map{ new_id, inputs, ids -> + [ + new_id, + [ + output_r1: inputs.collect{it.input_r1}, + output_r2: inputs.collect{it.input_r2}, + wells: inputs.collect{it.well}, + _meta: [ join_id: ids[0] ] + ] + ] + } + + emit: out_ + +} + diff --git a/src/workflows/utils/splitWells/config.vsh.yaml b/src/workflows/utils/splitWells/config.vsh.yaml new file mode 100644 index 00000000..ab6357bf --- /dev/null +++ b/src/workflows/utils/splitWells/config.vsh.yaml @@ -0,0 +1,39 @@ +name: splitWells +namespace: workflows/utils +description: | + N/A +argument_groups: + - name: Inputs + arguments: + - name: "--input" + type: file + description: List of demultiplexed fastq files + required: true + multiple: true + example: ACAGCGATCGAC_R1_001.fastq + + - name: Output + arguments: + - name: "--pool" + type: string + description: The original pool / sample name + direction: output + - name: "--barcode" + type: string + direction: output + - name: "--barcode_path" + type: file + direction: output + - name: "--lane" + type: string + direction: output + - name: "--pair_end" + type: string + direction: output +resources: + - type: nextflow_script + path: main.nf + entrypoint: run_wf + +runners: + - type: nextflow diff --git a/src/workflows/utils/splitWells/main.nf b/src/workflows/utils/splitWells/main.nf new file mode 100644 index 00000000..4f282c83 --- /dev/null +++ b/src/workflows/utils/splitWells/main.nf @@ -0,0 +1,31 @@ +workflow run_wf { + + take: in_ + + main: + + out_ = in_ + + | flatMap{ id, state -> + state.input.collect{ p -> + barcode = (p =~ /.*\\/([ACTG]*|unknown)_R?.*/)[0][1] + pair_end = (p =~ /.*_(R[12])_.*/)[0][1] + lane = (id =~ /.*_(L\d+).*/) ? (id =~ /.*_(L\d+).*/)[0][1] : "no_lanes" + [ + id + "__" + barcode + "__" + pair_end, + [ + pool: id, + barcode: barcode, + barcode_path: p, + lane: lane, + pair_end: pair_end, + _meta: [ join_id: id ] + ] + ] + } + } + + emit: out_ + +} + diff --git a/src/workflows/well_demultiplex/config.vsh.yaml b/src/workflows/well_demultiplex/config.vsh.yaml new file mode 100644 index 00000000..c4dbdbf8 --- /dev/null +++ b/src/workflows/well_demultiplex/config.vsh.yaml @@ -0,0 +1,52 @@ +name: well_demultiplex +namespace: workflows +description: Demultiplexing on well level +argument_groups: + - name: Input arguments + arguments: + - name: --input_r1 + description: R1 + type: file + required: true + - name: --input_r2 + description: R2 + type: file + required: true + - name: --barcodesFasta + type: file + required: true + - name: Output arguments + arguments: + - name: --output + description: List of demultiplexed fastq files + type: file + direction: output + multiple: true + required: true + default: "fastq/*_001.fastq" +resources: + - type: nextflow_script + path: main.nf + entrypoint: run_wf + +# Test dataset: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM5357044 +test_resources: + - type: nextflow_script + path: test.nf + entrypoint: test_wf + +dependencies: + - name: cutadapt + repository: bb +repositories: + - name: bb + type: vsh + repo: biobox + tag: v0.1.0 + +runners: + - type: nextflow + +engines: + - type: native + diff --git a/src/workflows/well_demultiplex/main.nf b/src/workflows/well_demultiplex/main.nf new file mode 100644 index 00000000..3f54c5e3 --- /dev/null +++ b/src/workflows/well_demultiplex/main.nf @@ -0,0 +1,33 @@ +workflow run_wf { + take: + input_ch + + main: + output_ch = input_ch + //| niceView() + | cutadapt.run( + // TODO: Remove hard-coded directives and replace with profiles + directives: [ + cpus: 4 + ], + fromState: { id, state -> + [ + input: state.input_r1, + input_r2: state.input_r2, + no_indels: true, + action: "none", + front_fasta: state.barcodesFasta, + output: state.output + ] + }, + toState: { id, result, state -> + [ + output: result.output, + ] + } + ) + //| niceView() + + emit: + output_ch +} diff --git a/src/workflows/well_demultiplex/nextflow.config b/src/workflows/well_demultiplex/nextflow.config new file mode 100644 index 00000000..45949e1e --- /dev/null +++ b/src/workflows/well_demultiplex/nextflow.config @@ -0,0 +1,9 @@ +manifest { + nextflowVersion = '!>=20.12.1-edge' +} + +params { + rootDir = java.nio.file.Paths.get("$projectDir/../../../").toAbsolutePath().normalize().toString() +} + + diff --git a/src/workflows/well_demultiplex/test.nf b/src/workflows/well_demultiplex/test.nf new file mode 100644 index 00000000..1b6e9e04 --- /dev/null +++ b/src/workflows/well_demultiplex/test.nf @@ -0,0 +1,46 @@ +include { well_demultiplex } from params.rootDir + "/target/nextflow/workflows/well_demultiplex/main.nf" + +base = "gs://viash-hub-test-data/htrnaseq/v1/" + +workflow test_wf { + output_ch = Channel.fromList([ + [ + id: "SRR14730301", + input_r1: base + "100k/SRR14730301/VH02001612_S9_R1_001.fastq", + input_r2: base + "100k/SRR14730301/VH02001612_S9_R2_001.fastq", + barcodesFasta: base + "2-wells.fasta", + ], + [ + id: "SRR14730302", + input_r1: base + "100k/SRR14730302/VH02001614_S8_R1_001.fastq", + input_r2: base + "100k/SRR14730302/VH02001614_S8_R2_001.fastq", + barcodesFasta: base + "2-wells.fasta", + ], + ]) + | map { state -> [ state.id, state ] } + | well_demultiplex.run( + fromState: { id, state -> + [ + input_r1: state.input_r1, + input_r2: state.input_r2, + barcodesFasta: state.barcodesFasta, + ] + }, + toState: { id, output, state -> + output } + ) + | view { output -> + assert output.size() == 2 : "outputs should contain two elements; [id, file]" + assert output[1].output.size == 6 : "6 fastq files should be generated: pairs for 2 wells and 1 unkonwn" + "Output: $output" + } + | view { id, state -> + assert state.output.size == 6 : "6 fastq files should be generated: pairs for 2 wells and 1 unkonwn" + "State: $state" + } + | toSortedList() + | view { output -> + assert output.size() == 2 : "2 samples in should result in 2 results out" + } +} + diff --git a/target/.build.yaml b/target/.build.yaml new file mode 100644 index 00000000..e69de29b diff --git a/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/.config.vsh.yaml b/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/.config.vsh.yaml new file mode 100644 index 00000000..d26efaf8 --- /dev/null +++ b/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/.config.vsh.yaml @@ -0,0 +1,733 @@ +name: "cutadapt" +version: "v0.1.0" +argument_groups: +- name: "Specify Adapters for R1" + arguments: + - type: "string" + name: "--adapter" + alternatives: + - "-a" + description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\ + \ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\ + \ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\ + \ the read.\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "string" + name: "--front" + alternatives: + - "-g" + description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\ + \ first read). The adapter and any preceding bases\nare trimmed. Partial matches\ + \ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\ + \ the adapter is\nonly found if it is a prefix of the read.\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "string" + name: "--anywhere" + alternatives: + - "-b" + description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\ + \ (paired data: of the first read). Both types of\nmatches as described under\ + \ -a and -g are allowed. If the\nfirst base of the read is part of the match,\ + \ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\ + for rescuing failed library preparations - do not use if\nyou know which end\ + \ your adapter was ligated to!\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" +- name: "Specify Adapters using Fasta files for R1" + arguments: + - type: "file" + name: "--adapter_fasta" + description: "Fasta file containing sequences of an adapter ligated to the 3'\ + \ end (paired data:\nof the first read). The adapter and subsequent bases are\n\ + trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\ + \ found if it is a suffix of the read.\n" + info: null + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--front_fasta" + description: "Fasta file containing sequences of an adapter ligated to the 5'\ + \ end (paired data:\nof the first read). The adapter and any preceding bases\n\ + are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\ + \ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\ + \ the read.\n" + info: null + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--anywhere_fasta" + description: "Fasta file containing sequences of an adapter that may be ligated\ + \ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\ + \ as described under -a and -g are allowed. If the\nfirst base of the read is\ + \ part of the match, the behavior\nis as with -g, otherwise as with -a. This\ + \ option is mostly\nfor rescuing failed library preparations - do not use if\n\ + you know which end your adapter was ligated to!\n" + info: null + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Specify Adapters for R2" + arguments: + - type: "string" + name: "--adapter_r2" + alternatives: + - "-A" + description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\ + \ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\ + \ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\ + \ the read.\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "string" + name: "--front_r2" + alternatives: + - "-G" + description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\ + \ first read). The adapter and any preceding bases\nare trimmed. Partial matches\ + \ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\ + \ the adapter is\nonly found if it is a prefix of the read.\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "string" + name: "--anywhere_r2" + alternatives: + - "-B" + description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\ + \ (paired data: of the first read). Both types of\nmatches as described under\ + \ -a and -g are allowed. If the\nfirst base of the read is part of the match,\ + \ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\ + for rescuing failed library preparations - do not use if\nyou know which end\ + \ your adapter was ligated to!\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" +- name: "Specify Adapters using Fasta files for R2" + arguments: + - type: "file" + name: "--adapter_r2_fasta" + description: "Fasta file containing sequences of an adapter ligated to the 3'\ + \ end (paired data:\nof the first read). The adapter and subsequent bases are\n\ + trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\ + \ found if it is a suffix of the read.\n" + info: null + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--front_r2_fasta" + description: "Fasta file containing sequences of an adapter ligated to the 5'\ + \ end (paired data:\nof the first read). The adapter and any preceding bases\n\ + are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\ + \ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\ + \ the read.\n" + info: null + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--anywhere_r2_fasta" + description: "Fasta file containing sequences of an adapter that may be ligated\ + \ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\ + \ as described under -a and -g are allowed. If the\nfirst base of the read is\ + \ part of the match, the behavior\nis as with -g, otherwise as with -a. This\ + \ option is mostly\nfor rescuing failed library preparations - do not use if\n\ + you know which end your adapter was ligated to!\n" + info: null + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Paired-end options" + arguments: + - type: "boolean_true" + name: "--pair_adapters" + description: "Treat adapters given with -a/-A etc. as pairs. Either both\nor none\ + \ are removed from each read pair.\n" + info: null + direction: "input" + - type: "string" + name: "--pair_filter" + description: "Which of the reads in a paired-end read have to match the\nfiltering\ + \ criterion in order for the pair to be filtered.\n" + info: null + required: false + choices: + - "any" + - "both" + - "first" + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--interleaved" + description: "Read and/or write interleaved paired-end reads.\n" + info: null + direction: "input" +- name: "Input parameters" + arguments: + - type: "file" + name: "--input" + description: "Input fastq file for single-end reads or R1 for paired-end reads.\n" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--input_r2" + description: "Input fastq file for R2 in the case of paired-end reads.\n" + info: null + must_exist: true + create_parent: true + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "double" + name: "--error_rate" + alternatives: + - "-E" + - "--errors" + description: "Maximum allowed error rate (if 0 <= E < 1), or absolute\nnumber\ + \ of errors for full-length adapter match (if E is an\ninteger >= 1). Error\ + \ rate = no. of errors divided by\nlength of matching region. Default: 0.1 (10%).\n" + info: null + example: + - 0.1 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_false" + name: "--no_indels" + description: "Allow only mismatches in alignments.\n" + info: null + direction: "input" + - type: "integer" + name: "--times" + alternatives: + - "-n" + description: "Remove up to COUNT adapters from each read. Default: 1.\n" + info: null + example: + - 1 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--overlap" + alternatives: + - "-O" + description: "Require MINLENGTH overlap between read and adapter for an\nadapter\ + \ to be found. The default is 3.\n" + info: null + example: + - 3 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--match_read_wildcards" + description: "Interpret IUPAC wildcards in reads.\n" + info: null + direction: "input" + - type: "boolean_false" + name: "--no_match_adapter_wildcards" + description: "Do not interpret IUPAC wildcards in adapters.\n" + info: null + direction: "input" + - type: "string" + name: "--action" + description: "What to do if a match was found. trim: trim adapter and\nup- or\ + \ downstream sequence; retain: trim, but retain\nadapter; mask: replace with\ + \ 'N' characters; lowercase:\nconvert to lowercase; none: leave unchanged.\n\ + The default is trim.\n" + info: null + example: + - "trim" + required: false + choices: + - "trim" + - "retain" + - "mask" + - "lowercase" + - "none" + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--revcomp" + alternatives: + - "--rc" + description: "Check both the read and its reverse complement for adapter\nmatches.\ + \ If match is on reverse-complemented version,\noutput that one.\n" + info: null + direction: "input" +- name: "Read modifications" + arguments: + - type: "integer" + name: "--cut" + alternatives: + - "-u" + description: "Remove LEN bases from each read (or R1 if paired; use --cut_r2\n\ + option for R2). If LEN is positive, remove bases from the\nbeginning. If LEN\ + \ is negative, remove bases from the end.\nCan be used twice if LENs have different\ + \ signs. Applied\n*before* adapter trimming.\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "integer" + name: "--cut_r2" + description: "Remove LEN bases from each read (for R2). If LEN is positive, remove\ + \ bases from the\nbeginning. If LEN is negative, remove bases from the end.\n\ + Can be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n" + info: null + required: false + direction: "input" + multiple: true + multiple_sep: ";" + - type: "string" + name: "--nextseq_trim" + description: "NextSeq-specific quality trimming (each read). Trims also\ndark\ + \ cycles appearing as high-quality G bases.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--quality_cutoff" + alternatives: + - "-q" + description: "Trim low-quality bases from 5' and/or 3' ends of each read\nbefore\ + \ adapter removal. Applied to both reads if data is\npaired. If one value is\ + \ given, only the 3' end is trimmed.\nIf two comma-separated cutoffs are given,\ + \ the 5' end is\ntrimmed with the first cutoff, the 3' end with the second.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--quality_cutoff_r2" + alternatives: + - "-Q" + description: "Quality-trimming cutoff for R2. Default: same as for R1\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--quality_base" + description: "Assume that quality values in FASTQ are encoded as\nascii(quality\ + \ + N). This needs to be set to 64 for some\nold Illumina FASTQ files. The default\ + \ is 33.\n" + info: null + example: + - 33 + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--poly_a" + description: "Trim poly-A tails" + info: null + direction: "input" + - type: "integer" + name: "--length" + alternatives: + - "-l" + description: "Shorten reads to LENGTH. Positive values remove bases at\nthe end\ + \ while negative ones remove bases at the beginning.\nThis and the following\ + \ modifications are applied after\nadapter trimming.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--trim_n" + description: "Trim N's on ends of reads." + info: null + direction: "input" + - type: "string" + name: "--length_tag" + description: "Search for TAG followed by a decimal number in the\ndescription\ + \ field of the read. Replace the decimal number\nwith the correct length of\ + \ the trimmed read. For example,\nuse --length-tag 'length=' to correct fields\ + \ like\n'length=123'.\n" + info: null + example: + - "length=" + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--strip_suffix" + description: "Remove this suffix from read names if present. Can be\ngiven multiple\ + \ times.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--prefix" + alternatives: + - "-x" + description: "Add this prefix to read names. Use {name} to insert the\nname of\ + \ the matching adapter.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--suffix" + alternatives: + - "-y" + description: "Add this suffix to read names; can also include {name}\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--rename" + description: "Rename reads using TEMPLATE containing variables such as\n{id},\ + \ {adapter_name} etc. (see documentation)\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--zero_cap" + alternatives: + - "-z" + description: "Change negative quality values to zero." + info: null + direction: "input" +- name: "Filtering of processed reads" + description: "Filters are applied after above read modifications. Paired-end reads\ + \ are\nalways discarded pairwise (see also --pair_filter).\n" + arguments: + - type: "string" + name: "--minimum_length" + alternatives: + - "-m" + description: "Discard reads shorter than LEN. Default is 0.\nWhen trimming paired-end\ + \ reads, the minimum lengths for R1 and R2 can be specified separately by separating\ + \ them with a colon (:).\nIf the colon syntax is not used, the same minimum\ + \ length applies to both reads, as discussed above.\nAlso, one of the values\ + \ can be omitted to impose no restrictions.\nFor example, with -m 17:, the length\ + \ of R1 must be at least 17, but the length of R2 is ignored.\n" + info: null + example: + - "0" + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--maximum_length" + alternatives: + - "-M" + description: "Discard reads longer than LEN. Default: no limit.\nFor paired reads,\ + \ see the remark for --minimum_length\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--max_n" + description: "Discard reads with more than COUNT 'N' bases. If COUNT is\na number\ + \ between 0 and 1, it is interpreted as a fraction\nof the read length.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "long" + name: "--max_expected_errors" + alternatives: + - "--max_ee" + description: "Discard reads whose expected number of errors (computed\nfrom quality\ + \ values) exceeds ERRORS.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "long" + name: "--max_average_error_rate" + alternatives: + - "--max_aer" + description: "as --max_expected_errors (see above), but divided by\nlength to\ + \ account for reads of varying length.\n" + info: null + required: false + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--discard_trimmed" + alternatives: + - "--discard" + description: "Discard reads that contain an adapter. Use also -O to\navoid discarding\ + \ too many randomly matching reads.\n" + info: null + direction: "input" + - type: "boolean_true" + name: "--discard_untrimmed" + alternatives: + - "--trimmed_only" + description: "Discard reads that do not contain an adapter.\n" + info: null + direction: "input" + - type: "boolean_true" + name: "--discard_casava" + description: "Discard reads that did not pass CASAVA filtering (header\nhas :Y:).\n" + info: null + direction: "input" +- name: "Output parameters" + arguments: + - type: "string" + name: "--report" + description: "Which type of report to print: 'full' (default) or 'minimal'.\n" + info: null + example: + - "full" + required: false + choices: + - "full" + - "minimal" + direction: "input" + multiple: false + multiple_sep: ";" + - type: "boolean_true" + name: "--json" + description: "Write report in JSON format to this file.\n" + info: null + direction: "input" + - type: "file" + name: "--output" + description: "Glob pattern for matching the expected output files.\nShould include\ + \ `$output_dir`.\n" + info: null + example: + - "fastq/*_001.fast[a,q]" + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: true + multiple_sep: ";" + - type: "boolean_true" + name: "--fasta" + description: "Output FASTA to standard output even on FASTQ input.\n" + info: null + direction: "input" + - type: "boolean_true" + name: "--info_file" + description: "Write information about each read and its adapter matches\ninto\ + \ info.txt in the output directory.\nSee the documentation for the file format.\n" + info: null + direction: "input" +- name: "Debug" + arguments: + - type: "boolean_true" + name: "--debug" + description: "Print debug information" + info: null + direction: "input" +resources: +- type: "bash_script" + path: "script.sh" + is_executable: true +description: "Cutadapt removes adapter sequences from high-throughput sequencing reads.\n" +test_resources: +- type: "bash_script" + path: "test.sh" + is_executable: true +info: null +status: "enabled" +requirements: + commands: + - "ps" +keywords: +- "RNA-seq" +- "scRNA-seq" +- "high-throughput" +license: "MIT" +references: + doi: + - "10.14806/ej.17.1.200" +links: + repository: "https://github.com/marcelm/cutadapt" + homepage: "https://cutadapt.readthedocs.io" + documentation: "https://cutadapt.readthedocs.io" +runners: +- type: "executable" + id: "executable" + docker_setup_strategy: "ifneedbepullelsecachedbuild" +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "docker" + id: "docker" + image: "python:3.12" + target_registry: "images.viash-hub.com" + target_tag: "v0.1.0" + namespace_separator: "/" + setup: + - type: "python" + user: false + pip: + - "cutadapt" + upgrade: true + - type: "docker" + run: + - "cutadapt --version | sed 's/\\(.*\\)/cutadapt: \"\\1\"/' > /var/software_versions.txt\n" + entrypoint: [] + cmd: null +- type: "native" + id: "native" +build_info: + config: "src/cutadapt/config.vsh.yaml" + runner: "nextflow" + engine: "docker|native" + output: "target/nextflow/cutadapt" + executable: "target/nextflow/cutadapt/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724" + git_remote: "https://github.com/viash-hub/biobox" +package_config: + name: "biobox" + version: "v0.1.0" + description: "A collection of bioinformatics tools for working with sequence data.\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'v0.1.0'" + keywords: + - "bioinformatics" + - "modules" + - "sequencing" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/biobox" + issue_tracker: "https://github.com/viash-hub/biobox/issues" diff --git a/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/main.nf b/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/main.nf new file mode 100644 index 00000000..8956722f --- /dev/null +++ b/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/main.nf @@ -0,0 +1,4371 @@ +// cutadapt v0.1.0 +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "cutadapt", + "version" : "v0.1.0", + "argument_groups" : [ + { + "name" : "Specify Adapters for R1", + "arguments" : [ + { + "type" : "string", + "name" : "--adapter", + "alternatives" : [ + "-a" + ], + "description" : "Sequence of an adapter ligated to the 3' end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a '$' character is appended ('anchoring'), the\nadapter is only found if it is a suffix of the read.\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--front", + "alternatives" : [ + "-g" + ], + "description" : "Sequence of an adapter ligated to the 5' end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5' end are allowed. If\na '^' character is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of the read.\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--anywhere", + "alternatives" : [ + "-b" + ], + "description" : "Sequence of an adapter that may be ligated to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Specify Adapters using Fasta files for R1", + "arguments" : [ + { + "type" : "file", + "name" : "--adapter_fasta", + "description" : "Fasta file containing sequences of an adapter ligated to the 3' end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a '$' character is appended ('anchoring'), the\nadapter is only found if it is a suffix of the read.\n", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--front_fasta", + "description" : "Fasta file containing sequences of an adapter ligated to the 5' end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5' end are allowed. If\na '^' character is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of the read.\n", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--anywhere_fasta", + "description" : "Fasta file containing sequences of an adapter that may be ligated to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Specify Adapters for R2", + "arguments" : [ + { + "type" : "string", + "name" : "--adapter_r2", + "alternatives" : [ + "-A" + ], + "description" : "Sequence of an adapter ligated to the 3' end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a '$' character is appended ('anchoring'), the\nadapter is only found if it is a suffix of the read.\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--front_r2", + "alternatives" : [ + "-G" + ], + "description" : "Sequence of an adapter ligated to the 5' end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5' end are allowed. If\na '^' character is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of the read.\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--anywhere_r2", + "alternatives" : [ + "-B" + ], + "description" : "Sequence of an adapter that may be ligated to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Specify Adapters using Fasta files for R2", + "arguments" : [ + { + "type" : "file", + "name" : "--adapter_r2_fasta", + "description" : "Fasta file containing sequences of an adapter ligated to the 3' end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a '$' character is appended ('anchoring'), the\nadapter is only found if it is a suffix of the read.\n", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--front_r2_fasta", + "description" : "Fasta file containing sequences of an adapter ligated to the 5' end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5' end are allowed. If\na '^' character is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of the read.\n", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--anywhere_r2_fasta", + "description" : "Fasta file containing sequences of an adapter that may be ligated to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Paired-end options", + "arguments" : [ + { + "type" : "boolean_true", + "name" : "--pair_adapters", + "description" : "Treat adapters given with -a/-A etc. as pairs. Either both\nor none are removed from each read pair.\n", + "direction" : "input" + }, + { + "type" : "string", + "name" : "--pair_filter", + "description" : "Which of the reads in a paired-end read have to match the\nfiltering criterion in order for the pair to be filtered.\n", + "required" : false, + "choices" : [ + "any", + "both", + "first" + ], + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--interleaved", + "description" : "Read and/or write interleaved paired-end reads.\n", + "direction" : "input" + } + ] + }, + { + "name" : "Input parameters", + "arguments" : [ + { + "type" : "file", + "name" : "--input", + "description" : "Input fastq file for single-end reads or R1 for paired-end reads.\n", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--input_r2", + "description" : "Input fastq file for R2 in the case of paired-end reads.\n", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "double", + "name" : "--error_rate", + "alternatives" : [ + "-E", + "--errors" + ], + "description" : "Maximum allowed error rate (if 0 <= E < 1), or absolute\nnumber of errors for full-length adapter match (if E is an\ninteger >= 1). Error rate = no. of errors divided by\nlength of matching region. Default: 0.1 (10%).\n", + "example" : [ + 0.1 + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_false", + "name" : "--no_indels", + "description" : "Allow only mismatches in alignments.\n", + "direction" : "input" + }, + { + "type" : "integer", + "name" : "--times", + "alternatives" : [ + "-n" + ], + "description" : "Remove up to COUNT adapters from each read. Default: 1.\n", + "example" : [ + 1 + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--overlap", + "alternatives" : [ + "-O" + ], + "description" : "Require MINLENGTH overlap between read and adapter for an\nadapter to be found. The default is 3.\n", + "example" : [ + 3 + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--match_read_wildcards", + "description" : "Interpret IUPAC wildcards in reads.\n", + "direction" : "input" + }, + { + "type" : "boolean_false", + "name" : "--no_match_adapter_wildcards", + "description" : "Do not interpret IUPAC wildcards in adapters.\n", + "direction" : "input" + }, + { + "type" : "string", + "name" : "--action", + "description" : "What to do if a match was found. trim: trim adapter and\nup- or downstream sequence; retain: trim, but retain\nadapter; mask: replace with 'N' characters; lowercase:\nconvert to lowercase; none: leave unchanged.\nThe default is trim.\n", + "example" : [ + "trim" + ], + "required" : false, + "choices" : [ + "trim", + "retain", + "mask", + "lowercase", + "none" + ], + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--revcomp", + "alternatives" : [ + "--rc" + ], + "description" : "Check both the read and its reverse complement for adapter\nmatches. If match is on reverse-complemented version,\noutput that one.\n", + "direction" : "input" + } + ] + }, + { + "name" : "Read modifications", + "arguments" : [ + { + "type" : "integer", + "name" : "--cut", + "alternatives" : [ + "-u" + ], + "description" : "Remove LEN bases from each read (or R1 if paired; use --cut_r2\noption for R2). If LEN is positive, remove bases from the\nbeginning. If LEN is negative, remove bases from the end.\nCan be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--cut_r2", + "description" : "Remove LEN bases from each read (for R2). If LEN is positive, remove bases from the\nbeginning. If LEN is negative, remove bases from the end.\nCan be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n", + "required" : false, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--nextseq_trim", + "description" : "NextSeq-specific quality trimming (each read). Trims also\ndark cycles appearing as high-quality G bases.\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--quality_cutoff", + "alternatives" : [ + "-q" + ], + "description" : "Trim low-quality bases from 5' and/or 3' ends of each read\nbefore adapter removal. Applied to both reads if data is\npaired. If one value is given, only the 3' end is trimmed.\nIf two comma-separated cutoffs are given, the 5' end is\ntrimmed with the first cutoff, the 3' end with the second.\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--quality_cutoff_r2", + "alternatives" : [ + "-Q" + ], + "description" : "Quality-trimming cutoff for R2. Default: same as for R1\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--quality_base", + "description" : "Assume that quality values in FASTQ are encoded as\nascii(quality + N). This needs to be set to 64 for some\nold Illumina FASTQ files. The default is 33.\n", + "example" : [ + 33 + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--poly_a", + "description" : "Trim poly-A tails", + "direction" : "input" + }, + { + "type" : "integer", + "name" : "--length", + "alternatives" : [ + "-l" + ], + "description" : "Shorten reads to LENGTH. Positive values remove bases at\nthe end while negative ones remove bases at the beginning.\nThis and the following modifications are applied after\nadapter trimming.\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--trim_n", + "description" : "Trim N's on ends of reads.", + "direction" : "input" + }, + { + "type" : "string", + "name" : "--length_tag", + "description" : "Search for TAG followed by a decimal number in the\ndescription field of the read. Replace the decimal number\nwith the correct length of the trimmed read. For example,\nuse --length-tag 'length=' to correct fields like\n'length=123'.\n", + "example" : [ + "length=" + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--strip_suffix", + "description" : "Remove this suffix from read names if present. Can be\ngiven multiple times.\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--prefix", + "alternatives" : [ + "-x" + ], + "description" : "Add this prefix to read names. Use {name} to insert the\nname of the matching adapter.\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--suffix", + "alternatives" : [ + "-y" + ], + "description" : "Add this suffix to read names; can also include {name}\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--rename", + "description" : "Rename reads using TEMPLATE containing variables such as\n{id}, {adapter_name} etc. (see documentation)\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--zero_cap", + "alternatives" : [ + "-z" + ], + "description" : "Change negative quality values to zero.", + "direction" : "input" + } + ] + }, + { + "name" : "Filtering of processed reads", + "description" : "Filters are applied after above read modifications. Paired-end reads are\nalways discarded pairwise (see also --pair_filter).\n", + "arguments" : [ + { + "type" : "string", + "name" : "--minimum_length", + "alternatives" : [ + "-m" + ], + "description" : "Discard reads shorter than LEN. Default is 0.\nWhen trimming paired-end reads, the minimum lengths for R1 and R2 can be specified separately by separating them with a colon (:).\nIf the colon syntax is not used, the same minimum length applies to both reads, as discussed above.\nAlso, one of the values can be omitted to impose no restrictions.\nFor example, with -m 17:, the length of R1 must be at least 17, but the length of R2 is ignored.\n", + "example" : [ + "0" + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--maximum_length", + "alternatives" : [ + "-M" + ], + "description" : "Discard reads longer than LEN. Default: no limit.\nFor paired reads, see the remark for --minimum_length\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--max_n", + "description" : "Discard reads with more than COUNT 'N' bases. If COUNT is\na number between 0 and 1, it is interpreted as a fraction\nof the read length.\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "long", + "name" : "--max_expected_errors", + "alternatives" : [ + "--max_ee" + ], + "description" : "Discard reads whose expected number of errors (computed\nfrom quality values) exceeds ERRORS.\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "long", + "name" : "--max_average_error_rate", + "alternatives" : [ + "--max_aer" + ], + "description" : "as --max_expected_errors (see above), but divided by\nlength to account for reads of varying length.\n", + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--discard_trimmed", + "alternatives" : [ + "--discard" + ], + "description" : "Discard reads that contain an adapter. Use also -O to\navoid discarding too many randomly matching reads.\n", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--discard_untrimmed", + "alternatives" : [ + "--trimmed_only" + ], + "description" : "Discard reads that do not contain an adapter.\n", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--discard_casava", + "description" : "Discard reads that did not pass CASAVA filtering (header\nhas :Y:).\n", + "direction" : "input" + } + ] + }, + { + "name" : "Output parameters", + "arguments" : [ + { + "type" : "string", + "name" : "--report", + "description" : "Which type of report to print: 'full' (default) or 'minimal'.\n", + "example" : [ + "full" + ], + "required" : false, + "choices" : [ + "full", + "minimal" + ], + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--json", + "description" : "Write report in JSON format to this file.\n", + "direction" : "input" + }, + { + "type" : "file", + "name" : "--output", + "description" : "Glob pattern for matching the expected output files.\nShould include `$output_dir`.\n", + "example" : [ + "fastq/*_001.fast[a,q]" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "boolean_true", + "name" : "--fasta", + "description" : "Output FASTA to standard output even on FASTQ input.\n", + "direction" : "input" + }, + { + "type" : "boolean_true", + "name" : "--info_file", + "description" : "Write information about each read and its adapter matches\ninto info.txt in the output directory.\nSee the documentation for the file format.\n", + "direction" : "input" + } + ] + }, + { + "name" : "Debug", + "arguments" : [ + { + "type" : "boolean_true", + "name" : "--debug", + "description" : "Print debug information", + "direction" : "input" + } + ] + } + ], + "resources" : [ + { + "type" : "bash_script", + "path" : "script.sh", + "is_executable" : true + } + ], + "description" : "Cutadapt removes adapter sequences from high-throughput sequencing reads.\n", + "test_resources" : [ + { + "type" : "bash_script", + "path" : "test.sh", + "is_executable" : true + } + ], + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "keywords" : [ + "RNA-seq", + "scRNA-seq", + "high-throughput" + ], + "license" : "MIT", + "references" : { + "doi" : [ + "10.14806/ej.17.1.200" + ] + }, + "links" : { + "repository" : "https://github.com/marcelm/cutadapt", + "homepage" : "https://cutadapt.readthedocs.io", + "documentation" : "https://cutadapt.readthedocs.io" + }, + "runners" : [ + { + "type" : "executable", + "id" : "executable", + "docker_setup_strategy" : "ifneedbepullelsecachedbuild" + }, + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "docker", + "id" : "docker", + "image" : "python:3.12", + "target_registry" : "images.viash-hub.com", + "target_tag" : "v0.1.0", + "namespace_separator" : "/", + "setup" : [ + { + "type" : "python", + "user" : false, + "pip" : [ + "cutadapt" + ], + "upgrade" : true + }, + { + "type" : "docker", + "run" : [ + "cutadapt --version | sed 's/\\\\(.*\\\\)/cutadapt: \\"\\\\1\\"/' > /var/software_versions.txt\n" + ] + } + ] + }, + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/cutadapt/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "docker|native", + "output" : "target/nextflow/cutadapt", + "viash_version" : "0.9.0-RC6", + "git_commit" : "b84b29747d0635f2ac83ea63b496be9a9edb6724", + "git_remote" : "https://github.com/viash-hub/biobox" + }, + "package_config" : { + "name" : "biobox", + "version" : "v0.1.0", + "description" : "A collection of bioinformatics tools for working with sequence data.\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'v0.1.0'" + ], + "keywords" : [ + "bioinformatics", + "modules", + "sequencing" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/biobox", + "issue_tracker" : "https://github.com/viash-hub/biobox/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// inner workflow hook +def innerWorkflowFactory(args) { + def rawScript = '''set -e +tempscript=".viash_script.sh" +cat > "$tempscript" << VIASHMAIN +#!/bin/bash + +## VIASH START +# The following code has been auto-generated by Viash. +$( if [ ! -z ${VIASH_PAR_ADAPTER+x} ]; then echo "${VIASH_PAR_ADAPTER}" | sed "s#'#'\\"'\\"'#g;s#.*#par_adapter='&'#" ; else echo "# par_adapter="; fi ) +$( if [ ! -z ${VIASH_PAR_FRONT+x} ]; then echo "${VIASH_PAR_FRONT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_front='&'#" ; else echo "# par_front="; fi ) +$( if [ ! -z ${VIASH_PAR_ANYWHERE+x} ]; then echo "${VIASH_PAR_ANYWHERE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_anywhere='&'#" ; else echo "# par_anywhere="; fi ) +$( if [ ! -z ${VIASH_PAR_ADAPTER_FASTA+x} ]; then echo "${VIASH_PAR_ADAPTER_FASTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_adapter_fasta='&'#" ; else echo "# par_adapter_fasta="; fi ) +$( if [ ! -z ${VIASH_PAR_FRONT_FASTA+x} ]; then echo "${VIASH_PAR_FRONT_FASTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_front_fasta='&'#" ; else echo "# par_front_fasta="; fi ) +$( if [ ! -z ${VIASH_PAR_ANYWHERE_FASTA+x} ]; then echo "${VIASH_PAR_ANYWHERE_FASTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_anywhere_fasta='&'#" ; else echo "# par_anywhere_fasta="; fi ) +$( if [ ! -z ${VIASH_PAR_ADAPTER_R2+x} ]; then echo "${VIASH_PAR_ADAPTER_R2}" | sed "s#'#'\\"'\\"'#g;s#.*#par_adapter_r2='&'#" ; else echo "# par_adapter_r2="; fi ) +$( if [ ! -z ${VIASH_PAR_FRONT_R2+x} ]; then echo "${VIASH_PAR_FRONT_R2}" | sed "s#'#'\\"'\\"'#g;s#.*#par_front_r2='&'#" ; else echo "# par_front_r2="; fi ) +$( if [ ! -z ${VIASH_PAR_ANYWHERE_R2+x} ]; then echo "${VIASH_PAR_ANYWHERE_R2}" | sed "s#'#'\\"'\\"'#g;s#.*#par_anywhere_r2='&'#" ; else echo "# par_anywhere_r2="; fi ) +$( if [ ! -z ${VIASH_PAR_ADAPTER_R2_FASTA+x} ]; then echo "${VIASH_PAR_ADAPTER_R2_FASTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_adapter_r2_fasta='&'#" ; else echo "# par_adapter_r2_fasta="; fi ) +$( if [ ! -z ${VIASH_PAR_FRONT_R2_FASTA+x} ]; then echo "${VIASH_PAR_FRONT_R2_FASTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_front_r2_fasta='&'#" ; else echo "# par_front_r2_fasta="; fi ) +$( if [ ! -z ${VIASH_PAR_ANYWHERE_R2_FASTA+x} ]; then echo "${VIASH_PAR_ANYWHERE_R2_FASTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_anywhere_r2_fasta='&'#" ; else echo "# par_anywhere_r2_fasta="; fi ) +$( if [ ! -z ${VIASH_PAR_PAIR_ADAPTERS+x} ]; then echo "${VIASH_PAR_PAIR_ADAPTERS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_pair_adapters='&'#" ; else echo "# par_pair_adapters="; fi ) +$( if [ ! -z ${VIASH_PAR_PAIR_FILTER+x} ]; then echo "${VIASH_PAR_PAIR_FILTER}" | sed "s#'#'\\"'\\"'#g;s#.*#par_pair_filter='&'#" ; else echo "# par_pair_filter="; fi ) +$( if [ ! -z ${VIASH_PAR_INTERLEAVED+x} ]; then echo "${VIASH_PAR_INTERLEAVED}" | sed "s#'#'\\"'\\"'#g;s#.*#par_interleaved='&'#" ; else echo "# par_interleaved="; fi ) +$( if [ ! -z ${VIASH_PAR_INPUT+x} ]; then echo "${VIASH_PAR_INPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input='&'#" ; else echo "# par_input="; fi ) +$( if [ ! -z ${VIASH_PAR_INPUT_R2+x} ]; then echo "${VIASH_PAR_INPUT_R2}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input_r2='&'#" ; else echo "# par_input_r2="; fi ) +$( if [ ! -z ${VIASH_PAR_ERROR_RATE+x} ]; then echo "${VIASH_PAR_ERROR_RATE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_error_rate='&'#" ; else echo "# par_error_rate="; fi ) +$( if [ ! -z ${VIASH_PAR_NO_INDELS+x} ]; then echo "${VIASH_PAR_NO_INDELS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_no_indels='&'#" ; else echo "# par_no_indels="; fi ) +$( if [ ! -z ${VIASH_PAR_TIMES+x} ]; then echo "${VIASH_PAR_TIMES}" | sed "s#'#'\\"'\\"'#g;s#.*#par_times='&'#" ; else echo "# par_times="; fi ) +$( if [ ! -z ${VIASH_PAR_OVERLAP+x} ]; then echo "${VIASH_PAR_OVERLAP}" | sed "s#'#'\\"'\\"'#g;s#.*#par_overlap='&'#" ; else echo "# par_overlap="; fi ) +$( if [ ! -z ${VIASH_PAR_MATCH_READ_WILDCARDS+x} ]; then echo "${VIASH_PAR_MATCH_READ_WILDCARDS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_match_read_wildcards='&'#" ; else echo "# par_match_read_wildcards="; fi ) +$( if [ ! -z ${VIASH_PAR_NO_MATCH_ADAPTER_WILDCARDS+x} ]; then echo "${VIASH_PAR_NO_MATCH_ADAPTER_WILDCARDS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_no_match_adapter_wildcards='&'#" ; else echo "# par_no_match_adapter_wildcards="; fi ) +$( if [ ! -z ${VIASH_PAR_ACTION+x} ]; then echo "${VIASH_PAR_ACTION}" | sed "s#'#'\\"'\\"'#g;s#.*#par_action='&'#" ; else echo "# par_action="; fi ) +$( if [ ! -z ${VIASH_PAR_REVCOMP+x} ]; then echo "${VIASH_PAR_REVCOMP}" | sed "s#'#'\\"'\\"'#g;s#.*#par_revcomp='&'#" ; else echo "# par_revcomp="; fi ) +$( if [ ! -z ${VIASH_PAR_CUT+x} ]; then echo "${VIASH_PAR_CUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_cut='&'#" ; else echo "# par_cut="; fi ) +$( if [ ! -z ${VIASH_PAR_CUT_R2+x} ]; then echo "${VIASH_PAR_CUT_R2}" | sed "s#'#'\\"'\\"'#g;s#.*#par_cut_r2='&'#" ; else echo "# par_cut_r2="; fi ) +$( if [ ! -z ${VIASH_PAR_NEXTSEQ_TRIM+x} ]; then echo "${VIASH_PAR_NEXTSEQ_TRIM}" | sed "s#'#'\\"'\\"'#g;s#.*#par_nextseq_trim='&'#" ; else echo "# par_nextseq_trim="; fi ) +$( if [ ! -z ${VIASH_PAR_QUALITY_CUTOFF+x} ]; then echo "${VIASH_PAR_QUALITY_CUTOFF}" | sed "s#'#'\\"'\\"'#g;s#.*#par_quality_cutoff='&'#" ; else echo "# par_quality_cutoff="; fi ) +$( if [ ! -z ${VIASH_PAR_QUALITY_CUTOFF_R2+x} ]; then echo "${VIASH_PAR_QUALITY_CUTOFF_R2}" | sed "s#'#'\\"'\\"'#g;s#.*#par_quality_cutoff_r2='&'#" ; else echo "# par_quality_cutoff_r2="; fi ) +$( if [ ! -z ${VIASH_PAR_QUALITY_BASE+x} ]; then echo "${VIASH_PAR_QUALITY_BASE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_quality_base='&'#" ; else echo "# par_quality_base="; fi ) +$( if [ ! -z ${VIASH_PAR_POLY_A+x} ]; then echo "${VIASH_PAR_POLY_A}" | sed "s#'#'\\"'\\"'#g;s#.*#par_poly_a='&'#" ; else echo "# par_poly_a="; fi ) +$( if [ ! -z ${VIASH_PAR_LENGTH+x} ]; then echo "${VIASH_PAR_LENGTH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_length='&'#" ; else echo "# par_length="; fi ) +$( if [ ! -z ${VIASH_PAR_TRIM_N+x} ]; then echo "${VIASH_PAR_TRIM_N}" | sed "s#'#'\\"'\\"'#g;s#.*#par_trim_n='&'#" ; else echo "# par_trim_n="; fi ) +$( if [ ! -z ${VIASH_PAR_LENGTH_TAG+x} ]; then echo "${VIASH_PAR_LENGTH_TAG}" | sed "s#'#'\\"'\\"'#g;s#.*#par_length_tag='&'#" ; else echo "# par_length_tag="; fi ) +$( if [ ! -z ${VIASH_PAR_STRIP_SUFFIX+x} ]; then echo "${VIASH_PAR_STRIP_SUFFIX}" | sed "s#'#'\\"'\\"'#g;s#.*#par_strip_suffix='&'#" ; else echo "# par_strip_suffix="; fi ) +$( if [ ! -z ${VIASH_PAR_PREFIX+x} ]; then echo "${VIASH_PAR_PREFIX}" | sed "s#'#'\\"'\\"'#g;s#.*#par_prefix='&'#" ; else echo "# par_prefix="; fi ) +$( if [ ! -z ${VIASH_PAR_SUFFIX+x} ]; then echo "${VIASH_PAR_SUFFIX}" | sed "s#'#'\\"'\\"'#g;s#.*#par_suffix='&'#" ; else echo "# par_suffix="; fi ) +$( if [ ! -z ${VIASH_PAR_RENAME+x} ]; then echo "${VIASH_PAR_RENAME}" | sed "s#'#'\\"'\\"'#g;s#.*#par_rename='&'#" ; else echo "# par_rename="; fi ) +$( if [ ! -z ${VIASH_PAR_ZERO_CAP+x} ]; then echo "${VIASH_PAR_ZERO_CAP}" | sed "s#'#'\\"'\\"'#g;s#.*#par_zero_cap='&'#" ; else echo "# par_zero_cap="; fi ) +$( if [ ! -z ${VIASH_PAR_MINIMUM_LENGTH+x} ]; then echo "${VIASH_PAR_MINIMUM_LENGTH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_minimum_length='&'#" ; else echo "# par_minimum_length="; fi ) +$( if [ ! -z ${VIASH_PAR_MAXIMUM_LENGTH+x} ]; then echo "${VIASH_PAR_MAXIMUM_LENGTH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_maximum_length='&'#" ; else echo "# par_maximum_length="; fi ) +$( if [ ! -z ${VIASH_PAR_MAX_N+x} ]; then echo "${VIASH_PAR_MAX_N}" | sed "s#'#'\\"'\\"'#g;s#.*#par_max_n='&'#" ; else echo "# par_max_n="; fi ) +$( if [ ! -z ${VIASH_PAR_MAX_EXPECTED_ERRORS+x} ]; then echo "${VIASH_PAR_MAX_EXPECTED_ERRORS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_max_expected_errors='&'#" ; else echo "# par_max_expected_errors="; fi ) +$( if [ ! -z ${VIASH_PAR_MAX_AVERAGE_ERROR_RATE+x} ]; then echo "${VIASH_PAR_MAX_AVERAGE_ERROR_RATE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_max_average_error_rate='&'#" ; else echo "# par_max_average_error_rate="; fi ) +$( if [ ! -z ${VIASH_PAR_DISCARD_TRIMMED+x} ]; then echo "${VIASH_PAR_DISCARD_TRIMMED}" | sed "s#'#'\\"'\\"'#g;s#.*#par_discard_trimmed='&'#" ; else echo "# par_discard_trimmed="; fi ) +$( if [ ! -z ${VIASH_PAR_DISCARD_UNTRIMMED+x} ]; then echo "${VIASH_PAR_DISCARD_UNTRIMMED}" | sed "s#'#'\\"'\\"'#g;s#.*#par_discard_untrimmed='&'#" ; else echo "# par_discard_untrimmed="; fi ) +$( if [ ! -z ${VIASH_PAR_DISCARD_CASAVA+x} ]; then echo "${VIASH_PAR_DISCARD_CASAVA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_discard_casava='&'#" ; else echo "# par_discard_casava="; fi ) +$( if [ ! -z ${VIASH_PAR_REPORT+x} ]; then echo "${VIASH_PAR_REPORT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_report='&'#" ; else echo "# par_report="; fi ) +$( if [ ! -z ${VIASH_PAR_JSON+x} ]; then echo "${VIASH_PAR_JSON}" | sed "s#'#'\\"'\\"'#g;s#.*#par_json='&'#" ; else echo "# par_json="; fi ) +$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi ) +$( if [ ! -z ${VIASH_PAR_FASTA+x} ]; then echo "${VIASH_PAR_FASTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_fasta='&'#" ; else echo "# par_fasta="; fi ) +$( if [ ! -z ${VIASH_PAR_INFO_FILE+x} ]; then echo "${VIASH_PAR_INFO_FILE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_info_file='&'#" ; else echo "# par_info_file="; fi ) +$( if [ ! -z ${VIASH_PAR_DEBUG+x} ]; then echo "${VIASH_PAR_DEBUG}" | sed "s#'#'\\"'\\"'#g;s#.*#par_debug='&'#" ; else echo "# par_debug="; fi ) +$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi ) +$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi ) +$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi ) +$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi ) +$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi ) +$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi ) +$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi ) + +## VIASH END + +function debug { + [[ "\\$par_debug" == "true" ]] && echo "DEBUG: \\$@" +} + +output_dir=\\$(dirname \\$par_output) +[[ ! -d \\$output_dir ]] && mkdir -p \\$output_dir + +# Init +########################################################### + +echo ">> Paired-end data or not?" + +mode="" +if [[ -z \\$par_input_r2 ]]; then + mode="se" + echo " Single end" + input="\\$par_input" +else + echo " Paired end" + mode="pe" + input="\\$par_input \\$par_input_r2" +fi + +# Adapter arguments +# - paired and single-end +# - string and fasta +########################################################### + +function add_flags { + local arg=\\$1 + local flag=\\$2 + local prefix=\\$3 + [[ -z \\$prefix ]] && prefix="" + + # This function should not be called if the input is empty + # but check for it just in case + if [[ -z \\$arg ]]; then + return + fi + + local output="" + IFS=';' read -r -a array <<< "\\$arg" + for a in "\\${array[@]}"; do + output="\\$output \\$flag \\$prefix\\$a" + done + echo \\$output +} + +debug ">> Parsing arguments dealing with adapters" +adapter_args=\\$(echo \\\\ + \\${par_adapter:+\\$(add_flags "\\$par_adapter" "--adapter")} \\\\ + \\${par_adapter_fasta:+\\$(add_flags "\\$par_adapter_fasta" "--adapter" "file:")} \\\\ + \\${par_front:+\\$(add_flags "\\$par_front" "--front")} \\\\ + \\${par_front_fasta:+\\$(add_flags "\\$par_front_fasta" "--front" "file:")} \\\\ + \\${par_anywhere:+\\$(add_flags "\\$par_anywhere" "--anywhere")} \\\\ + \\${par_anywhere_fasta:+\\$(add_flags "\\$par_anywhere_fasta" "--anywhere" "file:")} \\\\ + \\${par_adapter_r2:+\\$(add_flags "\\$par_adapter_r2" "-A")} \\\\ + \\${par_adapter_fasta_r2:+\\$(add_flags "\\$par_adapter_fasta_r2" "-A" "file:")} \\\\ + \\${par_front_r2:+\\$(add_flags "\\$par_front_r2" "-G")} \\\\ + \\${par_front_fasta_r2:+\\$(add_flags "\\$par_front_fasta_r2" "-G" "file:")} \\\\ + \\${par_anywhere_r2:+\\$(add_flags "\\$par_anywhere_r2" "-B")} \\\\ + \\${par_anywhere_fasta_r2:+\\$(add_flags "\\$par_anywhere_fasta_r2" "-B" "file:")} \\\\ +) + +debug "Arguments to cutadapt:" +debug "\\$adapter_args" +debug + +# Paired-end options +########################################################### +echo ">> Parsing arguments for paired-end reads" +[[ "\\$par_pair_adapters" == "false" ]] && unset par_pair_adapters +[[ "\\$par_interleaved" == "false" ]] && unset par_interleaved + +paired_args=\\$(echo \\\\ + \\${par_pair_adapters:+--pair-adapters} \\\\ + \\${par_pair_filter:+--pair-filter "\\${par_pair_filter}"} \\\\ + \\${par_interleaved:+--interleaved} +) +debug "Arguments to cutadapt:" +debug \\$paired_args +debug + +# Input arguments +########################################################### +echo ">> Parsing input arguments" +[[ "\\$par_no_indels" == "true" ]] && unset par_no_indels +[[ "\\$par_match_read_wildcards" == "false" ]] && unset par_match_read_wildcards +[[ "\\$par_no_match_adapter_wildcards" == "true" ]] && unset par_no_match_adapter_wildcards +[[ "\\$par_revcomp" == "false" ]] && unset par_revcomp + +input_args=\\$(echo \\\\ + \\${par_error_rate:+--error-rate "\\${par_error_rate}"} \\\\ + \\${par_no_indels:+--no-indels} \\\\ + \\${par_times:+--times "\\${par_times}"} \\\\ + \\${par_overlap:+--overlap "\\${par_overlap}"} \\\\ + \\${par_match_read_wildcards:+--match-read-wildcards} \\\\ + \\${par_no_match_adapter_wildcards:+--no-match-adapter-wildcards} \\\\ + \\${par_action:+--action "\\${par_action}"} \\\\ + \\${par_revcomp:+--revcomp} \\\\ +) +debug "Arguments to cutadapt:" +debug \\$input_args +debug + +# Read modifications +########################################################### +echo ">> Parsing read modification arguments" +[[ "\\$par_poly_a" == "false" ]] && unset par_poly_a +[[ "\\$par_trim_n" == "false" ]] && unset par_trim_n +[[ "\\$par_zero_cap" == "false" ]] && unset par_zero_cap + +mod_args=\\$(echo \\\\ + \\${par_cut:+--cut "\\${par_cut}"} \\\\ + \\${par_cut_r2:+--cut_r2 "\\${par_cut_r2}"} \\\\ + \\${par_nextseq_trim:+--nextseq-trim "\\${par_nextseq_trim}"} \\\\ + \\${par_quality_cutoff:+--quality-cutoff "\\${par_quality_cutoff}"} \\\\ + \\${par_quality_cutoff_r2:+--quality-cutoff_r2 "\\${par_quality_cutoff_r2}"} \\\\ + \\${par_quality_base:+--quality-base "\\${par_quality_base}"} \\\\ + \\${par_poly_a:+--poly-a} \\\\ + \\${par_length:+--length "\\${par_length}"} \\\\ + \\${par_trim_n:+--trim-n} \\\\ + \\${par_length_tag:+--length-tag "\\${par_length_tag}"} \\\\ + \\${par_strip_suffix:+--strip-suffix "\\${par_strip_suffix}"} \\\\ + \\${par_prefix:+--prefix "\\${par_prefix}"} \\\\ + \\${par_suffix:+--suffix "\\${par_suffix}"} \\\\ + \\${par_rename:+--rename "\\${par_rename}"} \\\\ + \\${par_zero_cap:+--zero-cap} \\\\ +) +debug "Arguments to cutadapt:" +debug \\$mod_args +debug + +# Filtering of processed reads arguments +########################################################### +echo ">> Filtering of processed reads arguments" +[[ "\\$par_discard_trimmed" == "false" ]] && unset par_discard_trimmed +[[ "\\$par_discard_untrimmed" == "false" ]] && unset par_discard_untrimmed +[[ "\\$par_discard_casava" == "false" ]] && unset par_discard_casava + +# Parse and transform the minimum and maximum length arguments +[[ -z \\$par_minimum_length ]] + +filter_args=\\$(echo \\\\ + \\${par_minimum_length:+--minimum-length "\\${par_minimum_length}"} \\\\ + \\${par_maximum_length:+--maximum-length "\\${par_maximum_length}"} \\\\ + \\${par_max_n:+--max-n "\\${par_max_n}"} \\\\ + \\${par_max_expected_errors:+--max-expected-errors "\\${par_max_expected_errors}"} \\\\ + \\${par_max_average_error_rate:+--max-average-error-rate "\\${par_max_average_error_rate}"} \\\\ + \\${par_discard_trimmed:+--discard-trimmed} \\\\ + \\${par_discard_untrimmed:+--discard-untrimmed} \\\\ + \\${par_discard_casava:+--discard-casava} \\\\ +) +debug "Arguments to cutadapt:" +debug \\$filter_args +debug + +# Optional output arguments +########################################################### +echo ">> Optional arguments" +[[ "\\$par_json" == "false" ]] && unset par_json +[[ "\\$par_fasta" == "false" ]] && unset par_fasta +[[ "\\$par_info_file" == "false" ]] && unset par_info_file + +optional_output_args=\\$(echo \\\\ + \\${par_report:+--report "\\${par_report}"} \\\\ + \\${par_json:+--json "report.json"} \\\\ + \\${par_fasta:+--fasta} \\\\ + \\${par_info_file:+--info-file "info.txt"} \\\\ +) + +debug "Arguments to cutadapt:" +debug \\$optional_output_args +debug + +# Output arguments +# We write the output to a directory rather than +# individual files. +########################################################### + +if [[ -z \\$par_fasta ]]; then + ext="fastq" +else + ext="fasta" +fi + +if [ \\$mode = "se" ]; then + output_args=\\$(echo \\\\ + --output "\\$output_dir/{name}_001.\\$ext" \\\\ + ) +else + output_args=\\$(echo \\\\ + --output "\\$output_dir/{name}_R1_001.\\$ext" \\\\ + --paired-output "\\$output_dir/{name}_R2_001.\\$ext" \\\\ + ) +fi + +debug "Arguments to cutadapt:" +debug \\$output_args +debug + +# Full CLI +# Set the --cores argument to 0 unless meta_cpus is set +########################################################### +echo ">> Running cutadapt" +par_cpus=0 +[[ ! -z \\$meta_cpus ]] && par_cpus=\\$meta_cpus + +cli=\\$(echo \\\\ + \\$input \\\\ + \\$adapter_args \\\\ + \\$paired_args \\\\ + \\$input_args \\\\ + \\$mod_args \\\\ + \\$filter_args \\\\ + \\$optional_output_args \\\\ + \\$output_args \\\\ + --cores \\$par_cpus +) + +debug ">> Full CLI to be run:" +debug cutadapt \\$cli | sed -e 's/--/\\\\r\\\\n --/g' +debug + +cutadapt \\$cli +VIASHMAIN +bash "$tempscript" +''' + + return vdsl3WorkflowFactory(args, meta, rawScript) +} + + + +/** + * Generate a workflow for VDSL3 modules. + * + * This function is called by the workflowFactory() function. + * + * Input channel: [id, input_map] + * Output channel: [id, output_map] + * + * Internally, this workflow will convert the input channel + * to a format which the Nextflow module will be able to handle. + */ +def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) { + def key = args["key"] + def processObj = null + + workflow processWf { + take: input_ + main: + + if (processObj == null) { + processObj = _vdsl3ProcessFactory(args, meta, rawScript) + } + + output_ = input_ + | map { tuple -> + def id = tuple[0] + def data_ = tuple[1] + + if (workflow.stubRun) { + // add id if missing + data_ = [id: 'stub'] + data_ + } + + // process input files separately + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { par -> + def val = data_.containsKey(par.plainName) ? data_[par.plainName] : [] + def inputFiles = [] + if (val == null) { + inputFiles = [] + } else if (val instanceof List) { + inputFiles = val + } else if (val instanceof Path) { + inputFiles = [ val ] + } else { + inputFiles = [] + } + if (!workflow.stubRun) { + // throw error when an input file doesn't exist + inputFiles.each{ file -> + assert file.exists() : + "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" + + " Required input file does not exist.\n" + + " Path: '$file'.\n" + + " Expected input file to exist" + } + } + inputFiles + } + + // remove input files + def argsExclInputFiles = meta.config.allArguments + .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) } + .collectEntries { par -> + def parName = par.plainName + def val = data_[parName] + if (par.multiple && val instanceof Collection) { + val = val.join(par.multiple_sep) + } + if (par.direction == "output" && par.type == "file") { + val = val.replaceAll('\\$id', id).replaceAll('\\$key', key) + } + [parName, val] + } + + [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ] + } + | processObj + | map { output -> + def outputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .indexed() + .collectEntries{ index, par -> + def out = output[index + 1] + // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678) + if (!out instanceof List || out.size() <= 1) { + if (par.multiple) { + out = [] + } else { + assert !par.required : + "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" + + " Required output file is missing" + out = null + } + } else if (out.size() == 2 && !par.multiple) { + out = out[1] + } else { + out = out.drop(1) + } + [ par.plainName, out ] + } + + // drop null outputs + outputFiles.removeAll{it.value == null} + + [ output[0], outputFiles ] + } + emit: output_ + } + + return processWf +} + +// depends on: session? +def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) { + // autodetect process key + def wfKey = workflowArgs["key"] + def procKeyPrefix = "${wfKey}_process" + def scriptMeta = nextflow.script.ScriptMeta.current() + def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)} + def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()} + def newNumber = (numbers + [-1]).max() + 1 + + def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber" + + if (newNumber > 0) { + log.warn "Key for module '${wfKey}' is duplicated.\n", + "If you run a component multiple times in the same workflow,\n" + + "it's recommended you set a unique key for every call,\n" + + "for example: ${wfKey}.run(key: \"foo\")." + } + + // subset directives and convert to list of tuples + def drctv = workflowArgs.directives + + // TODO: unit test the two commands below + // convert publish array into tags + def valueToStr = { val -> + // ignore closures + if (val instanceof CharSequence) { + if (!val.matches('^[{].*[}]$')) { + '"' + val + '"' + } else { + val + } + } else if (val instanceof List) { + "[" + val.collect{valueToStr(it)}.join(", ") + "]" + } else if (val instanceof Map) { + "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]" + } else { + val.inspect() + } + } + + // multiple entries allowed: label, publishdir + def drctvStrs = drctv.collect { key, value -> + if (key in ["label", "publishDir"]) { + value.collect{ val -> + if (val instanceof Map) { + "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else if (val == null) { + "" + } else { + "\n$key " + valueToStr(val) + } + }.join() + } else if (value instanceof Map) { + "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else { + "\n$key " + valueToStr(value) + } + }.join() + + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' } + .join() + + def outputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + // insert dummy into every output (see nextflow-io/nextflow#2678) + if (!par.multiple) { + ', path{[".exitcode", args.' + par.plainName + ']}' + } else { + ', path{[".exitcode"] + args.' + par.plainName + '}' + } + } + .join() + + // TODO: move this functionality somewhere else? + if (workflowArgs.auto.transcript) { + outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}' + } else { + outputPaths = outputPaths + ', path{[".exitcode"]}' + } + + // create dirs for output files (based on BashWrapper.createParentFiles) + def createParentStr = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" && it.create_parent } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"] : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // construct inputFileExports + def inputFileExports = meta.config.allArguments + .findAll { it.type == "file" && it.direction.toLowerCase() == "input" } + .collect { par -> + def viash_par_contents = "(viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName})" + "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}=\\\"\" + ${viash_par_contents} + \"\\\"\"}" + } + + // NOTE: if using docker, use /tmp instead of tmpDir! + def tmpDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('VIASH_TMPDIR') ?: + System.getenv('VIASH_TEMPDIR') ?: + System.getenv('VIASH_TMP') ?: + System.getenv('TEMP') ?: + System.getenv('TMPDIR') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMP') ?: + '/tmp' + ).toAbsolutePath() + + // construct stub + def stub = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // escape script + def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"') + + // publishdir assert + def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? + """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n Example: --publish_dir './output/'" """ : + "" + + // generate process string + def procStr = + """nextflow.enable.dsl=2 + | + |process $procKey {$drctvStrs + |input: + | tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources") + |output: + | tuple val("\$id")$outputPaths, optional: true + |stub: + |\"\"\" + |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; } + |$stub + |\"\"\" + |script:$assertStr + |def escapeText = { s -> s.toString().replaceAll('([`"])', '\\\\\\\\\$1') } + |def parInject = args + | .findAll{key, value -> value != null} + | .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}=\\\"\${escapeText(value)}\\\""} + | .join("\\n") + |\"\"\" + |# meta exports + |export VIASH_META_RESOURCES_DIR="\${resourcesDir}" + |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}" + |export VIASH_META_NAME="${meta.config.name}" + |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME" + |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml" + |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" } + |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" } + |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then + | export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 )) + | export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 )) + | export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 )) + | export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 )) + | export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 )) + | export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 )) + | export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 )) + | export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 )) + | export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 )) + | export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 )) + |fi + | + |# meta synonyms + |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR" + |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR" + | + |# create output dirs if need be + |function mkdir_parent { + | for file in "\\\$@"; do + | mkdir -p "\\\$(dirname "\\\$file")" + | done + |} + |$createParentStr + | + |# argument exports${inputFileExports.join()} + |\$parInject + | + |# process script + |${escapedScript} + |\"\"\" + |} + |""".stripMargin() + + // TODO: print on debug + // if (workflowArgs.debug == true) { + // println("######################\n$procStr\n######################") + // } + + // write process to temp file + def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf") + addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) } + tempFile.text = procStr + + // create process from temp file + def binding = new nextflow.script.ScriptBinding([:]) + def session = nextflow.Nextflow.getSession() + def parser = new nextflow.script.ScriptParser(session) + .setModule(true) + .setBinding(binding) + def moduleScript = parser.runScript(tempFile) + .getScript() + + // register module in meta + def module = new nextflow.script.IncludeDef.Module(name: procKey) + scriptMeta.addModule(moduleScript, module.name, module.alias) + + // retrieve and return process from meta + return scriptMeta.getProcess(procKey) +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "container" : { + "registry" : "images.viash-hub.com", + "image" : "vsh/biobox/cutadapt", + "tag" : "v0.1.0" + }, + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/nextflow.config b/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/nextflow.config new file mode 100644 index 00000000..0b8b606f --- /dev/null +++ b/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/nextflow.config @@ -0,0 +1,125 @@ +manifest { + name = 'cutadapt' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'v0.1.0' + description = 'Cutadapt removes adapter sequences from high-throughput sequencing reads.\n' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/nextflow_schema.json b/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/nextflow_schema.json new file mode 100644 index 00000000..2438aca0 --- /dev/null +++ b/target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/nextflow_schema.json @@ -0,0 +1,749 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "cutadapt", +"description": "Cutadapt removes adapter sequences from high-throughput sequencing reads.\n", +"type": "object", +"definitions": { + + + + "specify adapters for r1" : { + "title": "Specify Adapters for R1", + "type": "object", + "description": "No description", + "properties": { + + + "adapter": { + "type": + "string", + "description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)", + "help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n" + + } + + + , + "front": { + "type": + "string", + "description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)", + "help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n" + + } + + + , + "anywhere": { + "type": + "string", + "description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)", + "help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n" + + } + + +} +}, + + + "specify adapters using fasta files for r1" : { + "title": "Specify Adapters using Fasta files for R1", + "type": "object", + "description": "No description", + "properties": { + + + "adapter_fasta": { + "type": + "string", + "description": "Type: List of `file`, multiple_sep: `\":\"`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)", + "help_text": "Type: List of `file`, multiple_sep: `\":\"`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n" + + } + + + , + "front_fasta": { + "type": + "string", + "description": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)", + "help_text": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n" + + } + + + , + "anywhere_fasta": { + "type": + "string", + "description": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)", + "help_text": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n" + + } + + +} +}, + + + "specify adapters for r2" : { + "title": "Specify Adapters for R2", + "type": "object", + "description": "No description", + "properties": { + + + "adapter_r2": { + "type": + "string", + "description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)", + "help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n" + + } + + + , + "front_r2": { + "type": + "string", + "description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)", + "help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n" + + } + + + , + "anywhere_r2": { + "type": + "string", + "description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)", + "help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n" + + } + + +} +}, + + + "specify adapters using fasta files for r2" : { + "title": "Specify Adapters using Fasta files for R2", + "type": "object", + "description": "No description", + "properties": { + + + "adapter_r2_fasta": { + "type": + "string", + "description": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)", + "help_text": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n" + + } + + + , + "front_r2_fasta": { + "type": + "string", + "description": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)", + "help_text": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n" + + } + + + , + "anywhere_r2_fasta": { + "type": + "string", + "description": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)", + "help_text": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n" + + } + + +} +}, + + + "paired-end options" : { + "title": "Paired-end options", + "type": "object", + "description": "No description", + "properties": { + + + "pair_adapters": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Treat adapters given with -a/-A etc", + "help_text": "Type: `boolean_true`, default: `false`. Treat adapters given with -a/-A etc. as pairs. Either both\nor none are removed from each read pair.\n" + , + "default": "False" + } + + + , + "pair_filter": { + "type": + "string", + "description": "Type: `string`, choices: ``any`, `both`, `first``. Which of the reads in a paired-end read have to match the\nfiltering criterion in order for the pair to be filtered", + "help_text": "Type: `string`, choices: ``any`, `both`, `first``. Which of the reads in a paired-end read have to match the\nfiltering criterion in order for the pair to be filtered.\n", + "enum": ["any", "both", "first"] + + + } + + + , + "interleaved": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Read and/or write interleaved paired-end reads", + "help_text": "Type: `boolean_true`, default: `false`. Read and/or write interleaved paired-end reads.\n" + , + "default": "False" + } + + +} +}, + + + "input parameters" : { + "title": "Input parameters", + "type": "object", + "description": "No description", + "properties": { + + + "input": { + "type": + "string", + "description": "Type: `file`, required. Input fastq file for single-end reads or R1 for paired-end reads", + "help_text": "Type: `file`, required. Input fastq file for single-end reads or R1 for paired-end reads.\n" + + } + + + , + "input_r2": { + "type": + "string", + "description": "Type: `file`. Input fastq file for R2 in the case of paired-end reads", + "help_text": "Type: `file`. Input fastq file for R2 in the case of paired-end reads.\n" + + } + + + , + "error_rate": { + "type": + "number", + "description": "Type: `double`, example: `0.1`. Maximum allowed error rate (if 0 \u003c= E \u003c 1), or absolute\nnumber of errors for full-length adapter match (if E is an\ninteger \u003e= 1)", + "help_text": "Type: `double`, example: `0.1`. Maximum allowed error rate (if 0 \u003c= E \u003c 1), or absolute\nnumber of errors for full-length adapter match (if E is an\ninteger \u003e= 1). Error rate = no. of errors divided by\nlength of matching region. Default: 0.1 (10%).\n" + + } + + + , + "no_indels": { + "type": + "boolean", + "description": "Type: `boolean_false`, default: `true`. Allow only mismatches in alignments", + "help_text": "Type: `boolean_false`, default: `true`. Allow only mismatches in alignments.\n" + , + "default": "True" + } + + + , + "times": { + "type": + "integer", + "description": "Type: `integer`, example: `1`. Remove up to COUNT adapters from each read", + "help_text": "Type: `integer`, example: `1`. Remove up to COUNT adapters from each read. Default: 1.\n" + + } + + + , + "overlap": { + "type": + "integer", + "description": "Type: `integer`, example: `3`. Require MINLENGTH overlap between read and adapter for an\nadapter to be found", + "help_text": "Type: `integer`, example: `3`. Require MINLENGTH overlap between read and adapter for an\nadapter to be found. The default is 3.\n" + + } + + + , + "match_read_wildcards": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Interpret IUPAC wildcards in reads", + "help_text": "Type: `boolean_true`, default: `false`. Interpret IUPAC wildcards in reads.\n" + , + "default": "False" + } + + + , + "no_match_adapter_wildcards": { + "type": + "boolean", + "description": "Type: `boolean_false`, default: `true`. Do not interpret IUPAC wildcards in adapters", + "help_text": "Type: `boolean_false`, default: `true`. Do not interpret IUPAC wildcards in adapters.\n" + , + "default": "True" + } + + + , + "action": { + "type": + "string", + "description": "Type: `string`, example: `trim`, choices: ``trim`, `retain`, `mask`, `lowercase`, `none``. What to do if a match was found", + "help_text": "Type: `string`, example: `trim`, choices: ``trim`, `retain`, `mask`, `lowercase`, `none``. What to do if a match was found. trim: trim adapter and\nup- or downstream sequence; retain: trim, but retain\nadapter; mask: replace with \u0027N\u0027 characters; lowercase:\nconvert to lowercase; none: leave unchanged.\nThe default is trim.\n", + "enum": ["trim", "retain", "mask", "lowercase", "none"] + + + } + + + , + "revcomp": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Check both the read and its reverse complement for adapter\nmatches", + "help_text": "Type: `boolean_true`, default: `false`. Check both the read and its reverse complement for adapter\nmatches. If match is on reverse-complemented version,\noutput that one.\n" + , + "default": "False" + } + + +} +}, + + + "read modifications" : { + "title": "Read modifications", + "type": "object", + "description": "No description", + "properties": { + + + "cut": { + "type": + "string", + "description": "Type: List of `integer`, multiple_sep: `\":\"`. Remove LEN bases from each read (or R1 if paired; use --cut_r2\noption for R2)", + "help_text": "Type: List of `integer`, multiple_sep: `\":\"`. Remove LEN bases from each read (or R1 if paired; use --cut_r2\noption for R2). If LEN is positive, remove bases from the\nbeginning. If LEN is negative, remove bases from the end.\nCan be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n" + + } + + + , + "cut_r2": { + "type": + "string", + "description": "Type: List of `integer`, multiple_sep: `\":\"`. Remove LEN bases from each read (for R2)", + "help_text": "Type: List of `integer`, multiple_sep: `\":\"`. Remove LEN bases from each read (for R2). If LEN is positive, remove bases from the\nbeginning. If LEN is negative, remove bases from the end.\nCan be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n" + + } + + + , + "nextseq_trim": { + "type": + "string", + "description": "Type: `string`. NextSeq-specific quality trimming (each read)", + "help_text": "Type: `string`. NextSeq-specific quality trimming (each read). Trims also\ndark cycles appearing as high-quality G bases.\n" + + } + + + , + "quality_cutoff": { + "type": + "string", + "description": "Type: `string`. Trim low-quality bases from 5\u0027 and/or 3\u0027 ends of each read\nbefore adapter removal", + "help_text": "Type: `string`. Trim low-quality bases from 5\u0027 and/or 3\u0027 ends of each read\nbefore adapter removal. Applied to both reads if data is\npaired. If one value is given, only the 3\u0027 end is trimmed.\nIf two comma-separated cutoffs are given, the 5\u0027 end is\ntrimmed with the first cutoff, the 3\u0027 end with the second.\n" + + } + + + , + "quality_cutoff_r2": { + "type": + "string", + "description": "Type: `string`. Quality-trimming cutoff for R2", + "help_text": "Type: `string`. Quality-trimming cutoff for R2. Default: same as for R1\n" + + } + + + , + "quality_base": { + "type": + "integer", + "description": "Type: `integer`, example: `33`. Assume that quality values in FASTQ are encoded as\nascii(quality + N)", + "help_text": "Type: `integer`, example: `33`. Assume that quality values in FASTQ are encoded as\nascii(quality + N). This needs to be set to 64 for some\nold Illumina FASTQ files. The default is 33.\n" + + } + + + , + "poly_a": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Trim poly-A tails", + "help_text": "Type: `boolean_true`, default: `false`. Trim poly-A tails" + , + "default": "False" + } + + + , + "length": { + "type": + "integer", + "description": "Type: `integer`. Shorten reads to LENGTH", + "help_text": "Type: `integer`. Shorten reads to LENGTH. Positive values remove bases at\nthe end while negative ones remove bases at the beginning.\nThis and the following modifications are applied after\nadapter trimming.\n" + + } + + + , + "trim_n": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Trim N\u0027s on ends of reads", + "help_text": "Type: `boolean_true`, default: `false`. Trim N\u0027s on ends of reads." + , + "default": "False" + } + + + , + "length_tag": { + "type": + "string", + "description": "Type: `string`, example: `length=`. Search for TAG followed by a decimal number in the\ndescription field of the read", + "help_text": "Type: `string`, example: `length=`. Search for TAG followed by a decimal number in the\ndescription field of the read. Replace the decimal number\nwith the correct length of the trimmed read. For example,\nuse --length-tag \u0027length=\u0027 to correct fields like\n\u0027length=123\u0027.\n" + + } + + + , + "strip_suffix": { + "type": + "string", + "description": "Type: `string`. Remove this suffix from read names if present", + "help_text": "Type: `string`. Remove this suffix from read names if present. Can be\ngiven multiple times.\n" + + } + + + , + "prefix": { + "type": + "string", + "description": "Type: `string`. Add this prefix to read names", + "help_text": "Type: `string`. Add this prefix to read names. Use {name} to insert the\nname of the matching adapter.\n" + + } + + + , + "suffix": { + "type": + "string", + "description": "Type: `string`. Add this suffix to read names; can also include {name}\n", + "help_text": "Type: `string`. Add this suffix to read names; can also include {name}\n" + + } + + + , + "rename": { + "type": + "string", + "description": "Type: `string`. Rename reads using TEMPLATE containing variables such as\n{id}, {adapter_name} etc", + "help_text": "Type: `string`. Rename reads using TEMPLATE containing variables such as\n{id}, {adapter_name} etc. (see documentation)\n" + + } + + + , + "zero_cap": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Change negative quality values to zero", + "help_text": "Type: `boolean_true`, default: `false`. Change negative quality values to zero." + , + "default": "False" + } + + +} +}, + + + "filtering of processed reads" : { + "title": "Filtering of processed reads", + "type": "object", + "description": "Filters are applied after above read modifications. Paired-end reads are\nalways discarded pairwise (see also --pair_filter).\n", + "properties": { + + + "minimum_length": { + "type": + "string", + "description": "Type: `string`, example: `0`. Discard reads shorter than LEN", + "help_text": "Type: `string`, example: `0`. Discard reads shorter than LEN. Default is 0.\nWhen trimming paired-end reads, the minimum lengths for R1 and R2 can be specified separately by separating them with a colon (:).\nIf the colon syntax is not used, the same minimum length applies to both reads, as discussed above.\nAlso, one of the values can be omitted to impose no restrictions.\nFor example, with -m 17:, the length of R1 must be at least 17, but the length of R2 is ignored.\n" + + } + + + , + "maximum_length": { + "type": + "string", + "description": "Type: `string`. Discard reads longer than LEN", + "help_text": "Type: `string`. Discard reads longer than LEN. Default: no limit.\nFor paired reads, see the remark for --minimum_length\n" + + } + + + , + "max_n": { + "type": + "string", + "description": "Type: `string`. Discard reads with more than COUNT \u0027N\u0027 bases", + "help_text": "Type: `string`. Discard reads with more than COUNT \u0027N\u0027 bases. If COUNT is\na number between 0 and 1, it is interpreted as a fraction\nof the read length.\n" + + } + + + , + "max_expected_errors": { + "type": + "string", + "description": "Type: `long`. Discard reads whose expected number of errors (computed\nfrom quality values) exceeds ERRORS", + "help_text": "Type: `long`. Discard reads whose expected number of errors (computed\nfrom quality values) exceeds ERRORS.\n" + + } + + + , + "max_average_error_rate": { + "type": + "string", + "description": "Type: `long`. as --max_expected_errors (see above), but divided by\nlength to account for reads of varying length", + "help_text": "Type: `long`. as --max_expected_errors (see above), but divided by\nlength to account for reads of varying length.\n" + + } + + + , + "discard_trimmed": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Discard reads that contain an adapter", + "help_text": "Type: `boolean_true`, default: `false`. Discard reads that contain an adapter. Use also -O to\navoid discarding too many randomly matching reads.\n" + , + "default": "False" + } + + + , + "discard_untrimmed": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Discard reads that do not contain an adapter", + "help_text": "Type: `boolean_true`, default: `false`. Discard reads that do not contain an adapter.\n" + , + "default": "False" + } + + + , + "discard_casava": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Discard reads that did not pass CASAVA filtering (header\nhas :Y:)", + "help_text": "Type: `boolean_true`, default: `false`. Discard reads that did not pass CASAVA filtering (header\nhas :Y:).\n" + , + "default": "False" + } + + +} +}, + + + "output parameters" : { + "title": "Output parameters", + "type": "object", + "description": "No description", + "properties": { + + + "report": { + "type": + "string", + "description": "Type: `string`, example: `full`, choices: ``full`, `minimal``. Which type of report to print: \u0027full\u0027 (default) or \u0027minimal\u0027", + "help_text": "Type: `string`, example: `full`, choices: ``full`, `minimal``. Which type of report to print: \u0027full\u0027 (default) or \u0027minimal\u0027.\n", + "enum": ["full", "minimal"] + + + } + + + , + "json": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Write report in JSON format to this file", + "help_text": "Type: `boolean_true`, default: `false`. Write report in JSON format to this file.\n" + , + "default": "False" + } + + + , + "output": { + "type": + "string", + "description": "Type: List of `file`, required, default: `$id.$key.output_*.fast[a,q]`, example: `fastq/*_001.fast[a,q]`, multiple_sep: `\":\"`. Glob pattern for matching the expected output files", + "help_text": "Type: List of `file`, required, default: `$id.$key.output_*.fast[a,q]`, example: `fastq/*_001.fast[a,q]`, multiple_sep: `\":\"`. Glob pattern for matching the expected output files.\nShould include `$output_dir`.\n" + , + "default": "$id.$key.output_*.fast[a,q]" + } + + + , + "fasta": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Output FASTA to standard output even on FASTQ input", + "help_text": "Type: `boolean_true`, default: `false`. Output FASTA to standard output even on FASTQ input.\n" + , + "default": "False" + } + + + , + "info_file": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Write information about each read and its adapter matches\ninto info", + "help_text": "Type: `boolean_true`, default: `false`. Write information about each read and its adapter matches\ninto info.txt in the output directory.\nSee the documentation for the file format.\n" + , + "default": "False" + } + + +} +}, + + + "debug" : { + "title": "Debug", + "type": "object", + "description": "No description", + "properties": { + + + "debug": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Print debug information", + "help_text": "Type: `boolean_true`, default: `false`. Print debug information" + , + "default": "False" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/specify adapters for r1" + }, + + { + "$ref": "#/definitions/specify adapters using fasta files for r1" + }, + + { + "$ref": "#/definitions/specify adapters for r2" + }, + + { + "$ref": "#/definitions/specify adapters using fasta files for r2" + }, + + { + "$ref": "#/definitions/paired-end options" + }, + + { + "$ref": "#/definitions/input parameters" + }, + + { + "$ref": "#/definitions/read modifications" + }, + + { + "$ref": "#/definitions/filtering of processed reads" + }, + + { + "$ref": "#/definitions/output parameters" + }, + + { + "$ref": "#/definitions/debug" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/.config.vsh.yaml b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/.config.vsh.yaml new file mode 100644 index 00000000..11db8f52 --- /dev/null +++ b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/.config.vsh.yaml @@ -0,0 +1,197 @@ +name: "concat_text" +version: "concat_text" +authors: +- name: "Toni Verbeiren" + roles: + - "author" + - "maintainer" + info: + links: + github: "tverbeiren" + linkedin: "verbeiren" + organizations: + - name: "Data Intuitive" + href: "https://www.data-intuitive.com" + role: "Data Scientist and CEO" +- name: "Dries Schaumont" + roles: + - "reviewer" + info: + links: + email: "dries@data-intuitive.com" + github: "DriesSchaumont" + orcid: "0000-0002-4389-0440" + linkedin: "dries-schaumont" + organizations: + - name: "Data Intuitive" + href: "https://www.data-intuitive.com" + role: "Data Scientist" +argument_groups: +- name: "Input arguments" + arguments: + - type: "file" + name: "--input" + description: "A list of (gzipped) text files." + info: null + example: + - "input?.txt.gz" + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: true + multiple_sep: ";" +- name: "Output arguments" + arguments: + - type: "boolean_true" + name: "--gzip_output" + description: "Should the output be zipped?" + info: null + direction: "input" + - type: "file" + name: "--output" + description: "File to write the output to, optionally gzipped." + info: null + example: + - "output.txt" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" +resources: +- type: "bash_script" + path: "script.sh" + is_executable: true +description: "Concatenate a number of text files, handle gzipped text files gracefully\ + \ and\noptionally gzip the output text file.\n\nThis component is useful for concatening\ + \ fastq files from different lanes, for instance.\n" +test_resources: +- type: "bash_script" + path: "test.sh" + is_executable: true +info: + improvements: "This component could be improved in 2 ways:\n 1. Allow for a mix\ + \ of zipped and plain input files\n 2. Allow to specify a compression algorithm\ + \ for the output\n" +status: "enabled" +requirements: + commands: + - "ps" +license: "MIT" +links: + repository: "https://github.com/viash-hub/craftbox" +runners: +- type: "executable" + id: "executable" + docker_setup_strategy: "ifneedbepullelsecachedbuild" +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "docker" + id: "docker" + image: "alpine:latest" + target_registry: "images.viash-hub.com" + target_tag: "concat_text" + namespace_separator: "/" + setup: + - type: "apk" + packages: + - "bash" + - "procps" + - "file" + entrypoint: [] + cmd: null +- type: "native" + id: "native" +build_info: + config: "src/concat_text/config.vsh.yaml" + runner: "nextflow" + engine: "docker|native" + output: "target/nextflow/concat_text" + executable: "target/nextflow/concat_text/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "53228705a20c6764e3f0ae9ed2147e99009d7c34" + git_remote: "https://github.com/viash-hub/craftbox" +package_config: + name: "craftbox" + version: "concat_text" + description: "A collection of custom-tailored scripts and applied tools.\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'concat_text'" + keywords: + - "scripts" + - "custom" + - "implementations" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/craftbox" + issue_tracker: "https://github.com/viash-hub/craftbox/issues" diff --git a/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/main.nf b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/main.nf new file mode 100644 index 00000000..4f81a248 --- /dev/null +++ b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/main.nf @@ -0,0 +1,3582 @@ +// concat_text concat_text +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. +// +// Component authors: +// * Toni Verbeiren (author, maintainer) +// * Dries Schaumont (reviewer) + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "concat_text", + "version" : "concat_text", + "authors" : [ + { + "name" : "Toni Verbeiren", + "roles" : [ + "author", + "maintainer" + ], + "info" : { + "links" : { + "github" : "tverbeiren", + "linkedin" : "verbeiren" + }, + "organizations" : [ + { + "name" : "Data Intuitive", + "href" : "https://www.data-intuitive.com", + "role" : "Data Scientist and CEO" + } + ] + } + }, + { + "name" : "Dries Schaumont", + "roles" : [ + "reviewer" + ], + "info" : { + "links" : { + "email" : "dries@data-intuitive.com", + "github" : "DriesSchaumont", + "orcid" : "0000-0002-4389-0440", + "linkedin" : "dries-schaumont" + }, + "organizations" : [ + { + "name" : "Data Intuitive", + "href" : "https://www.data-intuitive.com", + "role" : "Data Scientist" + } + ] + } + } + ], + "argument_groups" : [ + { + "name" : "Input arguments", + "arguments" : [ + { + "type" : "file", + "name" : "--input", + "description" : "A list of (gzipped) text files.", + "example" : [ + "input?.txt.gz" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output arguments", + "arguments" : [ + { + "type" : "boolean_true", + "name" : "--gzip_output", + "description" : "Should the output be zipped?", + "direction" : "input" + }, + { + "type" : "file", + "name" : "--output", + "description" : "File to write the output to, optionally gzipped.", + "example" : [ + "output.txt" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "bash_script", + "path" : "script.sh", + "is_executable" : true + } + ], + "description" : "Concatenate a number of text files, handle gzipped text files gracefully and\noptionally gzip the output text file.\n\nThis component is useful for concatening fastq files from different lanes, for instance.\n", + "test_resources" : [ + { + "type" : "bash_script", + "path" : "test.sh", + "is_executable" : true + } + ], + "info" : { + "improvements" : "This component could be improved in 2 ways:\n 1. Allow for a mix of zipped and plain input files\n 2. Allow to specify a compression algorithm for the output\n" + }, + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "license" : "MIT", + "links" : { + "repository" : "https://github.com/viash-hub/craftbox" + }, + "runners" : [ + { + "type" : "executable", + "id" : "executable", + "docker_setup_strategy" : "ifneedbepullelsecachedbuild" + }, + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "docker", + "id" : "docker", + "image" : "alpine:latest", + "target_registry" : "images.viash-hub.com", + "target_tag" : "concat_text", + "namespace_separator" : "/", + "setup" : [ + { + "type" : "apk", + "packages" : [ + "bash", + "procps", + "file" + ] + } + ] + }, + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/concat_text/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "docker|native", + "output" : "target/nextflow/concat_text", + "viash_version" : "0.9.0-RC6", + "git_commit" : "53228705a20c6764e3f0ae9ed2147e99009d7c34", + "git_remote" : "https://github.com/viash-hub/craftbox" + }, + "package_config" : { + "name" : "craftbox", + "version" : "concat_text", + "description" : "A collection of custom-tailored scripts and applied tools.\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'concat_text'" + ], + "keywords" : [ + "scripts", + "custom", + "implementations" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/craftbox", + "issue_tracker" : "https://github.com/viash-hub/craftbox/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// inner workflow hook +def innerWorkflowFactory(args) { + def rawScript = '''set -e +tempscript=".viash_script.sh" +cat > "$tempscript" << VIASHMAIN +## VIASH START +# The following code has been auto-generated by Viash. +$( if [ ! -z ${VIASH_PAR_INPUT+x} ]; then echo "${VIASH_PAR_INPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input='&'#" ; else echo "# par_input="; fi ) +$( if [ ! -z ${VIASH_PAR_GZIP_OUTPUT+x} ]; then echo "${VIASH_PAR_GZIP_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_gzip_output='&'#" ; else echo "# par_gzip_output="; fi ) +$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi ) +$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi ) +$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi ) +$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi ) +$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi ) +$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi ) +$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi ) +$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi ) + +## VIASH END +#!/usr/bin/env bash + +set -euo pipefail + +TMPDIR=\\$(mktemp -d "\\$meta_temp_dir/concat_text-XXXXXX") +function clean_up { + [[ -d "\\$TMPDIR" ]] && rm -r "\\$TMPDIR" +} +trap clean_up EXIT + +par_input="\\$(echo "\\$par_input" | tr ';' ' ')" + +echo -n ">> Check if input is gzipped... " +set +eo pipefail +file \\$par_input | grep -q 'gzip' +is_zipped="\\$?" +set -euo pipefail +[[ "\\$is_zipped" == "0" ]] && echo "yes" || echo "no" + +if [[ "\\$is_zipped" == "0" ]]; then + echo ">> zcat gzipped files" + zcat \\$par_input > \\$TMPDIR/contents +else + echo ">> cat plain files" + cat \\$par_input > \\$TMPDIR/contents +fi + +if [ "\\$par_gzip_output" == true ]; then + echo ">> Zip output file" + gzip \\$TMPDIR/contents + mv \\$TMPDIR/contents.gz \\$par_output +else + mv \\$TMPDIR/contents \\$par_output +fi +VIASHMAIN +bash "$tempscript" +''' + + return vdsl3WorkflowFactory(args, meta, rawScript) +} + + + +/** + * Generate a workflow for VDSL3 modules. + * + * This function is called by the workflowFactory() function. + * + * Input channel: [id, input_map] + * Output channel: [id, output_map] + * + * Internally, this workflow will convert the input channel + * to a format which the Nextflow module will be able to handle. + */ +def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) { + def key = args["key"] + def processObj = null + + workflow processWf { + take: input_ + main: + + if (processObj == null) { + processObj = _vdsl3ProcessFactory(args, meta, rawScript) + } + + output_ = input_ + | map { tuple -> + def id = tuple[0] + def data_ = tuple[1] + + if (workflow.stubRun) { + // add id if missing + data_ = [id: 'stub'] + data_ + } + + // process input files separately + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { par -> + def val = data_.containsKey(par.plainName) ? data_[par.plainName] : [] + def inputFiles = [] + if (val == null) { + inputFiles = [] + } else if (val instanceof List) { + inputFiles = val + } else if (val instanceof Path) { + inputFiles = [ val ] + } else { + inputFiles = [] + } + if (!workflow.stubRun) { + // throw error when an input file doesn't exist + inputFiles.each{ file -> + assert file.exists() : + "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" + + " Required input file does not exist.\n" + + " Path: '$file'.\n" + + " Expected input file to exist" + } + } + inputFiles + } + + // remove input files + def argsExclInputFiles = meta.config.allArguments + .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) } + .collectEntries { par -> + def parName = par.plainName + def val = data_[parName] + if (par.multiple && val instanceof Collection) { + val = val.join(par.multiple_sep) + } + if (par.direction == "output" && par.type == "file") { + val = val.replaceAll('\\$id', id).replaceAll('\\$key', key) + } + [parName, val] + } + + [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ] + } + | processObj + | map { output -> + def outputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .indexed() + .collectEntries{ index, par -> + def out = output[index + 1] + // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678) + if (!out instanceof List || out.size() <= 1) { + if (par.multiple) { + out = [] + } else { + assert !par.required : + "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" + + " Required output file is missing" + out = null + } + } else if (out.size() == 2 && !par.multiple) { + out = out[1] + } else { + out = out.drop(1) + } + [ par.plainName, out ] + } + + // drop null outputs + outputFiles.removeAll{it.value == null} + + [ output[0], outputFiles ] + } + emit: output_ + } + + return processWf +} + +// depends on: session? +def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) { + // autodetect process key + def wfKey = workflowArgs["key"] + def procKeyPrefix = "${wfKey}_process" + def scriptMeta = nextflow.script.ScriptMeta.current() + def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)} + def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()} + def newNumber = (numbers + [-1]).max() + 1 + + def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber" + + if (newNumber > 0) { + log.warn "Key for module '${wfKey}' is duplicated.\n", + "If you run a component multiple times in the same workflow,\n" + + "it's recommended you set a unique key for every call,\n" + + "for example: ${wfKey}.run(key: \"foo\")." + } + + // subset directives and convert to list of tuples + def drctv = workflowArgs.directives + + // TODO: unit test the two commands below + // convert publish array into tags + def valueToStr = { val -> + // ignore closures + if (val instanceof CharSequence) { + if (!val.matches('^[{].*[}]$')) { + '"' + val + '"' + } else { + val + } + } else if (val instanceof List) { + "[" + val.collect{valueToStr(it)}.join(", ") + "]" + } else if (val instanceof Map) { + "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]" + } else { + val.inspect() + } + } + + // multiple entries allowed: label, publishdir + def drctvStrs = drctv.collect { key, value -> + if (key in ["label", "publishDir"]) { + value.collect{ val -> + if (val instanceof Map) { + "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else if (val == null) { + "" + } else { + "\n$key " + valueToStr(val) + } + }.join() + } else if (value instanceof Map) { + "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else { + "\n$key " + valueToStr(value) + } + }.join() + + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' } + .join() + + def outputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + // insert dummy into every output (see nextflow-io/nextflow#2678) + if (!par.multiple) { + ', path{[".exitcode", args.' + par.plainName + ']}' + } else { + ', path{[".exitcode"] + args.' + par.plainName + '}' + } + } + .join() + + // TODO: move this functionality somewhere else? + if (workflowArgs.auto.transcript) { + outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}' + } else { + outputPaths = outputPaths + ', path{[".exitcode"]}' + } + + // create dirs for output files (based on BashWrapper.createParentFiles) + def createParentStr = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" && it.create_parent } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"] : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // construct inputFileExports + def inputFileExports = meta.config.allArguments + .findAll { it.type == "file" && it.direction.toLowerCase() == "input" } + .collect { par -> + def viash_par_contents = "(viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName})" + "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}=\\\"\" + ${viash_par_contents} + \"\\\"\"}" + } + + // NOTE: if using docker, use /tmp instead of tmpDir! + def tmpDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('VIASH_TMPDIR') ?: + System.getenv('VIASH_TEMPDIR') ?: + System.getenv('VIASH_TMP') ?: + System.getenv('TEMP') ?: + System.getenv('TMPDIR') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMP') ?: + '/tmp' + ).toAbsolutePath() + + // construct stub + def stub = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // escape script + def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"') + + // publishdir assert + def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? + """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n Example: --publish_dir './output/'" """ : + "" + + // generate process string + def procStr = + """nextflow.enable.dsl=2 + | + |process $procKey {$drctvStrs + |input: + | tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources") + |output: + | tuple val("\$id")$outputPaths, optional: true + |stub: + |\"\"\" + |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; } + |$stub + |\"\"\" + |script:$assertStr + |def escapeText = { s -> s.toString().replaceAll('([`"])', '\\\\\\\\\$1') } + |def parInject = args + | .findAll{key, value -> value != null} + | .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}=\\\"\${escapeText(value)}\\\""} + | .join("\\n") + |\"\"\" + |# meta exports + |export VIASH_META_RESOURCES_DIR="\${resourcesDir}" + |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}" + |export VIASH_META_NAME="${meta.config.name}" + |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME" + |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml" + |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" } + |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" } + |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then + | export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 )) + | export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 )) + | export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 )) + | export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 )) + | export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 )) + | export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 )) + | export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 )) + | export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 )) + | export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 )) + | export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 )) + |fi + | + |# meta synonyms + |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR" + |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR" + | + |# create output dirs if need be + |function mkdir_parent { + | for file in "\\\$@"; do + | mkdir -p "\\\$(dirname "\\\$file")" + | done + |} + |$createParentStr + | + |# argument exports${inputFileExports.join()} + |\$parInject + | + |# process script + |${escapedScript} + |\"\"\" + |} + |""".stripMargin() + + // TODO: print on debug + // if (workflowArgs.debug == true) { + // println("######################\n$procStr\n######################") + // } + + // write process to temp file + def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf") + addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) } + tempFile.text = procStr + + // create process from temp file + def binding = new nextflow.script.ScriptBinding([:]) + def session = nextflow.Nextflow.getSession() + def parser = new nextflow.script.ScriptParser(session) + .setModule(true) + .setBinding(binding) + def moduleScript = parser.runScript(tempFile) + .getScript() + + // register module in meta + def module = new nextflow.script.IncludeDef.Module(name: procKey) + scriptMeta.addModule(moduleScript, module.name, module.alias) + + // retrieve and return process from meta + return scriptMeta.getProcess(procKey) +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "container" : { + "registry" : "images.viash-hub.com", + "image" : "vsh/craftbox/concat_text", + "tag" : "concat_text" + }, + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/nextflow.config b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/nextflow.config new file mode 100644 index 00000000..1d6fe370 --- /dev/null +++ b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/nextflow.config @@ -0,0 +1,126 @@ +manifest { + name = 'concat_text' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'concat_text' + description = 'Concatenate a number of text files, handle gzipped text files gracefully and\noptionally gzip the output text file.\n\nThis component is useful for concatening fastq files from different lanes, for instance.\n' + author = 'Toni Verbeiren, Dries Schaumont' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/nextflow_schema.json b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/nextflow_schema.json new file mode 100644 index 00000000..07a599a4 --- /dev/null +++ b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/nextflow_schema.json @@ -0,0 +1,106 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "concat_text", +"description": "Concatenate a number of text files, handle gzipped text files gracefully and\noptionally gzip the output text file.\n\nThis component is useful for concatening fastq files from different lanes, for instance.\n", +"type": "object", +"definitions": { + + + + "input arguments" : { + "title": "Input arguments", + "type": "object", + "description": "No description", + "properties": { + + + "input": { + "type": + "string", + "description": "Type: List of `file`, required, example: `input?.txt.gz`, multiple_sep: `\":\"`. A list of (gzipped) text files", + "help_text": "Type: List of `file`, required, example: `input?.txt.gz`, multiple_sep: `\":\"`. A list of (gzipped) text files." + + } + + +} +}, + + + "output arguments" : { + "title": "Output arguments", + "type": "object", + "description": "No description", + "properties": { + + + "gzip_output": { + "type": + "boolean", + "description": "Type: `boolean_true`, default: `false`. Should the output be zipped?", + "help_text": "Type: `boolean_true`, default: `false`. Should the output be zipped?" + , + "default": "False" + } + + + , + "output": { + "type": + "string", + "description": "Type: `file`, default: `$id.$key.output.txt`, example: `output.txt`. File to write the output to, optionally gzipped", + "help_text": "Type: `file`, default: `$id.$key.output.txt`, example: `output.txt`. File to write the output to, optionally gzipped." + , + "default": "$id.$key.output.txt" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/input arguments" + }, + + { + "$ref": "#/definitions/output arguments" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/.config.vsh.yaml b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/.config.vsh.yaml new file mode 100644 index 00000000..bf9c28e4 --- /dev/null +++ b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/.config.vsh.yaml @@ -0,0 +1,173 @@ +name: "untar" +version: "concat_text" +argument_groups: +- name: "Input arguments" + arguments: + - type: "file" + name: "--input" + description: "Tarball file to be unpacked." + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output arguments" + arguments: + - type: "file" + name: "--output" + description: "Directory to write the contents of the .tar file to." + info: null + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: false + multiple_sep: ";" +- name: "Other arguments" + arguments: + - type: "string" + name: "--exclude" + alternatives: + - "-e" + description: "Prevents any file or member whose name matches the shell wildcard\ + \ (pattern) from being extracted." + info: null + example: + - "docs/figures" + required: false + direction: "input" + multiple: false + multiple_sep: ";" +resources: +- type: "bash_script" + path: "script.sh" + is_executable: true +description: "Unpack a .tar file. When the contents of the .tar file is just a single\ + \ directory,\nput the contents of the directory into the output folder instead of\ + \ that directory.\n" +test_resources: +- type: "bash_script" + path: "test.sh" + is_executable: true +info: null +status: "enabled" +requirements: + commands: + - "ps" +license: "MIT" +links: + repository: "https://github.com/viash-hub/craftbox" +runners: +- type: "executable" + id: "executable" + docker_setup_strategy: "ifneedbepullelsecachedbuild" +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "docker" + id: "docker" + image: "debian:stable-slim" + target_registry: "images.viash-hub.com" + target_tag: "concat_text" + namespace_separator: "/" + setup: + - type: "apt" + packages: + - "procps" + interactive: false + entrypoint: [] + cmd: null +- type: "native" + id: "native" +build_info: + config: "src/untar/config.vsh.yaml" + runner: "nextflow" + engine: "docker|native" + output: "target/nextflow/untar" + executable: "target/nextflow/untar/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "53228705a20c6764e3f0ae9ed2147e99009d7c34" + git_remote: "https://github.com/viash-hub/craftbox" +package_config: + name: "craftbox" + version: "concat_text" + description: "A collection of custom-tailored scripts and applied tools.\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'concat_text'" + keywords: + - "scripts" + - "custom" + - "implementations" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/craftbox" + issue_tracker: "https://github.com/viash-hub/craftbox/issues" diff --git a/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/main.nf b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/main.nf new file mode 100644 index 00000000..3d014862 --- /dev/null +++ b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/main.nf @@ -0,0 +1,3545 @@ +// untar concat_text +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "untar", + "version" : "concat_text", + "argument_groups" : [ + { + "name" : "Input arguments", + "arguments" : [ + { + "type" : "file", + "name" : "--input", + "description" : "Tarball file to be unpacked.", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output arguments", + "arguments" : [ + { + "type" : "file", + "name" : "--output", + "description" : "Directory to write the contents of the .tar file to.", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Other arguments", + "arguments" : [ + { + "type" : "string", + "name" : "--exclude", + "alternatives" : [ + "-e" + ], + "description" : "Prevents any file or member whose name matches the shell wildcard (pattern) from being extracted.", + "example" : [ + "docs/figures" + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "bash_script", + "path" : "script.sh", + "is_executable" : true + } + ], + "description" : "Unpack a .tar file. When the contents of the .tar file is just a single directory,\nput the contents of the directory into the output folder instead of that directory.\n", + "test_resources" : [ + { + "type" : "bash_script", + "path" : "test.sh", + "is_executable" : true + } + ], + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "license" : "MIT", + "links" : { + "repository" : "https://github.com/viash-hub/craftbox" + }, + "runners" : [ + { + "type" : "executable", + "id" : "executable", + "docker_setup_strategy" : "ifneedbepullelsecachedbuild" + }, + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "docker", + "id" : "docker", + "image" : "debian:stable-slim", + "target_registry" : "images.viash-hub.com", + "target_tag" : "concat_text", + "namespace_separator" : "/", + "setup" : [ + { + "type" : "apt", + "packages" : [ + "procps" + ], + "interactive" : false + } + ] + }, + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/untar/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "docker|native", + "output" : "target/nextflow/untar", + "viash_version" : "0.9.0-RC6", + "git_commit" : "53228705a20c6764e3f0ae9ed2147e99009d7c34", + "git_remote" : "https://github.com/viash-hub/craftbox" + }, + "package_config" : { + "name" : "craftbox", + "version" : "concat_text", + "description" : "A collection of custom-tailored scripts and applied tools.\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'concat_text'" + ], + "keywords" : [ + "scripts", + "custom", + "implementations" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/craftbox", + "issue_tracker" : "https://github.com/viash-hub/craftbox/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// inner workflow hook +def innerWorkflowFactory(args) { + def rawScript = '''set -e +tempscript=".viash_script.sh" +cat > "$tempscript" << VIASHMAIN +## VIASH START +# The following code has been auto-generated by Viash. +$( if [ ! -z ${VIASH_PAR_INPUT+x} ]; then echo "${VIASH_PAR_INPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input='&'#" ; else echo "# par_input="; fi ) +$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi ) +$( if [ ! -z ${VIASH_PAR_EXCLUDE+x} ]; then echo "${VIASH_PAR_EXCLUDE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_exclude='&'#" ; else echo "# par_exclude="; fi ) +$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi ) +$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi ) +$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi ) +$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi ) +$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi ) +$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi ) +$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi ) + +## VIASH END +#!/usr/bin/env bash + +set -eo pipefail + +extra_args=() + +TMPDIR=\\$(mktemp -d "\\$meta_temp_dir/\\$meta_functionality_name-XXXXXX") +function clean_up { + [[ -d "\\$TMPDIR" ]] && rm -r "\\$TMPDIR" +} +trap clean_up EXIT + +# Check if tarball contains 1 top-level directory. If so, extract the contents of the +# directory to the output directory instead of the directory itself. +echo "Directory contents:" +tar -taf "\\${par_input}" > "\\$TMPDIR/tar_contents.txt" +cat "\\$TMPDIR/tar_contents.txt" + +printf "Checking if tarball contains only a single top-level directory: " +if [[ \\$(grep -o -E '^[./]*[^/]+/\\$' "\\$TMPDIR/tar_contents.txt" | uniq | wc -l) -eq 1 ]]; then + echo "It does." + echo "Extracting the contents of the top-level directory to the output directory instead of the directory itself." + # The directory can be both of the format './' (or ././) or just + # Adjust the number of stripped components accordingly by looking for './' at the beginning of the file. + starting_relative=\\$(grep -oP -m 1 '^(./)*' "\\$TMPDIR/tar_contents.txt" | tr -d '\\\\n' | wc -c) + n_strips=\\$(( (\\$starting_relative / 2)+1 )) + extra_args+=("--strip-components=\\$n_strips") +else + echo "It does not." +fi + +if [ "\\$par_exclude" != "" ]; then + echo "Exclusion of files with wildcard '\\$par_exclude' requested." + extra_args+=("--exclude=\\$par_exclude") +fi + +echo "Starting extraction of tarball '\\$par_input' to output directory '\\$par_output'." +mkdir -p "\\$par_output" +echo "executing 'tar --no-same-owner --no-same-permissions --directory=\\$par_output \\${extra_args[@]} -xavf \\$par_input'" +tar --no-same-owner --no-same-permissions --directory="\\$par_output" \\${extra_args[@]} -xavf "\\$par_input" +VIASHMAIN +bash "$tempscript" +''' + + return vdsl3WorkflowFactory(args, meta, rawScript) +} + + + +/** + * Generate a workflow for VDSL3 modules. + * + * This function is called by the workflowFactory() function. + * + * Input channel: [id, input_map] + * Output channel: [id, output_map] + * + * Internally, this workflow will convert the input channel + * to a format which the Nextflow module will be able to handle. + */ +def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) { + def key = args["key"] + def processObj = null + + workflow processWf { + take: input_ + main: + + if (processObj == null) { + processObj = _vdsl3ProcessFactory(args, meta, rawScript) + } + + output_ = input_ + | map { tuple -> + def id = tuple[0] + def data_ = tuple[1] + + if (workflow.stubRun) { + // add id if missing + data_ = [id: 'stub'] + data_ + } + + // process input files separately + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { par -> + def val = data_.containsKey(par.plainName) ? data_[par.plainName] : [] + def inputFiles = [] + if (val == null) { + inputFiles = [] + } else if (val instanceof List) { + inputFiles = val + } else if (val instanceof Path) { + inputFiles = [ val ] + } else { + inputFiles = [] + } + if (!workflow.stubRun) { + // throw error when an input file doesn't exist + inputFiles.each{ file -> + assert file.exists() : + "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" + + " Required input file does not exist.\n" + + " Path: '$file'.\n" + + " Expected input file to exist" + } + } + inputFiles + } + + // remove input files + def argsExclInputFiles = meta.config.allArguments + .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) } + .collectEntries { par -> + def parName = par.plainName + def val = data_[parName] + if (par.multiple && val instanceof Collection) { + val = val.join(par.multiple_sep) + } + if (par.direction == "output" && par.type == "file") { + val = val.replaceAll('\\$id', id).replaceAll('\\$key', key) + } + [parName, val] + } + + [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ] + } + | processObj + | map { output -> + def outputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .indexed() + .collectEntries{ index, par -> + def out = output[index + 1] + // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678) + if (!out instanceof List || out.size() <= 1) { + if (par.multiple) { + out = [] + } else { + assert !par.required : + "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" + + " Required output file is missing" + out = null + } + } else if (out.size() == 2 && !par.multiple) { + out = out[1] + } else { + out = out.drop(1) + } + [ par.plainName, out ] + } + + // drop null outputs + outputFiles.removeAll{it.value == null} + + [ output[0], outputFiles ] + } + emit: output_ + } + + return processWf +} + +// depends on: session? +def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) { + // autodetect process key + def wfKey = workflowArgs["key"] + def procKeyPrefix = "${wfKey}_process" + def scriptMeta = nextflow.script.ScriptMeta.current() + def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)} + def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()} + def newNumber = (numbers + [-1]).max() + 1 + + def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber" + + if (newNumber > 0) { + log.warn "Key for module '${wfKey}' is duplicated.\n", + "If you run a component multiple times in the same workflow,\n" + + "it's recommended you set a unique key for every call,\n" + + "for example: ${wfKey}.run(key: \"foo\")." + } + + // subset directives and convert to list of tuples + def drctv = workflowArgs.directives + + // TODO: unit test the two commands below + // convert publish array into tags + def valueToStr = { val -> + // ignore closures + if (val instanceof CharSequence) { + if (!val.matches('^[{].*[}]$')) { + '"' + val + '"' + } else { + val + } + } else if (val instanceof List) { + "[" + val.collect{valueToStr(it)}.join(", ") + "]" + } else if (val instanceof Map) { + "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]" + } else { + val.inspect() + } + } + + // multiple entries allowed: label, publishdir + def drctvStrs = drctv.collect { key, value -> + if (key in ["label", "publishDir"]) { + value.collect{ val -> + if (val instanceof Map) { + "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else if (val == null) { + "" + } else { + "\n$key " + valueToStr(val) + } + }.join() + } else if (value instanceof Map) { + "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else { + "\n$key " + valueToStr(value) + } + }.join() + + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' } + .join() + + def outputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + // insert dummy into every output (see nextflow-io/nextflow#2678) + if (!par.multiple) { + ', path{[".exitcode", args.' + par.plainName + ']}' + } else { + ', path{[".exitcode"] + args.' + par.plainName + '}' + } + } + .join() + + // TODO: move this functionality somewhere else? + if (workflowArgs.auto.transcript) { + outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}' + } else { + outputPaths = outputPaths + ', path{[".exitcode"]}' + } + + // create dirs for output files (based on BashWrapper.createParentFiles) + def createParentStr = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" && it.create_parent } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"] : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // construct inputFileExports + def inputFileExports = meta.config.allArguments + .findAll { it.type == "file" && it.direction.toLowerCase() == "input" } + .collect { par -> + def viash_par_contents = "(viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName})" + "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}=\\\"\" + ${viash_par_contents} + \"\\\"\"}" + } + + // NOTE: if using docker, use /tmp instead of tmpDir! + def tmpDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('VIASH_TMPDIR') ?: + System.getenv('VIASH_TEMPDIR') ?: + System.getenv('VIASH_TMP') ?: + System.getenv('TEMP') ?: + System.getenv('TMPDIR') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMP') ?: + '/tmp' + ).toAbsolutePath() + + // construct stub + def stub = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // escape script + def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"') + + // publishdir assert + def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? + """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n Example: --publish_dir './output/'" """ : + "" + + // generate process string + def procStr = + """nextflow.enable.dsl=2 + | + |process $procKey {$drctvStrs + |input: + | tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources") + |output: + | tuple val("\$id")$outputPaths, optional: true + |stub: + |\"\"\" + |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; } + |$stub + |\"\"\" + |script:$assertStr + |def escapeText = { s -> s.toString().replaceAll('([`"])', '\\\\\\\\\$1') } + |def parInject = args + | .findAll{key, value -> value != null} + | .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}=\\\"\${escapeText(value)}\\\""} + | .join("\\n") + |\"\"\" + |# meta exports + |export VIASH_META_RESOURCES_DIR="\${resourcesDir}" + |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}" + |export VIASH_META_NAME="${meta.config.name}" + |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME" + |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml" + |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" } + |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" } + |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then + | export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 )) + | export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 )) + | export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 )) + | export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 )) + | export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 )) + | export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 )) + | export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 )) + | export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 )) + | export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 )) + | export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 )) + |fi + | + |# meta synonyms + |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR" + |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR" + | + |# create output dirs if need be + |function mkdir_parent { + | for file in "\\\$@"; do + | mkdir -p "\\\$(dirname "\\\$file")" + | done + |} + |$createParentStr + | + |# argument exports${inputFileExports.join()} + |\$parInject + | + |# process script + |${escapedScript} + |\"\"\" + |} + |""".stripMargin() + + // TODO: print on debug + // if (workflowArgs.debug == true) { + // println("######################\n$procStr\n######################") + // } + + // write process to temp file + def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf") + addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) } + tempFile.text = procStr + + // create process from temp file + def binding = new nextflow.script.ScriptBinding([:]) + def session = nextflow.Nextflow.getSession() + def parser = new nextflow.script.ScriptParser(session) + .setModule(true) + .setBinding(binding) + def moduleScript = parser.runScript(tempFile) + .getScript() + + // register module in meta + def module = new nextflow.script.IncludeDef.Module(name: procKey) + scriptMeta.addModule(moduleScript, module.name, module.alias) + + // retrieve and return process from meta + return scriptMeta.getProcess(procKey) +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "container" : { + "registry" : "images.viash-hub.com", + "image" : "vsh/craftbox/untar", + "tag" : "concat_text" + }, + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/nextflow.config b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/nextflow.config new file mode 100644 index 00000000..4fb3bdfc --- /dev/null +++ b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/nextflow.config @@ -0,0 +1,125 @@ +manifest { + name = 'untar' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'concat_text' + description = 'Unpack a .tar file. When the contents of the .tar file is just a single directory,\nput the contents of the directory into the output folder instead of that directory.\n' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/nextflow_schema.json b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/nextflow_schema.json new file mode 100644 index 00000000..5ab49092 --- /dev/null +++ b/target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/nextflow_schema.json @@ -0,0 +1,119 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "untar", +"description": "Unpack a .tar file. When the contents of the .tar file is just a single directory,\nput the contents of the directory into the output folder instead of that directory.\n", +"type": "object", +"definitions": { + + + + "input arguments" : { + "title": "Input arguments", + "type": "object", + "description": "No description", + "properties": { + + + "input": { + "type": + "string", + "description": "Type: `file`, required. Tarball file to be unpacked", + "help_text": "Type: `file`, required. Tarball file to be unpacked." + + } + + +} +}, + + + "output arguments" : { + "title": "Output arguments", + "type": "object", + "description": "No description", + "properties": { + + + "output": { + "type": + "string", + "description": "Type: `file`, required, default: `$id.$key.output.output`. Directory to write the contents of the ", + "help_text": "Type: `file`, required, default: `$id.$key.output.output`. Directory to write the contents of the .tar file to." + , + "default": "$id.$key.output.output" + } + + +} +}, + + + "other arguments" : { + "title": "Other arguments", + "type": "object", + "description": "No description", + "properties": { + + + "exclude": { + "type": + "string", + "description": "Type: `string`, example: `docs/figures`. Prevents any file or member whose name matches the shell wildcard (pattern) from being extracted", + "help_text": "Type: `string`, example: `docs/figures`. Prevents any file or member whose name matches the shell wildcard (pattern) from being extracted." + + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/input arguments" + }, + + { + "$ref": "#/definitions/output arguments" + }, + + { + "$ref": "#/definitions/other arguments" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/executable/parallel_map/.config.vsh.yaml b/target/executable/parallel_map/.config.vsh.yaml new file mode 100644 index 00000000..94ce6af3 --- /dev/null +++ b/target/executable/parallel_map/.config.vsh.yaml @@ -0,0 +1,260 @@ +name: "parallel_map" +version: "unpack_genome" +argument_groups: +- name: "Input arguments" + arguments: + - type: "file" + name: "--input_r1" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--input_r2" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--genomeDir" + description: "STAR reference directory" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--barcodes" + description: "The barcodes/wells to process" + info: null + required: true + direction: "input" + multiple: true + multiple_sep: ";" +- name: "Barcode arguments" + arguments: + - type: "integer" + name: "--wellBarcodesLength" + description: "The length of the well barcodes" + info: null + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--umiLength" + description: "The length of the UMIs" + info: null + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--limitBAMsortRAM" + info: null + default: + - "10000000000" + required: false + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Runtime arguments" + arguments: + - type: "integer" + name: "--runThreadN" + description: "Number of threads to use for a single STAR execution." + info: null + default: + - 1 + required: false + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output arguments" + arguments: + - type: "file" + name: "--output" + description: "Location of the output folders, 1 folder per barcode. The value\ + \ used\nfor this argument must contain a '*', which will be replaced with the\n\ + barcode to form the final output location for that barcode.\n" + info: null + default: + - "./*" + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--joblog" + description: "Where to store the log file listing all the jobs." + info: null + default: + - "execution_log.txt" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" +resources: +- type: "bash_script" + path: "script.sh" + is_executable: true +description: "Map wells in batch, using STAR\nSpliced Transcripts Alignment to a Reference\ + \ (C) Alexander Dobin\nhttps://github.com/alexdobin/STAR\n" +test_resources: +- type: "bash_script" + path: "test.sh" + is_executable: true +info: null +status: "enabled" +requirements: + commands: + - "ps" +license: "MIT" +links: + repository: "https://github.com/viash-hub/htrnaseq" +runners: +- type: "executable" + id: "executable" + docker_setup_strategy: "ifneedbepullelsecachedbuild" +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "docker" + id: "docker" + image: "debian:stable-slim" + target_registry: "images.viash-hub.com" + target_tag: "unpack_genome" + namespace_separator: "/" + setup: + - type: "apt" + packages: + - "procps" + - "gzip" + - "bzip2" + - "parallel" + - "wget" + - "zlib1g-dev" + - "unzip" + - "xxd" + - "file" + interactive: false + - type: "docker" + run: + - "wget -O $STAR_TARGET $STAR_SOURCE && \\\n unzip $STAR_TARGET -d /tmp && \\\ + \n mv /tmp/STAR_$STAR_VERSION/Linux_x86_64_static/STAR /usr/local/bin/$STAR_BINARY\ + \ && \\\n chmod +x /usr/local/bin/$STAR_BINARY && \\\n rm $STAR_TARGET &&\ + \ rm -rf /tmp/STAR_$STAR_VERSION\n" + env: + - "STAR_VERSION \"2.7.11b\"" + - "STAR_SOURCE \"https://github.com/alexdobin/STAR/releases/download/$STAR_VERSION/STAR_$STAR_VERSION.zip\"" + - "STAR_TARGET \"/tmp/star.zip\"" + - "STAR_BINARY \"STAR\"" + entrypoint: [] + cmd: null +- type: "native" + id: "native" +build_info: + config: "src/parallel_map/config.vsh.yaml" + runner: "executable" + engine: "docker|native" + output: "target/executable/parallel_map" + executable: "target/executable/parallel_map/parallel_map" + viash_version: "0.9.0-RC6" + git_commit: "7c0705a514b86c8d335f308abf7fb1b62d16aa2f" + git_remote: "https://github.com/viash-hub/htrnaseq" +package_config: + name: "htrnaseq" + version: "unpack_genome" + description: "Demultiplexing pipeline [WIP]\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + keywords: + - "bioinformatics" + - "sequence" + - "high-throughput" + - "mapping" + - "counting" + - "pipeline" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/htrnaseq" + issue_tracker: "https://github.com/viash-hub/htrnaseq/issues" diff --git a/target/executable/parallel_map/parallel_map b/target/executable/parallel_map/parallel_map new file mode 100755 index 00000000..a2baf614 --- /dev/null +++ b/target/executable/parallel_map/parallel_map @@ -0,0 +1,1625 @@ +#!/usr/bin/env bash + +# parallel_map unpack_genome +# +# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +# Data Intuitive. +# +# The component may contain files which fall under a different license. The +# authors of this component should specify the license in the header of such +# files, or include a separate license file detailing the licenses of all included +# files. + +set -e + +if [ -z "$VIASH_TEMP" ]; then + VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$VIASH_TEMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$VIASH_TMP} + VIASH_TEMP=${VIASH_TEMP:-$TMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$TMP} + VIASH_TEMP=${VIASH_TEMP:-$TEMPDIR} + VIASH_TEMP=${VIASH_TEMP:-$TEMP} + VIASH_TEMP=${VIASH_TEMP:-/tmp} +fi + +# define helper functions +# ViashQuote: put quotes around non flag values +# $1 : unquoted string +# return : possibly quoted string +# examples: +# ViashQuote --foo # returns --foo +# ViashQuote bar # returns 'bar' +# Viashquote --foo=bar # returns --foo='bar' +function ViashQuote { + if [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+=.+$ ]]; then + echo "$1" | sed "s#=\(.*\)#='\1'#" + elif [[ "$1" =~ ^-+[a-zA-Z0-9_\-]+$ ]]; then + echo "$1" + else + echo "'$1'" + fi +} +# ViashRemoveFlags: Remove leading flag +# $1 : string with a possible leading flag +# return : string without possible leading flag +# examples: +# ViashRemoveFlags --foo=bar # returns bar +function ViashRemoveFlags { + echo "$1" | sed 's/^--*[a-zA-Z0-9_\-]*=//' +} +# ViashSourceDir: return the path of a bash file, following symlinks +# usage : ViashSourceDir ${BASH_SOURCE[0]} +# $1 : Should always be set to ${BASH_SOURCE[0]} +# returns : The absolute path of the bash file +function ViashSourceDir { + SOURCE="$1" + while [ -h "$SOURCE" ]; do + DIR="$( cd -P "$( dirname "$SOURCE" )" >/dev/null 2>&1 && pwd )" + SOURCE="$(readlink "$SOURCE")" + [[ $SOURCE != /* ]] && SOURCE="$DIR/$SOURCE" + done + cd -P "$( dirname "$SOURCE" )" >/dev/null 2>&1 && pwd +} +# ViashFindTargetDir: return the path of the '.build.yaml' file, following symlinks +# usage : ViashFindTargetDir 'ScriptPath' +# $1 : The location from where to start the upward search +# returns : The absolute path of the '.build.yaml' file +function ViashFindTargetDir { + SOURCE="$1" + while [[ "$SOURCE" != "" && ! -e "$SOURCE/.build.yaml" ]]; do + SOURCE=${SOURCE%/*} + done + echo $SOURCE +} +# see https://en.wikipedia.org/wiki/Syslog#Severity_level +VIASH_LOGCODE_EMERGENCY=0 +VIASH_LOGCODE_ALERT=1 +VIASH_LOGCODE_CRITICAL=2 +VIASH_LOGCODE_ERROR=3 +VIASH_LOGCODE_WARNING=4 +VIASH_LOGCODE_NOTICE=5 +VIASH_LOGCODE_INFO=6 +VIASH_LOGCODE_DEBUG=7 +VIASH_VERBOSITY=$VIASH_LOGCODE_NOTICE + +# ViashLog: Log events depending on the verbosity level +# usage: ViashLog 1 alert Oh no something went wrong! +# $1: required verbosity level +# $2: display tag +# $3+: messages to display +# stdout: Your input, prepended by '[$2] '. +function ViashLog { + local required_level="$1" + local display_tag="$2" + shift 2 + if [ $VIASH_VERBOSITY -ge $required_level ]; then + >&2 echo "[$display_tag]" "$@" + fi +} + +# ViashEmergency: log events when the system is unstable +# usage: ViashEmergency Oh no something went wrong. +# stdout: Your input, prepended by '[emergency] '. +function ViashEmergency { + ViashLog $VIASH_LOGCODE_EMERGENCY emergency "$@" +} + +# ViashAlert: log events when actions must be taken immediately (e.g. corrupted system database) +# usage: ViashAlert Oh no something went wrong. +# stdout: Your input, prepended by '[alert] '. +function ViashAlert { + ViashLog $VIASH_LOGCODE_ALERT alert "$@" +} + +# ViashCritical: log events when a critical condition occurs +# usage: ViashCritical Oh no something went wrong. +# stdout: Your input, prepended by '[critical] '. +function ViashCritical { + ViashLog $VIASH_LOGCODE_CRITICAL critical "$@" +} + +# ViashError: log events when an error condition occurs +# usage: ViashError Oh no something went wrong. +# stdout: Your input, prepended by '[error] '. +function ViashError { + ViashLog $VIASH_LOGCODE_ERROR error "$@" +} + +# ViashWarning: log potentially abnormal events +# usage: ViashWarning Something may have gone wrong. +# stdout: Your input, prepended by '[warning] '. +function ViashWarning { + ViashLog $VIASH_LOGCODE_WARNING warning "$@" +} + +# ViashNotice: log significant but normal events +# usage: ViashNotice This just happened. +# stdout: Your input, prepended by '[notice] '. +function ViashNotice { + ViashLog $VIASH_LOGCODE_NOTICE notice "$@" +} + +# ViashInfo: log normal events +# usage: ViashInfo This just happened. +# stdout: Your input, prepended by '[info] '. +function ViashInfo { + ViashLog $VIASH_LOGCODE_INFO info "$@" +} + +# ViashDebug: log all events, for debugging purposes +# usage: ViashDebug This just happened. +# stdout: Your input, prepended by '[debug] '. +function ViashDebug { + ViashLog $VIASH_LOGCODE_DEBUG debug "$@" +} + +# find source folder of this component +VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}` + +# find the root of the built components & dependencies +VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR` + +# define meta fields +VIASH_META_NAME="parallel_map" +VIASH_META_FUNCTIONALITY_NAME="parallel_map" +VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME" +VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml" +VIASH_META_TEMP_DIR="$VIASH_TEMP" + + +# ViashHelp: Display helpful explanation about this executable +function ViashHelp { + echo "parallel_map unpack_genome" + echo "" + echo "Map wells in batch, using STAR" + echo "Spliced Transcripts Alignment to a Reference (C) Alexander Dobin" + echo "https://github.com/alexdobin/STAR" + echo "" + echo "Input arguments:" + echo " --input_r1" + echo " type: file, required parameter, multiple values allowed, file must exist" + echo "" + echo " --input_r2" + echo " type: file, required parameter, multiple values allowed, file must exist" + echo "" + echo " --genomeDir" + echo " type: file, required parameter, file must exist" + echo " STAR reference directory" + echo "" + echo " --barcodes" + echo " type: string, required parameter, multiple values allowed" + echo " The barcodes/wells to process" + echo "" + echo "Barcode arguments:" + echo " --wellBarcodesLength" + echo " type: integer, required parameter" + echo " The length of the well barcodes" + echo "" + echo " --umiLength" + echo " type: integer, required parameter" + echo " The length of the UMIs" + echo "" + echo " --limitBAMsortRAM" + echo " type: string" + echo " default: 10000000000" + echo "" + echo "Runtime arguments:" + echo " --runThreadN" + echo " type: integer" + echo " default: 1" + echo " Number of threads to use for a single STAR execution." + echo "" + echo "Output arguments:" + echo " --output" + echo " type: file, required parameter, multiple values allowed, output, file" + echo "must exist" + echo " default: ./*" + echo " Location of the output folders, 1 folder per barcode. The value used" + echo " for this argument must contain a '*', which will be replaced with the" + echo " barcode to form the final output location for that barcode." + echo "" + echo " --joblog" + echo " type: file, output, file must exist" + echo " default: execution_log.txt" + echo " Where to store the log file listing all the jobs." +} + +# initialise variables +VIASH_MODE='run' +VIASH_ENGINE_ID='docker' + +######## Helper functions for setting up Docker images for viash ######## +# expects: ViashDockerBuild + +# ViashDockerInstallationCheck: check whether Docker is installed correctly +# +# examples: +# ViashDockerInstallationCheck +function ViashDockerInstallationCheck { + ViashDebug "Checking whether Docker is installed" + if [ ! command -v docker &> /dev/null ]; then + ViashCritical "Docker doesn't seem to be installed. See 'https://docs.docker.com/get-docker/' for instructions." + exit 1 + fi + + ViashDebug "Checking whether the Docker daemon is running" + save=$-; set +e + docker_version=$(docker version --format '{{.Client.APIVersion}}' 2> /dev/null) + out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashCritical "Docker daemon does not seem to be running. Try one of the following:" + ViashCritical "- Try running 'dockerd' in the command line" + ViashCritical "- See https://docs.docker.com/config/daemon/" + exit 1 + fi +} + +# ViashDockerRemoteTagCheck: check whether a Docker image is available +# on a remote. Assumes `docker login` has been performed, if relevant. +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# ViashDockerRemoteTagCheck python:latest +# echo $? # returns '0' +# ViashDockerRemoteTagCheck sdaizudceahifu +# echo $? # returns '1' +function ViashDockerRemoteTagCheck { + docker manifest inspect $1 > /dev/null 2> /dev/null +} + +# ViashDockerLocalTagCheck: check whether a Docker image is available locally +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# docker pull python:latest +# ViashDockerLocalTagCheck python:latest +# echo $? # returns '0' +# ViashDockerLocalTagCheck sdaizudceahifu +# echo $? # returns '1' +function ViashDockerLocalTagCheck { + [ -n "$(docker images -q $1)" ] +} + +# ViashDockerPull: pull a Docker image +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# ViashDockerPull python:latest +# echo $? # returns '0' +# ViashDockerPull sdaizudceahifu +# echo $? # returns '1' +function ViashDockerPull { + ViashNotice "Checking if Docker image is available at '$1'" + if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then + docker pull $1 && return 0 || return 1 + else + save=$-; set +e + docker pull $1 2> /dev/null > /dev/null + out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashWarning "Could not pull from '$1'. Docker image doesn't exist or is not accessible." + fi + return $out + fi +} + +# ViashDockerPush: push a Docker image +# +# $1 : image identifier with format `[registry/]image[:tag]` +# exit code $? : whether or not the image was found +# examples: +# ViashDockerPush python:latest +# echo $? # returns '0' +# ViashDockerPush sdaizudceahifu +# echo $? # returns '1' +function ViashDockerPush { + ViashNotice "Pushing image to '$1'" + save=$-; set +e + if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then + docker push $1 + out=$? + else + docker push $1 2> /dev/null > /dev/null + out=$? + fi + [[ $save =~ e ]] && set -e + if [ $out -eq 0 ]; then + ViashNotice "Container '$1' push succeeded." + else + ViashError "Container '$1' push errored. You might not be logged in or have the necessary permissions." + fi + return $out +} + +# ViashDockerPullElseBuild: pull a Docker image, else build it +# +# $1 : image identifier with format `[registry/]image[:tag]` +# ViashDockerBuild : a Bash function which builds a docker image, takes image identifier as argument. +# examples: +# ViashDockerPullElseBuild mynewcomponent +function ViashDockerPullElseBuild { + save=$-; set +e + ViashDockerPull $1 + out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashDockerBuild $@ + fi +} + +# ViashDockerSetup: create a Docker image, according to specified docker setup strategy +# +# $1 : image identifier with format `[registry/]image[:tag]` +# $2 : docker setup strategy, see DockerSetupStrategy.scala +# examples: +# ViashDockerSetup mynewcomponent alwaysbuild +function ViashDockerSetup { + local image_id="$1" + local setup_strategy="$2" + if [ "$setup_strategy" == "alwaysbuild" -o "$setup_strategy" == "build" -o "$setup_strategy" == "b" ]; then + ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "alwayspull" -o "$setup_strategy" == "pull" -o "$setup_strategy" == "p" ]; then + ViashDockerPull $image_id + elif [ "$setup_strategy" == "alwayspullelsebuild" -o "$setup_strategy" == "pullelsebuild" ]; then + ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "alwayspullelsecachedbuild" -o "$setup_strategy" == "pullelsecachedbuild" ]; then + ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "alwayscachedbuild" -o "$setup_strategy" == "cachedbuild" -o "$setup_strategy" == "cb" ]; then + ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id") + elif [[ "$setup_strategy" =~ ^ifneedbe ]]; then + local save=$-; set +e + ViashDockerLocalTagCheck $image_id + local outCheck=$? + [[ $save =~ e ]] && set -e + if [ $outCheck -eq 0 ]; then + ViashInfo "Image $image_id already exists" + elif [ "$setup_strategy" == "ifneedbebuild" ]; then + ViashDockerBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "ifneedbecachedbuild" ]; then + ViashDockerBuild $image_id $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "ifneedbepull" ]; then + ViashDockerPull $image_id + elif [ "$setup_strategy" == "ifneedbepullelsebuild" ]; then + ViashDockerPullElseBuild $image_id --no-cache $(ViashDockerBuildArgs "$engine_id") + elif [ "$setup_strategy" == "ifneedbepullelsecachedbuild" ]; then + ViashDockerPullElseBuild $image_id $(ViashDockerBuildArgs "$engine_id") + else + ViashError "Unrecognised Docker strategy: $setup_strategy" + exit 1 + fi + elif [ "$setup_strategy" == "push" -o "$setup_strategy" == "forcepush" -o "$setup_strategy" == "alwayspush" ]; then + ViashDockerPush "$image_id" + elif [ "$setup_strategy" == "pushifnotpresent" -o "$setup_strategy" == "gentlepush" -o "$setup_strategy" == "maybepush" ]; then + local save=$-; set +e + ViashDockerRemoteTagCheck $image_id + local outCheck=$? + [[ $save =~ e ]] && set -e + if [ $outCheck -eq 0 ]; then + ViashNotice "Container '$image_id' exists, doing nothing." + else + ViashNotice "Container '$image_id' does not yet exist." + ViashDockerPush "$image_id" + fi + elif [ "$setup_strategy" == "donothing" -o "$setup_strategy" == "meh" ]; then + ViashNotice "Skipping setup." + else + ViashError "Unrecognised Docker strategy: $setup_strategy" + exit 1 + fi +} + +# ViashDockerCheckCommands: Check whether a docker container has the required commands +# +# $1 : image identifier with format `[registry/]image[:tag]` +# $@ : commands to verify being present +# examples: +# ViashDockerCheckCommands bash:4.0 bash ps foo +function ViashDockerCheckCommands { + local image_id="$1" + shift 1 + local commands="$@" + local save=$-; set +e + local missing # mark 'missing' as local in advance, otherwise the exit code of the command will be missing and always be '0' + missing=$(docker run --rm --entrypoint=sh "$image_id" -c "for command in $commands; do command -v \$command >/dev/null 2>&1; if [ \$? -ne 0 ]; then echo \$command; exit 1; fi; done") + local outCheck=$? + [[ $save =~ e ]] && set -e + if [ $outCheck -ne 0 ]; then + ViashError "Docker container '$image_id' does not contain command '$missing'." + exit 1 + fi +} + +# ViashDockerBuild: build a docker image +# $1 : image identifier with format `[registry/]image[:tag]` +# $... : additional arguments to pass to docker build +# $VIASH_META_TEMP_DIR : temporary directory to store dockerfile & optional resources in +# $VIASH_META_NAME : name of the component +# $VIASH_META_RESOURCES_DIR : directory containing the resources +# $VIASH_VERBOSITY : verbosity level +# exit code $? : whether or not the image was built successfully +function ViashDockerBuild { + local image_id="$1" + shift 1 + + # create temporary directory to store dockerfile & optional resources in + local tmpdir=$(mktemp -d "$VIASH_META_TEMP_DIR/dockerbuild-$VIASH_META_NAME-XXXXXX") + local dockerfile="$tmpdir/Dockerfile" + function clean_up { + rm -rf "$tmpdir" + } + trap clean_up EXIT + + # store dockerfile and resources + ViashDockerfile "$VIASH_ENGINE_ID" > "$dockerfile" + + # generate the build command + local docker_build_cmd="docker build -t '$image_id' $@ '$VIASH_META_RESOURCES_DIR' -f '$dockerfile'" + + # build the container + ViashNotice "Building container '$image_id' with Dockerfile" + ViashInfo "$docker_build_cmd" + local save=$-; set +e + if [ $VIASH_VERBOSITY -ge $VIASH_LOGCODE_INFO ]; then + eval $docker_build_cmd + else + eval $docker_build_cmd &> "$tmpdir/docker_build.log" + fi + + # check exit code + local out=$? + [[ $save =~ e ]] && set -e + if [ $out -ne 0 ]; then + ViashError "Error occurred while building container '$image_id'" + if [ $VIASH_VERBOSITY -lt $VIASH_LOGCODE_INFO ]; then + ViashError "Transcript: --------------------------------" + cat "$tmpdir/docker_build.log" + ViashError "End of transcript --------------------------" + fi + exit 1 + fi +} + +######## End of helper functions for setting up Docker images for viash ######## + +# ViashDockerFile: print the dockerfile to stdout +# $1 : engine identifier +# return : dockerfile required to run this component +# examples: +# ViashDockerFile +function ViashDockerfile { + local engine_id="$1" + + if [[ "$engine_id" == "docker" ]]; then + cat << 'VIASHDOCKER' +FROM debian:stable-slim +ENTRYPOINT [] +RUN apt-get update && \ + DEBIAN_FRONTEND=noninteractive apt-get install -y procps gzip bzip2 parallel wget zlib1g-dev unzip xxd file && \ + rm -rf /var/lib/apt/lists/* + +ENV STAR_VERSION "2.7.11b" +ENV STAR_SOURCE "https://github.com/alexdobin/STAR/releases/download/$STAR_VERSION/STAR_$STAR_VERSION.zip" +ENV STAR_TARGET "/tmp/star.zip" +ENV STAR_BINARY "STAR" +RUN wget -O $STAR_TARGET $STAR_SOURCE && \ + unzip $STAR_TARGET -d /tmp && \ + mv /tmp/STAR_$STAR_VERSION/Linux_x86_64_static/STAR /usr/local/bin/$STAR_BINARY && \ + chmod +x /usr/local/bin/$STAR_BINARY && \ + rm $STAR_TARGET && rm -rf /tmp/STAR_$STAR_VERSION + +LABEL org.opencontainers.image.description="Companion container for running component parallel_map" +LABEL org.opencontainers.image.created="2024-08-20T13:54:57Z" +LABEL org.opencontainers.image.source="https://github.com/viash-hub/htrnaseq" +LABEL org.opencontainers.image.revision="7c0705a514b86c8d335f308abf7fb1b62d16aa2f" +LABEL org.opencontainers.image.version="unpack_genome" + +VIASHDOCKER + fi +} + +# ViashDockerBuildArgs: return the arguments to pass to docker build +# $1 : engine identifier +# return : arguments to pass to docker build +function ViashDockerBuildArgs { + local engine_id="$1" + + if [[ "$engine_id" == "docker" ]]; then + echo "" + fi +} + +# ViashAbsolutePath: generate absolute path from relative path +# borrowed from https://stackoverflow.com/a/21951256 +# $1 : relative filename +# return : absolute path +# examples: +# ViashAbsolutePath some_file.txt # returns /path/to/some_file.txt +# ViashAbsolutePath /foo/bar/.. # returns /foo +function ViashAbsolutePath { + local thePath + if [[ ! "$1" =~ ^/ ]]; then + thePath="$PWD/$1" + else + thePath="$1" + fi + echo "$thePath" | ( + IFS=/ + read -a parr + declare -a outp + for i in "${parr[@]}"; do + case "$i" in + ''|.) continue ;; + ..) + len=${#outp[@]} + if ((len==0)); then + continue + else + unset outp[$((len-1))] + fi + ;; + *) + len=${#outp[@]} + outp[$len]="$i" + ;; + esac + done + echo /"${outp[*]}" + ) +} +# ViashDockerAutodetectMount: auto configuring docker mounts from parameters +# $1 : The parameter value +# returns : New parameter +# $VIASH_DIRECTORY_MOUNTS : Added another parameter to be passed to docker +# examples: +# ViashDockerAutodetectMount /path/to/bar # returns '/viash_automount/path/to/bar' +# ViashDockerAutodetectMountArg /path/to/bar # returns '--volume="/path/to:/viash_automount/path/to"' +function ViashDockerAutodetectMount { + abs_path=$(ViashAbsolutePath "$1") + if [ -d "$abs_path" ]; then + mount_source="$abs_path" + base_name="" + else + mount_source=`dirname "$abs_path"` + base_name=`basename "$abs_path"` + fi + mount_target="/viash_automount$mount_source" + if [ -z "$base_name" ]; then + echo "$mount_target" + else + echo "$mount_target/$base_name" + fi +} +function ViashDockerAutodetectMountArg { + abs_path=$(ViashAbsolutePath "$1") + if [ -d "$abs_path" ]; then + mount_source="$abs_path" + base_name="" + else + mount_source=`dirname "$abs_path"` + base_name=`basename "$abs_path"` + fi + mount_target="/viash_automount$mount_source" + ViashDebug "ViashDockerAutodetectMountArg $1 -> $mount_source -> $mount_target" + echo "--volume=\"$mount_source:$mount_target\"" +} +function ViashDockerStripAutomount { + abs_path=$(ViashAbsolutePath "$1") + echo "${abs_path#/viash_automount}" +} +# initialise variables +VIASH_DIRECTORY_MOUNTS=() + +# initialise docker variables +VIASH_DOCKER_RUN_ARGS=(-i --rm) + +# initialise array +VIASH_POSITIONAL_ARGS='' + +while [[ $# -gt 0 ]]; do + case "$1" in + -h|--help) + ViashHelp + exit + ;; + ---v|---verbose) + let "VIASH_VERBOSITY=VIASH_VERBOSITY+1" + shift 1 + ;; + ---verbosity) + VIASH_VERBOSITY="$2" + shift 2 + ;; + ---verbosity=*) + VIASH_VERBOSITY="$(ViashRemoveFlags "$1")" + shift 1 + ;; + --version) + echo "parallel_map unpack_genome" + exit + ;; + --input_r1) + if [ -z "$VIASH_PAR_INPUT_R1" ]; then + VIASH_PAR_INPUT_R1="$2" + else + VIASH_PAR_INPUT_R1="$VIASH_PAR_INPUT_R1;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --input_r1. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --input_r1=*) + if [ -z "$VIASH_PAR_INPUT_R1" ]; then + VIASH_PAR_INPUT_R1=$(ViashRemoveFlags "$1") + else + VIASH_PAR_INPUT_R1="$VIASH_PAR_INPUT_R1;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --input_r2) + if [ -z "$VIASH_PAR_INPUT_R2" ]; then + VIASH_PAR_INPUT_R2="$2" + else + VIASH_PAR_INPUT_R2="$VIASH_PAR_INPUT_R2;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --input_r2. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --input_r2=*) + if [ -z "$VIASH_PAR_INPUT_R2" ]; then + VIASH_PAR_INPUT_R2=$(ViashRemoveFlags "$1") + else + VIASH_PAR_INPUT_R2="$VIASH_PAR_INPUT_R2;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --genomeDir) + [ -n "$VIASH_PAR_GENOMEDIR" ] && ViashError Bad arguments for option \'--genomeDir\': \'$VIASH_PAR_GENOMEDIR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_GENOMEDIR="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --genomeDir. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --genomeDir=*) + [ -n "$VIASH_PAR_GENOMEDIR" ] && ViashError Bad arguments for option \'--genomeDir=*\': \'$VIASH_PAR_GENOMEDIR\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_GENOMEDIR=$(ViashRemoveFlags "$1") + shift 1 + ;; + --barcodes) + if [ -z "$VIASH_PAR_BARCODES" ]; then + VIASH_PAR_BARCODES="$2" + else + VIASH_PAR_BARCODES="$VIASH_PAR_BARCODES;""$2" + fi + [ $# -lt 2 ] && ViashError Not enough arguments passed to --barcodes. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --barcodes=*) + if [ -z "$VIASH_PAR_BARCODES" ]; then + VIASH_PAR_BARCODES=$(ViashRemoveFlags "$1") + else + VIASH_PAR_BARCODES="$VIASH_PAR_BARCODES;"$(ViashRemoveFlags "$1") + fi + shift 1 + ;; + --wellBarcodesLength) + [ -n "$VIASH_PAR_WELLBARCODESLENGTH" ] && ViashError Bad arguments for option \'--wellBarcodesLength\': \'$VIASH_PAR_WELLBARCODESLENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_WELLBARCODESLENGTH="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --wellBarcodesLength. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --wellBarcodesLength=*) + [ -n "$VIASH_PAR_WELLBARCODESLENGTH" ] && ViashError Bad arguments for option \'--wellBarcodesLength=*\': \'$VIASH_PAR_WELLBARCODESLENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_WELLBARCODESLENGTH=$(ViashRemoveFlags "$1") + shift 1 + ;; + --umiLength) + [ -n "$VIASH_PAR_UMILENGTH" ] && ViashError Bad arguments for option \'--umiLength\': \'$VIASH_PAR_UMILENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_UMILENGTH="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --umiLength. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --umiLength=*) + [ -n "$VIASH_PAR_UMILENGTH" ] && ViashError Bad arguments for option \'--umiLength=*\': \'$VIASH_PAR_UMILENGTH\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_UMILENGTH=$(ViashRemoveFlags "$1") + shift 1 + ;; + --limitBAMsortRAM) + [ -n "$VIASH_PAR_LIMITBAMSORTRAM" ] && ViashError Bad arguments for option \'--limitBAMsortRAM\': \'$VIASH_PAR_LIMITBAMSORTRAM\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_LIMITBAMSORTRAM="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --limitBAMsortRAM. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --limitBAMsortRAM=*) + [ -n "$VIASH_PAR_LIMITBAMSORTRAM" ] && ViashError Bad arguments for option \'--limitBAMsortRAM=*\': \'$VIASH_PAR_LIMITBAMSORTRAM\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_LIMITBAMSORTRAM=$(ViashRemoveFlags "$1") + shift 1 + ;; + --runThreadN) + [ -n "$VIASH_PAR_RUNTHREADN" ] && ViashError Bad arguments for option \'--runThreadN\': \'$VIASH_PAR_RUNTHREADN\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_RUNTHREADN="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --runThreadN. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --runThreadN=*) + [ -n "$VIASH_PAR_RUNTHREADN" ] && ViashError Bad arguments for option \'--runThreadN=*\': \'$VIASH_PAR_RUNTHREADN\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_RUNTHREADN=$(ViashRemoveFlags "$1") + shift 1 + ;; + --output) + [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_OUTPUT="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --output. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --output=*) + [ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'--output=*\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_OUTPUT=$(ViashRemoveFlags "$1") + shift 1 + ;; + --joblog) + [ -n "$VIASH_PAR_JOBLOG" ] && ViashError Bad arguments for option \'--joblog\': \'$VIASH_PAR_JOBLOG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_JOBLOG="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to --joblog. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + --joblog=*) + [ -n "$VIASH_PAR_JOBLOG" ] && ViashError Bad arguments for option \'--joblog=*\': \'$VIASH_PAR_JOBLOG\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_PAR_JOBLOG=$(ViashRemoveFlags "$1") + shift 1 + ;; + ---engine) + VIASH_ENGINE_ID="$2" + shift 2 + ;; + ---engine=*) + VIASH_ENGINE_ID="$(ViashRemoveFlags "$1")" + shift 1 + ;; + ---setup) + VIASH_MODE='setup' + VIASH_SETUP_STRATEGY="$2" + shift 2 + ;; + ---setup=*) + VIASH_MODE='setup' + VIASH_SETUP_STRATEGY="$(ViashRemoveFlags "$1")" + shift 1 + ;; + ---dockerfile) + VIASH_MODE='dockerfile' + shift 1 + ;; + ---debug) + VIASH_MODE='debug' + shift 1 + ;; + ---cpus) + [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_CPUS="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to ---cpus. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + ---cpus=*) + [ -n "$VIASH_META_CPUS" ] && ViashError Bad arguments for option \'---cpus=*\': \'$VIASH_META_CPUS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_CPUS=$(ViashRemoveFlags "$1") + shift 1 + ;; + ---memory) + [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_MEMORY="$2" + [ $# -lt 2 ] && ViashError Not enough arguments passed to ---memory. Use "--help" to get more information on the parameters. && exit 1 + shift 2 + ;; + ---memory=*) + [ -n "$VIASH_META_MEMORY" ] && ViashError Bad arguments for option \'---memory=*\': \'$VIASH_META_MEMORY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1 + VIASH_META_MEMORY=$(ViashRemoveFlags "$1") + shift 1 + ;; + *) # positional arg or unknown option + # since the positional args will be eval'd, can we always quote, instead of using ViashQuote + VIASH_POSITIONAL_ARGS="$VIASH_POSITIONAL_ARGS '$1'" + [[ $1 == -* ]] && ViashWarning $1 looks like a parameter but is not a defined parameter and will instead be treated as a positional argument. Use "--help" to get more information on the parameters. + shift # past argument + ;; + esac +done + +# parse positional parameters +eval set -- $VIASH_POSITIONAL_ARGS + + +if [ "$VIASH_ENGINE_ID" == "native" ] ; then + VIASH_ENGINE_TYPE='native' +elif [ "$VIASH_ENGINE_ID" == "docker" ] ; then + VIASH_ENGINE_TYPE='docker' +else + ViashError "Engine '$VIASH_ENGINE_ID' is not recognized. Options are: docker, native." + exit 1 +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # check if docker is installed properly + ViashDockerInstallationCheck + + # determine docker image id + if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then + VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/htrnaseq/parallel_map:unpack_genome' + fi + + # print dockerfile + if [ "$VIASH_MODE" == "dockerfile" ]; then + ViashDockerfile "$VIASH_ENGINE_ID" + exit 0 + + # enter docker container + elif [[ "$VIASH_MODE" == "debug" ]]; then + VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} -v '$(pwd)':/pwd --workdir /pwd -t $VIASH_DOCKER_IMAGE_ID" + ViashNotice "+ $VIASH_CMD" + eval $VIASH_CMD + exit + + # build docker image + elif [ "$VIASH_MODE" == "setup" ]; then + ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" "$VIASH_SETUP_STRATEGY" + ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash' + exit 0 + fi + + # check if docker image exists + ViashDockerSetup "$VIASH_DOCKER_IMAGE_ID" ifneedbepullelsecachedbuild + ViashDockerCheckCommands "$VIASH_DOCKER_IMAGE_ID" 'ps' 'bash' +fi + +# setting computational defaults + +# helper function for parsing memory strings +function ViashMemoryAsBytes { + local memory=`echo "$1" | tr '[:upper:]' '[:lower:]' | tr -d '[:space:]'` + local memory_regex='^([0-9]+)([kmgtp]i?b?|b)$' + if [[ $memory =~ $memory_regex ]]; then + local number=${memory/[^0-9]*/} + local symbol=${memory/*[0-9]/} + + case $symbol in + b) memory_b=$number ;; + kb|k) memory_b=$(( $number * 1000 )) ;; + mb|m) memory_b=$(( $number * 1000 * 1000 )) ;; + gb|g) memory_b=$(( $number * 1000 * 1000 * 1000 )) ;; + tb|t) memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 )) ;; + pb|p) memory_b=$(( $number * 1000 * 1000 * 1000 * 1000 * 1000 )) ;; + kib|ki) memory_b=$(( $number * 1024 )) ;; + mib|mi) memory_b=$(( $number * 1024 * 1024 )) ;; + gib|gi) memory_b=$(( $number * 1024 * 1024 * 1024 )) ;; + tib|ti) memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 )) ;; + pib|pi) memory_b=$(( $number * 1024 * 1024 * 1024 * 1024 * 1024 )) ;; + esac + echo "$memory_b" + fi +} +# compute memory in different units +if [ ! -z ${VIASH_META_MEMORY+x} ]; then + VIASH_META_MEMORY_B=`ViashMemoryAsBytes $VIASH_META_MEMORY` + # do not define other variables if memory_b is an empty string + if [ ! -z "$VIASH_META_MEMORY_B" ]; then + VIASH_META_MEMORY_KB=$(( ($VIASH_META_MEMORY_B+999) / 1000 )) + VIASH_META_MEMORY_MB=$(( ($VIASH_META_MEMORY_KB+999) / 1000 )) + VIASH_META_MEMORY_GB=$(( ($VIASH_META_MEMORY_MB+999) / 1000 )) + VIASH_META_MEMORY_TB=$(( ($VIASH_META_MEMORY_GB+999) / 1000 )) + VIASH_META_MEMORY_PB=$(( ($VIASH_META_MEMORY_TB+999) / 1000 )) + VIASH_META_MEMORY_KIB=$(( ($VIASH_META_MEMORY_B+1023) / 1024 )) + VIASH_META_MEMORY_MIB=$(( ($VIASH_META_MEMORY_KIB+1023) / 1024 )) + VIASH_META_MEMORY_GIB=$(( ($VIASH_META_MEMORY_MIB+1023) / 1024 )) + VIASH_META_MEMORY_TIB=$(( ($VIASH_META_MEMORY_GIB+1023) / 1024 )) + VIASH_META_MEMORY_PIB=$(( ($VIASH_META_MEMORY_TIB+1023) / 1024 )) + else + # unset memory if string is empty + unset $VIASH_META_MEMORY_B + fi +fi +# unset nproc if string is empty +if [ -z "$VIASH_META_CPUS" ]; then + unset $VIASH_META_CPUS +fi + + +# check whether required parameters exist +if [ -z ${VIASH_PAR_INPUT_R1+x} ]; then + ViashError '--input_r1' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_PAR_INPUT_R2+x} ]; then + ViashError '--input_r2' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_PAR_GENOMEDIR+x} ]; then + ViashError '--genomeDir' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_PAR_BARCODES+x} ]; then + ViashError '--barcodes' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_PAR_WELLBARCODESLENGTH+x} ]; then + ViashError '--wellBarcodesLength' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_PAR_UMILENGTH+x} ]; then + ViashError '--umiLength' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_PAR_OUTPUT+x} ]; then + ViashError '--output' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_NAME+x} ]; then + ViashError 'name' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then + ViashError 'functionality_name' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_RESOURCES_DIR+x} ]; then + ViashError 'resources_dir' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_EXECUTABLE+x} ]; then + ViashError 'executable' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_CONFIG+x} ]; then + ViashError 'config' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi +if [ -z ${VIASH_META_TEMP_DIR+x} ]; then + ViashError 'temp_dir' is a required argument. Use "--help" to get more information on the parameters. + exit 1 +fi + +# filling in defaults +if [ -z ${VIASH_PAR_LIMITBAMSORTRAM+x} ]; then + VIASH_PAR_LIMITBAMSORTRAM="10000000000" +fi +if [ -z ${VIASH_PAR_RUNTHREADN+x} ]; then + VIASH_PAR_RUNTHREADN="1" +fi +if [ -z ${VIASH_PAR_JOBLOG+x} ]; then + VIASH_PAR_JOBLOG="execution_log.txt" +fi + +# check whether required files exist +if [ ! -z "$VIASH_PAR_INPUT_R1" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_INPUT_R1; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_INPUT_R2" ]; then + IFS=';' + set -f + for file in $VIASH_PAR_INPUT_R2; do + unset IFS + if [ ! -e "$file" ]; then + ViashError "Input file '$file' does not exist." + exit 1 + fi + done + set +f +fi +if [ ! -z "$VIASH_PAR_GENOMEDIR" ] && [ ! -e "$VIASH_PAR_GENOMEDIR" ]; then + ViashError "Input file '$VIASH_PAR_GENOMEDIR' does not exist." + exit 1 +fi + +# check whether parameters values are of the right type +if [[ -n "$VIASH_PAR_WELLBARCODESLENGTH" ]]; then + if ! [[ "$VIASH_PAR_WELLBARCODESLENGTH" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--wellBarcodesLength' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_UMILENGTH" ]]; then + if ! [[ "$VIASH_PAR_UMILENGTH" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--umiLength' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_RUNTHREADN" ]]; then + if ! [[ "$VIASH_PAR_RUNTHREADN" =~ ^[-+]?[0-9]+$ ]]; then + ViashError '--runThreadN' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_PAR_OUTPUT" ]]; then + if ! [[ "$VIASH_PAR_OUTPUT" =~ \* ]]; then + ViashError '--output' has to be a path containing a wildcard, e.g. 'output_*.txt'. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_CPUS" ]]; then + if ! [[ "$VIASH_META_CPUS" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'cpus' has to be an integer. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_B" ]]; then + if ! [[ "$VIASH_META_MEMORY_B" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_b' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_KB" ]]; then + if ! [[ "$VIASH_META_MEMORY_KB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_kb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_MB" ]]; then + if ! [[ "$VIASH_META_MEMORY_MB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_mb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_GB" ]]; then + if ! [[ "$VIASH_META_MEMORY_GB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_gb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_TB" ]]; then + if ! [[ "$VIASH_META_MEMORY_TB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_tb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_PB" ]]; then + if ! [[ "$VIASH_META_MEMORY_PB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_pb' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_KIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_KIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_kib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_MIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_MIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_mib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_GIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_GIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_gib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_TIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_TIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_tib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi +if [[ -n "$VIASH_META_MEMORY_PIB" ]]; then + if ! [[ "$VIASH_META_MEMORY_PIB" =~ ^[-+]?[0-9]+$ ]]; then + ViashError 'memory_pib' has to be a long. Use "--help" to get more information on the parameters. + exit 1 + fi +fi + +# create parent directories of output files, if so desired +if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT")" ]; then + mkdir -p "$(dirname "$VIASH_PAR_OUTPUT")" +fi +if [ ! -z "$VIASH_PAR_JOBLOG" ] && [ ! -d "$(dirname "$VIASH_PAR_JOBLOG")" ]; then + mkdir -p "$(dirname "$VIASH_PAR_JOBLOG")" +fi + +if [ "$VIASH_ENGINE_ID" == "native" ] ; then + if [ "$VIASH_MODE" == "run" ]; then + VIASH_CMD="bash" + else + ViashError "Engine '$VIASH_ENGINE_ID' does not support mode '$VIASH_MODE'." + exit 1 + fi +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # detect volumes from file arguments + VIASH_CHOWN_VARS=() +if [ ! -z "$VIASH_PAR_INPUT_R1" ]; then + VIASH_TEST_INPUT_R1=() + IFS=';' + for var in $VIASH_PAR_INPUT_R1; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_INPUT_R1+=( "$var" ) + done + VIASH_PAR_INPUT_R1=$(IFS=';' ; echo "${VIASH_TEST_INPUT_R1[*]}") +fi +if [ ! -z "$VIASH_PAR_INPUT_R2" ]; then + VIASH_TEST_INPUT_R2=() + IFS=';' + for var in $VIASH_PAR_INPUT_R2; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_INPUT_R2+=( "$var" ) + done + VIASH_PAR_INPUT_R2=$(IFS=';' ; echo "${VIASH_TEST_INPUT_R2[*]}") +fi +if [ ! -z "$VIASH_PAR_GENOMEDIR" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_GENOMEDIR")" ) + VIASH_PAR_GENOMEDIR=$(ViashDockerAutodetectMount "$VIASH_PAR_GENOMEDIR") +fi +if [ ! -z "$VIASH_PAR_OUTPUT" ]; then + VIASH_TEST_OUTPUT=() + IFS=';' + for var in $VIASH_PAR_OUTPUT; do + unset IFS + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$var")" ) + var=$(ViashDockerAutodetectMount "$var") + VIASH_TEST_OUTPUT+=( "$var" ) + VIASH_CHOWN_VARS+=( "$var" ) + done + VIASH_PAR_OUTPUT=$(IFS=';' ; echo "${VIASH_TEST_OUTPUT[*]}") +fi +if [ ! -z "$VIASH_PAR_JOBLOG" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_JOBLOG")" ) + VIASH_PAR_JOBLOG=$(ViashDockerAutodetectMount "$VIASH_PAR_JOBLOG") + VIASH_CHOWN_VARS+=( "$VIASH_PAR_JOBLOG" ) +fi +if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" ) + VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR") +fi +if [ ! -z "$VIASH_META_EXECUTABLE" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_EXECUTABLE")" ) + VIASH_META_EXECUTABLE=$(ViashDockerAutodetectMount "$VIASH_META_EXECUTABLE") +fi +if [ ! -z "$VIASH_META_CONFIG" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_CONFIG")" ) + VIASH_META_CONFIG=$(ViashDockerAutodetectMount "$VIASH_META_CONFIG") +fi +if [ ! -z "$VIASH_META_TEMP_DIR" ]; then + VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_TEMP_DIR")" ) + VIASH_META_TEMP_DIR=$(ViashDockerAutodetectMount "$VIASH_META_TEMP_DIR") +fi + + # get unique mounts + VIASH_UNIQUE_MOUNTS=($(for val in "${VIASH_DIRECTORY_MOUNTS[@]}"; do echo "$val"; done | sort -u)) +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # change file ownership + function ViashPerformChown { + if (( ${#VIASH_CHOWN_VARS[@]} )); then + set +e + VIASH_CMD="docker run --entrypoint=bash --rm ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID -c 'chown $(id -u):$(id -g) --silent --recursive ${VIASH_CHOWN_VARS[@]}'" + ViashDebug "+ $VIASH_CMD" + eval $VIASH_CMD + set -e + fi + } + trap ViashPerformChown EXIT +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # helper function for filling in extra docker args + if [ ! -z "$VIASH_META_MEMORY_B" ]; then + VIASH_DOCKER_RUN_ARGS+=("--memory=${VIASH_META_MEMORY_B}") + fi + if [ ! -z "$VIASH_META_CPUS" ]; then + VIASH_DOCKER_RUN_ARGS+=("--cpus=${VIASH_META_CPUS}") + fi +fi + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + VIASH_CMD="docker run --entrypoint=bash ${VIASH_DOCKER_RUN_ARGS[@]} ${VIASH_UNIQUE_MOUNTS[@]} $VIASH_DOCKER_IMAGE_ID" +fi + + +# set dependency paths + + +ViashDebug "Running command: $(echo $VIASH_CMD)" +cat << VIASHEOF | eval $VIASH_CMD +set -e +tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-parallel_map-XXXXXX").sh +function clean_up { + rm "\$tempscript" +} +function interrupt { + echo -e "\nCTRL-C Pressed..." + exit 1 +} +trap clean_up EXIT +trap interrupt INT SIGINT +cat > "\$tempscript" << 'VIASHMAIN' +#!/bin/bash + +## VIASH START +# The following code has been auto-generated by Viash. +$( if [ ! -z ${VIASH_PAR_INPUT_R1+x} ]; then echo "${VIASH_PAR_INPUT_R1}" | sed "s#'#'\"'\"'#g;s#.*#par_input_r1='&'#" ; else echo "# par_input_r1="; fi ) +$( if [ ! -z ${VIASH_PAR_INPUT_R2+x} ]; then echo "${VIASH_PAR_INPUT_R2}" | sed "s#'#'\"'\"'#g;s#.*#par_input_r2='&'#" ; else echo "# par_input_r2="; fi ) +$( if [ ! -z ${VIASH_PAR_GENOMEDIR+x} ]; then echo "${VIASH_PAR_GENOMEDIR}" | sed "s#'#'\"'\"'#g;s#.*#par_genomeDir='&'#" ; else echo "# par_genomeDir="; fi ) +$( if [ ! -z ${VIASH_PAR_BARCODES+x} ]; then echo "${VIASH_PAR_BARCODES}" | sed "s#'#'\"'\"'#g;s#.*#par_barcodes='&'#" ; else echo "# par_barcodes="; fi ) +$( if [ ! -z ${VIASH_PAR_WELLBARCODESLENGTH+x} ]; then echo "${VIASH_PAR_WELLBARCODESLENGTH}" | sed "s#'#'\"'\"'#g;s#.*#par_wellBarcodesLength='&'#" ; else echo "# par_wellBarcodesLength="; fi ) +$( if [ ! -z ${VIASH_PAR_UMILENGTH+x} ]; then echo "${VIASH_PAR_UMILENGTH}" | sed "s#'#'\"'\"'#g;s#.*#par_umiLength='&'#" ; else echo "# par_umiLength="; fi ) +$( if [ ! -z ${VIASH_PAR_LIMITBAMSORTRAM+x} ]; then echo "${VIASH_PAR_LIMITBAMSORTRAM}" | sed "s#'#'\"'\"'#g;s#.*#par_limitBAMsortRAM='&'#" ; else echo "# par_limitBAMsortRAM="; fi ) +$( if [ ! -z ${VIASH_PAR_RUNTHREADN+x} ]; then echo "${VIASH_PAR_RUNTHREADN}" | sed "s#'#'\"'\"'#g;s#.*#par_runThreadN='&'#" ; else echo "# par_runThreadN="; fi ) +$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi ) +$( if [ ! -z ${VIASH_PAR_JOBLOG+x} ]; then echo "${VIASH_PAR_JOBLOG}" | sed "s#'#'\"'\"'#g;s#.*#par_joblog='&'#" ; else echo "# par_joblog="; fi ) +$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi ) +$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi ) +$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi ) +$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\"'\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi ) +$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\"'\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi ) +$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi ) +$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\"'\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi ) + +## VIASH END + +set -eo pipefail + +# Check if wildcard character is present in output folder template +printf "Checking if output folder template (\$par_output) contains a single wildcard character '*'. " +output_glob_character="\${par_output//[^\\*]}" +if [[ "\${#output_glob_character}" -ne "1" ]]; then + echo "The value for --output must contain exactly one '*' character. Exiting..." + exit 1 +else + echo "Done, wildcard character found!" +fi + +# Split the delimited strings into arrays +IFS=';' read -r -a barcodes <<< "\$par_barcodes" +IFS=';' read -r -a input_r1 <<< "\$par_input_r1" +IFS=';' read -r -a input_r2 <<< "\$par_input_r2" + +# Check that the number of values provided for the barcodes and the fastq files are the same. +num_barcodes="\${#barcodes[@]}" +num_r1_inputs="\${#input_r1[@]}" +num_r2_inputs="\${#input_r2[@]}" + +if [ ! "\$num_barcodes" -eq "\$num_r1_inputs" ] || [ ! "\$num_r1_inputs" -eq "\$num_r2_inputs" ]; then + echo "The number of values for arguments 'barcodes' (\$num_barcodes), "\\ + "'input_r1' (\$num_r1_inputs) and 'input_r2' (\$num_r2_inputs) "\\ + "should be the same, and their order should match." + exit 1 +else + echo "Checked if length of barcodes input (\$num_barcodes) is "\\ + "the same as R1 reads (\$num_r1_inputs) and R2 reads "\\ + "(\$num_r2_inputs). Seems OK!" +fi + +# Function to test for unique values in array +function arrayContainsUniqueValues { + # Pass the argument by reference + local -n arr=\$1 + # Create a temporary associative array + # in order to use its uniqueness of keys + # 'declare' in a function is automatically local + declare -A uniq_tmp + for item in "\${arr[@]}"; do + uniq_tmp[\$item]=0 # assigning a placeholder + done + local unique_array_values=(\${!uniq_tmp[@]}) + if [ "\${#unique_array_values[@]}" -eq "\${#arr[@]}" ]; then + return + fi + false +} +arrayContainsUniqueValues barcodes +is_array_unique_exit_code=\$? +if ! (exit \$is_array_unique_exit_code); then + echo "The provided barcodes should be unique!" + echo "Values: \$par_barcodes" + exit 1 +fi + +# Define the function that will be used to run a single job +function _run() { + local par_wellBarcodeLength="\$1" + local par_UMIlength="\$2" + local par_output="\$3" + local par_genomeDir="\$4" + local par_limitBAMsortRAM="\$5" + local par_runThreadN="\$6" + local barcode="\$7" + local input_R1="\$8" + local input_R2="\$9" + local par_UMIstart=\$((\$par_wellBarcodeLength + 1)) + + set -eo pipefail + + echo <<-EOF + Processing \$barcode + For the following inputs (lanes): + "\$star_readFilesIn + EOF + + echo "Writing barcode '\$barcode' to \$barcode.txt and using it as input". + # Note that there is no possible conflict between jobs here + # because the barcodes are unique (and the barcode is part of the name + # of the file). + echo "\$barcode" > "\$barcode.txt" + + local dir="\${par_output//\\*/\$barcode}/" + echo "Setting output for barcode '\$barcode' to '\$dir'." + mkdir -p "\$dir" + + # check if files are compressed + local TMPDIR=\$(mktemp -d "\$meta_temp_dir/parallel_map-\$barcode-XXXXXX") + function clean_up { + [[ -d "\$TMPDIR" ]] && rm -r "\$TMPDIR" + } + trap clean_up RETURN + + # Decompress the input files when needed + # NOTE: for some reason, using STAR's --readFilesCommand does not always work + # This might be because STAR creates fifo files (see https://man7.org/linux/man-pages/man7/fifo.7.html) + # and this requires a filesystem that supports this. Another cause might be that the input files + # are symlinks. When testing this, using '--readFilesCommand "zcat"' + # always produced empty BAM files, but also a succesfull exit code (0) so the problem is not reported. + # However, the logs showed the following error: "gzip -: unexpected end of file". + + function is_gzipped { + printf "Checking if input '\$1' (barcode '\$barcode') is gzipped... " + if file "\$1" | grep -q 'gzip'; then + echo "Done, detected compressed file." + return + fi + echo "Done, file does not need decompression." + false + } + + # Resolve symbolic links to actual file paths + input_R1=\$(realpath \$input_R1) + input_R2=\$(realpath \$input_R2) + + if is_gzipped \$input_R1; then + local compressed_file_name_r1="\$(basename -- \$input_R1)" + local uncompressed_file_r1="\$TMPDIR/\${compressed_file_name_r1%.gz}" + printf "Unpacking input to \$uncompressed_file_r1... " + zcat "\$input_R1" > "\$uncompressed_file_r1" + echo "Decompression done." + else + local uncompressed_file_r1="\$input_R1" + fi + + if is_gzipped \$input_R2; then + local compressed_file_name_r2="\$(basename -- \$input_R2)" + local uncompressed_file_r2="\$TMPDIR/\${compressed_file_name_r2%.gz}" + printf "Unpacking input to \$uncompressed_file_r2... " + zcat "\$input_R2" > "\$uncompressed_file_r2" + echo "Decompression done." + else + local uncompressed_file_r2="\$input_R2" + fi + + local n_input_lines_r1=\$(wc -l < "\$uncompressed_file_r1") + local n_input_lines_r2=\$(wc -l < "\$uncompressed_file_r2") + + printf "Checking if length of input file mates match. " + if (( \$n_input_lines_r1 != n_input_lines_r2 )); then + echo "The length of file \$input_R1 (\$n_input_lines_r1) does not match with \$input_R2 (\$n_input_lines_r2)" + return 1 + else + echo "Seems OK, \$n_input_lines_r1 input lines." + fi + echo "Starting STAR for barcode '\$barcode'" + # soloType 'Droplet' is the same as 'CB_UMI_Simple': one UMI and one cell barcode of fixed length. + # By default in this mode, STAR will look for the cell barcode and the UMI int the last files specified with --readFilesIn + # So we need to specify R2 first and R1 second, because R1 contains the barcode and UMI. + # Also, you might be tempted to use '--soloBarcodeMate 1' to alter this behavior, but this requires the clipping + # the barcode from this mate by specifying --clip5pNbases and/or --clip3pNbases, which we do not want to do. + STAR \\ + --readFilesIn "\$uncompressed_file_r2" "\$uncompressed_file_r1" \\ + --soloType Droplet \\ + --quantMode GeneCounts \\ + --genomeLoad LoadAndKeep \\ + --limitBAMsortRAM "\$par_limitBAMsortRAM" \\ + --runThreadN "\$par_runThreadN" \\ + --outFilterMultimapNmax 1 \\ + --outSAMtype BAM SortedByCoordinate \\ + --soloCBstart 1 \\ + --readFilesType "Fastx" \\ + --soloCBlen "\$par_wellBarcodeLength" \\ + --soloUMIstart "\$par_UMIstart" \\ + --soloUMIlen "\$par_UMIlength" \\ + --soloBarcodeReadLength 0 \\ + --soloStrand Unstranded \\ + --soloFeatures Gene \\ + --genomeDir "\$par_genomeDir" \\ + --outReadsUnmapped Fastx \\ + --outSAMunmapped Within \\ + --outSAMattributes NH HI nM AS CR UR CB UB GX GN \\ + --soloCBwhitelist "\$barcode.txt" \\ + --outFileNamePrefix "\$dir" \\ + --outTmpDir "\$TMPDIR/STARtemp/" + + printf "Done running STAR. " + # Check if the number of processed reads is equal to the number of input reads + local n_input_reads=\$((\$n_input_lines_r1 / 4)) + local nr_output_reads=\$(grep -Po "Number\\ of\\ input\\ reads \\\\|\\W*\\K\\d+" "\$dir/Log.final.out") + if (( \$nr_output_reads != \$n_input_reads )); then + echo "Not all input reads were processed for barcode \$barcode." + return 1 + else + echo "Processed \$nr_output_reads reads for barcode \$barcode". + fi +} + +# Export the function - requires bash +export -f _run + +# Load reference genome +echo "Loading reference genome" +STAR --genomeLoad LoadAndExit --genomeDir "\$par_genomeDir" + +# Run the concurrent jobs using GNU parallel + +# Make sure that parallel uses the correct shell +export PARALLEL_SHELL="/bin/bash" + +# Some notes: +# --halt now,fail=1: instruct parallel to exit when a job has failed and kill remaining running jobs. +# +# ::: is a special syntax for GNU parallel to delineate inputs +# If multiple ::: are given, each group will be treated as an input source, and all combinations of input +# sources will be generated. E.g. ::: 1 2 ::: a b c will result in the combinations (1,a) (1,b) (1,c) (2,a) (2,b) (2,c) +# The delimiter :::+ (note the extra '+') links the argument to the previous argument, and one argument from each of the input +# sources will be read. +parallel_cmd=("parallel" "--jobs" "80%" "--verbose" "--memfree" "2G" + "--tmpdir" "\$meta_temp_dir" + "--retry-failed" "--retries" "4" "--halt" "soon,fail=1" + "--joblog" "\$par_joblog" "_run" "{}") + +# Arguments for which there is one value, so these will not create extra jobs +parallel_cmd+=(":::" "\$par_wellBarcodesLength" ":::" "\$par_umiLength" ":::" "\$par_output" ":::" "\$par_genomeDir" ":::" "\$par_limitBAMsortRAM" ":::" "\$par_runThreadN") + +# Argument which in fact will cause extra jobs to be spawned, per job one item from each argument will be selected +# Thus, these argument lists should have the same length. +parallel_cmd+=(":::" "\${barcodes[@]}" ":::+" "\${input_r1[@]}" ":::+" "\${input_r2[@]}") + +set +eo pipefail +"\${parallel_cmd[@]}" +exit_code=\$? +set -eo pipefail + +echo "GNU parallel finished!" + +# Unload reference +printf "Unloading reference genome. " +STAR --genomeLoad Remove --genomeDir "\$par_genomeDir" +echo "Done!" + +# Exit code from GNU parallel: +# If fail=1 is used, the exit status will be the exit status of the failing job. +echo "Checking exit code" +if ((exit_code>0)); then + # Note that the ending HERE must be indented with TAB characters (not spaces) + # in order to remove leading indentation + MESSAGE=\$( + cat <<-HERE + ================================================================== + + !!! An error occurred for one of the jobs. + Exit code of the failing job: \$exit_code. + + %s + + ================================================================== + + HERE + ) + printf "\$MESSAGE" "\$(<\$par_joblog)" + exit 1 +else + cat <<-HERE + ================================================================== + + Mapping went fine (exit code '\$exit_code'), zero errors occurred + + ================================================================== + HERE + +fi +VIASHMAIN +bash "\$tempscript" & +wait "\$!" + +VIASHEOF + + +if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then + # strip viash automount from file paths + + if [ ! -z "$VIASH_PAR_INPUT_R1" ]; then + unset VIASH_TEST_INPUT_R1 + IFS=';' + for var in $VIASH_PAR_INPUT_R1; do + unset IFS + if [ -z "$VIASH_TEST_INPUT_R1" ]; then + VIASH_TEST_INPUT_R1="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_INPUT_R1="$VIASH_TEST_INPUT_R1;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_INPUT_R1="$VIASH_TEST_INPUT_R1" + fi + if [ ! -z "$VIASH_PAR_INPUT_R2" ]; then + unset VIASH_TEST_INPUT_R2 + IFS=';' + for var in $VIASH_PAR_INPUT_R2; do + unset IFS + if [ -z "$VIASH_TEST_INPUT_R2" ]; then + VIASH_TEST_INPUT_R2="$(ViashDockerStripAutomount "$var")" + else + VIASH_TEST_INPUT_R2="$VIASH_TEST_INPUT_R2;""$(ViashDockerStripAutomount "$var")" + fi + done + VIASH_PAR_INPUT_R2="$VIASH_TEST_INPUT_R2" + fi + if [ ! -z "$VIASH_PAR_GENOMEDIR" ]; then + VIASH_PAR_GENOMEDIR=$(ViashDockerStripAutomount "$VIASH_PAR_GENOMEDIR") + fi + if [ ! -z "$VIASH_PAR_OUTPUT" ]; then + VIASH_PAR_OUTPUT=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT") + fi + if [ ! -z "$VIASH_PAR_JOBLOG" ]; then + VIASH_PAR_JOBLOG=$(ViashDockerStripAutomount "$VIASH_PAR_JOBLOG") + fi + if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then + VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR") + fi + if [ ! -z "$VIASH_META_EXECUTABLE" ]; then + VIASH_META_EXECUTABLE=$(ViashDockerStripAutomount "$VIASH_META_EXECUTABLE") + fi + if [ ! -z "$VIASH_META_CONFIG" ]; then + VIASH_META_CONFIG=$(ViashDockerStripAutomount "$VIASH_META_CONFIG") + fi + if [ ! -z "$VIASH_META_TEMP_DIR" ]; then + VIASH_META_TEMP_DIR=$(ViashDockerStripAutomount "$VIASH_META_TEMP_DIR") + fi +fi + + +# check whether required files exist +if [ ! -z "$VIASH_PAR_OUTPUT" ] && ! compgen -G "$VIASH_PAR_OUTPUT" > /dev/null; then + ViashError "Output file '$VIASH_PAR_OUTPUT' does not exist." + exit 1 +fi +if [ ! -z "$VIASH_PAR_JOBLOG" ] && [ ! -e "$VIASH_PAR_JOBLOG" ]; then + ViashError "Output file '$VIASH_PAR_JOBLOG' does not exist." + exit 1 +fi + + +exit 0 diff --git a/target/nextflow/parallel_map/.config.vsh.yaml b/target/nextflow/parallel_map/.config.vsh.yaml new file mode 100644 index 00000000..e0b6c9d9 --- /dev/null +++ b/target/nextflow/parallel_map/.config.vsh.yaml @@ -0,0 +1,260 @@ +name: "parallel_map" +version: "unpack_genome" +argument_groups: +- name: "Input arguments" + arguments: + - type: "file" + name: "--input_r1" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--input_r2" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--genomeDir" + description: "STAR reference directory" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--barcodes" + description: "The barcodes/wells to process" + info: null + required: true + direction: "input" + multiple: true + multiple_sep: ";" +- name: "Barcode arguments" + arguments: + - type: "integer" + name: "--wellBarcodesLength" + description: "The length of the well barcodes" + info: null + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "integer" + name: "--umiLength" + description: "The length of the UMIs" + info: null + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--limitBAMsortRAM" + info: null + default: + - "10000000000" + required: false + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Runtime arguments" + arguments: + - type: "integer" + name: "--runThreadN" + description: "Number of threads to use for a single STAR execution." + info: null + default: + - 1 + required: false + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output arguments" + arguments: + - type: "file" + name: "--output" + description: "Location of the output folders, 1 folder per barcode. The value\ + \ used\nfor this argument must contain a '*', which will be replaced with the\n\ + barcode to form the final output location for that barcode.\n" + info: null + default: + - "./*" + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--joblog" + description: "Where to store the log file listing all the jobs." + info: null + default: + - "execution_log.txt" + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" +resources: +- type: "bash_script" + path: "script.sh" + is_executable: true +description: "Map wells in batch, using STAR\nSpliced Transcripts Alignment to a Reference\ + \ (C) Alexander Dobin\nhttps://github.com/alexdobin/STAR\n" +test_resources: +- type: "bash_script" + path: "test.sh" + is_executable: true +info: null +status: "enabled" +requirements: + commands: + - "ps" +license: "MIT" +links: + repository: "https://github.com/viash-hub/htrnaseq" +runners: +- type: "executable" + id: "executable" + docker_setup_strategy: "ifneedbepullelsecachedbuild" +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "docker" + id: "docker" + image: "debian:stable-slim" + target_registry: "images.viash-hub.com" + target_tag: "unpack_genome" + namespace_separator: "/" + setup: + - type: "apt" + packages: + - "procps" + - "gzip" + - "bzip2" + - "parallel" + - "wget" + - "zlib1g-dev" + - "unzip" + - "xxd" + - "file" + interactive: false + - type: "docker" + run: + - "wget -O $STAR_TARGET $STAR_SOURCE && \\\n unzip $STAR_TARGET -d /tmp && \\\ + \n mv /tmp/STAR_$STAR_VERSION/Linux_x86_64_static/STAR /usr/local/bin/$STAR_BINARY\ + \ && \\\n chmod +x /usr/local/bin/$STAR_BINARY && \\\n rm $STAR_TARGET &&\ + \ rm -rf /tmp/STAR_$STAR_VERSION\n" + env: + - "STAR_VERSION \"2.7.11b\"" + - "STAR_SOURCE \"https://github.com/alexdobin/STAR/releases/download/$STAR_VERSION/STAR_$STAR_VERSION.zip\"" + - "STAR_TARGET \"/tmp/star.zip\"" + - "STAR_BINARY \"STAR\"" + entrypoint: [] + cmd: null +- type: "native" + id: "native" +build_info: + config: "src/parallel_map/config.vsh.yaml" + runner: "nextflow" + engine: "docker|native" + output: "target/nextflow/parallel_map" + executable: "target/nextflow/parallel_map/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "7c0705a514b86c8d335f308abf7fb1b62d16aa2f" + git_remote: "https://github.com/viash-hub/htrnaseq" +package_config: + name: "htrnaseq" + version: "unpack_genome" + description: "Demultiplexing pipeline [WIP]\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + keywords: + - "bioinformatics" + - "sequence" + - "high-throughput" + - "mapping" + - "counting" + - "pipeline" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/htrnaseq" + issue_tracker: "https://github.com/viash-hub/htrnaseq/issues" diff --git a/target/nextflow/parallel_map/main.nf b/target/nextflow/parallel_map/main.nf new file mode 100644 index 00000000..74f9ad7e --- /dev/null +++ b/target/nextflow/parallel_map/main.nf @@ -0,0 +1,3881 @@ +// parallel_map unpack_genome +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "parallel_map", + "version" : "unpack_genome", + "argument_groups" : [ + { + "name" : "Input arguments", + "arguments" : [ + { + "type" : "file", + "name" : "--input_r1", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--input_r2", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--genomeDir", + "description" : "STAR reference directory", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--barcodes", + "description" : "The barcodes/wells to process", + "required" : true, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Barcode arguments", + "arguments" : [ + { + "type" : "integer", + "name" : "--wellBarcodesLength", + "description" : "The length of the well barcodes", + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "integer", + "name" : "--umiLength", + "description" : "The length of the UMIs", + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--limitBAMsortRAM", + "default" : [ + "10000000000" + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Runtime arguments", + "arguments" : [ + { + "type" : "integer", + "name" : "--runThreadN", + "description" : "Number of threads to use for a single STAR execution.", + "default" : [ + 1 + ], + "required" : false, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output arguments", + "arguments" : [ + { + "type" : "file", + "name" : "--output", + "description" : "Location of the output folders, 1 folder per barcode. The value used\nfor this argument must contain a '*', which will be replaced with the\nbarcode to form the final output location for that barcode.\n", + "default" : [ + "./*" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--joblog", + "description" : "Where to store the log file listing all the jobs.", + "default" : [ + "execution_log.txt" + ], + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "bash_script", + "path" : "script.sh", + "is_executable" : true + } + ], + "description" : "Map wells in batch, using STAR\nSpliced Transcripts Alignment to a Reference (C) Alexander Dobin\nhttps://github.com/alexdobin/STAR\n", + "test_resources" : [ + { + "type" : "bash_script", + "path" : "test.sh", + "is_executable" : true + } + ], + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "license" : "MIT", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq" + }, + "runners" : [ + { + "type" : "executable", + "id" : "executable", + "docker_setup_strategy" : "ifneedbepullelsecachedbuild" + }, + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "docker", + "id" : "docker", + "image" : "debian:stable-slim", + "target_registry" : "images.viash-hub.com", + "target_tag" : "unpack_genome", + "namespace_separator" : "/", + "setup" : [ + { + "type" : "apt", + "packages" : [ + "procps", + "gzip", + "bzip2", + "parallel", + "wget", + "zlib1g-dev", + "unzip", + "xxd", + "file" + ], + "interactive" : false + }, + { + "type" : "docker", + "run" : [ + "wget -O $STAR_TARGET $STAR_SOURCE && \\\\\n unzip $STAR_TARGET -d /tmp && \\\\\n mv /tmp/STAR_$STAR_VERSION/Linux_x86_64_static/STAR /usr/local/bin/$STAR_BINARY && \\\\\n chmod +x /usr/local/bin/$STAR_BINARY && \\\\\n rm $STAR_TARGET && rm -rf /tmp/STAR_$STAR_VERSION\n" + ], + "env" : [ + "STAR_VERSION \\"2.7.11b\\"", + "STAR_SOURCE \\"https://github.com/alexdobin/STAR/releases/download/$STAR_VERSION/STAR_$STAR_VERSION.zip\\"", + "STAR_TARGET \\"/tmp/star.zip\\"", + "STAR_BINARY \\"STAR\\"" + ] + } + ] + }, + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/parallel_map/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "docker|native", + "output" : "target/nextflow/parallel_map", + "viash_version" : "0.9.0-RC6", + "git_commit" : "7c0705a514b86c8d335f308abf7fb1b62d16aa2f", + "git_remote" : "https://github.com/viash-hub/htrnaseq" + }, + "package_config" : { + "name" : "htrnaseq", + "version" : "unpack_genome", + "description" : "Demultiplexing pipeline [WIP]\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + ], + "keywords" : [ + "bioinformatics", + "sequence", + "high-throughput", + "mapping", + "counting", + "pipeline" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq", + "issue_tracker" : "https://github.com/viash-hub/htrnaseq/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// inner workflow hook +def innerWorkflowFactory(args) { + def rawScript = '''set -e +tempscript=".viash_script.sh" +cat > "$tempscript" << VIASHMAIN +#!/bin/bash + +## VIASH START +# The following code has been auto-generated by Viash. +$( if [ ! -z ${VIASH_PAR_INPUT_R1+x} ]; then echo "${VIASH_PAR_INPUT_R1}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input_r1='&'#" ; else echo "# par_input_r1="; fi ) +$( if [ ! -z ${VIASH_PAR_INPUT_R2+x} ]; then echo "${VIASH_PAR_INPUT_R2}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input_r2='&'#" ; else echo "# par_input_r2="; fi ) +$( if [ ! -z ${VIASH_PAR_GENOMEDIR+x} ]; then echo "${VIASH_PAR_GENOMEDIR}" | sed "s#'#'\\"'\\"'#g;s#.*#par_genomeDir='&'#" ; else echo "# par_genomeDir="; fi ) +$( if [ ! -z ${VIASH_PAR_BARCODES+x} ]; then echo "${VIASH_PAR_BARCODES}" | sed "s#'#'\\"'\\"'#g;s#.*#par_barcodes='&'#" ; else echo "# par_barcodes="; fi ) +$( if [ ! -z ${VIASH_PAR_WELLBARCODESLENGTH+x} ]; then echo "${VIASH_PAR_WELLBARCODESLENGTH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_wellBarcodesLength='&'#" ; else echo "# par_wellBarcodesLength="; fi ) +$( if [ ! -z ${VIASH_PAR_UMILENGTH+x} ]; then echo "${VIASH_PAR_UMILENGTH}" | sed "s#'#'\\"'\\"'#g;s#.*#par_umiLength='&'#" ; else echo "# par_umiLength="; fi ) +$( if [ ! -z ${VIASH_PAR_LIMITBAMSORTRAM+x} ]; then echo "${VIASH_PAR_LIMITBAMSORTRAM}" | sed "s#'#'\\"'\\"'#g;s#.*#par_limitBAMsortRAM='&'#" ; else echo "# par_limitBAMsortRAM="; fi ) +$( if [ ! -z ${VIASH_PAR_RUNTHREADN+x} ]; then echo "${VIASH_PAR_RUNTHREADN}" | sed "s#'#'\\"'\\"'#g;s#.*#par_runThreadN='&'#" ; else echo "# par_runThreadN="; fi ) +$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi ) +$( if [ ! -z ${VIASH_PAR_JOBLOG+x} ]; then echo "${VIASH_PAR_JOBLOG}" | sed "s#'#'\\"'\\"'#g;s#.*#par_joblog='&'#" ; else echo "# par_joblog="; fi ) +$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi ) +$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi ) +$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi ) +$( if [ ! -z ${VIASH_META_EXECUTABLE+x} ]; then echo "${VIASH_META_EXECUTABLE}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_executable='&'#" ; else echo "# meta_executable="; fi ) +$( if [ ! -z ${VIASH_META_CONFIG+x} ]; then echo "${VIASH_META_CONFIG}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_config='&'#" ; else echo "# meta_config="; fi ) +$( if [ ! -z ${VIASH_META_TEMP_DIR+x} ]; then echo "${VIASH_META_TEMP_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_temp_dir='&'#" ; else echo "# meta_temp_dir="; fi ) +$( if [ ! -z ${VIASH_META_CPUS+x} ]; then echo "${VIASH_META_CPUS}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_cpus='&'#" ; else echo "# meta_cpus="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_B+x} ]; then echo "${VIASH_META_MEMORY_B}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_b='&'#" ; else echo "# meta_memory_b="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KB+x} ]; then echo "${VIASH_META_MEMORY_KB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kb='&'#" ; else echo "# meta_memory_kb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MB+x} ]; then echo "${VIASH_META_MEMORY_MB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mb='&'#" ; else echo "# meta_memory_mb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GB+x} ]; then echo "${VIASH_META_MEMORY_GB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gb='&'#" ; else echo "# meta_memory_gb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TB+x} ]; then echo "${VIASH_META_MEMORY_TB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tb='&'#" ; else echo "# meta_memory_tb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PB+x} ]; then echo "${VIASH_META_MEMORY_PB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pb='&'#" ; else echo "# meta_memory_pb="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_KIB+x} ]; then echo "${VIASH_META_MEMORY_KIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_kib='&'#" ; else echo "# meta_memory_kib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_MIB+x} ]; then echo "${VIASH_META_MEMORY_MIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_mib='&'#" ; else echo "# meta_memory_mib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_GIB+x} ]; then echo "${VIASH_META_MEMORY_GIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_gib='&'#" ; else echo "# meta_memory_gib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_tib='&'#" ; else echo "# meta_memory_tib="; fi ) +$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi ) + +## VIASH END + +set -eo pipefail + +# Check if wildcard character is present in output folder template +printf "Checking if output folder template (\\$par_output) contains a single wildcard character '*'. " +output_glob_character="\\${par_output//[^\\\\*]}" +if [[ "\\${#output_glob_character}" -ne "1" ]]; then + echo "The value for --output must contain exactly one '*' character. Exiting..." + exit 1 +else + echo "Done, wildcard character found!" +fi + +# Split the delimited strings into arrays +IFS=';' read -r -a barcodes <<< "\\$par_barcodes" +IFS=';' read -r -a input_r1 <<< "\\$par_input_r1" +IFS=';' read -r -a input_r2 <<< "\\$par_input_r2" + +# Check that the number of values provided for the barcodes and the fastq files are the same. +num_barcodes="\\${#barcodes[@]}" +num_r1_inputs="\\${#input_r1[@]}" +num_r2_inputs="\\${#input_r2[@]}" + +if [ ! "\\$num_barcodes" -eq "\\$num_r1_inputs" ] || [ ! "\\$num_r1_inputs" -eq "\\$num_r2_inputs" ]; then + echo "The number of values for arguments 'barcodes' (\\$num_barcodes), "\\\\ + "'input_r1' (\\$num_r1_inputs) and 'input_r2' (\\$num_r2_inputs) "\\\\ + "should be the same, and their order should match." + exit 1 +else + echo "Checked if length of barcodes input (\\$num_barcodes) is "\\\\ + "the same as R1 reads (\\$num_r1_inputs) and R2 reads "\\\\ + "(\\$num_r2_inputs). Seems OK!" +fi + +# Function to test for unique values in array +function arrayContainsUniqueValues { + # Pass the argument by reference + local -n arr=\\$1 + # Create a temporary associative array + # in order to use its uniqueness of keys + # 'declare' in a function is automatically local + declare -A uniq_tmp + for item in "\\${arr[@]}"; do + uniq_tmp[\\$item]=0 # assigning a placeholder + done + local unique_array_values=(\\${!uniq_tmp[@]}) + if [ "\\${#unique_array_values[@]}" -eq "\\${#arr[@]}" ]; then + return + fi + false +} +arrayContainsUniqueValues barcodes +is_array_unique_exit_code=\\$? +if ! (exit \\$is_array_unique_exit_code); then + echo "The provided barcodes should be unique!" + echo "Values: \\$par_barcodes" + exit 1 +fi + +# Define the function that will be used to run a single job +function _run() { + local par_wellBarcodeLength="\\$1" + local par_UMIlength="\\$2" + local par_output="\\$3" + local par_genomeDir="\\$4" + local par_limitBAMsortRAM="\\$5" + local par_runThreadN="\\$6" + local barcode="\\$7" + local input_R1="\\$8" + local input_R2="\\$9" + local par_UMIstart=\\$((\\$par_wellBarcodeLength + 1)) + + set -eo pipefail + + echo <<-EOF + Processing \\$barcode + For the following inputs (lanes): + "\\$star_readFilesIn + EOF + + echo "Writing barcode '\\$barcode' to \\$barcode.txt and using it as input". + # Note that there is no possible conflict between jobs here + # because the barcodes are unique (and the barcode is part of the name + # of the file). + echo "\\$barcode" > "\\$barcode.txt" + + local dir="\\${par_output//\\\\*/\\$barcode}/" + echo "Setting output for barcode '\\$barcode' to '\\$dir'." + mkdir -p "\\$dir" + + # check if files are compressed + local TMPDIR=\\$(mktemp -d "\\$meta_temp_dir/parallel_map-\\$barcode-XXXXXX") + function clean_up { + [[ -d "\\$TMPDIR" ]] && rm -r "\\$TMPDIR" + } + trap clean_up RETURN + + # Decompress the input files when needed + # NOTE: for some reason, using STAR's --readFilesCommand does not always work + # This might be because STAR creates fifo files (see https://man7.org/linux/man-pages/man7/fifo.7.html) + # and this requires a filesystem that supports this. Another cause might be that the input files + # are symlinks. When testing this, using '--readFilesCommand "zcat"' + # always produced empty BAM files, but also a succesfull exit code (0) so the problem is not reported. + # However, the logs showed the following error: "gzip -: unexpected end of file". + + function is_gzipped { + printf "Checking if input '\\$1' (barcode '\\$barcode') is gzipped... " + if file "\\$1" | grep -q 'gzip'; then + echo "Done, detected compressed file." + return + fi + echo "Done, file does not need decompression." + false + } + + # Resolve symbolic links to actual file paths + input_R1=\\$(realpath \\$input_R1) + input_R2=\\$(realpath \\$input_R2) + + if is_gzipped \\$input_R1; then + local compressed_file_name_r1="\\$(basename -- \\$input_R1)" + local uncompressed_file_r1="\\$TMPDIR/\\${compressed_file_name_r1%.gz}" + printf "Unpacking input to \\$uncompressed_file_r1... " + zcat "\\$input_R1" > "\\$uncompressed_file_r1" + echo "Decompression done." + else + local uncompressed_file_r1="\\$input_R1" + fi + + if is_gzipped \\$input_R2; then + local compressed_file_name_r2="\\$(basename -- \\$input_R2)" + local uncompressed_file_r2="\\$TMPDIR/\\${compressed_file_name_r2%.gz}" + printf "Unpacking input to \\$uncompressed_file_r2... " + zcat "\\$input_R2" > "\\$uncompressed_file_r2" + echo "Decompression done." + else + local uncompressed_file_r2="\\$input_R2" + fi + + local n_input_lines_r1=\\$(wc -l < "\\$uncompressed_file_r1") + local n_input_lines_r2=\\$(wc -l < "\\$uncompressed_file_r2") + + printf "Checking if length of input file mates match. " + if (( \\$n_input_lines_r1 != n_input_lines_r2 )); then + echo "The length of file \\$input_R1 (\\$n_input_lines_r1) does not match with \\$input_R2 (\\$n_input_lines_r2)" + return 1 + else + echo "Seems OK, \\$n_input_lines_r1 input lines." + fi + echo "Starting STAR for barcode '\\$barcode'" + # soloType 'Droplet' is the same as 'CB_UMI_Simple': one UMI and one cell barcode of fixed length. + # By default in this mode, STAR will look for the cell barcode and the UMI int the last files specified with --readFilesIn + # So we need to specify R2 first and R1 second, because R1 contains the barcode and UMI. + # Also, you might be tempted to use '--soloBarcodeMate 1' to alter this behavior, but this requires the clipping + # the barcode from this mate by specifying --clip5pNbases and/or --clip3pNbases, which we do not want to do. + STAR \\\\ + --readFilesIn "\\$uncompressed_file_r2" "\\$uncompressed_file_r1" \\\\ + --soloType Droplet \\\\ + --quantMode GeneCounts \\\\ + --genomeLoad LoadAndKeep \\\\ + --limitBAMsortRAM "\\$par_limitBAMsortRAM" \\\\ + --runThreadN "\\$par_runThreadN" \\\\ + --outFilterMultimapNmax 1 \\\\ + --outSAMtype BAM SortedByCoordinate \\\\ + --soloCBstart 1 \\\\ + --readFilesType "Fastx" \\\\ + --soloCBlen "\\$par_wellBarcodeLength" \\\\ + --soloUMIstart "\\$par_UMIstart" \\\\ + --soloUMIlen "\\$par_UMIlength" \\\\ + --soloBarcodeReadLength 0 \\\\ + --soloStrand Unstranded \\\\ + --soloFeatures Gene \\\\ + --genomeDir "\\$par_genomeDir" \\\\ + --outReadsUnmapped Fastx \\\\ + --outSAMunmapped Within \\\\ + --outSAMattributes NH HI nM AS CR UR CB UB GX GN \\\\ + --soloCBwhitelist "\\$barcode.txt" \\\\ + --outFileNamePrefix "\\$dir" \\\\ + --outTmpDir "\\$TMPDIR/STARtemp/" + + printf "Done running STAR. " + # Check if the number of processed reads is equal to the number of input reads + local n_input_reads=\\$((\\$n_input_lines_r1 / 4)) + local nr_output_reads=\\$(grep -Po "Number\\\\ of\\\\ input\\\\ reads \\\\\\\\|\\\\W*\\\\K\\\\d+" "\\$dir/Log.final.out") + if (( \\$nr_output_reads != \\$n_input_reads )); then + echo "Not all input reads were processed for barcode \\$barcode." + return 1 + else + echo "Processed \\$nr_output_reads reads for barcode \\$barcode". + fi +} + +# Export the function - requires bash +export -f _run + +# Load reference genome +echo "Loading reference genome" +STAR --genomeLoad LoadAndExit --genomeDir "\\$par_genomeDir" + +# Run the concurrent jobs using GNU parallel + +# Make sure that parallel uses the correct shell +export PARALLEL_SHELL="/bin/bash" + +# Some notes: +# --halt now,fail=1: instruct parallel to exit when a job has failed and kill remaining running jobs. +# +# ::: is a special syntax for GNU parallel to delineate inputs +# If multiple ::: are given, each group will be treated as an input source, and all combinations of input +# sources will be generated. E.g. ::: 1 2 ::: a b c will result in the combinations (1,a) (1,b) (1,c) (2,a) (2,b) (2,c) +# The delimiter :::+ (note the extra '+') links the argument to the previous argument, and one argument from each of the input +# sources will be read. +parallel_cmd=("parallel" "--jobs" "80%" "--verbose" "--memfree" "2G" + "--tmpdir" "\\$meta_temp_dir" + "--retry-failed" "--retries" "4" "--halt" "soon,fail=1" + "--joblog" "\\$par_joblog" "_run" "{}") + +# Arguments for which there is one value, so these will not create extra jobs +parallel_cmd+=(":::" "\\$par_wellBarcodesLength" ":::" "\\$par_umiLength" ":::" "\\$par_output" ":::" "\\$par_genomeDir" ":::" "\\$par_limitBAMsortRAM" ":::" "\\$par_runThreadN") + +# Argument which in fact will cause extra jobs to be spawned, per job one item from each argument will be selected +# Thus, these argument lists should have the same length. +parallel_cmd+=(":::" "\\${barcodes[@]}" ":::+" "\\${input_r1[@]}" ":::+" "\\${input_r2[@]}") + +set +eo pipefail +"\\${parallel_cmd[@]}" +exit_code=\\$? +set -eo pipefail + +echo "GNU parallel finished!" + +# Unload reference +printf "Unloading reference genome. " +STAR --genomeLoad Remove --genomeDir "\\$par_genomeDir" +echo "Done!" + +# Exit code from GNU parallel: +# If fail=1 is used, the exit status will be the exit status of the failing job. +echo "Checking exit code" +if ((exit_code>0)); then + # Note that the ending HERE must be indented with TAB characters (not spaces) + # in order to remove leading indentation + MESSAGE=\\$( + cat <<-HERE + ================================================================== + + !!! An error occurred for one of the jobs. + Exit code of the failing job: \\$exit_code. + + %s + + ================================================================== + + HERE + ) + printf "\\$MESSAGE" "\\$(<\\$par_joblog)" + exit 1 +else + cat <<-HERE + ================================================================== + + Mapping went fine (exit code '\\$exit_code'), zero errors occurred + + ================================================================== + HERE + +fi +VIASHMAIN +bash "$tempscript" +''' + + return vdsl3WorkflowFactory(args, meta, rawScript) +} + + + +/** + * Generate a workflow for VDSL3 modules. + * + * This function is called by the workflowFactory() function. + * + * Input channel: [id, input_map] + * Output channel: [id, output_map] + * + * Internally, this workflow will convert the input channel + * to a format which the Nextflow module will be able to handle. + */ +def vdsl3WorkflowFactory(Map args, Map meta, String rawScript) { + def key = args["key"] + def processObj = null + + workflow processWf { + take: input_ + main: + + if (processObj == null) { + processObj = _vdsl3ProcessFactory(args, meta, rawScript) + } + + output_ = input_ + | map { tuple -> + def id = tuple[0] + def data_ = tuple[1] + + if (workflow.stubRun) { + // add id if missing + data_ = [id: 'stub'] + data_ + } + + // process input files separately + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { par -> + def val = data_.containsKey(par.plainName) ? data_[par.plainName] : [] + def inputFiles = [] + if (val == null) { + inputFiles = [] + } else if (val instanceof List) { + inputFiles = val + } else if (val instanceof Path) { + inputFiles = [ val ] + } else { + inputFiles = [] + } + if (!workflow.stubRun) { + // throw error when an input file doesn't exist + inputFiles.each{ file -> + assert file.exists() : + "Error in module '${key}' id '${id}' argument '${par.plainName}'.\n" + + " Required input file does not exist.\n" + + " Path: '$file'.\n" + + " Expected input file to exist" + } + } + inputFiles + } + + // remove input files + def argsExclInputFiles = meta.config.allArguments + .findAll { (it.type != "file" || it.direction != "input") && data_.containsKey(it.plainName) } + .collectEntries { par -> + def parName = par.plainName + def val = data_[parName] + if (par.multiple && val instanceof Collection) { + val = val.join(par.multiple_sep) + } + if (par.direction == "output" && par.type == "file") { + val = val.replaceAll('\\$id', id).replaceAll('\\$key', key) + } + [parName, val] + } + + [ id ] + inputPaths + [ argsExclInputFiles, meta.resources_dir ] + } + | processObj + | map { output -> + def outputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .indexed() + .collectEntries{ index, par -> + def out = output[index + 1] + // strip dummy '.exitcode' file from output (see nextflow-io/nextflow#2678) + if (!out instanceof List || out.size() <= 1) { + if (par.multiple) { + out = [] + } else { + assert !par.required : + "Error in module '${key}' id '${output[0]}' argument '${par.plainName}'.\n" + + " Required output file is missing" + out = null + } + } else if (out.size() == 2 && !par.multiple) { + out = out[1] + } else { + out = out.drop(1) + } + [ par.plainName, out ] + } + + // drop null outputs + outputFiles.removeAll{it.value == null} + + [ output[0], outputFiles ] + } + emit: output_ + } + + return processWf +} + +// depends on: session? +def _vdsl3ProcessFactory(Map workflowArgs, Map meta, String rawScript) { + // autodetect process key + def wfKey = workflowArgs["key"] + def procKeyPrefix = "${wfKey}_process" + def scriptMeta = nextflow.script.ScriptMeta.current() + def existing = scriptMeta.getProcessNames().findAll{it.startsWith(procKeyPrefix)} + def numbers = existing.collect{it.replace(procKeyPrefix, "0").toInteger()} + def newNumber = (numbers + [-1]).max() + 1 + + def procKey = newNumber == 0 ? procKeyPrefix : "$procKeyPrefix$newNumber" + + if (newNumber > 0) { + log.warn "Key for module '${wfKey}' is duplicated.\n", + "If you run a component multiple times in the same workflow,\n" + + "it's recommended you set a unique key for every call,\n" + + "for example: ${wfKey}.run(key: \"foo\")." + } + + // subset directives and convert to list of tuples + def drctv = workflowArgs.directives + + // TODO: unit test the two commands below + // convert publish array into tags + def valueToStr = { val -> + // ignore closures + if (val instanceof CharSequence) { + if (!val.matches('^[{].*[}]$')) { + '"' + val + '"' + } else { + val + } + } else if (val instanceof List) { + "[" + val.collect{valueToStr(it)}.join(", ") + "]" + } else if (val instanceof Map) { + "[" + val.collect{k, v -> k + ": " + valueToStr(v)}.join(", ") + "]" + } else { + val.inspect() + } + } + + // multiple entries allowed: label, publishdir + def drctvStrs = drctv.collect { key, value -> + if (key in ["label", "publishDir"]) { + value.collect{ val -> + if (val instanceof Map) { + "\n$key " + val.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else if (val == null) { + "" + } else { + "\n$key " + valueToStr(val) + } + }.join() + } else if (value instanceof Map) { + "\n$key " + value.collect{ k, v -> k + ": " + valueToStr(v) }.join(", ") + } else { + "\n$key " + valueToStr(value) + } + }.join() + + def inputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + .collect { ', path(viash_par_' + it.plainName + ', stageAs: "_viash_par/' + it.plainName + '_?/*")' } + .join() + + def outputPaths = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + // insert dummy into every output (see nextflow-io/nextflow#2678) + if (!par.multiple) { + ', path{[".exitcode", args.' + par.plainName + ']}' + } else { + ', path{[".exitcode"] + args.' + par.plainName + '}' + } + } + .join() + + // TODO: move this functionality somewhere else? + if (workflowArgs.auto.transcript) { + outputPaths = outputPaths + ', path{[".exitcode", ".command*"]}' + } else { + outputPaths = outputPaths + ', path{[".exitcode"]}' + } + + // create dirs for output files (based on BashWrapper.createParentFiles) + def createParentStr = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" && it.create_parent } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"mkdir_parent \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"] : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // construct inputFileExports + def inputFileExports = meta.config.allArguments + .findAll { it.type == "file" && it.direction.toLowerCase() == "input" } + .collect { par -> + def viash_par_contents = "(viash_par_${par.plainName} instanceof List ? viash_par_${par.plainName}.join(\"${par.multiple_sep}\") : viash_par_${par.plainName})" + "\n\${viash_par_${par.plainName}.empty ? \"\" : \"export VIASH_PAR_${par.plainName.toUpperCase()}=\\\"\" + ${viash_par_contents} + \"\\\"\"}" + } + + // NOTE: if using docker, use /tmp instead of tmpDir! + def tmpDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('VIASH_TMPDIR') ?: + System.getenv('VIASH_TEMPDIR') ?: + System.getenv('VIASH_TMP') ?: + System.getenv('TEMP') ?: + System.getenv('TMPDIR') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMP') ?: + '/tmp' + ).toAbsolutePath() + + // construct stub + def stub = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "output" } + .collect { par -> + "\${ args.containsKey(\"${par.plainName}\") ? \"touch2 \\\"\" + (args[\"${par.plainName}\"] instanceof String ? args[\"${par.plainName}\"].replace(\"_*\", \"_0\") : args[\"${par.plainName}\"].join('\" \"')) + \"\\\"\" : \"\" }" + } + .join("\n") + + // escape script + def escapedScript = rawScript.replace('\\', '\\\\').replace('$', '\\$').replace('"""', '\\"\\"\\"') + + // publishdir assert + def assertStr = (workflowArgs.auto.publish == true) || workflowArgs.auto.transcript ? + """\nassert task.publishDir.size() > 0: "if auto.publish is true, params.publish_dir needs to be defined.\\n Example: --publish_dir './output/'" """ : + "" + + // generate process string + def procStr = + """nextflow.enable.dsl=2 + | + |process $procKey {$drctvStrs + |input: + | tuple val(id)$inputPaths, val(args), path(resourcesDir, stageAs: ".viash_meta_resources") + |output: + | tuple val("\$id")$outputPaths, optional: true + |stub: + |\"\"\" + |touch2() { mkdir -p "\\\$(dirname "\\\$1")" && touch "\\\$1" ; } + |$stub + |\"\"\" + |script:$assertStr + |def escapeText = { s -> s.toString().replaceAll('([`"])', '\\\\\\\\\$1') } + |def parInject = args + | .findAll{key, value -> value != null} + | .collect{key, value -> "export VIASH_PAR_\${key.toUpperCase()}=\\\"\${escapeText(value)}\\\""} + | .join("\\n") + |\"\"\" + |# meta exports + |export VIASH_META_RESOURCES_DIR="\${resourcesDir}" + |export VIASH_META_TEMP_DIR="${['docker', 'podman', 'charliecloud'].any{ it == workflow.containerEngine } ? '/tmp' : tmpDir}" + |export VIASH_META_NAME="${meta.config.name}" + |# export VIASH_META_EXECUTABLE="\\\$VIASH_META_RESOURCES_DIR/\\\$VIASH_META_NAME" + |export VIASH_META_CONFIG="\\\$VIASH_META_RESOURCES_DIR/.config.vsh.yaml" + |\${task.cpus ? "export VIASH_META_CPUS=\$task.cpus" : "" } + |\${task.memory?.bytes != null ? "export VIASH_META_MEMORY_B=\$task.memory.bytes" : "" } + |if [ ! -z \\\${VIASH_META_MEMORY_B+x} ]; then + | export VIASH_META_MEMORY_KB=\\\$(( (\\\$VIASH_META_MEMORY_B+999) / 1000 )) + | export VIASH_META_MEMORY_MB=\\\$(( (\\\$VIASH_META_MEMORY_KB+999) / 1000 )) + | export VIASH_META_MEMORY_GB=\\\$(( (\\\$VIASH_META_MEMORY_MB+999) / 1000 )) + | export VIASH_META_MEMORY_TB=\\\$(( (\\\$VIASH_META_MEMORY_GB+999) / 1000 )) + | export VIASH_META_MEMORY_PB=\\\$(( (\\\$VIASH_META_MEMORY_TB+999) / 1000 )) + | export VIASH_META_MEMORY_KIB=\\\$(( (\\\$VIASH_META_MEMORY_B+1023) / 1024 )) + | export VIASH_META_MEMORY_MIB=\\\$(( (\\\$VIASH_META_MEMORY_KIB+1023) / 1024 )) + | export VIASH_META_MEMORY_GIB=\\\$(( (\\\$VIASH_META_MEMORY_MIB+1023) / 1024 )) + | export VIASH_META_MEMORY_TIB=\\\$(( (\\\$VIASH_META_MEMORY_GIB+1023) / 1024 )) + | export VIASH_META_MEMORY_PIB=\\\$(( (\\\$VIASH_META_MEMORY_TIB+1023) / 1024 )) + |fi + | + |# meta synonyms + |export VIASH_TEMP="\\\$VIASH_META_TEMP_DIR" + |export TEMP_DIR="\\\$VIASH_META_TEMP_DIR" + | + |# create output dirs if need be + |function mkdir_parent { + | for file in "\\\$@"; do + | mkdir -p "\\\$(dirname "\\\$file")" + | done + |} + |$createParentStr + | + |# argument exports${inputFileExports.join()} + |\$parInject + | + |# process script + |${escapedScript} + |\"\"\" + |} + |""".stripMargin() + + // TODO: print on debug + // if (workflowArgs.debug == true) { + // println("######################\n$procStr\n######################") + // } + + // write process to temp file + def tempFile = java.nio.file.Files.createTempFile("viash-process-${procKey}-", ".nf") + addShutdownHook { java.nio.file.Files.deleteIfExists(tempFile) } + tempFile.text = procStr + + // create process from temp file + def binding = new nextflow.script.ScriptBinding([:]) + def session = nextflow.Nextflow.getSession() + def parser = new nextflow.script.ScriptParser(session) + .setModule(true) + .setBinding(binding) + def moduleScript = parser.runScript(tempFile) + .getScript() + + // register module in meta + def module = new nextflow.script.IncludeDef.Module(name: procKey) + scriptMeta.addModule(moduleScript, module.name, module.alias) + + // retrieve and return process from meta + return scriptMeta.getProcess(procKey) +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "container" : { + "registry" : "images.viash-hub.com", + "image" : "vsh/htrnaseq/parallel_map", + "tag" : "unpack_genome" + }, + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/nextflow/parallel_map/nextflow.config b/target/nextflow/parallel_map/nextflow.config new file mode 100644 index 00000000..b191484b --- /dev/null +++ b/target/nextflow/parallel_map/nextflow.config @@ -0,0 +1,125 @@ +manifest { + name = 'parallel_map' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'unpack_genome' + description = 'Map wells in batch, using STAR\nSpliced Transcripts Alignment to a Reference (C) Alexander Dobin\nhttps://github.com/alexdobin/STAR\n' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/nextflow/parallel_map/nextflow_schema.json b/target/nextflow/parallel_map/nextflow_schema.json new file mode 100644 index 00000000..01dd5063 --- /dev/null +++ b/target/nextflow/parallel_map/nextflow_schema.json @@ -0,0 +1,206 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "parallel_map", +"description": "Map wells in batch, using STAR\nSpliced Transcripts Alignment to a Reference (C) Alexander Dobin\nhttps://github.com/alexdobin/STAR\n", +"type": "object", +"definitions": { + + + + "input arguments" : { + "title": "Input arguments", + "type": "object", + "description": "No description", + "properties": { + + + "input_r1": { + "type": + "string", + "description": "Type: List of `file`, required, multiple_sep: `\":\"`. ", + "help_text": "Type: List of `file`, required, multiple_sep: `\":\"`. " + + } + + + , + "input_r2": { + "type": + "string", + "description": "Type: List of `file`, required, multiple_sep: `\":\"`. ", + "help_text": "Type: List of `file`, required, multiple_sep: `\":\"`. " + + } + + + , + "genomeDir": { + "type": + "string", + "description": "Type: `file`, required. STAR reference directory", + "help_text": "Type: `file`, required. STAR reference directory" + + } + + + , + "barcodes": { + "type": + "string", + "description": "Type: List of `string`, required, multiple_sep: `\":\"`. The barcodes/wells to process", + "help_text": "Type: List of `string`, required, multiple_sep: `\":\"`. The barcodes/wells to process" + + } + + +} +}, + + + "barcode arguments" : { + "title": "Barcode arguments", + "type": "object", + "description": "No description", + "properties": { + + + "wellBarcodesLength": { + "type": + "integer", + "description": "Type: `integer`, required. The length of the well barcodes", + "help_text": "Type: `integer`, required. The length of the well barcodes" + + } + + + , + "umiLength": { + "type": + "integer", + "description": "Type: `integer`, required. The length of the UMIs", + "help_text": "Type: `integer`, required. The length of the UMIs" + + } + + + , + "limitBAMsortRAM": { + "type": + "string", + "description": "Type: `string`, default: `10000000000`. ", + "help_text": "Type: `string`, default: `10000000000`. " + , + "default": "10000000000" + } + + +} +}, + + + "runtime arguments" : { + "title": "Runtime arguments", + "type": "object", + "description": "No description", + "properties": { + + + "runThreadN": { + "type": + "integer", + "description": "Type: `integer`, default: `1`. Number of threads to use for a single STAR execution", + "help_text": "Type: `integer`, default: `1`. Number of threads to use for a single STAR execution." + , + "default": "1" + } + + +} +}, + + + "output arguments" : { + "title": "Output arguments", + "type": "object", + "description": "No description", + "properties": { + + + "output": { + "type": + "string", + "description": "Type: List of `file`, required, default: `$id.$key.output_*./*`, multiple_sep: `\":\"`. Location of the output folders, 1 folder per barcode", + "help_text": "Type: List of `file`, required, default: `$id.$key.output_*./*`, multiple_sep: `\":\"`. Location of the output folders, 1 folder per barcode. The value used\nfor this argument must contain a \u0027*\u0027, which will be replaced with the\nbarcode to form the final output location for that barcode.\n" + , + "default": "$id.$key.output_*./*" + } + + + , + "joblog": { + "type": + "string", + "description": "Type: `file`, default: `$id.$key.joblog.txt`. Where to store the log file listing all the jobs", + "help_text": "Type: `file`, default: `$id.$key.joblog.txt`. Where to store the log file listing all the jobs." + , + "default": "$id.$key.joblog.txt" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/input arguments" + }, + + { + "$ref": "#/definitions/barcode arguments" + }, + + { + "$ref": "#/definitions/runtime arguments" + }, + + { + "$ref": "#/definitions/output arguments" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/nextflow/workflows/htrnaseq/.config.vsh.yaml b/target/nextflow/workflows/htrnaseq/.config.vsh.yaml new file mode 100644 index 00000000..cf432da4 --- /dev/null +++ b/target/nextflow/workflows/htrnaseq/.config.vsh.yaml @@ -0,0 +1,233 @@ +name: "htrnaseq" +namespace: "workflows" +version: "unpack_genome" +argument_groups: +- name: "Input arguments" + arguments: + - type: "file" + name: "--input_r1" + description: "R1" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--input_r2" + description: "R2" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--barcodesFasta" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--genomeDir" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output arguments" + arguments: + - type: "file" + name: "--fastq_output" + description: "List of demultiplexed fastq files" + info: null + default: + - "fastq/*_001.fastq" + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--star_output" + description: "Output from mapping with STAR" + info: null + default: + - "$id/star/*" + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: true + multiple_sep: ";" +resources: +- type: "nextflow_script" + path: "main.nf" + is_executable: true + entrypoint: "run_wf" +info: null +status: "enabled" +requirements: + commands: + - "ps" +dependencies: +- name: "workflows/well_demultiplex" + repository: + type: "local" +- name: "untar" + repository: + type: "vsh" + repo: "craftbox" + tag: "concat_text" +- name: "parallel_map" + repository: + type: "local" +- name: "workflows/utils/splitWells" + repository: + type: "local" +- name: "workflows/utils/groupLanes" + repository: + type: "local" +- name: "workflows/utils/groupPairs" + repository: + type: "local" +- name: "workflows/utils/groupWells" + repository: + type: "local" +- name: "concat_text" + repository: + type: "vsh" + repo: "craftbox" + tag: "concat_text" +repositories: +- type: "local" + name: "local" +- type: "vsh" + name: "bb" + repo: "biobox" + tag: "v0.1.0" +- type: "vsh" + name: "cb" + repo: "craftbox" + tag: "concat_text" +license: "MIT" +links: + repository: "https://github.com/viash-hub/htrnaseq" +runners: +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "native" + id: "native" +- type: "native" + id: "native" +build_info: + config: "src/workflows/htrnaseq/config.vsh.yaml" + runner: "nextflow" + engine: "native|native" + output: "target/nextflow/workflows/htrnaseq" + executable: "target/nextflow/workflows/htrnaseq/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "7c0705a514b86c8d335f308abf7fb1b62d16aa2f" + git_remote: "https://github.com/viash-hub/htrnaseq" + dependencies: + - "target/nextflow/workflows/well_demultiplex" + - "target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar" + - "target/nextflow/parallel_map" + - "target/nextflow/workflows/utils/splitWells" + - "target/nextflow/workflows/utils/groupLanes" + - "target/nextflow/workflows/utils/groupPairs" + - "target/nextflow/workflows/utils/groupWells" + - "target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text" +package_config: + name: "htrnaseq" + version: "unpack_genome" + description: "Demultiplexing pipeline [WIP]\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + keywords: + - "bioinformatics" + - "sequence" + - "high-throughput" + - "mapping" + - "counting" + - "pipeline" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/htrnaseq" + issue_tracker: "https://github.com/viash-hub/htrnaseq/issues" diff --git a/target/nextflow/workflows/htrnaseq/main.nf b/target/nextflow/workflows/htrnaseq/main.nf new file mode 100644 index 00000000..415351aa --- /dev/null +++ b/target/nextflow/workflows/htrnaseq/main.nf @@ -0,0 +1,3405 @@ +// htrnaseq unpack_genome +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "htrnaseq", + "namespace" : "workflows", + "version" : "unpack_genome", + "argument_groups" : [ + { + "name" : "Input arguments", + "arguments" : [ + { + "type" : "file", + "name" : "--input_r1", + "description" : "R1", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--input_r2", + "description" : "R2", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--barcodesFasta", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--genomeDir", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output arguments", + "arguments" : [ + { + "type" : "file", + "name" : "--fastq_output", + "description" : "List of demultiplexed fastq files", + "default" : [ + "fastq/*_001.fastq" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--star_output", + "description" : "Output from mapping with STAR", + "default" : [ + "$id/star/*" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "nextflow_script", + "path" : "main.nf", + "is_executable" : true, + "entrypoint" : "run_wf" + } + ], + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "dependencies" : [ + { + "name" : "workflows/well_demultiplex", + "repository" : { + "type" : "local" + } + }, + { + "name" : "untar", + "repository" : { + "type" : "vsh", + "repo" : "craftbox", + "tag" : "concat_text" + } + }, + { + "name" : "parallel_map", + "repository" : { + "type" : "local" + } + }, + { + "name" : "workflows/utils/splitWells", + "repository" : { + "type" : "local" + } + }, + { + "name" : "workflows/utils/groupLanes", + "repository" : { + "type" : "local" + } + }, + { + "name" : "workflows/utils/groupPairs", + "repository" : { + "type" : "local" + } + }, + { + "name" : "workflows/utils/groupWells", + "repository" : { + "type" : "local" + } + }, + { + "name" : "concat_text", + "repository" : { + "type" : "vsh", + "repo" : "craftbox", + "tag" : "concat_text" + } + } + ], + "repositories" : [ + { + "type" : "local", + "name" : "local" + }, + { + "type" : "vsh", + "name" : "bb", + "repo" : "biobox", + "tag" : "v0.1.0" + }, + { + "type" : "vsh", + "name" : "cb", + "repo" : "craftbox", + "tag" : "concat_text" + } + ], + "license" : "MIT", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq" + }, + "runners" : [ + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "native", + "id" : "native" + }, + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/workflows/htrnaseq/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "native|native", + "output" : "target/nextflow/workflows/htrnaseq", + "viash_version" : "0.9.0-RC6", + "git_commit" : "7c0705a514b86c8d335f308abf7fb1b62d16aa2f", + "git_remote" : "https://github.com/viash-hub/htrnaseq" + }, + "package_config" : { + "name" : "htrnaseq", + "version" : "unpack_genome", + "description" : "Demultiplexing pipeline [WIP]\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + ], + "keywords" : [ + "bioinformatics", + "sequence", + "high-throughput", + "mapping", + "counting", + "pipeline" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq", + "issue_tracker" : "https://github.com/viash-hub/htrnaseq/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) +meta["root_dir"] = getRootDir() +include { well_demultiplex } from "${meta.resources_dir}/../../../nextflow/workflows/well_demultiplex/main.nf" +include { untar } from "${meta.root_dir}/dependencies/vsh/vsh/craftbox/concat_text/nextflow/untar/main.nf" +include { parallel_map } from "${meta.resources_dir}/../../../nextflow/parallel_map/main.nf" +include { splitWells } from "${meta.resources_dir}/../../../nextflow/workflows/utils/splitWells/main.nf" +include { groupLanes } from "${meta.resources_dir}/../../../nextflow/workflows/utils/groupLanes/main.nf" +include { groupPairs } from "${meta.resources_dir}/../../../nextflow/workflows/utils/groupPairs/main.nf" +include { groupWells } from "${meta.resources_dir}/../../../nextflow/workflows/utils/groupWells/main.nf" +include { concat_text } from "${meta.root_dir}/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text/main.nf" + +// inner workflow +// user-provided Nextflow code +workflow run_wf { + take: + input_ch + + main: + // Untar input genome if needed + untar_ch = input_ch + | toSortedList() + | map {ids_and_states -> + def ids = ids_and_states.collect{it[0]} + def genomeDirs = ids_and_states.collect{it[1].genomeDir}.unique() + assert genomeDirs.size() == 1, "Only one value for 'genomeDirs' should have been defined across all inputs." + def genomeDir + genomeDirs.each { genomeDir = it } + ["unpack_genome", ["genomeDir": genomeDir, "original_ids": ids]] + } + | untar.run( + runIf: {id, state -> + def genomeDirStr = state.genomeDir.toString() + genomeDirStr.endsWith(".tar.gz") || \ + genomeDirStr.endsWith(".tar") || \ + genomeDirStr.endsWith(".tgz") ? true : false + }, + fromState: [ + "input": "genomeDir", + ], + toState: { id, result, state -> + state + ["genomeDir": result.output] + }, + ) + | flatMap{ id, state -> + state.original_ids.collect{[it, state.genomeDir]} + } + + output_ch = input_ch.join(untar_ch) + | niceView() + | map {id, state, genomeDir -> + def newState = state + ["genomeDir": genomeDir] + [id, newState] + } + | well_demultiplex.run( + fromState: { id, state -> + [ + input_r1: state.input_r1, + input_r2: state.input_r2, + barcodesFasta: state.barcodesFasta, + ] + }, + toState: { id, result, state -> + state + [ + fastq_output: result.output, + output: result.output, + ] + }, + directives: [label: ["midmem", "midcpu"]] + ) + + | splitWells.run( + fromState: { id, state -> + [ + input: state.output, + ] + }, + toState: { id, result, state -> + state + result + } + ) + | setState( + [ + "input": "barcode_path", + "barcode": "barcode", + "barcodesFasta": "barcodesFasta", + "genomeDir": "genomeDir", + "star_output": "star_output", + "fastq_output": "fastq_output", + ] + ) + + // TODO: Expand this into matching a whitelist/blacklist of barcodes + // ... and turn into separate component + | filter{ id, state -> state.barcode != "unknown" } + + | groupPairs.run( + fromState: { id, state -> + [ + input: state.input + ] + }, + toState: { id, result, state -> + state + result + } + ) + + // Does the sequencing platform use lanes? + // Should those lanes be discriminated over? + | groupLanes.run( + fromState: { id, state -> + [ + input_r1: state.r1, + input_r2: state.r2 + ] + }, + toState: { id, result, state -> + state + result + [ multiple_lanes: result.output_r1.size() > 1] + } + ) + + | setState( + [ + "input_r1": "r1", + "input_r2": "r2", + "barcodesFasta": "barcodesFasta", + "genomeDir": "genomeDir", + "barcode": "barcode", + "star_output": "star_output", + "fastq_output": "fastq_output", + ] + ) + | concat_text.run( + key: "concat_text_r1", + fromState: { id, state -> + [ + input: state.input_r1, + gzip_output: true + ] + }, + toState: { id, result, state -> + state + [ input_r1: result.output ] + } + ) + | concat_text.run( + key: "concat_text_r2", + fromState: { id, state -> + [ + input: state.input_r2, + gzip_output: true + ] + }, + toState: { id, result, state -> + state + [ input_r2: result.output ] + } + ) + + | groupWells.run( + fromState: { id, state -> + [ + input_r1: state.input_r1, + input_r2: state.input_r2, + well: state.barcode + ] + }, + toState: { id, result, state -> + state + [ "wells": result.wells, "input_r1": result.output_r1, "input_r2": result.output_r2] + } + ) + | parallel_map.run( + fromState: { id, state -> + [ + input_r1: state.input_r1, + input_r2: state.input_r2, + genomeDir: state.genomeDir, + barcodes: state.wells, + wellBarcodesLength: 10, + umiLength: 10, + output: state.star_output[0], + ] + }, + toState: { id, result, state -> + state + [ + star_output: result.output, + ] + }, + directives: [label: ["midmem", "midcpu"]] + ) + | niceView() + | setState(["star_output", "fastq_output"]) + + //| niceView() + // + //| setState( [ "output": "out" ] ) + + emit: + output_ch +} + +// inner workflow hook +def innerWorkflowFactory(args) { + return run_wf +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/nextflow/workflows/htrnaseq/nextflow.config b/target/nextflow/workflows/htrnaseq/nextflow.config new file mode 100644 index 00000000..a48d4c82 --- /dev/null +++ b/target/nextflow/workflows/htrnaseq/nextflow.config @@ -0,0 +1,124 @@ +manifest { + name = 'workflows/htrnaseq' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'unpack_genome' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/nextflow/workflows/htrnaseq/nextflow_schema.json b/target/nextflow/workflows/htrnaseq/nextflow_schema.json new file mode 100644 index 00000000..4cc27c65 --- /dev/null +++ b/target/nextflow/workflows/htrnaseq/nextflow_schema.json @@ -0,0 +1,136 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "htrnaseq", +"description": "No description", +"type": "object", +"definitions": { + + + + "input arguments" : { + "title": "Input arguments", + "type": "object", + "description": "No description", + "properties": { + + + "input_r1": { + "type": + "string", + "description": "Type: `file`, required. R1", + "help_text": "Type: `file`, required. R1" + + } + + + , + "input_r2": { + "type": + "string", + "description": "Type: `file`, required. R2", + "help_text": "Type: `file`, required. R2" + + } + + + , + "barcodesFasta": { + "type": + "string", + "description": "Type: `file`, required. ", + "help_text": "Type: `file`, required. " + + } + + + , + "genomeDir": { + "type": + "string", + "description": "Type: `file`, required. ", + "help_text": "Type: `file`, required. " + + } + + +} +}, + + + "output arguments" : { + "title": "Output arguments", + "type": "object", + "description": "No description", + "properties": { + + + "fastq_output": { + "type": + "string", + "description": "Type: List of `file`, required, default: `$id.$key.fastq_output_*.fastq`, multiple_sep: `\":\"`. List of demultiplexed fastq files", + "help_text": "Type: List of `file`, required, default: `$id.$key.fastq_output_*.fastq`, multiple_sep: `\":\"`. List of demultiplexed fastq files" + , + "default": "$id.$key.fastq_output_*.fastq" + } + + + , + "star_output": { + "type": + "string", + "description": "Type: List of `file`, required, default: `$id.$key.star_output_*.star_output_*`, multiple_sep: `\":\"`. Output from mapping with STAR", + "help_text": "Type: List of `file`, required, default: `$id.$key.star_output_*.star_output_*`, multiple_sep: `\":\"`. Output from mapping with STAR" + , + "default": "$id.$key.star_output_*.star_output_*" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/input arguments" + }, + + { + "$ref": "#/definitions/output arguments" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/nextflow/workflows/utils/groupLanes/.config.vsh.yaml b/target/nextflow/workflows/utils/groupLanes/.config.vsh.yaml new file mode 100644 index 00000000..fe56df00 --- /dev/null +++ b/target/nextflow/workflows/utils/groupLanes/.config.vsh.yaml @@ -0,0 +1,165 @@ +name: "groupLanes" +namespace: "workflows/utils" +version: "unpack_genome" +argument_groups: +- name: "Inputs" + arguments: + - type: "file" + name: "--input_r1" + description: "Path to the input for R1" + info: null + example: + - "input.fastq.gz" + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--input_r2" + description: "Path to the input for R2" + info: null + example: + - "input.fastq.gz" + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output" + arguments: + - type: "file" + name: "--output_r1" + description: "Path to output for R2" + info: null + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--output_r2" + description: "Path to the output for R2" + info: null + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: true + multiple_sep: ";" +resources: +- type: "nextflow_script" + path: "main.nf" + is_executable: true + entrypoint: "run_wf" +description: "N/A\n" +info: null +status: "enabled" +requirements: + commands: + - "ps" +license: "MIT" +links: + repository: "https://github.com/viash-hub/htrnaseq" +runners: +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "native" + id: "native" +build_info: + config: "src/workflows/utils/groupLanes/config.vsh.yaml" + runner: "nextflow" + engine: "native" + output: "target/nextflow/workflows/utils/groupLanes" + executable: "target/nextflow/workflows/utils/groupLanes/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "7c0705a514b86c8d335f308abf7fb1b62d16aa2f" + git_remote: "https://github.com/viash-hub/htrnaseq" +package_config: + name: "htrnaseq" + version: "unpack_genome" + description: "Demultiplexing pipeline [WIP]\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + keywords: + - "bioinformatics" + - "sequence" + - "high-throughput" + - "mapping" + - "counting" + - "pipeline" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/htrnaseq" + issue_tracker: "https://github.com/viash-hub/htrnaseq/issues" diff --git a/target/nextflow/workflows/utils/groupLanes/main.nf b/target/nextflow/workflows/utils/groupLanes/main.nf new file mode 100644 index 00000000..a37576b4 --- /dev/null +++ b/target/nextflow/workflows/utils/groupLanes/main.nf @@ -0,0 +1,3141 @@ +// groupLanes unpack_genome +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "groupLanes", + "namespace" : "workflows/utils", + "version" : "unpack_genome", + "argument_groups" : [ + { + "name" : "Inputs", + "arguments" : [ + { + "type" : "file", + "name" : "--input_r1", + "description" : "Path to the input for R1", + "example" : [ + "input.fastq.gz" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--input_r2", + "description" : "Path to the input for R2", + "example" : [ + "input.fastq.gz" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output", + "arguments" : [ + { + "type" : "file", + "name" : "--output_r1", + "description" : "Path to output for R2", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--output_r2", + "description" : "Path to the output for R2", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "nextflow_script", + "path" : "main.nf", + "is_executable" : true, + "entrypoint" : "run_wf" + } + ], + "description" : "N/A\n", + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "license" : "MIT", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq" + }, + "runners" : [ + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/workflows/utils/groupLanes/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "native", + "output" : "target/nextflow/workflows/utils/groupLanes", + "viash_version" : "0.9.0-RC6", + "git_commit" : "7c0705a514b86c8d335f308abf7fb1b62d16aa2f", + "git_remote" : "https://github.com/viash-hub/htrnaseq" + }, + "package_config" : { + "name" : "htrnaseq", + "version" : "unpack_genome", + "description" : "Demultiplexing pipeline [WIP]\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + ], + "keywords" : [ + "bioinformatics", + "sequence", + "high-throughput", + "mapping", + "counting", + "pipeline" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq", + "issue_tracker" : "https://github.com/viash-hub/htrnaseq/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// user-provided Nextflow code +workflow run_wf { + + take: in_ + + main: + + out_ = in_ + | map{ id, f -> [ id.replaceAll("_L00\\d", "").replaceAll("_lane\\d", ""), [ input_r1: f.input_r1, input_r2: f.input_r2 ] , id ] } + | groupTuple(sort: "hash") + | map{ new_id, inputs, ids -> + [ + new_id, + [ + output_r1: inputs.collect{it.input_r1}, + output_r2: inputs.collect{it.input_r2}, + _meta: [ join_id: ids[0] ] + ] + ] + } + + emit: out_ + +} + +// inner workflow hook +def innerWorkflowFactory(args) { + return run_wf +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/nextflow/workflows/utils/groupLanes/nextflow.config b/target/nextflow/workflows/utils/groupLanes/nextflow.config new file mode 100644 index 00000000..5e1df324 --- /dev/null +++ b/target/nextflow/workflows/utils/groupLanes/nextflow.config @@ -0,0 +1,125 @@ +manifest { + name = 'workflows/utils/groupLanes' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'unpack_genome' + description = 'N/A\n' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/nextflow/workflows/utils/groupLanes/nextflow_schema.json b/target/nextflow/workflows/utils/groupLanes/nextflow_schema.json new file mode 100644 index 00000000..555452fe --- /dev/null +++ b/target/nextflow/workflows/utils/groupLanes/nextflow_schema.json @@ -0,0 +1,116 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "groupLanes", +"description": "N/A\n", +"type": "object", +"definitions": { + + + + "inputs" : { + "title": "Inputs", + "type": "object", + "description": "No description", + "properties": { + + + "input_r1": { + "type": + "string", + "description": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1", + "help_text": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1" + + } + + + , + "input_r2": { + "type": + "string", + "description": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R2", + "help_text": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R2" + + } + + +} +}, + + + "output" : { + "title": "Output", + "type": "object", + "description": "No description", + "properties": { + + + "output_r1": { + "type": + "string", + "description": "Type: List of `file`, required, default: `$id.$key.output_r1_*.output_r1_*`, multiple_sep: `\":\"`. Path to output for R2", + "help_text": "Type: List of `file`, required, default: `$id.$key.output_r1_*.output_r1_*`, multiple_sep: `\":\"`. Path to output for R2" + , + "default": "$id.$key.output_r1_*.output_r1_*" + } + + + , + "output_r2": { + "type": + "string", + "description": "Type: List of `file`, required, default: `$id.$key.output_r2_*.output_r2_*`, multiple_sep: `\":\"`. Path to the output for R2", + "help_text": "Type: List of `file`, required, default: `$id.$key.output_r2_*.output_r2_*`, multiple_sep: `\":\"`. Path to the output for R2" + , + "default": "$id.$key.output_r2_*.output_r2_*" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/inputs" + }, + + { + "$ref": "#/definitions/output" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/nextflow/workflows/utils/groupPairs/.config.vsh.yaml b/target/nextflow/workflows/utils/groupPairs/.config.vsh.yaml new file mode 100644 index 00000000..d53bd55e --- /dev/null +++ b/target/nextflow/workflows/utils/groupPairs/.config.vsh.yaml @@ -0,0 +1,153 @@ +name: "groupPairs" +namespace: "workflows/utils" +version: "unpack_genome" +argument_groups: +- name: "Inputs" + arguments: + - type: "file" + name: "--input" + description: "Path to the input for R1" + info: null + example: + - "input.fastq.gz" + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output" + arguments: + - type: "file" + name: "--r1" + description: "Path to output for R2" + info: null + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--r2" + description: "Path to output for R2" + info: null + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: false + multiple_sep: ";" +resources: +- type: "nextflow_script" + path: "main.nf" + is_executable: true + entrypoint: "run_wf" +description: "N/A\n" +info: null +status: "enabled" +requirements: + commands: + - "ps" +license: "MIT" +links: + repository: "https://github.com/viash-hub/htrnaseq" +runners: +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "native" + id: "native" +build_info: + config: "src/workflows/utils/groupPairs/config.vsh.yaml" + runner: "nextflow" + engine: "native" + output: "target/nextflow/workflows/utils/groupPairs" + executable: "target/nextflow/workflows/utils/groupPairs/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "7c0705a514b86c8d335f308abf7fb1b62d16aa2f" + git_remote: "https://github.com/viash-hub/htrnaseq" +package_config: + name: "htrnaseq" + version: "unpack_genome" + description: "Demultiplexing pipeline [WIP]\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + keywords: + - "bioinformatics" + - "sequence" + - "high-throughput" + - "mapping" + - "counting" + - "pipeline" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/htrnaseq" + issue_tracker: "https://github.com/viash-hub/htrnaseq/issues" diff --git a/target/nextflow/workflows/utils/groupPairs/main.nf b/target/nextflow/workflows/utils/groupPairs/main.nf new file mode 100644 index 00000000..ee5f2a10 --- /dev/null +++ b/target/nextflow/workflows/utils/groupPairs/main.nf @@ -0,0 +1,3129 @@ +// groupPairs unpack_genome +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "groupPairs", + "namespace" : "workflows/utils", + "version" : "unpack_genome", + "argument_groups" : [ + { + "name" : "Inputs", + "arguments" : [ + { + "type" : "file", + "name" : "--input", + "description" : "Path to the input for R1", + "example" : [ + "input.fastq.gz" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output", + "arguments" : [ + { + "type" : "file", + "name" : "--r1", + "description" : "Path to output for R2", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--r2", + "description" : "Path to output for R2", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "nextflow_script", + "path" : "main.nf", + "is_executable" : true, + "entrypoint" : "run_wf" + } + ], + "description" : "N/A\n", + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "license" : "MIT", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq" + }, + "runners" : [ + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/workflows/utils/groupPairs/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "native", + "output" : "target/nextflow/workflows/utils/groupPairs", + "viash_version" : "0.9.0-RC6", + "git_commit" : "7c0705a514b86c8d335f308abf7fb1b62d16aa2f", + "git_remote" : "https://github.com/viash-hub/htrnaseq" + }, + "package_config" : { + "name" : "htrnaseq", + "version" : "unpack_genome", + "description" : "Demultiplexing pipeline [WIP]\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + ], + "keywords" : [ + "bioinformatics", + "sequence", + "high-throughput", + "mapping", + "counting", + "pipeline" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq", + "issue_tracker" : "https://github.com/viash-hub/htrnaseq/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// user-provided Nextflow code +workflow run_wf { + + take: in_ + + main: + + out_ = in_ + | map{ id, f -> [ id.replaceAll("__R[12]", ""), [ input: f.input ] , id ] } + | groupTuple(sort: "hash") + | map{ new_id, inputs, ids -> + r1 = inputs.collect{it.input}.findAll{it =~ "_R1_"}[0] + r2 = inputs.collect{it.input}.findAll{it =~ "_R2_"}[0] + [ + new_id, + [ + r1: r1, + r2: r2, + _meta: [ join_id: ids[0] ] + ] + ] + } + + emit: out_ + +} + +// inner workflow hook +def innerWorkflowFactory(args) { + return run_wf +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/nextflow/workflows/utils/groupPairs/nextflow.config b/target/nextflow/workflows/utils/groupPairs/nextflow.config new file mode 100644 index 00000000..030d486d --- /dev/null +++ b/target/nextflow/workflows/utils/groupPairs/nextflow.config @@ -0,0 +1,125 @@ +manifest { + name = 'workflows/utils/groupPairs' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'unpack_genome' + description = 'N/A\n' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/nextflow/workflows/utils/groupPairs/nextflow_schema.json b/target/nextflow/workflows/utils/groupPairs/nextflow_schema.json new file mode 100644 index 00000000..de3c4074 --- /dev/null +++ b/target/nextflow/workflows/utils/groupPairs/nextflow_schema.json @@ -0,0 +1,106 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "groupPairs", +"description": "N/A\n", +"type": "object", +"definitions": { + + + + "inputs" : { + "title": "Inputs", + "type": "object", + "description": "No description", + "properties": { + + + "input": { + "type": + "string", + "description": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1", + "help_text": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1" + + } + + +} +}, + + + "output" : { + "title": "Output", + "type": "object", + "description": "No description", + "properties": { + + + "r1": { + "type": + "string", + "description": "Type: `file`, required, default: `$id.$key.r1.r1`. Path to output for R2", + "help_text": "Type: `file`, required, default: `$id.$key.r1.r1`. Path to output for R2" + , + "default": "$id.$key.r1.r1" + } + + + , + "r2": { + "type": + "string", + "description": "Type: `file`, required, default: `$id.$key.r2.r2`. Path to output for R2", + "help_text": "Type: `file`, required, default: `$id.$key.r2.r2`. Path to output for R2" + , + "default": "$id.$key.r2.r2" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/inputs" + }, + + { + "$ref": "#/definitions/output" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/nextflow/workflows/utils/groupWells/.config.vsh.yaml b/target/nextflow/workflows/utils/groupWells/.config.vsh.yaml new file mode 100644 index 00000000..e7a9ac8e --- /dev/null +++ b/target/nextflow/workflows/utils/groupWells/.config.vsh.yaml @@ -0,0 +1,185 @@ +name: "groupWells" +namespace: "workflows/utils" +version: "unpack_genome" +argument_groups: +- name: "Inputs" + arguments: + - type: "string" + name: "--well" + description: "Barcode identifier for a well" + info: null + example: + - "input.fastq.gz" + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--input_r1" + description: "Path to the input for R1" + info: null + example: + - "input.fastq.gz" + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--input_r2" + description: "Path to the input for R1" + info: null + example: + - "input.fastq.gz" + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output" + arguments: + - type: "string" + name: "--wells" + description: "List of grouped wells (by means of barcodes)" + info: null + example: + - "input.fastq.gz" + required: false + direction: "output" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--output_r1" + description: "Path to output for R2" + info: null + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: true + multiple_sep: ";" + - type: "file" + name: "--output_r2" + description: "Path to the output for R2" + info: null + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: true + multiple_sep: ";" +resources: +- type: "nextflow_script" + path: "main.nf" + is_executable: true + entrypoint: "run_wf" +description: "N/A\n" +info: null +status: "enabled" +requirements: + commands: + - "ps" +license: "MIT" +links: + repository: "https://github.com/viash-hub/htrnaseq" +runners: +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "native" + id: "native" +build_info: + config: "src/workflows/utils/groupWells/config.vsh.yaml" + runner: "nextflow" + engine: "native" + output: "target/nextflow/workflows/utils/groupWells" + executable: "target/nextflow/workflows/utils/groupWells/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "7c0705a514b86c8d335f308abf7fb1b62d16aa2f" + git_remote: "https://github.com/viash-hub/htrnaseq" +package_config: + name: "htrnaseq" + version: "unpack_genome" + description: "Demultiplexing pipeline [WIP]\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + keywords: + - "bioinformatics" + - "sequence" + - "high-throughput" + - "mapping" + - "counting" + - "pipeline" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/htrnaseq" + issue_tracker: "https://github.com/viash-hub/htrnaseq/issues" diff --git a/target/nextflow/workflows/utils/groupWells/main.nf b/target/nextflow/workflows/utils/groupWells/main.nf new file mode 100644 index 00000000..16a75116 --- /dev/null +++ b/target/nextflow/workflows/utils/groupWells/main.nf @@ -0,0 +1,3166 @@ +// groupWells unpack_genome +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "groupWells", + "namespace" : "workflows/utils", + "version" : "unpack_genome", + "argument_groups" : [ + { + "name" : "Inputs", + "arguments" : [ + { + "type" : "string", + "name" : "--well", + "description" : "Barcode identifier for a well", + "example" : [ + "input.fastq.gz" + ], + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--input_r1", + "description" : "Path to the input for R1", + "example" : [ + "input.fastq.gz" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--input_r2", + "description" : "Path to the input for R1", + "example" : [ + "input.fastq.gz" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output", + "arguments" : [ + { + "type" : "string", + "name" : "--wells", + "description" : "List of grouped wells (by means of barcodes)", + "example" : [ + "input.fastq.gz" + ], + "required" : false, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--output_r1", + "description" : "Path to output for R2", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--output_r2", + "description" : "Path to the output for R2", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "nextflow_script", + "path" : "main.nf", + "is_executable" : true, + "entrypoint" : "run_wf" + } + ], + "description" : "N/A\n", + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "license" : "MIT", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq" + }, + "runners" : [ + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/workflows/utils/groupWells/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "native", + "output" : "target/nextflow/workflows/utils/groupWells", + "viash_version" : "0.9.0-RC6", + "git_commit" : "7c0705a514b86c8d335f308abf7fb1b62d16aa2f", + "git_remote" : "https://github.com/viash-hub/htrnaseq" + }, + "package_config" : { + "name" : "htrnaseq", + "version" : "unpack_genome", + "description" : "Demultiplexing pipeline [WIP]\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + ], + "keywords" : [ + "bioinformatics", + "sequence", + "high-throughput", + "mapping", + "counting", + "pipeline" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq", + "issue_tracker" : "https://github.com/viash-hub/htrnaseq/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// user-provided Nextflow code +workflow run_wf { + + take: in_ + + main: + + out_ = in_ + | map{ id, f -> [ id.replaceAll("__[ACGT]+", ""), [ input_r1: f.input_r1, input_r2: f.input_r2, well: f.well ] , id ] } + | groupTuple(sort: "hash") + | map{ new_id, inputs, ids -> + [ + new_id, + [ + output_r1: inputs.collect{it.input_r1}, + output_r2: inputs.collect{it.input_r2}, + wells: inputs.collect{it.well}, + _meta: [ join_id: ids[0] ] + ] + ] + } + + emit: out_ + +} + +// inner workflow hook +def innerWorkflowFactory(args) { + return run_wf +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/nextflow/workflows/utils/groupWells/nextflow.config b/target/nextflow/workflows/utils/groupWells/nextflow.config new file mode 100644 index 00000000..5016265c --- /dev/null +++ b/target/nextflow/workflows/utils/groupWells/nextflow.config @@ -0,0 +1,125 @@ +manifest { + name = 'workflows/utils/groupWells' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'unpack_genome' + description = 'N/A\n' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/nextflow/workflows/utils/groupWells/nextflow_schema.json b/target/nextflow/workflows/utils/groupWells/nextflow_schema.json new file mode 100644 index 00000000..16a22ea7 --- /dev/null +++ b/target/nextflow/workflows/utils/groupWells/nextflow_schema.json @@ -0,0 +1,136 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "groupWells", +"description": "N/A\n", +"type": "object", +"definitions": { + + + + "inputs" : { + "title": "Inputs", + "type": "object", + "description": "No description", + "properties": { + + + "well": { + "type": + "string", + "description": "Type: `string`, required, example: `input.fastq.gz`. Barcode identifier for a well", + "help_text": "Type: `string`, required, example: `input.fastq.gz`. Barcode identifier for a well" + + } + + + , + "input_r1": { + "type": + "string", + "description": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1", + "help_text": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1" + + } + + + , + "input_r2": { + "type": + "string", + "description": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1", + "help_text": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1" + + } + + +} +}, + + + "output" : { + "title": "Output", + "type": "object", + "description": "No description", + "properties": { + + + "wells": { + "type": + "string", + "description": "Type: List of `string`, example: `input.fastq.gz`, multiple_sep: `\":\"`. List of grouped wells (by means of barcodes)", + "help_text": "Type: List of `string`, example: `input.fastq.gz`, multiple_sep: `\":\"`. List of grouped wells (by means of barcodes)" + + } + + + , + "output_r1": { + "type": + "string", + "description": "Type: List of `file`, default: `$id.$key.output_r1_*.output_r1_*`, multiple_sep: `\":\"`. Path to output for R2", + "help_text": "Type: List of `file`, default: `$id.$key.output_r1_*.output_r1_*`, multiple_sep: `\":\"`. Path to output for R2" + , + "default": "$id.$key.output_r1_*.output_r1_*" + } + + + , + "output_r2": { + "type": + "string", + "description": "Type: List of `file`, default: `$id.$key.output_r2_*.output_r2_*`, multiple_sep: `\":\"`. Path to the output for R2", + "help_text": "Type: List of `file`, default: `$id.$key.output_r2_*.output_r2_*`, multiple_sep: `\":\"`. Path to the output for R2" + , + "default": "$id.$key.output_r2_*.output_r2_*" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/inputs" + }, + + { + "$ref": "#/definitions/output" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/nextflow/workflows/utils/splitWells/.config.vsh.yaml b/target/nextflow/workflows/utils/splitWells/.config.vsh.yaml new file mode 100644 index 00000000..3fabfe2f --- /dev/null +++ b/target/nextflow/workflows/utils/splitWells/.config.vsh.yaml @@ -0,0 +1,171 @@ +name: "splitWells" +namespace: "workflows/utils" +version: "unpack_genome" +argument_groups: +- name: "Inputs" + arguments: + - type: "file" + name: "--input" + description: "List of demultiplexed fastq files" + info: null + example: + - "ACAGCGATCGAC_R1_001.fastq" + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: true + multiple_sep: ";" +- name: "Output" + arguments: + - type: "string" + name: "--pool" + description: "The original pool / sample name" + info: null + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--barcode" + info: null + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--barcode_path" + info: null + must_exist: true + create_parent: true + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--lane" + info: null + required: false + direction: "output" + multiple: false + multiple_sep: ";" + - type: "string" + name: "--pair_end" + info: null + required: false + direction: "output" + multiple: false + multiple_sep: ";" +resources: +- type: "nextflow_script" + path: "main.nf" + is_executable: true + entrypoint: "run_wf" +description: "N/A\n" +info: null +status: "enabled" +requirements: + commands: + - "ps" +license: "MIT" +links: + repository: "https://github.com/viash-hub/htrnaseq" +runners: +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "native" + id: "native" +build_info: + config: "src/workflows/utils/splitWells/config.vsh.yaml" + runner: "nextflow" + engine: "native" + output: "target/nextflow/workflows/utils/splitWells" + executable: "target/nextflow/workflows/utils/splitWells/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "7c0705a514b86c8d335f308abf7fb1b62d16aa2f" + git_remote: "https://github.com/viash-hub/htrnaseq" +package_config: + name: "htrnaseq" + version: "unpack_genome" + description: "Demultiplexing pipeline [WIP]\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + keywords: + - "bioinformatics" + - "sequence" + - "high-throughput" + - "mapping" + - "counting" + - "pipeline" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/htrnaseq" + issue_tracker: "https://github.com/viash-hub/htrnaseq/issues" diff --git a/target/nextflow/workflows/utils/splitWells/main.nf b/target/nextflow/workflows/utils/splitWells/main.nf new file mode 100644 index 00000000..9b8e4068 --- /dev/null +++ b/target/nextflow/workflows/utils/splitWells/main.nf @@ -0,0 +1,3155 @@ +// splitWells unpack_genome +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "splitWells", + "namespace" : "workflows/utils", + "version" : "unpack_genome", + "argument_groups" : [ + { + "name" : "Inputs", + "arguments" : [ + { + "type" : "file", + "name" : "--input", + "description" : "List of demultiplexed fastq files", + "example" : [ + "ACAGCGATCGAC_R1_001.fastq" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : true, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output", + "arguments" : [ + { + "type" : "string", + "name" : "--pool", + "description" : "The original pool / sample name", + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--barcode", + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--barcode_path", + "must_exist" : true, + "create_parent" : true, + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--lane", + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "string", + "name" : "--pair_end", + "required" : false, + "direction" : "output", + "multiple" : false, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "nextflow_script", + "path" : "main.nf", + "is_executable" : true, + "entrypoint" : "run_wf" + } + ], + "description" : "N/A\n", + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "license" : "MIT", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq" + }, + "runners" : [ + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/workflows/utils/splitWells/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "native", + "output" : "target/nextflow/workflows/utils/splitWells", + "viash_version" : "0.9.0-RC6", + "git_commit" : "7c0705a514b86c8d335f308abf7fb1b62d16aa2f", + "git_remote" : "https://github.com/viash-hub/htrnaseq" + }, + "package_config" : { + "name" : "htrnaseq", + "version" : "unpack_genome", + "description" : "Demultiplexing pipeline [WIP]\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + ], + "keywords" : [ + "bioinformatics", + "sequence", + "high-throughput", + "mapping", + "counting", + "pipeline" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq", + "issue_tracker" : "https://github.com/viash-hub/htrnaseq/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) + + +// inner workflow +// user-provided Nextflow code +workflow run_wf { + + take: in_ + + main: + + out_ = in_ + + | flatMap{ id, state -> + state.input.collect{ p -> + barcode = (p =~ /.*\\/([ACTG]*|unknown)_R?.*/)[0][1] + pair_end = (p =~ /.*_(R[12])_.*/)[0][1] + lane = (id =~ /.*_(L\d+).*/) ? (id =~ /.*_(L\d+).*/)[0][1] : "no_lanes" + [ + id + "__" + barcode + "__" + pair_end, + [ + pool: id, + barcode: barcode, + barcode_path: p, + lane: lane, + pair_end: pair_end, + _meta: [ join_id: id ] + ] + ] + } + } + + emit: out_ + +} + +// inner workflow hook +def innerWorkflowFactory(args) { + return run_wf +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/nextflow/workflows/utils/splitWells/nextflow.config b/target/nextflow/workflows/utils/splitWells/nextflow.config new file mode 100644 index 00000000..cb8936e4 --- /dev/null +++ b/target/nextflow/workflows/utils/splitWells/nextflow.config @@ -0,0 +1,125 @@ +manifest { + name = 'workflows/utils/splitWells' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'unpack_genome' + description = 'N/A\n' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/nextflow/workflows/utils/splitWells/nextflow_schema.json b/target/nextflow/workflows/utils/splitWells/nextflow_schema.json new file mode 100644 index 00000000..89b7c812 --- /dev/null +++ b/target/nextflow/workflows/utils/splitWells/nextflow_schema.json @@ -0,0 +1,135 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "splitWells", +"description": "N/A\n", +"type": "object", +"definitions": { + + + + "inputs" : { + "title": "Inputs", + "type": "object", + "description": "No description", + "properties": { + + + "input": { + "type": + "string", + "description": "Type: List of `file`, required, example: `ACAGCGATCGAC_R1_001.fastq`, multiple_sep: `\":\"`. List of demultiplexed fastq files", + "help_text": "Type: List of `file`, required, example: `ACAGCGATCGAC_R1_001.fastq`, multiple_sep: `\":\"`. List of demultiplexed fastq files" + + } + + +} +}, + + + "output" : { + "title": "Output", + "type": "object", + "description": "No description", + "properties": { + + + "pool": { + "type": + "string", + "description": "Type: `string`. The original pool / sample name", + "help_text": "Type: `string`. The original pool / sample name" + + } + + + , + "barcode": { + "type": + "string", + "description": "Type: `string`. ", + "help_text": "Type: `string`. " + + } + + + , + "barcode_path": { + "type": + "string", + "description": "Type: `file`, default: `$id.$key.barcode_path.barcode_path`. ", + "help_text": "Type: `file`, default: `$id.$key.barcode_path.barcode_path`. " + , + "default": "$id.$key.barcode_path.barcode_path" + } + + + , + "lane": { + "type": + "string", + "description": "Type: `string`. ", + "help_text": "Type: `string`. " + + } + + + , + "pair_end": { + "type": + "string", + "description": "Type: `string`. ", + "help_text": "Type: `string`. " + + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/inputs" + }, + + { + "$ref": "#/definitions/output" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +} diff --git a/target/nextflow/workflows/well_demultiplex/.config.vsh.yaml b/target/nextflow/workflows/well_demultiplex/.config.vsh.yaml new file mode 100644 index 00000000..7ddbe89f --- /dev/null +++ b/target/nextflow/workflows/well_demultiplex/.config.vsh.yaml @@ -0,0 +1,182 @@ +name: "well_demultiplex" +namespace: "workflows" +version: "unpack_genome" +argument_groups: +- name: "Input arguments" + arguments: + - type: "file" + name: "--input_r1" + description: "R1" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--input_r2" + description: "R2" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" + - type: "file" + name: "--barcodesFasta" + info: null + must_exist: true + create_parent: true + required: true + direction: "input" + multiple: false + multiple_sep: ";" +- name: "Output arguments" + arguments: + - type: "file" + name: "--output" + description: "List of demultiplexed fastq files" + info: null + default: + - "fastq/*_001.fastq" + must_exist: true + create_parent: true + required: true + direction: "output" + multiple: true + multiple_sep: ";" +resources: +- type: "nextflow_script" + path: "main.nf" + is_executable: true + entrypoint: "run_wf" +description: "Demultiplexing on well level" +test_resources: +- type: "nextflow_script" + path: "test.nf" + is_executable: true + entrypoint: "test_wf" +info: null +status: "enabled" +requirements: + commands: + - "ps" +dependencies: +- name: "cutadapt" + repository: + type: "vsh" + repo: "biobox" + tag: "v0.1.0" +repositories: +- type: "vsh" + name: "bb" + repo: "biobox" + tag: "v0.1.0" +license: "MIT" +links: + repository: "https://github.com/viash-hub/htrnaseq" +runners: +- type: "nextflow" + id: "nextflow" + directives: + tag: "$id" + auto: + simplifyInput: true + simplifyOutput: false + transcript: false + publish: false + config: + labels: + mem1gb: "memory = 1000000000.B" + mem2gb: "memory = 2000000000.B" + mem5gb: "memory = 5000000000.B" + mem10gb: "memory = 10000000000.B" + mem20gb: "memory = 20000000000.B" + mem50gb: "memory = 50000000000.B" + mem100gb: "memory = 100000000000.B" + mem200gb: "memory = 200000000000.B" + mem500gb: "memory = 500000000000.B" + mem1tb: "memory = 1000000000000.B" + mem2tb: "memory = 2000000000000.B" + mem5tb: "memory = 5000000000000.B" + mem10tb: "memory = 10000000000000.B" + mem20tb: "memory = 20000000000000.B" + mem50tb: "memory = 50000000000000.B" + mem100tb: "memory = 100000000000000.B" + mem200tb: "memory = 200000000000000.B" + mem500tb: "memory = 500000000000000.B" + mem1gib: "memory = 1073741824.B" + mem2gib: "memory = 2147483648.B" + mem4gib: "memory = 4294967296.B" + mem8gib: "memory = 8589934592.B" + mem16gib: "memory = 17179869184.B" + mem32gib: "memory = 34359738368.B" + mem64gib: "memory = 68719476736.B" + mem128gib: "memory = 137438953472.B" + mem256gib: "memory = 274877906944.B" + mem512gib: "memory = 549755813888.B" + mem1tib: "memory = 1099511627776.B" + mem2tib: "memory = 2199023255552.B" + mem4tib: "memory = 4398046511104.B" + mem8tib: "memory = 8796093022208.B" + mem16tib: "memory = 17592186044416.B" + mem32tib: "memory = 35184372088832.B" + mem64tib: "memory = 70368744177664.B" + mem128tib: "memory = 140737488355328.B" + mem256tib: "memory = 281474976710656.B" + mem512tib: "memory = 562949953421312.B" + cpu1: "cpus = 1" + cpu2: "cpus = 2" + cpu5: "cpus = 5" + cpu10: "cpus = 10" + cpu20: "cpus = 20" + cpu50: "cpus = 50" + cpu100: "cpus = 100" + cpu200: "cpus = 200" + cpu500: "cpus = 500" + cpu1000: "cpus = 1000" + debug: false + container: "docker" +engines: +- type: "native" + id: "native" +- type: "native" + id: "native" +build_info: + config: "src/workflows/well_demultiplex/config.vsh.yaml" + runner: "nextflow" + engine: "native|native" + output: "target/nextflow/workflows/well_demultiplex" + executable: "target/nextflow/workflows/well_demultiplex/main.nf" + viash_version: "0.9.0-RC6" + git_commit: "7c0705a514b86c8d335f308abf7fb1b62d16aa2f" + git_remote: "https://github.com/viash-hub/htrnaseq" + dependencies: + - "target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt" +package_config: + name: "htrnaseq" + version: "unpack_genome" + description: "Demultiplexing pipeline [WIP]\n" + info: null + viash_version: "0.9.0-RC6" + source: "src" + target: "target" + config_mods: + - ".requirements.commands := ['ps']\n" + - ".engines += { type: \"native\" }" + - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'" + - ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + keywords: + - "bioinformatics" + - "sequence" + - "high-throughput" + - "mapping" + - "counting" + - "pipeline" + license: "MIT" + organization: "vsh" + links: + repository: "https://github.com/viash-hub/htrnaseq" + issue_tracker: "https://github.com/viash-hub/htrnaseq/issues" diff --git a/target/nextflow/workflows/well_demultiplex/main.nf b/target/nextflow/workflows/well_demultiplex/main.nf new file mode 100644 index 00000000..e04b6457 --- /dev/null +++ b/target/nextflow/workflows/well_demultiplex/main.nf @@ -0,0 +1,3178 @@ +// well_demultiplex unpack_genome +// +// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a +// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from +// Data Intuitive. +// +// The component may contain files which fall under a different license. The +// authors of this component should specify the license in the header of such +// files, or include a separate license file detailing the licenses of all included +// files. + +//////////////////////////// +// VDSL3 helper functions // +//////////////////////////// + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_checkArgumentType.nf' +class UnexpectedArgumentTypeException extends Exception { + String errorIdentifier + String stage + String plainName + String expectedClass + String foundClass + + // ${key ? " in module '$key'" : ""}${id ? " id '$id'" : ""} + UnexpectedArgumentTypeException(String errorIdentifier, String stage, String plainName, String expectedClass, String foundClass) { + super("Error${errorIdentifier ? " $errorIdentifier" : ""}:${stage ? " $stage" : "" } argument '${plainName}' has the wrong type. " + + "Expected type: ${expectedClass}. Found type: ${foundClass}") + this.errorIdentifier = errorIdentifier + this.stage = stage + this.plainName = plainName + this.expectedClass = expectedClass + this.foundClass = foundClass + } +} + +/** + * Checks if the given value is of the expected type. If not, an exception is thrown. + * + * @param stage The stage of the argument (input or output) + * @param par The parameter definition + * @param value The value to check + * @param errorIdentifier The identifier to use in the error message + * @return The value, if it is of the expected type + * @throws UnexpectedArgumentTypeException If the value is not of the expected type +*/ +def _checkArgumentType(String stage, Map par, Object value, String errorIdentifier) { + // expectedClass will only be != null if value is not of the expected type + def expectedClass = null + def foundClass = null + + // todo: split if need be + + if (!par.required && value == null) { + expectedClass = null + } else if (par.multiple) { + if (value !instanceof Collection) { + value = [value] + } + + // split strings + value = value.collectMany{ val -> + if (val instanceof String) { + // collect() to ensure that the result is a List and not simply an array + val.split(par.multiple_sep).collect() + } else { + [val] + } + } + + // process globs + if (par.type == "file" && par.direction == "input") { + value = value.collect{ it instanceof String ? file(it, hidden: true) : it }.flatten() + } + + // check types of elements in list + try { + value = value.collect { listVal -> + _checkArgumentType(stage, par + [multiple: false], listVal, errorIdentifier) + } + } catch (UnexpectedArgumentTypeException e) { + expectedClass = "List[${e.expectedClass}]" + foundClass = "List[${e.foundClass}]" + } + } else if (par.type == "string") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else if (par.type == "integer") { + // cast to integer if need be + if (value instanceof String) { + try { + value = value.toInteger() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigInteger) { + value = value.intValue() + } + expectedClass = value instanceof Integer ? null : "Integer" + } else if (par.type == "long") { + // cast to long if need be + if (value instanceof String) { + try { + value = value.toLong() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof Integer) { + value = value.toLong() + } + expectedClass = value instanceof Long ? null : "Long" + } else if (par.type == "double") { + // cast to double if need be + if (value instanceof String) { + try { + value = value.toDouble() + } catch (NumberFormatException e) { + // do nothing + } + } + if (value instanceof java.math.BigDecimal) { + value = value.doubleValue() + } + if (value instanceof Float) { + value = value.toDouble() + } + expectedClass = value instanceof Double ? null : "Double" + } else if (par.type == "boolean" | par.type == "boolean_true" | par.type == "boolean_false") { + // cast to boolean if need be + if (value instanceof String) { + def valueLower = value.toLowerCase() + if (valueLower == "true") { + value = true + } else if (valueLower == "false") { + value = false + } + } + expectedClass = value instanceof Boolean ? null : "Boolean" + } else if (par.type == "file" && (par.direction == "input" || stage == "output")) { + // cast to path if need be + if (value instanceof String) { + value = file(value, hidden: true) + } + if (value instanceof File) { + value = value.toPath() + } + expectedClass = value instanceof Path ? null : "Path" + } else if (par.type == "file" && stage == "input" && par.direction == "output") { + // cast to string if need be + if (value instanceof GString) { + value = value.toString() + } + expectedClass = value instanceof String ? null : "String" + } else { + // didn't find a match for par.type + expectedClass = par.type + } + + if (expectedClass != null) { + if (foundClass == null) { + foundClass = value.getClass().getName() + } + throw new UnexpectedArgumentTypeException(errorIdentifier, stage, par.plainName, expectedClass, foundClass) + } + + return value +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processInputValues.nf' +Map _processInputValues(Map inputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.required) { + assert inputs.containsKey(arg.plainName) && inputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required input argument '${arg.plainName}' is missing" + } + } + + inputs = inputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid input argument" + + value = _checkArgumentType("input", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return inputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/arguments/_processOutputValues.nf' +Map _processOutputValues(Map outputs, Map config, String id, String key) { + if (!workflow.stubRun) { + config.allArguments.each { arg -> + if (arg.direction == "output" && arg.required) { + assert outputs.containsKey(arg.plainName) && outputs.get(arg.plainName) != null : + "Error in module '${key}' id '${id}': required output argument '${arg.plainName}' is missing" + } + } + + outputs = outputs.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && it.direction == "output" } + assert par != null : "Error in module '${key}' id '${id}': '${name}' is not a valid output argument" + + value = _checkArgumentType("output", par, value, "in module '$key' id '$id'") + + [ name, value ] + } + } + return outputs +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/IDChecker.nf' +class IDChecker { + final def items = [] as Set + + @groovy.transform.WithWriteLock + boolean observe(String item) { + if (items.contains(item)) { + return false + } else { + items << item + return true + } + } + + @groovy.transform.WithReadLock + boolean contains(String item) { + return items.contains(item) + } + + @groovy.transform.WithReadLock + Set getItems() { + return items.clone() + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_checkUniqueIds.nf' + +/** + * Check if the ids are unique across parameter sets + * + * @param parameterSets a list of parameter sets. + */ +private void _checkUniqueIds(List>> parameterSets) { + def ppIds = parameterSets.collect{it[0]} + assert ppIds.size() == ppIds.unique().size() : "All argument sets should have unique ids. Detected ids: $ppIds" +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_getChild.nf' + +// helper functions for reading params from file // +def _getChild(parent, child) { + if (child.contains("://") || java.nio.file.Paths.get(child).isAbsolute()) { + child + } else { + def parentAbsolute = java.nio.file.Paths.get(parent).toAbsolutePath().toString() + parentAbsolute.replaceAll('/[^/]*$', "/") + child + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_parseParamList.nf' +/** + * Figure out the param list format based on the file extension + * + * @param param_list A String containing the path to the parameter list file. + * + * @return A String containing the format of the parameter list file. + */ +def _paramListGuessFormat(param_list) { + if (param_list !instanceof String) { + "asis" + } else if (param_list.endsWith(".csv")) { + "csv" + } else if (param_list.endsWith(".json") || param_list.endsWith(".jsn")) { + "json" + } else if (param_list.endsWith(".yaml") || param_list.endsWith(".yml")) { + "yaml" + } else { + "yaml_blob" + } +} + + +/** + * Read the param list + * + * @param param_list One of the following: + * - A String containing the path to the parameter list file (csv, json or yaml), + * - A yaml blob of a list of maps (yaml_blob), + * - Or a groovy list of maps (asis). + * @param config A Map of the Viash configuration. + * + * @return A List of Maps containing the parameters. + */ +def _parseParamList(param_list, Map config) { + // first determine format by extension + def paramListFormat = _paramListGuessFormat(param_list) + + def paramListPath = (paramListFormat != "asis" && paramListFormat != "yaml_blob") ? + file(param_list, hidden: true) : + null + + // get the correct parser function for the detected params_list format + def paramSets = [] + if (paramListFormat == "asis") { + paramSets = param_list + } else if (paramListFormat == "yaml_blob") { + paramSets = readYamlBlob(param_list) + } else if (paramListFormat == "yaml") { + paramSets = readYaml(paramListPath) + } else if (paramListFormat == "json") { + paramSets = readJson(paramListPath) + } else if (paramListFormat == "csv") { + paramSets = readCsv(paramListPath) + } else { + error "Format of provided --param_list not recognised.\n" + + "Found: '$paramListFormat'.\n" + + "Expected: a csv file, a json file, a yaml file,\n" + + "a yaml blob or a groovy list of maps." + } + + // data checks + assert paramSets instanceof List: "--param_list should contain a list of maps" + for (value in paramSets) { + assert value instanceof Map: "--param_list should contain a list of maps" + } + + // id is argument + def idIsArgument = config.allArguments.any{it.plainName == "id"} + + // Reformat from List to List> by adding the ID as first element of a Tuple2 + paramSets = paramSets.collect({ data -> + def id = data.id + if (!idIsArgument) { + data = data.findAll{k, v -> k != "id"} + } + [id, data] + }) + + // Split parameters with 'multiple: true' + paramSets = paramSets.collect({ id, data -> + data = _splitParams(data, config) + [id, data] + }) + + // The paths of input files inside a param_list file may have been specified relatively to the + // location of the param_list file. These paths must be made absolute. + if (paramListPath) { + paramSets = paramSets.collect({ id, data -> + def new_data = data.collectEntries{ parName, parValue -> + def par = config.allArguments.find{it.plainName == parName} + if (par && par.type == "file" && par.direction == "input") { + if (parValue instanceof Collection) { + parValue = parValue.collectMany{path -> + def x = _resolveSiblingIfNotAbsolute(path, paramListPath) + x instanceof Collection ? x : [x] + } + } else { + parValue = _resolveSiblingIfNotAbsolute(parValue, paramListPath) + } + } + [parName, parValue] + } + [id, new_data] + }) + } + + return paramSets +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/_splitParams.nf' +/** + * Split parameters for arguments that accept multiple values using their separator + * + * @param paramList A Map containing parameters to split. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A Map of parameters where the parameter values have been split into a list using + * their seperator. + */ +Map _splitParams(Map parValues, Map config){ + def parsedParamValues = parValues.collectEntries { parName, parValue -> + def parameterSettings = config.allArguments.find({it.plainName == parName}) + + if (!parameterSettings) { + // if argument is not found, do not alter + return [parName, parValue] + } + if (parameterSettings.multiple) { // Check if parameter can accept multiple values + if (parValue instanceof Collection) { + parValue = parValue.collect{it instanceof String ? it.split(parameterSettings.multiple_sep) : it } + } else if (parValue instanceof String) { + parValue = parValue.split(parameterSettings.multiple_sep) + } else if (parValue == null) { + parValue = [] + } else { + parValue = [ parValue ] + } + parValue = parValue.flatten() + } + // For all parameters check if multiple values are only passed for + // arguments that allow it. Quietly simplify lists of length 1. + if (!parameterSettings.multiple && parValue instanceof Collection) { + assert parValue.size() == 1 : + "Error: argument ${parName} has too many values.\n" + + " Expected amount: 1. Found: ${parValue.size()}" + parValue = parValue[0] + } + [parName, parValue] + } + return parsedParamValues +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/channelFromParams.nf' +/** + * Parse nextflow parameters based on settings defined in a viash config. + * Return a list of parameter sets, each parameter set corresponding to + * an event in a nextflow channel. The output from this function can be used + * with Channel.fromList to create a nextflow channel with Vdsl3 formatted + * events. + * + * This function performs: + * - A filtering of the params which can be found in the config file. + * - Process the params_list argument which allows a user to to initialise + * a Vsdl3 channel with multiple parameter sets. Possible formats are + * csv, json, yaml, or simply a yaml_blob. A csv should have column names + * which correspond to the different arguments of this pipeline. A json or a yaml + * file should be a list of maps, each of which has keys corresponding to the + * arguments of the pipeline. A yaml blob can also be passed directly as a parameter. + * When passing a csv, json or yaml, relative path names are relativized to the + * location of the parameter file. + * - Combine the parameter sets into a vdsl3 Channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A list of parameters with the first element of the event being + * the event ID and the second element containing a map of the parsed parameters. + */ + +private List>> _paramsToParamSets(Map params, Map config){ + // todo: fetch key from run args + def key_ = config.name + + /* parse regular parameters (not in param_list) */ + /*************************************************/ + def globalParams = config.allArguments + .findAll { params.containsKey(it.plainName) } + .collectEntries { [ it.plainName, params[it.plainName] ] } + def globalID = params.get("id", null) + + /* process params_list arguments */ + /*********************************/ + def paramList = params.containsKey("param_list") && params.param_list != null ? + params.param_list : [] + // if (paramList instanceof String) { + // paramList = [paramList] + // } + // def paramSets = paramList.collectMany{ _parseParamList(it, config) } + // TODO: be able to process param_list when it is a list of strings + def paramSets = _parseParamList(paramList, config) + if (paramSets.isEmpty()) { + paramSets = [[null, [:]]] + } + + /* combine arguments into channel */ + /**********************************/ + def processedParams = paramSets.indexed().collect{ index, tup -> + // Process ID + def id = tup[0] ?: globalID + + if (workflow.stubRun && !id) { + // if stub run, explicitly add an id if missing + id = "stub${index}" + } + assert id != null: "Each parameter set should have at least an 'id'" + + // Process params + def parValues = globalParams + tup[1] + // // Remove parameters which are null, if the default is also null + // parValues = parValues.collectEntries{paramName, paramValue -> + // parameterSettings = config.functionality.allArguments.find({it.plainName == paramName}) + // if ( paramValue != null || parameterSettings.get("default", null) != null ) { + // [paramName, paramValue] + // } + // } + parValues = parValues.collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + assert par != null : "Error in module '${key_}' id '${id}': '${name}' is not a valid input argument" + + if (par == null) { + return [:] + } + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + + [ name, value ] + } + + [id, parValues] + } + + // Check if ids (first element of each list) is unique + _checkUniqueIds(processedParams) + return processedParams +} + +/** + * Parse nextflow parameters based on settings defined in a viash config + * and return a nextflow channel. + * + * @param params Input parameters. Can optionaly contain a 'param_list' key that + * provides a list of arguments that can be split up into multiple events + * in the output channel possible formats of param_lists are: a csv file, + * json file, a yaml file or a yaml blob. Each parameters set (event) must + * have a unique ID. + * @param config A Map of the Viash configuration. This Map can be generated from the config file + * using the readConfig() function. + * + * @return A nextflow Channel with events. Events are formatted as a tuple that contains + * first contains the ID of the event and as second element holds a parameter map. + * + * + */ +def channelFromParams(Map params, Map config) { + def processedParams = _paramsToParamSets(params, config) + return Channel.fromList(processedParams) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/checkUniqueIds.nf' +def checkUniqueIds(Map args) { + def stopOnError = args.stopOnError == null ? args.stopOnError : true + + def idChecker = new IDChecker() + + return filter { tup -> + if (!idChecker.observe(tup[0])) { + if (stopOnError) { + error "Duplicate id: ${tup[0]}" + } else { + log.warn "Duplicate id: ${tup[0]}, removing duplicate entry" + return false + } + } + return true + } +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/preprocessInputs.nf' +// This helper file will be deprecated soon +preprocessInputsDeprecationWarningPrinted = false + +def preprocessInputsDeprecationWarning() { + if (!preprocessInputsDeprecationWarningPrinted) { + preprocessInputsDeprecationWarningPrinted = true + System.err.println("Warning: preprocessInputs() is deprecated and will be removed in Viash 0.9.0.") + } +} + +/** + * Generate a nextflow Workflow that allows processing a channel of + * Vdsl3 formatted events and apply a Viash config to them: + * - Gather default parameters from the Viash config and make + * sure that they are correctly formatted (see applyConfig method). + * - Format the input parameters (also using the applyConfig method). + * - Apply the default parameter to the input parameters. + * - Do some assertions: + * ~ Check if the event IDs in the channel are unique. + * + * The events in the channel are formatted as tuples, with the + * first element of the tuples being a unique id of the parameter set, + * and the second element containg the the parameters themselves. + * Optional extra elements of the tuples will be passed to the output as is. + * + * @param args A map that must contain a 'config' key that points + * to a parsed config (see readConfig()). Optionally, a + * 'key' key can be provided which can be used to create a unique + * name for the workflow process. + * + * @return A workflow that allows processing a channel of Vdsl3 formatted events + * and apply a Viash config to them. + */ +def preprocessInputs(Map args) { + preprocessInputsDeprecationWarning() + + def config = args.config + assert config instanceof Map : + "Error in preprocessInputs: config must be a map. " + + "Expected class: Map. Found: config.getClass() is ${config.getClass()}" + def key_ = args.key ?: config.name + + // Get different parameter types (used throughout this function) + def defaultArgs = config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + map { tup -> + def id = tup[0] + def data = tup[1] + def passthrough = tup.drop(2) + + def new_data = (defaultArgs + data).collectEntries { name, value -> + def par = config.allArguments.find { it.plainName == name && (it.direction == "input" || it.type == "file") } + + if (par != null) { + value = _checkArgumentType("input", par, value, "in module '$key_' id '$id'") + } + + [ name, value ] + } + + [ id, new_data ] + passthrough + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runComponents.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component config. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component config. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component config. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component config. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runComponents(Map args) { + log.warn("runComponents is deprecated, use runEach instead") + assert args.components: "runComponents should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runComponents" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runComponentsWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def comp_config = comp_.config + + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_config) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + // def new_id = id_(tup[0], tup[1], comp_config) + def new_id = tup[0] + if (id_ instanceof String) { + new_id = id_ + } else if (id_ instanceof Closure) { + new_id = id_(new_id, tup[1], comp_config) + } + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_config) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_config) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runComponentsWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/runEach.nf' +/** + * Run a list of components on a stream of data. + * + * @param components: list of Viash VDSL3 modules to run + * @param fromState: a closure, a map or a list of keys to extract from the input data. + * If a closure, it will be called with the id, the data and the component itself. + * @param toState: a closure, a map or a list of keys to extract from the output data + * If a closure, it will be called with the id, the output data, the old state and the component itself. + * @param filter: filter function to apply to the input. + * It will be called with the id, the data and the component itself. + * @param id: id to use for the output data + * If a closure, it will be called with the id, the data and the component itself. + * @param auto: auto options to pass to the components + * + * @return: a workflow that runs the components + **/ +def runEach(Map args) { + assert args.components: "runEach should be passed a list of components to run" + + def components_ = args.components + if (components_ !instanceof List) { + components_ = [ components_ ] + } + assert components_.size() > 0: "pass at least one component to runEach" + + def fromState_ = args.fromState + def toState_ = args.toState + def filter_ = args.filter + def id_ = args.id + + workflow runEachWf { + take: input_ch + main: + + // generate one channel per method + out_chs = components_.collect{ comp_ -> + def filter_ch = filter_ + ? input_ch | filter{tup -> + filter_(tup[0], tup[1], comp_) + } + : input_ch + def id_ch = id_ + ? filter_ch | map{tup -> + def new_id = id_ + if (new_id instanceof Closure) { + new_id = new_id(tup[0], tup[1], comp_) + } + assert new_id instanceof String : "Error in runEach: id should be a String or a Closure that returns a String. Expected: id instanceof String. Found: ${new_id.getClass()}" + [new_id] + tup.drop(1) + } + : filter_ch + def data_ch = id_ch | map{tup -> + def new_data = tup[1] + if (fromState_ instanceof Map) { + new_data = fromState_.collectEntries{ key0, key1 -> + [key0, new_data[key1]] + } + } else if (fromState_ instanceof List) { + new_data = fromState_.collectEntries{ key -> + [key, new_data[key]] + } + } else if (fromState_ instanceof Closure) { + new_data = fromState_(tup[0], new_data, comp_) + } + tup.take(1) + [new_data] + tup.drop(1) + } + def out_ch = data_ch + | comp_.run( + auto: (args.auto ?: [:]) + [simplifyInput: false, simplifyOutput: false] + ) + def post_ch = toState_ + ? out_ch | map{tup -> + def output = tup[1] + def old_state = tup[2] + def new_state = null + if (toState_ instanceof Map) { + new_state = old_state + toState_.collectEntries{ key0, key1 -> + [key0, output[key1]] + } + } else if (toState_ instanceof List) { + new_state = old_state + toState_.collectEntries{ key -> + [key, output[key]] + } + } else if (toState_ instanceof Closure) { + new_state = toState_(tup[0], output, old_state, comp_) + } + [tup[0], new_state] + tup.drop(3) + } + : out_ch + + post_ch + } + + // mix all results + output_ch = + (out_chs.size == 1) + ? out_chs[0] + : out_chs[0].mix(*out_chs.drop(1)) + + emit: output_ch + } + + return runEachWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/channel/safeJoin.nf' +/** + * Join sourceChannel to targetChannel + * + * This function joins the sourceChannel to the targetChannel. + * However, each id in the targetChannel must be present in the + * sourceChannel. If _meta.join_id exists in the targetChannel, that is + * used as an id instead. If the id doesn't match any id in the sourceChannel, + * an error is thrown. + */ + +def safeJoin(targetChannel, sourceChannel, key) { + def sourceIDs = new IDChecker() + + def sourceCheck = sourceChannel + | map { tup -> + sourceIDs.observe(tup[0]) + tup + } + def targetCheck = targetChannel + | map { tup -> + def id = tup[0] + + if (!sourceIDs.contains(id)) { + error ( + "Error in module '${key}' when merging output with original state.\n" + + " Reason: output with id '${id}' could not be joined with source channel.\n" + + " If the IDs in the output channel differ from the input channel,\n" + + " please set `tup[1]._meta.join_id to the original ID.\n" + + " Original IDs in input channel: ['${sourceIDs.getItems().join("', '")}'].\n" + + " Unexpected ID in the output channel: '${id}'.\n" + + " Example input event: [\"id\", [input: file(...)]],\n" + + " Example output event: [\"newid\", [output: file(...), _meta: [join_id: \"id\"]]]" + ) + } + // TODO: add link to our documentation on how to fix this + + tup + } + + sourceCheck.cross(targetChannel) + | map{ left, right -> + right + left.drop(1) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/_processArgument.nf' +def _processArgument(arg) { + arg.multiple = arg.multiple != null ? arg.multiple : false + arg.required = arg.required != null ? arg.required : false + arg.direction = arg.direction != null ? arg.direction : "input" + arg.multiple_sep = arg.multiple_sep != null ? arg.multiple_sep : ";" + arg.plainName = arg.name.replaceAll("^-*", "") + + if (arg.type == "file") { + arg.must_exist = arg.must_exist != null ? arg.must_exist : true + arg.create_parent = arg.create_parent != null ? arg.create_parent : true + } + + // add default values to output files which haven't already got a default + if (arg.type == "file" && arg.direction == "output" && arg.default == null) { + def mult = arg.multiple ? "_*" : "" + def extSearch = "" + if (arg.default != null) { + extSearch = arg.default + } else if (arg.example != null) { + extSearch = arg.example + } + if (extSearch instanceof List) { + extSearch = extSearch[0] + } + def extSearchResult = extSearch.find("\\.[^\\.]+\$") + def ext = extSearchResult != null ? extSearchResult : "" + arg.default = "\$id.\$key.${arg.plainName}${mult}${ext}" + if (arg.multiple) { + arg.default = [arg.default] + } + } + + if (!arg.multiple) { + if (arg.default != null && arg.default instanceof List) { + arg.default = arg.default[0] + } + if (arg.example != null && arg.example instanceof List) { + arg.example = arg.example[0] + } + } + + if (arg.type == "boolean_true") { + arg.default = false + } + if (arg.type == "boolean_false") { + arg.default = true + } + + arg +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/addGlobalParams.nf' +def addGlobalArguments(config) { + def localConfig = [ + "argument_groups": [ + [ + "name": "Nextflow input-output arguments", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "arguments" : [ + [ + 'name': '--publish_dir', + 'required': true, + 'type': 'string', + 'description': 'Path to an output directory.', + 'example': 'output/', + 'multiple': false + ], + [ + 'name': '--param_list', + 'required': false, + 'type': 'string', + 'description': '''Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob. + | + |* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ ['id': 'foo', 'input': 'foo.txt'], ['id': 'bar', 'input': 'bar.txt'] ]`. + |* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`. + |* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]`. + |* A yaml blob can also be passed directly as a string. Example: `--param_list "[ {'id': 'foo', 'input': 'foo.txt'}, {'id': 'bar', 'input': 'bar.txt'} ]"`. + | + |When passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.'''.stripMargin(), + 'example': 'my_params.yaml', + 'multiple': false, + 'hidden': true + ] + // TODO: allow multiple: true in param_list? + // TODO: allow to specify a --param_list_regex to filter the param_list? + // TODO: allow to specify a --param_list_from_state to remap entries in the param_list? + ] + ] + ] + ] + + return processConfig(_mergeMap(config, localConfig)) +} + +def _mergeMap(Map lhs, Map rhs) { + return rhs.inject(lhs.clone()) { map, entry -> + if (map[entry.key] instanceof Map && entry.value instanceof Map) { + map[entry.key] = _mergeMap(map[entry.key], entry.value) + } else if (map[entry.key] instanceof Collection && entry.value instanceof Collection) { + map[entry.key] += entry.value + } else { + map[entry.key] = entry.value + } + return map + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/generateHelp.nf' +def _generateArgumentHelp(param) { + // alternatives are not supported + // def names = param.alternatives ::: List(param.name) + + def unnamedProps = [ + ["required parameter", param.required], + ["multiple values allowed", param.multiple], + ["output", param.direction.toLowerCase() == "output"], + ["file must exist", param.type == "file" && param.must_exist] + ].findAll{it[1]}.collect{it[0]} + + def dflt = null + if (param.default != null) { + if (param.default instanceof List) { + dflt = param.default.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + dflt = param.default.toString() + } + } + def example = null + if (param.example != null) { + if (param.example instanceof List) { + example = param.example.join(param.multiple_sep != null ? param.multiple_sep : ", ") + } else { + example = param.example.toString() + } + } + def min = param.min?.toString() + def max = param.max?.toString() + + def escapeChoice = { choice -> + def s1 = choice.replaceAll("\\n", "\\\\n") + def s2 = s1.replaceAll("\"", """\\\"""") + s2.contains(",") || s2 != choice ? "\"" + s2 + "\"" : s2 + } + def choices = param.choices == null ? + null : + "[ " + param.choices.collect{escapeChoice(it.toString())}.join(", ") + " ]" + + def namedPropsStr = [ + ["type", ([param.type] + unnamedProps).join(", ")], + ["default", dflt], + ["example", example], + ["choices", choices], + ["min", min], + ["max", max] + ] + .findAll{it[1]} + .collect{"\n " + it[0] + ": " + it[1].replaceAll("\n", "\\n")} + .join("") + + def descStr = param.description == null ? + "" : + _paragraphWrap("\n" + param.description.trim(), 80 - 8).join("\n ") + + "\n --" + param.plainName + + namedPropsStr + + descStr +} + +// Based on Helper.generateHelp() in Helper.scala +def _generateHelp(config) { + def fun = config + + // PART 1: NAME AND VERSION + def nameStr = fun.name + + (fun.version == null ? "" : " " + fun.version) + + // PART 2: DESCRIPTION + def descrStr = fun.description == null ? + "" : + "\n\n" + _paragraphWrap(fun.description.trim(), 80).join("\n") + + // PART 3: Usage + def usageStr = fun.usage == null ? + "" : + "\n\nUsage:\n" + fun.usage.trim() + + // PART 4: Options + def argGroupStrs = fun.allArgumentGroups.collect{argGroup -> + def name = argGroup.name + def descriptionStr = argGroup.description == null ? + "" : + "\n " + _paragraphWrap(argGroup.description.trim(), 80-4).join("\n ") + "\n" + def arguments = argGroup.arguments.collect{arg -> + arg instanceof String ? fun.allArguments.find{it.plainName == arg} : arg + }.findAll{it != null} + def argumentStrs = arguments.collect{param -> _generateArgumentHelp(param)} + + "\n\n$name:" + + descriptionStr + + argumentStrs.join("\n") + } + + // FINAL: combine + def out = nameStr + + descrStr + + usageStr + + argGroupStrs.join("") + + return out +} + +// based on Format._paragraphWrap +def _paragraphWrap(str, maxLength) { + def outLines = [] + str.split("\n").each{par -> + def words = par.split("\\s").toList() + + def word = null + def line = words.pop() + while(!words.isEmpty()) { + word = words.pop() + if (line.length() + word.length() + 1 <= maxLength) { + line = line + " " + word + } else { + outLines.add(line) + line = word + } + } + if (words.isEmpty()) { + outLines.add(line) + } + } + return outLines +} + +def helpMessage(config) { + if (params.containsKey("help") && params.help) { + def mergedConfig = addGlobalArguments(config) + def helpStr = _generateHelp(mergedConfig) + println(helpStr) + exit 0 + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/processConfig.nf' +def processConfig(config) { + // set defaults for arguments + config.arguments = + (config.arguments ?: []).collect{_processArgument(it)} + + // set defaults for argument_group arguments + config.argument_groups = + (config.argument_groups ?: []).collect{grp -> + grp.arguments = (grp.arguments ?: []).collect{_processArgument(it)} + grp + } + + // create combined arguments list + config.allArguments = + config.arguments + + config.argument_groups.collectMany{it.arguments} + + // add missing argument groups (based on Functionality::allArgumentGroups()) + def argGroups = config.argument_groups + if (argGroups.any{it.name.toLowerCase() == "arguments"}) { + argGroups = argGroups.collect{ grp -> + if (grp.name.toLowerCase() == "arguments") { + grp = grp + [ + arguments: grp.arguments + config.arguments + ] + } + grp + } + } else { + argGroups = argGroups + [ + name: "Arguments", + arguments: config.arguments + ] + } + config.allArgumentGroups = argGroups + + config +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/config/readConfig.nf' + +def readConfig(file) { + def config = readYaml(file ?: moduleDir.resolve("config.vsh.yaml")) + processConfig(config) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_resolveSiblingIfNotAbsolute.nf' +/** + * Resolve a path relative to the current file. + * + * @param str The path to resolve, as a String. + * @param parentPath The path to resolve relative to, as a Path. + * + * @return The path that may have been resovled, as a Path. + */ +def _resolveSiblingIfNotAbsolute(str, parentPath) { + if (str !instanceof String) { + return str + } + if (!_stringIsAbsolutePath(str)) { + return parentPath.resolveSibling(str) + } else { + return file(str, hidden: true) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/_stringIsAbsolutePath.nf' +/** + * Check whether a path as a string is absolute. + * + * In the past, we tried using `file(., relative: true).isAbsolute()`, + * but the 'relative' option was added in 22.10.0. + * + * @param path The path to check, as a String. + * + * @return Whether the path is absolute, as a boolean. + */ +def _stringIsAbsolutePath(path) { + def _resolve_URL_PROTOCOL = ~/^([a-zA-Z][a-zA-Z0-9]*:)?\\/.+/ + + assert path instanceof String + return _resolve_URL_PROTOCOL.matcher(path).matches() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/collectTraces.nf' +class CustomTraceObserver implements nextflow.trace.TraceObserver { + List traces + + CustomTraceObserver(List traces) { + this.traces = traces + } + + @Override + void onProcessComplete(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } + + @Override + void onProcessCached(nextflow.processor.TaskHandler handler, nextflow.trace.TraceRecord trace) { + def trace2 = trace.store.clone() + trace2.script = null + traces.add(trace2) + } +} + +def collectTraces() { + def traces = Collections.synchronizedList([]) + + // add custom trace observer which stores traces in the traces object + session.observers.add(new CustomTraceObserver(traces)) + + traces +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/deepClone.nf' +/** + * Performs a deep clone of the given object. + * @param x an object + */ +def deepClone(x) { + iterateMap(x, {it instanceof Cloneable ? it.clone() : it}) +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getPublishDir.nf' +def getPublishDir() { + return params.containsKey("publish_dir") ? params.publish_dir : + params.containsKey("publishDir") ? params.publishDir : + null +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/getRootDir.nf' + +// Recurse upwards until we find a '.build.yaml' file +def _findBuildYamlFile(pathPossiblySymlink) { + def path = pathPossiblySymlink.toRealPath() + def child = path.resolve(".build.yaml") + if (java.nio.file.Files.isDirectory(path) && java.nio.file.Files.exists(child)) { + return child + } else { + def parent = path.getParent() + if (parent == null) { + return null + } else { + return _findBuildYamlFile(parent) + } + } +} + +// get the root of the target folder +def getRootDir() { + def dir = _findBuildYamlFile(meta.resources_dir) + assert dir != null: "Could not find .build.yaml in the folder structure" + dir.getParent() +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/iterateMap.nf' +/** + * Recursively apply a function over the leaves of an object. + * @param obj The object to iterate over. + * @param fun The function to apply to each value. + * @return The object with the function applied to each value. + */ +def iterateMap(obj, fun) { + if (obj instanceof List && obj !instanceof String) { + return obj.collect{item -> + iterateMap(item, fun) + } + } else if (obj instanceof Map) { + return obj.collectEntries{key, item -> + [key.toString(), iterateMap(item, fun)] + } + } else { + return fun(obj) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/functions/niceView.nf' +/** + * A view for printing the event of each channel as a YAML blob. + * This is useful for debugging. + */ +def niceView() { + workflow niceViewWf { + take: input + main: + output = input + | view{toYamlBlob(it)} + emit: output + } + return niceViewWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readCsv.nf' + +def readCsv(file_path) { + def output = [] + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + + // todo: allow escaped quotes in string + // todo: allow single quotes? + def splitRegex = java.util.regex.Pattern.compile(''',(?=(?:[^"]*"[^"]*")*[^"]*$)''') + def removeQuote = java.util.regex.Pattern.compile('''"(.*)"''') + + def br = java.nio.file.Files.newBufferedReader(inputFile) + + def row = -1 + def header = null + while (br.ready() && header == null) { + def line = br.readLine() + row++ + if (!line.startsWith("#")) { + header = splitRegex.split(line, -1).collect{field -> + m = removeQuote.matcher(field) + m.find() ? m.replaceFirst('$1') : field + } + } + } + assert header != null: "CSV file should contain a header" + + while (br.ready()) { + def line = br.readLine() + row++ + if (line == null) { + br.close() + break + } + + if (!line.startsWith("#")) { + def predata = splitRegex.split(line, -1) + def data = predata.collect{field -> + if (field == "") { + return null + } + def m = removeQuote.matcher(field) + if (m.find()) { + return m.replaceFirst('$1') + } else { + return field + } + } + assert header.size() == data.size(): "Row $row should contain the same number as fields as the header" + + def dataMap = [header, data].transpose().collectEntries().findAll{it.value != null} + output.add(dataMap) + } + } + + output +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJson.nf' +def readJson(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parse(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readJsonBlob.nf' +def readJsonBlob(str) { + def jsonSlurper = new groovy.json.JsonSlurper() + jsonSlurper.parseText(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readTaggedYaml.nf' +// Custom constructor to modify how certain objects are parsed from YAML +class CustomConstructor extends org.yaml.snakeyaml.constructor.Constructor { + Path root + + class ConstructPath extends org.yaml.snakeyaml.constructor.AbstractConstruct { + public Object construct(org.yaml.snakeyaml.nodes.Node node) { + String filename = (String) constructScalar(node); + if (root != null) { + return root.resolve(filename); + } + return java.nio.file.Paths.get(filename); + } + } + + CustomConstructor(org.yaml.snakeyaml.LoaderOptions options, Path root) { + super(options) + this.root = root + // Handling !file tag and parse it back to a File type + this.yamlConstructors.put(new org.yaml.snakeyaml.nodes.Tag("!file"), new ConstructPath()) + } +} + +def readTaggedYaml(Path path) { + def options = new org.yaml.snakeyaml.LoaderOptions() + def constructor = new CustomConstructor(options, path.getParent()) + def yaml = new org.yaml.snakeyaml.Yaml(constructor) + return yaml.load(path.text) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYaml.nf' +def readYaml(file_path) { + def inputFile = file_path !instanceof Path ? file(file_path, hidden: true) : file_path + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(inputFile) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/readYamlBlob.nf' +def readYamlBlob(str) { + def yamlSlurper = new org.yaml.snakeyaml.Yaml() + yamlSlurper.load(str) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toJsonBlob.nf' +String toJsonBlob(data) { + return groovy.json.JsonOutput.toJson(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toTaggedYamlBlob.nf' +// Custom representer to modify how certain objects are represented in YAML +class CustomRepresenter extends org.yaml.snakeyaml.representer.Representer { + Path relativizer + + class RepresentPath implements org.yaml.snakeyaml.representer.Represent { + public String getFileName(Object obj) { + if (obj instanceof File) { + obj = ((File) obj).toPath(); + } + if (obj !instanceof Path) { + throw new IllegalArgumentException("Object: " + obj + " is not a Path or File"); + } + def path = (Path) obj; + + if (relativizer != null) { + return relativizer.relativize(path).toString() + } else { + return path.toString() + } + } + + public org.yaml.snakeyaml.nodes.Node representData(Object data) { + String filename = getFileName(data); + def tag = new org.yaml.snakeyaml.nodes.Tag("!file"); + return representScalar(tag, filename); + } + } + CustomRepresenter(org.yaml.snakeyaml.DumperOptions options, Path relativizer) { + super(options) + this.relativizer = relativizer + this.representers.put(sun.nio.fs.UnixPath, new RepresentPath()) + this.representers.put(Path, new RepresentPath()) + this.representers.put(File, new RepresentPath()) + } +} + +String toTaggedYamlBlob(data) { + return toRelativeTaggedYamlBlob(data, null) +} +String toRelativeTaggedYamlBlob(data, Path relativizer) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + def representer = new CustomRepresenter(options, relativizer) + def yaml = new org.yaml.snakeyaml.Yaml(representer, options) + return yaml.dump(data) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/toYamlBlob.nf' +String toYamlBlob(data) { + def options = new org.yaml.snakeyaml.DumperOptions() + options.setDefaultFlowStyle(org.yaml.snakeyaml.DumperOptions.FlowStyle.BLOCK) + options.setPrettyFlow(true) + def yaml = new org.yaml.snakeyaml.Yaml(options) + def cleanData = iterateMap(data, { it instanceof Path ? it.toString() : it }) + return yaml.dump(cleanData) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeJson.nf' +void writeJson(data, file) { + assert data: "writeJson: data should not be null" + assert file: "writeJson: file should not be null" + file.write(toJsonBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/readwrite/writeYaml.nf' +void writeYaml(data, file) { + assert data: "writeYaml: data should not be null" + assert file: "writeYaml: file should not be null" + file.write(toYamlBlob(data)) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/findStates.nf' +def findStates(Map params, Map config) { + def auto_config = deepClone(config) + def auto_params = deepClone(params) + + auto_config = auto_config.clone() + // override arguments + auto_config.argument_groups = [] + auto_config.arguments = [ + [ + type: "string", + name: "--id", + description: "A dummy identifier", + required: false + ], + [ + type: "file", + name: "--input_states", + example: "/path/to/input/directory/**/state.yaml", + description: "Path to input directory containing the datasets to be integrated.", + required: true, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--filter", + example: "foo/.*/state.yaml", + description: "Regex to filter state files by path.", + required: false + ], + // to do: make this a yaml blob? + [ + type: "string", + name: "--rename_keys", + example: ["newKey1:oldKey1", "newKey2:oldKey2"], + description: "Rename keys in the detected input files. This is useful if the input files do not match the set of input arguments of the workflow.", + required: false, + multiple: true, + multiple_sep: ";" + ], + [ + type: "string", + name: "--settings", + example: '{"output_dataset": "dataset.h5ad", "k": 10}', + description: "Global arguments as a JSON glob to be passed to all components.", + required: false + ] + ] + if (!(auto_params.containsKey("id"))) { + auto_params["id"] = "auto" + } + + // run auto config through processConfig once more + auto_config = processConfig(auto_config) + + workflow findStatesWf { + helpMessage(auto_config) + + output_ch = + channelFromParams(auto_params, auto_config) + | flatMap { autoId, args -> + + def globalSettings = args.settings ? readYamlBlob(args.settings) : [:] + + // look for state files in input dir + def stateFiles = args.input_states + + // filter state files by regex + if (args.filter) { + stateFiles = stateFiles.findAll{ stateFile -> + def stateFileStr = stateFile.toString() + def matcher = stateFileStr =~ args.filter + matcher.matches()} + } + + // read in states + def states = stateFiles.collect { stateFile -> + def state_ = readTaggedYaml(stateFile) + [state_.id, state_] + } + + // construct renameMap + if (args.rename_keys) { + def renameMap = args.rename_keys.collectEntries{renameString -> + def split = renameString.split(";") + assert split.size() == 2: "Argument 'rename_keys' should be of the form 'newKey:oldKey,newKey:oldKey'" + split + } + + // rename keys in state, only let states through which have all keys + // also add global settings + states = states.collectMany{id, state -> + def newState = [:] + + for (key in renameMap.keySet()) { + def origKey = renameMap[key] + if (!(state.containsKey(origKey))) { + return [] + } + newState[key] = state[origKey] + } + + [[id, globalSettings + newState]] + } + } + + states + } + emit: + output_ch + } + + return findStatesWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/joinStates.nf' +def joinStates(Closure apply_) { + workflow joinStatesWf { + take: input_ch + main: + output_ch = input_ch + | toSortedList + | filter{ it.size() > 0 } + | map{ tups -> + def ids = tups.collect{it[0]} + def states = tups.collect{it[1]} + apply_(ids, states) + } + + emit: output_ch + } + return joinStatesWf +} +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/publishStates.nf' +def collectFiles(obj) { + if (obj instanceof java.io.File || obj instanceof Path) { + return [obj] + } else if (obj instanceof List && obj !instanceof String) { + return obj.collectMany{item -> + collectFiles(item) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectFiles(item) + } + } else { + return [] + } +} + +/** + * Recurse through a state and collect all input files and their target output filenames. + * @param obj The state to recurse through. + * @param prefix The prefix to prepend to the output filenames. + */ +def collectInputOutputPaths(obj, prefix) { + if (obj instanceof File || obj instanceof Path) { + def path = obj instanceof Path ? obj : obj.toPath() + def ext = path.getFileName().toString().find("\\.[^\\.]+\$") ?: "" + def newFilename = prefix + ext + return [[obj, newFilename]] + } else if (obj instanceof List && obj !instanceof String) { + return obj.withIndex().collectMany{item, ix -> + collectInputOutputPaths(item, prefix + "_" + ix) + } + } else if (obj instanceof Map) { + return obj.collectMany{key, item -> + collectInputOutputPaths(item, prefix + "." + key) + } + } else { + return [] + } +} + +def publishStates(Map args) { + def key_ = args.get("key") + def yamlTemplate_ = args.get("output_state", args.get("outputState", '$id.$key.state.yaml')) + + assert key_ != null : "publishStates: key must be specified" + + workflow publishStatesWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] + + // the input files and the target output filenames + def inputoutputFilenames_ = collectInputOutputPaths(state_, id_ + "." + key_).transpose() + def inputFiles_ = inputoutputFilenames_[0] + def outputFilenames_ = inputoutputFilenames_[1] + + def yamlFilename = yamlTemplate_ + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + + // TODO: do the pathnames in state_ match up with the outputFilenames_? + + // convert state to yaml blob + def yamlBlob_ = toRelativeTaggedYamlBlob([id: id_] + state_, java.nio.file.Paths.get(yamlFilename)) + + [id_, yamlBlob_, yamlFilename, inputFiles_, outputFilenames_] + } + | publishStatesProc + emit: input_ch + } + return publishStatesWf +} +process publishStatesProc { + // todo: check publishpath? + publishDir path: "${getPublishDir()}/", mode: "copy" + tag "$id" + input: + tuple val(id), val(yamlBlob), val(yamlFile), path(inputFiles, stageAs: "_inputfile?/*"), val(outputFiles) + output: + tuple val(id), path{[yamlFile] + outputFiles} + script: + def copyCommands = [ + inputFiles instanceof List ? inputFiles : [inputFiles], + outputFiles instanceof List ? outputFiles : [outputFiles] + ] + .transpose() + .collectMany{infile, outfile -> + if (infile.toString() != outfile.toString()) { + [ + "[ -d \"\$(dirname '${outfile.toString()}')\" ] || mkdir -p \"\$(dirname '${outfile.toString()}')\"", + "cp -r '${infile.toString()}' '${outfile.toString()}'" + ] + } else { + // no need to copy if infile is the same as outfile + [] + } + } + """ +mkdir -p "\$(dirname '${yamlFile}')" +echo "Storing state as yaml" +echo '${yamlBlob}' > '${yamlFile}' +echo "Copying output files to destination folder" +${copyCommands.join("\n ")} +""" +} + + +// this assumes that the state contains no other values other than those specified in the config +def publishStatesByConfig(Map args) { + def config = args.get("config") + assert config != null : "publishStatesByConfig: config must be specified" + + def key_ = args.get("key", config.name) + assert key_ != null : "publishStatesByConfig: key must be specified" + + workflow publishStatesSimpleWf { + take: input_ch + main: + input_ch + | map { tup -> + def id_ = tup[0] + def state_ = tup[1] // e.g. [output: new File("myoutput.h5ad"), k: 10] + def origState_ = tup[2] // e.g. [output: '$id.$key.foo.h5ad'] + + // TODO: allow overriding the state.yaml template + // TODO TODO: if auto.publish == "state", add output_state as an argument + def yamlTemplate = params.containsKey("output_state") ? params.output_state : '$id.$key.state.yaml' + def yamlFilename = yamlTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + def yamlDir = java.nio.file.Paths.get(yamlFilename).getParent() + + // the processed state is a list of [key, value, inputPath, outputFilename] tuples, where + // - key is a String + // - value is any object that can be serialized to a Yaml (so a String/Integer/Long/Double/Boolean, a List, a Map, or a Path) + // - inputPath is a List[Path] + // - outputFilename is a List[String] + // - (key, value) are the tuples that will be saved to the state.yaml file + // - (inputPath, outputFilename) are the files that will be copied from src to dest (relative to the state.yaml) + def processedState = + config.allArguments + .findAll { it.direction == "output" } + .collectMany { par -> + def plainName_ = par.plainName + // if the state does not contain the key, it's an + // optional argument for which the component did + // not generate any output + if (!state_.containsKey(plainName_)) { + return [] + } + def value = state_[plainName_] + // if the parameter is not a file, it should be stored + // in the state as-is, but is not something that needs + // to be copied from the source path to the dest path + if (par.type != "file") { + return [[key: plainName_, value: value, inputPath: [], outputFilename: []]] + } + // if the orig state does not contain this filename, + // it's an optional argument for which the user specified + // that it should not be returned as a state + if (!origState_.containsKey(plainName_)) { + return [] + } + def filenameTemplate = origState_[plainName_] + // if the pararameter is multiple: true, fetch the template + if (par.multiple && filenameTemplate instanceof List) { + filenameTemplate = filenameTemplate[0] + } + // instantiate the template + def filename = filenameTemplate + .replaceAll('\\$id', id_) + .replaceAll('\\$key', key_) + if (par.multiple) { + // if the parameter is multiple: true, the filename + // should contain a wildcard '*' that is replaced with + // the index of the file + assert filename.contains("*") : "Module '${key_}' id '${id_}': Multiple output files specified, but no wildcard '*' in the filename: ${filename}" + def outputPerFile = value.withIndex().collect{ val, ix -> + def filename_ix = filename.replace("*", ix.toString()) + def value_ = java.nio.file.Paths.get(filename_ix) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = val instanceof File ? val.toPath() : val + [value: value_, inputPath: inputPath, outputFilename: filename_ix] + } + def transposedOutputs = ["value", "inputPath", "outputFilename"].collectEntries{ key -> + [key, outputPerFile.collect{dic -> dic[key]}] + } + return [[key: plainName_] + transposedOutputs] + } else { + def value_ = java.nio.file.Paths.get(filename) + // if id contains a slash + if (yamlDir != null) { + value_ = yamlDir.relativize(value_) + } + def inputPath = value instanceof File ? value.toPath() : value + return [[key: plainName_, value: value_, inputPath: [inputPath], outputFilename: [filename]]] + } + } + + def updatedState_ = processedState.collectEntries{[it.key, it.value]} + def inputPaths = processedState.collectMany{it.inputPath} + def outputFilenames = processedState.collectMany{it.outputFilename} + + // convert state to yaml blob + def yamlBlob_ = toTaggedYamlBlob([id: id_] + updatedState_) + + [id_, yamlBlob_, yamlFilename, inputPaths, outputFilenames] + } + | publishStatesProc + emit: input_ch + } + return publishStatesSimpleWf +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/states/setState.nf' +def setState(fun) { + assert fun instanceof Closure || fun instanceof Map || fun instanceof List : + "Error in setState: Expected process argument to be a Closure, a Map, or a List. Found: class ${fun.getClass()}" + + // if fun is a List, convert to map + if (fun instanceof List) { + // check whether fun is a list[string] + assert fun.every{it instanceof CharSequence} : "Error in setState: argument is a List, but not all elements are Strings" + fun = fun.collectEntries{[it, it]} + } + + // if fun is a map, convert to closure + if (fun instanceof Map) { + // check whether fun is a map[string, string] + assert fun.values().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all values are Strings" + assert fun.keySet().every{it instanceof CharSequence} : "Error in setState: argument is a Map, but not all keys are Strings" + def funMap = fun.clone() + // turn the map into a closure to be used later on + fun = { id_, state_ -> + assert state_ instanceof Map : "Error in setState: the state is not a Map" + funMap.collectMany{newkey, origkey -> + if (state_.containsKey(origkey)) { + [[newkey, state_[origkey]]] + } else { + [] + } + }.collectEntries() + } + } + + map { tup -> + def id = tup[0] + def state = tup[1] + def unfilteredState = fun(id, state) + def newState = unfilteredState.findAll{key, val -> val != null} + [id, newState] + tup.drop(2) + } +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processAuto.nf' +// TODO: unit test processAuto +def processAuto(Map auto) { + // remove null values + auto = auto.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = ["simplifyInput", "simplifyOutput", "transcript", "publish"] + def unexpectedKeys = auto.keySet() - expectedKeys + assert unexpectedKeys.isEmpty(), "unexpected keys in auto: '${unexpectedKeys.join("', '")}'" + + // check auto.simplifyInput + assert auto.simplifyInput instanceof Boolean, "auto.simplifyInput must be a boolean" + + // check auto.simplifyOutput + assert auto.simplifyOutput instanceof Boolean, "auto.simplifyOutput must be a boolean" + + // check auto.transcript + assert auto.transcript instanceof Boolean, "auto.transcript must be a boolean" + + // check auto.publish + assert auto.publish instanceof Boolean || auto.publish == "state", "auto.publish must be a boolean or 'state'" + + return auto.subMap(expectedKeys) +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processDirectives.nf' +def assertMapKeys(map, expectedKeys, requiredKeys, mapName) { + assert map instanceof Map : "Expected argument '$mapName' to be a Map. Found: class ${map.getClass()}" + map.forEach { key, val -> + assert key in expectedKeys : "Unexpected key '$key' in ${mapName ? mapName + " " : ""}map" + } + requiredKeys.forEach { requiredKey -> + assert map.containsKey(requiredKey) : "Missing required key '$key' in ${mapName ? mapName + " " : ""}map" + } +} + +// TODO: unit test processDirectives +def processDirectives(Map drctv) { + // remove null values + drctv = drctv.findAll{k, v -> v != null} + + // check for unexpected keys + def expectedKeys = [ + "accelerator", "afterScript", "beforeScript", "cache", "conda", "container", "containerOptions", "cpus", "disk", "echo", "errorStrategy", "executor", "machineType", "maxErrors", "maxForks", "maxRetries", "memory", "module", "penv", "pod", "publishDir", "queue", "label", "scratch", "storeDir", "stageInMode", "stageOutMode", "tag", "time" + ] + def unexpectedKeys = drctv.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Unexpected keys in process directive: '${unexpectedKeys.join("', '")}'" + + /* DIRECTIVE accelerator + accepted examples: + - [ limit: 4, type: "nvidia-tesla-k80" ] + */ + if (drctv.containsKey("accelerator")) { + assertMapKeys(drctv["accelerator"], ["type", "limit", "request", "runtime"], [], "accelerator") + } + + /* DIRECTIVE afterScript + accepted examples: + - "source /cluster/bin/cleanup" + */ + if (drctv.containsKey("afterScript")) { + assert drctv["afterScript"] instanceof CharSequence + } + + /* DIRECTIVE beforeScript + accepted examples: + - "source /cluster/bin/setup" + */ + if (drctv.containsKey("beforeScript")) { + assert drctv["beforeScript"] instanceof CharSequence + } + + /* DIRECTIVE cache + accepted examples: + - true + - false + - "deep" + - "lenient" + */ + if (drctv.containsKey("cache")) { + assert drctv["cache"] instanceof CharSequence || drctv["cache"] instanceof Boolean + if (drctv["cache"] instanceof CharSequence) { + assert drctv["cache"] in ["deep", "lenient"] : "Unexpected value for cache" + } + } + + /* DIRECTIVE conda + accepted examples: + - "bwa=0.7.15" + - "bwa=0.7.15 fastqc=0.11.5" + - ["bwa=0.7.15", "fastqc=0.11.5"] + */ + if (drctv.containsKey("conda")) { + if (drctv["conda"] instanceof List) { + drctv["conda"] = drctv["conda"].join(" ") + } + assert drctv["conda"] instanceof CharSequence + } + + /* DIRECTIVE container + accepted examples: + - "foo/bar:tag" + - [ registry: "reg", image: "im", tag: "ta" ] + is transformed to "reg/im:ta" + - [ image: "im" ] + is transformed to "im:latest" + */ + if (drctv.containsKey("container")) { + assert drctv["container"] instanceof Map || drctv["container"] instanceof CharSequence + if (drctv["container"] instanceof Map) { + def m = drctv["container"] + assertMapKeys(m, [ "registry", "image", "tag" ], ["image"], "container") + def part1 = + System.getenv('OVERRIDE_CONTAINER_REGISTRY') ? System.getenv('OVERRIDE_CONTAINER_REGISTRY') + "/" : + params.containsKey("override_container_registry") ? params["override_container_registry"] + "/" : // todo: remove? + m.registry ? m.registry + "/" : + "" + def part2 = m.image + def part3 = m.tag ? ":" + m.tag : ":latest" + drctv["container"] = part1 + part2 + part3 + } + } + + /* DIRECTIVE containerOptions + accepted examples: + - "--foo bar" + - ["--foo bar", "-f b"] + */ + if (drctv.containsKey("containerOptions")) { + if (drctv["containerOptions"] instanceof List) { + drctv["containerOptions"] = drctv["containerOptions"].join(" ") + } + assert drctv["containerOptions"] instanceof CharSequence + } + + /* DIRECTIVE cpus + accepted examples: + - 1 + - 10 + */ + if (drctv.containsKey("cpus")) { + assert drctv["cpus"] instanceof Integer + } + + /* DIRECTIVE disk + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("disk")) { + assert drctv["disk"] instanceof CharSequence + // assert drctv["disk"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE echo + accepted examples: + - true + - false + */ + if (drctv.containsKey("echo")) { + assert drctv["echo"] instanceof Boolean + } + + /* DIRECTIVE errorStrategy + accepted examples: + - "terminate" + - "finish" + */ + if (drctv.containsKey("errorStrategy")) { + assert drctv["errorStrategy"] instanceof CharSequence + assert drctv["errorStrategy"] in ["terminate", "finish", "ignore", "retry"] : "Unexpected value for errorStrategy" + } + + /* DIRECTIVE executor + accepted examples: + - "local" + - "sge" + */ + if (drctv.containsKey("executor")) { + assert drctv["executor"] instanceof CharSequence + assert drctv["executor"] in ["local", "sge", "uge", "lsf", "slurm", "pbs", "pbspro", "moab", "condor", "nqsii", "ignite", "k8s", "awsbatch", "google-pipelines"] : "Unexpected value for executor" + } + + /* DIRECTIVE machineType + accepted examples: + - "n1-highmem-8" + */ + if (drctv.containsKey("machineType")) { + assert drctv["machineType"] instanceof CharSequence + } + + /* DIRECTIVE maxErrors + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxErrors")) { + assert drctv["maxErrors"] instanceof Integer + } + + /* DIRECTIVE maxForks + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxForks")) { + assert drctv["maxForks"] instanceof Integer + } + + /* DIRECTIVE maxRetries + accepted examples: + - 1 + - 3 + */ + if (drctv.containsKey("maxRetries")) { + assert drctv["maxRetries"] instanceof Integer + } + + /* DIRECTIVE memory + accepted examples: + - "1 GB" + - "2TB" + - "3.2KB" + - "10.B" + */ + if (drctv.containsKey("memory")) { + assert drctv["memory"] instanceof CharSequence + // assert drctv["memory"].matches("[0-9]+(\\.[0-9]*)? *[KMGTPEZY]?B") + // ^ does not allow closures + } + + /* DIRECTIVE module + accepted examples: + - "ncbi-blast/2.2.27" + - "ncbi-blast/2.2.27:t_coffee/10.0" + - ["ncbi-blast/2.2.27", "t_coffee/10.0"] + */ + if (drctv.containsKey("module")) { + if (drctv["module"] instanceof List) { + drctv["module"] = drctv["module"].join(":") + } + assert drctv["module"] instanceof CharSequence + } + + /* DIRECTIVE penv + accepted examples: + - "smp" + */ + if (drctv.containsKey("penv")) { + assert drctv["penv"] instanceof CharSequence + } + + /* DIRECTIVE pod + accepted examples: + - [ label: "key", value: "val" ] + - [ annotation: "key", value: "val" ] + - [ env: "key", value: "val" ] + - [ [label: "l", value: "v"], [env: "e", value: "v"]] + */ + if (drctv.containsKey("pod")) { + if (drctv["pod"] instanceof Map) { + drctv["pod"] = [ drctv["pod"] ] + } + assert drctv["pod"] instanceof List + drctv["pod"].forEach { pod -> + assert pod instanceof Map + // TODO: should more checks be added? + // See https://www.nextflow.io/docs/latest/process.html?highlight=directives#pod + // e.g. does it contain 'label' and 'value', or 'annotation' and 'value', or ...? + } + } + + /* DIRECTIVE publishDir + accepted examples: + - [] + - [ [ path: "foo", enabled: true ], [ path: "bar", enabled: false ] ] + - "/path/to/dir" + is transformed to [[ path: "/path/to/dir" ]] + - [ path: "/path/to/dir", mode: "cache" ] + is transformed to [[ path: "/path/to/dir", mode: "cache" ]] + */ + // TODO: should we also look at params["publishDir"]? + if (drctv.containsKey("publishDir")) { + def pblsh = drctv["publishDir"] + + // check different options + assert pblsh instanceof List || pblsh instanceof Map || pblsh instanceof CharSequence + + // turn into list if not already so + // for some reason, 'if (!pblsh instanceof List) pblsh = [ pblsh ]' doesn't work. + pblsh = pblsh instanceof List ? pblsh : [ pblsh ] + + // check elements of publishDir + pblsh = pblsh.collect{ elem -> + // turn into map if not already so + elem = elem instanceof CharSequence ? [ path: elem ] : elem + + // check types and keys + assert elem instanceof Map : "Expected publish argument '$elem' to be a String or a Map. Found: class ${elem.getClass()}" + assertMapKeys(elem, [ "path", "mode", "overwrite", "pattern", "saveAs", "enabled" ], ["path"], "publishDir") + + // check elements in map + assert elem.containsKey("path") + assert elem["path"] instanceof CharSequence + if (elem.containsKey("mode")) { + assert elem["mode"] instanceof CharSequence + assert elem["mode"] in [ "symlink", "rellink", "link", "copy", "copyNoFollow", "move" ] + } + if (elem.containsKey("overwrite")) { + assert elem["overwrite"] instanceof Boolean + } + if (elem.containsKey("pattern")) { + assert elem["pattern"] instanceof CharSequence + } + if (elem.containsKey("saveAs")) { + assert elem["saveAs"] instanceof CharSequence //: "saveAs as a Closure is currently not supported. Surround your closure with single quotes to get the desired effect. Example: '\{ foo \}'" + } + if (elem.containsKey("enabled")) { + assert elem["enabled"] instanceof Boolean + } + + // return final result + elem + } + // store final directive + drctv["publishDir"] = pblsh + } + + /* DIRECTIVE queue + accepted examples: + - "long" + - "short,long" + - ["short", "long"] + */ + if (drctv.containsKey("queue")) { + if (drctv["queue"] instanceof List) { + drctv["queue"] = drctv["queue"].join(",") + } + assert drctv["queue"] instanceof CharSequence + } + + /* DIRECTIVE label + accepted examples: + - "big_mem" + - "big_cpu" + - ["big_mem", "big_cpu"] + */ + if (drctv.containsKey("label")) { + if (drctv["label"] instanceof CharSequence) { + drctv["label"] = [ drctv["label"] ] + } + assert drctv["label"] instanceof List + drctv["label"].forEach { label -> + assert label instanceof CharSequence + // assert label.matches("[a-zA-Z0-9]([a-zA-Z0-9_]*[a-zA-Z0-9])?") + // ^ does not allow closures + } + } + + /* DIRECTIVE scratch + accepted examples: + - true + - "/path/to/scratch" + - '$MY_PATH_TO_SCRATCH' + - "ram-disk" + */ + if (drctv.containsKey("scratch")) { + assert drctv["scratch"] == true || drctv["scratch"] instanceof CharSequence + } + + /* DIRECTIVE storeDir + accepted examples: + - "/path/to/storeDir" + */ + if (drctv.containsKey("storeDir")) { + assert drctv["storeDir"] instanceof CharSequence + } + + /* DIRECTIVE stageInMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageInMode")) { + assert drctv["stageInMode"] instanceof CharSequence + assert drctv["stageInMode"] in ["copy", "link", "symlink", "rellink"] + } + + /* DIRECTIVE stageOutMode + accepted examples: + - "copy" + - "link" + */ + if (drctv.containsKey("stageOutMode")) { + assert drctv["stageOutMode"] instanceof CharSequence + assert drctv["stageOutMode"] in ["copy", "move", "rsync"] + } + + /* DIRECTIVE tag + accepted examples: + - "foo" + - '$id' + */ + if (drctv.containsKey("tag")) { + assert drctv["tag"] instanceof CharSequence + } + + /* DIRECTIVE time + accepted examples: + - "1h" + - "2days" + - "1day 6hours 3minutes 30seconds" + */ + if (drctv.containsKey("time")) { + assert drctv["time"] instanceof CharSequence + // todo: validation regex? + } + + return drctv +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/processWorkflowArgs.nf' +def processWorkflowArgs(Map args, Map defaultWfArgs, Map meta) { + // override defaults with args + def workflowArgs = defaultWfArgs + args + + // check whether 'key' exists + assert workflowArgs.containsKey("key") : "Error in module '${meta.config.name}': key is a required argument" + + // if 'key' is a closure, apply it to the original key + if (workflowArgs["key"] instanceof Closure) { + workflowArgs["key"] = workflowArgs["key"](meta.config.name) + } + def key = workflowArgs["key"] + assert key instanceof CharSequence : "Expected process argument 'key' to be a String. Found: class ${key.getClass()}" + assert key ==~ /^[a-zA-Z_]\w*$/ : "Error in module '$key': Expected process argument 'key' to consist of only letters, digits or underscores. Found: ${key}" + + // check for any unexpected keys + def expectedKeys = ["key", "directives", "auto", "map", "mapId", "mapData", "mapPassthrough", "filter", "runIf", "fromState", "toState", "args", "renameKeys", "debug"] + def unexpectedKeys = workflowArgs.keySet() - expectedKeys + assert unexpectedKeys.isEmpty() : "Error in module '$key': unexpected arguments to the '.run()' function: '${unexpectedKeys.join("', '")}'" + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("directives") : "Error in module '$key': directives is a required argument" + assert workflowArgs["directives"] instanceof Map : "Error in module '$key': Expected process argument 'directives' to be a Map. Found: class ${workflowArgs['directives'].getClass()}" + workflowArgs["directives"] = processDirectives(defaultWfArgs.directives + workflowArgs["directives"]) + + // check whether directives exists and apply defaults + assert workflowArgs.containsKey("auto") : "Error in module '$key': auto is a required argument" + assert workflowArgs["auto"] instanceof Map : "Error in module '$key': Expected process argument 'auto' to be a Map. Found: class ${workflowArgs['auto'].getClass()}" + workflowArgs["auto"] = processAuto(defaultWfArgs.auto + workflowArgs["auto"]) + + // auto define publish, if so desired + if (workflowArgs.auto.publish == true && (workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : [:]).isEmpty()) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.publish is true, params.publish_dir needs to be defined.\n" + + // " Example: params.publish_dir = \"./output/\"" + def publishDir = getPublishDir() + + if (publishDir != null) { + workflowArgs.directives.publishDir = [[ + path: publishDir, + saveAs: "{ it.startsWith('.') ? null : it }", // don't publish hidden files, by default + mode: "copy" + ]] + } + } + + // auto define transcript, if so desired + if (workflowArgs.auto.transcript == true) { + // can't assert at this level thanks to the no_publish profile + // assert params.containsKey("transcriptsDir") || params.containsKey("transcripts_dir") || params.containsKey("publishDir") || params.containsKey("publish_dir") : + // "Error in module '${workflowArgs['key']}': if auto.transcript is true, either params.transcripts_dir or params.publish_dir needs to be defined.\n" + + // " Example: params.transcripts_dir = \"./transcripts/\"" + def transcriptsDir = + params.containsKey("transcripts_dir") ? params.transcripts_dir : + params.containsKey("transcriptsDir") ? params.transcriptsDir : + params.containsKey("publish_dir") ? params.publish_dir + "/_transcripts" : + params.containsKey("publishDir") ? params.publishDir + "/_transcripts" : + null + if (transcriptsDir != null) { + def timestamp = nextflow.Nextflow.getSession().getWorkflowMetadata().start.format('yyyy-MM-dd_HH-mm-ss') + def transcriptsPublishDir = [ + path: "$transcriptsDir/$timestamp/\${task.process.replaceAll(':', '-')}/\${id}/", + saveAs: "{ it.startsWith('.') ? it.replaceAll('^.', '') : null }", + mode: "copy" + ] + def publishDirs = workflowArgs.directives.publishDir != null ? workflowArgs.directives.publishDir : null ? workflowArgs.directives.publishDir : [] + workflowArgs.directives.publishDir = publishDirs + transcriptsPublishDir + } + } + + // if this is a stubrun, remove certain directives? + if (workflow.stubRun) { + workflowArgs.directives.keySet().removeAll(["publishDir", "cpus", "memory", "label"]) + } + + for (nam in ["map", "mapId", "mapData", "mapPassthrough", "filter", "runIf"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam]) { + assert workflowArgs[nam] instanceof Closure : "Error in module '$key': Expected process argument '$nam' to be null or a Closure. Found: class ${workflowArgs[nam].getClass()}" + } + } + + // TODO: should functions like 'map', 'mapId', 'mapData', 'mapPassthrough' be deprecated as well? + for (nam in ["map", "mapData", "mapPassthrough", "renameKeys"]) { + if (workflowArgs.containsKey(nam) && workflowArgs[nam] != null) { + log.warn "module '$key': workflow argument '$nam' is deprecated and will be removed in Viash 0.9.0. Please use 'fromState' and 'toState' instead." + } + } + + // check fromState + workflowArgs["fromState"] = _processFromState(workflowArgs.get("fromState"), key, meta.config) + + // check toState + workflowArgs["toState"] = _processToState(workflowArgs.get("toState"), key, meta.config) + + // return output + return workflowArgs +} + +def _processFromState(fromState, key_, config_) { + assert fromState == null || fromState instanceof Closure || fromState instanceof Map || fromState instanceof List : + "Error in module '$key_': Expected process argument 'fromState' to be null, a Closure, a Map, or a List. Found: class ${fromState.getClass()}" + if (fromState == null) { + return null + } + + // if fromState is a List, convert to map + if (fromState instanceof List) { + // check whether fromstate is a list[string] + assert fromState.every{it instanceof CharSequence} : "Error in module '$key_': fromState is a List, but not all elements are Strings" + fromState = fromState.collectEntries{[it, it]} + } + + // if fromState is a map, convert to closure + if (fromState instanceof Map) { + // check whether fromstate is a map[string, string] + assert fromState.values().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all values are Strings" + assert fromState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': fromState is a Map, but not all keys are Strings" + def fromStateMap = fromState.clone() + def requiredInputNames = meta.config.allArguments.findAll{it.required && it.direction == "Input"}.collect{it.plainName} + // turn the map into a closure to be used later on + fromState = { it -> + def state = it[1] + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def data = fromStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (state.containsKey(origkey)) { + [[newkey, state[origkey]]] + } else if (!requiredInputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': fromState key '$origkey' not found in current state") + } + }.collectEntries() + data + } + } + + return fromState +} + +def _processToState(toState, key_, config_) { + if (toState == null) { + toState = { tup -> tup[1] } + } + + // toState should be a closure, map[string, string], or list[string] + assert toState instanceof Closure || toState instanceof Map || toState instanceof List : + "Error in module '$key_': Expected process argument 'toState' to be a Closure, a Map, or a List. Found: class ${toState.getClass()}" + + // if toState is a List, convert to map + if (toState instanceof List) { + // check whether toState is a list[string] + assert toState.every{it instanceof CharSequence} : "Error in module '$key_': toState is a List, but not all elements are Strings" + toState = toState.collectEntries{[it, it]} + } + + // if toState is a map, convert to closure + if (toState instanceof Map) { + // check whether toState is a map[string, string] + assert toState.values().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all values are Strings" + assert toState.keySet().every{it instanceof CharSequence} : "Error in module '$key_': toState is a Map, but not all keys are Strings" + def toStateMap = toState.clone() + def requiredOutputNames = config_.allArguments.findAll{it.required && it.direction == "Output"}.collect{it.plainName} + // turn the map into a closure to be used later on + toState = { it -> + def output = it[1] + def state = it[2] + assert output instanceof Map : "Error in module '$key_': the output is not a Map" + assert state instanceof Map : "Error in module '$key_': the state is not a Map" + def extraEntries = toStateMap.collectMany{newkey, origkey -> + // check whether newkey corresponds to a required argument + if (output.containsKey(origkey)) { + [[newkey, output[origkey]]] + } else if (!requiredOutputNames.contains(origkey)) { + [] + } else { + throw new Exception("Error in module '$key_': toState key '$origkey' not found in current output") + } + }.collectEntries() + state + extraEntries + } + } + + return toState +} + +// helper file: 'src/main/resources/io/viash/runners/nextflow/workflowFactory/workflowFactory.nf' +def _debug(workflowArgs, debugKey) { + if (workflowArgs.debug) { + view { "process '${workflowArgs.key}' $debugKey tuple: $it" } + } else { + map { it } + } +} + +// depends on: innerWorkflowFactory +def workflowFactory(Map args, Map defaultWfArgs, Map meta) { + def workflowArgs = processWorkflowArgs(args, defaultWfArgs, meta) + def key_ = workflowArgs["key"] + + workflow workflowInstance { + take: input_ + + main: + def chModified = input_ + | checkUniqueIds([:]) + | _debug(workflowArgs, "input") + | map { tuple -> + tuple = deepClone(tuple) + + if (workflowArgs.map) { + tuple = workflowArgs.map(tuple) + } + if (workflowArgs.mapId) { + tuple[0] = workflowArgs.mapId(tuple[0]) + } + if (workflowArgs.mapData) { + tuple[1] = workflowArgs.mapData(tuple[1]) + } + if (workflowArgs.mapPassthrough) { + tuple = tuple.take(2) + workflowArgs.mapPassthrough(tuple.drop(2)) + } + + // check tuple + assert tuple instanceof List : + "Error in module '${key_}': element in channel should be a tuple [id, data, ...otherargs...]\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: List. Found: tuple.getClass() is ${tuple.getClass()}" + assert tuple.size() >= 2 : + "Error in module '${key_}': expected length of tuple in input channel to be two or greater.\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: tuple.size() == ${tuple.size()}" + + // check id field + if (tuple[0] instanceof GString) { + tuple[0] = tuple[0].toString() + } + assert tuple[0] instanceof CharSequence : + "Error in module '${key_}': first element of tuple in channel should be a String\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Found: ${tuple[0]}" + + // match file to input file + if (workflowArgs.auto.simplifyInput && (tuple[1] instanceof Path || tuple[1] instanceof List)) { + def inputFiles = meta.config.allArguments + .findAll { it.type == "file" && it.direction == "input" } + + assert inputFiles.size() == 1 : + "Error in module '${key_}' id '${tuple[0]}'.\n" + + " Anonymous file inputs are only allowed when the process has exactly one file input.\n" + + " Expected: inputFiles.size() == 1. Found: inputFiles.size() is ${inputFiles.size()}" + + tuple[1] = [[ inputFiles[0].plainName, tuple[1] ]].collectEntries() + } + + // check data field + assert tuple[1] instanceof Map : + "Error in module '${key_}' id '${tuple[0]}': second element of tuple in channel should be a Map\n" + + " Example: [\"id\", [input: file('foo.txt'), arg: 10]].\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // rename keys of data field in tuple + if (workflowArgs.renameKeys) { + assert workflowArgs.renameKeys instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class: Map. Found: renameKeys.getClass() is ${workflowArgs.renameKeys.getClass()}" + assert tuple[1] instanceof Map : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Expected class: Map. Found: tuple[1].getClass() is ${tuple[1].getClass()}" + + // TODO: allow renameKeys to be a function? + workflowArgs.renameKeys.each { newKey, oldKey -> + assert newKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of newKey: String. Found: newKey.getClass() is ${newKey.getClass()}" + assert oldKey instanceof CharSequence : + "Error renaming data keys in module '${key_}' id '${tuple[0]}'.\n" + + " Example: renameKeys: ['new_key': 'old_key'].\n" + + " Expected class of oldKey: String. Found: oldKey.getClass() is ${oldKey.getClass()}" + assert tuple[1].containsKey(oldKey) : + "Error renaming data keys in module '${key}' id '${tuple[0]}'.\n" + + " Key '$oldKey' is missing in the data map. tuple[1].keySet() is '${tuple[1].keySet()}'" + tuple[1].put(newKey, tuple[1][oldKey]) + } + tuple[1].keySet().removeAll(workflowArgs.renameKeys.collect{ newKey, oldKey -> oldKey }) + } + tuple + } + + def chModifiedFiltered = workflowArgs.filter ? + chModified | filter{workflowArgs.filter(it)} : + chModified + + def chRun = null + def chPassthrough = null + if (workflowArgs.runIf) { + def runIfBranch = chModifiedFiltered.branch{ tup -> + run: workflowArgs.runIf(tup[0], tup[1]) + passthrough: true + } + chRun = runIfBranch.run + chPassthrough = runIfBranch.passthrough + } else { + chRun = chModifiedFiltered + chPassthrough = Channel.empty() + } + + def chArgs = workflowArgs.fromState ? + chRun | map{ + def new_data = workflowArgs.fromState(it.take(2)) + [it[0], new_data] + } : + chRun | map {tup -> tup.take(2)} + + // fill in defaults + def chArgsWithDefaults = chArgs + | map { tuple -> + def id_ = tuple[0] + def data_ = tuple[1] + + // TODO: could move fromState to here + + // fetch default params from functionality + def defaultArgs = meta.config.allArguments + .findAll { it.containsKey("default") } + .collectEntries { [ it.plainName, it.default ] } + + // fetch overrides in params + def paramArgs = meta.config.allArguments + .findAll { par -> + def argKey = key_ + "__" + par.plainName + params.containsKey(argKey) + } + .collectEntries { [ it.plainName, params[key_ + "__" + it.plainName] ] } + + // fetch overrides in data + def dataArgs = meta.config.allArguments + .findAll { data_.containsKey(it.plainName) } + .collectEntries { [ it.plainName, data_[it.plainName] ] } + + // combine params + def combinedArgs = defaultArgs + paramArgs + workflowArgs.args + dataArgs + + // remove arguments with explicit null values + combinedArgs + .removeAll{_, val -> val == null || val == "viash_no_value" || val == "force_null"} + + combinedArgs = _processInputValues(combinedArgs, meta.config, id_, key_) + + [id_, combinedArgs] + tuple.drop(2) + } + + // TODO: move some of the _meta.join_id wrangling to the safeJoin() function. + def chInitialOutput = chArgsWithDefaults + | _debug(workflowArgs, "processed") + // run workflow + | innerWorkflowFactory(workflowArgs) + // check output tuple + | map { id_, output_ -> + + // see if output map contains metadata + def meta_ = + output_ instanceof Map && output_.containsKey("_meta") ? + output_["_meta"] : + [:] + def join_id = meta_.join_id ?: id_ + + // remove metadata + output_ = output_.findAll{k, v -> k != "_meta"} + + // check value types + output_ = _processOutputValues(output_, meta.config, id_, key_) + + // simplify output if need be + if (workflowArgs.auto.simplifyOutput && output_.size() == 1) { + output_ = output_.values()[0] + } + + [join_id, id_, output_] + } + // | view{"chInitialOutput: ${it.take(3)}"} + + // join the output [prev_id, new_id, output] with the previous state [prev_id, state, ...] + def chNewState = safeJoin(chInitialOutput, chModifiedFiltered, key_) + // input tuple format: [join_id, id, output, prev_state, ...] + // output tuple format: [join_id, id, new_state, ...] + | map{ tup -> + def new_state = workflowArgs.toState(tup.drop(1).take(3)) + tup.take(2) + [new_state] + tup.drop(4) + } + + if (workflowArgs.auto.publish == "state") { + def chPublish = chNewState + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [join_id, id, new_state] + | map{ tup -> + tup.take(3) + } + + safeJoin(chPublish, chArgsWithDefaults, key_) + // input tuple format: [join_id, id, new_state, orig_state, ...] + // output tuple format: [id, new_state, orig_state] + | map { tup -> + tup.drop(1).take(3) + } + | publishStatesByConfig(key: key_, config: meta.config) + } + + // remove join_id and meta + chReturn = chNewState + | map { tup -> + // input tuple format: [join_id, id, new_state, ...] + // output tuple format: [id, new_state, ...] + tup.drop(1) + } + | _debug(workflowArgs, "output") + | concat(chPassthrough) + + emit: chReturn + } + + def wf = workflowInstance.cloneWithName(key_) + + // add factory function + wf.metaClass.run = { runArgs -> + workflowFactory(runArgs, workflowArgs, meta) + } + // add config to module for later introspection + wf.metaClass.config = meta.config + + return wf +} + +nextflow.enable.dsl=2 + +// START COMPONENT-SPECIFIC CODE + +// create meta object +meta = [ + "resources_dir": moduleDir.toRealPath().normalize(), + "config": processConfig(readJsonBlob('''{ + "name" : "well_demultiplex", + "namespace" : "workflows", + "version" : "unpack_genome", + "argument_groups" : [ + { + "name" : "Input arguments", + "arguments" : [ + { + "type" : "file", + "name" : "--input_r1", + "description" : "R1", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--input_r2", + "description" : "R2", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + }, + { + "type" : "file", + "name" : "--barcodesFasta", + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "input", + "multiple" : false, + "multiple_sep" : ";" + } + ] + }, + { + "name" : "Output arguments", + "arguments" : [ + { + "type" : "file", + "name" : "--output", + "description" : "List of demultiplexed fastq files", + "default" : [ + "fastq/*_001.fastq" + ], + "must_exist" : true, + "create_parent" : true, + "required" : true, + "direction" : "output", + "multiple" : true, + "multiple_sep" : ";" + } + ] + } + ], + "resources" : [ + { + "type" : "nextflow_script", + "path" : "main.nf", + "is_executable" : true, + "entrypoint" : "run_wf" + } + ], + "description" : "Demultiplexing on well level", + "test_resources" : [ + { + "type" : "nextflow_script", + "path" : "test.nf", + "is_executable" : true, + "entrypoint" : "test_wf" + } + ], + "status" : "enabled", + "requirements" : { + "commands" : [ + "ps" + ] + }, + "dependencies" : [ + { + "name" : "cutadapt", + "repository" : { + "type" : "vsh", + "repo" : "biobox", + "tag" : "v0.1.0" + } + } + ], + "repositories" : [ + { + "type" : "vsh", + "name" : "bb", + "repo" : "biobox", + "tag" : "v0.1.0" + } + ], + "license" : "MIT", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq" + }, + "runners" : [ + { + "type" : "nextflow", + "id" : "nextflow", + "directives" : { + "tag" : "$id" + }, + "auto" : { + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false + }, + "config" : { + "labels" : { + "mem1gb" : "memory = 1000000000.B", + "mem2gb" : "memory = 2000000000.B", + "mem5gb" : "memory = 5000000000.B", + "mem10gb" : "memory = 10000000000.B", + "mem20gb" : "memory = 20000000000.B", + "mem50gb" : "memory = 50000000000.B", + "mem100gb" : "memory = 100000000000.B", + "mem200gb" : "memory = 200000000000.B", + "mem500gb" : "memory = 500000000000.B", + "mem1tb" : "memory = 1000000000000.B", + "mem2tb" : "memory = 2000000000000.B", + "mem5tb" : "memory = 5000000000000.B", + "mem10tb" : "memory = 10000000000000.B", + "mem20tb" : "memory = 20000000000000.B", + "mem50tb" : "memory = 50000000000000.B", + "mem100tb" : "memory = 100000000000000.B", + "mem200tb" : "memory = 200000000000000.B", + "mem500tb" : "memory = 500000000000000.B", + "mem1gib" : "memory = 1073741824.B", + "mem2gib" : "memory = 2147483648.B", + "mem4gib" : "memory = 4294967296.B", + "mem8gib" : "memory = 8589934592.B", + "mem16gib" : "memory = 17179869184.B", + "mem32gib" : "memory = 34359738368.B", + "mem64gib" : "memory = 68719476736.B", + "mem128gib" : "memory = 137438953472.B", + "mem256gib" : "memory = 274877906944.B", + "mem512gib" : "memory = 549755813888.B", + "mem1tib" : "memory = 1099511627776.B", + "mem2tib" : "memory = 2199023255552.B", + "mem4tib" : "memory = 4398046511104.B", + "mem8tib" : "memory = 8796093022208.B", + "mem16tib" : "memory = 17592186044416.B", + "mem32tib" : "memory = 35184372088832.B", + "mem64tib" : "memory = 70368744177664.B", + "mem128tib" : "memory = 140737488355328.B", + "mem256tib" : "memory = 281474976710656.B", + "mem512tib" : "memory = 562949953421312.B", + "cpu1" : "cpus = 1", + "cpu2" : "cpus = 2", + "cpu5" : "cpus = 5", + "cpu10" : "cpus = 10", + "cpu20" : "cpus = 20", + "cpu50" : "cpus = 50", + "cpu100" : "cpus = 100", + "cpu200" : "cpus = 200", + "cpu500" : "cpus = 500", + "cpu1000" : "cpus = 1000" + } + }, + "debug" : false, + "container" : "docker" + } + ], + "engines" : [ + { + "type" : "native", + "id" : "native" + }, + { + "type" : "native", + "id" : "native" + } + ], + "build_info" : { + "config" : "/workdir/root/repo/src/workflows/well_demultiplex/config.vsh.yaml", + "runner" : "nextflow", + "engine" : "native|native", + "output" : "target/nextflow/workflows/well_demultiplex", + "viash_version" : "0.9.0-RC6", + "git_commit" : "7c0705a514b86c8d335f308abf7fb1b62d16aa2f", + "git_remote" : "https://github.com/viash-hub/htrnaseq" + }, + "package_config" : { + "name" : "htrnaseq", + "version" : "unpack_genome", + "description" : "Demultiplexing pipeline [WIP]\n", + "viash_version" : "0.9.0-RC6", + "source" : "src", + "target" : "target", + "config_mods" : [ + ".requirements.commands := ['ps']\n", + ".engines += { type: \\"native\\" }", + ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'", + ".engines[.type == 'docker'].target_tag := 'unpack_genome'" + ], + "keywords" : [ + "bioinformatics", + "sequence", + "high-throughput", + "mapping", + "counting", + "pipeline" + ], + "license" : "MIT", + "organization" : "vsh", + "links" : { + "repository" : "https://github.com/viash-hub/htrnaseq", + "issue_tracker" : "https://github.com/viash-hub/htrnaseq/issues" + } + } +}''')) +] + +// resolve dependencies dependencies (if any) +meta["root_dir"] = getRootDir() +include { cutadapt } from "${meta.root_dir}/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/main.nf" + +// inner workflow +// user-provided Nextflow code +workflow run_wf { + take: + input_ch + + main: + output_ch = input_ch + //| niceView() + | cutadapt.run( + // TODO: Remove hard-coded directives and replace with profiles + directives: [ + cpus: 4 + ], + fromState: { id, state -> + [ + input: state.input_r1, + input_r2: state.input_r2, + no_indels: true, + action: "none", + front_fasta: state.barcodesFasta, + output: state.output + ] + }, + toState: { id, result, state -> + [ + output: result.output, + ] + } + ) + //| niceView() + + emit: + output_ch +} + +// inner workflow hook +def innerWorkflowFactory(args) { + return run_wf +} + +// defaults +meta["defaults"] = [ + // key to be used to trace the process and determine output names + key: null, + + // fixed arguments to be passed to script + args: [:], + + // default directives + directives: readJsonBlob('''{ + "tag" : "$id" +}'''), + + // auto settings + auto: readJsonBlob('''{ + "simplifyInput" : true, + "simplifyOutput" : false, + "transcript" : false, + "publish" : false +}'''), + + // Apply a map over the incoming tuple + // Example: `{ tup -> [ tup[0], [input: tup[1].output] ] + tup.drop(2) }` + map: null, + + // Apply a map over the ID element of a tuple (i.e. the first element) + // Example: `{ id -> id + "_foo" }` + mapId: null, + + // Apply a map over the data element of a tuple (i.e. the second element) + // Example: `{ data -> [ input: data.output ] }` + mapData: null, + + // Apply a map over the passthrough elements of a tuple (i.e. the tuple excl. the first two elements) + // Example: `{ pt -> pt.drop(1) }` + mapPassthrough: null, + + // Filter the channel + // Example: `{ tup -> tup[0] == "foo" }` + filter: null, + + // Choose whether or not to run the component on the tuple if the condition is true. + // Otherwise, the tuple will be passed through. + // Example: `{ tup -> tup[0] != "skip_this" }` + runIf: null, + + // Rename keys in the data field of the tuple (i.e. the second element) + // Will likely be deprecated in favour of `fromState`. + // Example: `[ "new_key": "old_key" ]` + renameKeys: null, + + // Fetch data from the state and pass it to the module without altering the current state. + // + // `fromState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be passed to the module as is. + // - If it is a `List[String]`, the data will be the values of the state at the given keys. + // - If it is a `Map[String, String]`, the data will be the values of the state at the given keys, with the keys renamed according to the map. + // - If it is a function, the tuple (`[id, state]`) in the channel will be passed to the function, and the result will be used as the data. + // + // Example: `{ id, state -> [input: state.fastq_file] }` + // Default: `null` + fromState: null, + + // Determine how the state should be updated after the module has been run. + // + // `toState` should be `null`, `List[String]`, `Map[String, String]` or a function. + // + // - If it is `null`, the state will be replaced with the output of the module. + // - If it is a `List[String]`, the state will be updated with the values of the data at the given keys. + // - If it is a `Map[String, String]`, the state will be updated with the values of the data at the given keys, with the keys renamed according to the map. + // - If it is a function, a tuple (`[id, output, state]`) will be passed to the function, and the result will be used as the new state. + // + // Example: `{ id, output, state -> state + [counts: state.output] }` + // Default: `{ id, output, state -> output }` + toState: null, + + // Whether or not to print debug messages + // Default: `false` + debug: false +] + +// initialise default workflow +meta["workflow"] = workflowFactory([key: meta.config.name], meta.defaults, meta) + +// add workflow to environment +nextflow.script.ScriptMeta.current().addDefinition(meta.workflow) + +// anonymous workflow for running this module as a standalone +workflow { + // add id argument if it's not already in the config + // TODO: deep copy + def newConfig = deepClone(meta.config) + def newParams = deepClone(params) + + def argsContainsId = newConfig.allArguments.any{it.plainName == "id"} + if (!argsContainsId) { + def idArg = [ + 'name': '--id', + 'required': false, + 'type': 'string', + 'description': 'A unique id for every entry.', + 'multiple': false + ] + newConfig.arguments.add(0, idArg) + newConfig = processConfig(newConfig) + } + if (!newParams.containsKey("id")) { + newParams.id = "run" + } + + helpMessage(newConfig) + + channelFromParams(newParams, newConfig) + // make sure id is not in the state if id is not in the args + | map {id, state -> + if (!argsContainsId) { + [id, state.findAll{k, v -> k != "id"}] + } else { + [id, state] + } + } + | meta.workflow.run( + auto: [ publish: "state" ] + ) +} + +// END COMPONENT-SPECIFIC CODE diff --git a/target/nextflow/workflows/well_demultiplex/nextflow.config b/target/nextflow/workflows/well_demultiplex/nextflow.config new file mode 100644 index 00000000..7502769d --- /dev/null +++ b/target/nextflow/workflows/well_demultiplex/nextflow.config @@ -0,0 +1,125 @@ +manifest { + name = 'workflows/well_demultiplex' + mainScript = 'main.nf' + nextflowVersion = '!>=20.12.1-edge' + version = 'unpack_genome' + description = 'Demultiplexing on well level' +} + +process.container = 'nextflow/bash:latest' + +// detect tempdir +tempDir = java.nio.file.Paths.get( + System.getenv('NXF_TEMP') ?: + System.getenv('VIASH_TEMP') ?: + System.getenv('TEMPDIR') ?: + System.getenv('TMPDIR') ?: + '/tmp' +).toAbsolutePath() + +profiles { + no_publish { + process { + withName: '.*' { + publishDir = [ + enabled: false + ] + } + } + } + mount_temp { + docker.temp = tempDir + podman.temp = tempDir + charliecloud.temp = tempDir + } + docker { + docker.enabled = true + // docker.userEmulation = true + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + singularity { + singularity.enabled = true + singularity.autoMounts = true + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + podman { + podman.enabled = true + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + shifter { + shifter.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + } + charliecloud { + charliecloud.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + } +} + +process{ + withLabel: mem1gb { memory = 1000000000.B } + withLabel: mem2gb { memory = 2000000000.B } + withLabel: mem5gb { memory = 5000000000.B } + withLabel: mem10gb { memory = 10000000000.B } + withLabel: mem20gb { memory = 20000000000.B } + withLabel: mem50gb { memory = 50000000000.B } + withLabel: mem100gb { memory = 100000000000.B } + withLabel: mem200gb { memory = 200000000000.B } + withLabel: mem500gb { memory = 500000000000.B } + withLabel: mem1tb { memory = 1000000000000.B } + withLabel: mem2tb { memory = 2000000000000.B } + withLabel: mem5tb { memory = 5000000000000.B } + withLabel: mem10tb { memory = 10000000000000.B } + withLabel: mem20tb { memory = 20000000000000.B } + withLabel: mem50tb { memory = 50000000000000.B } + withLabel: mem100tb { memory = 100000000000000.B } + withLabel: mem200tb { memory = 200000000000000.B } + withLabel: mem500tb { memory = 500000000000000.B } + withLabel: mem1gib { memory = 1073741824.B } + withLabel: mem2gib { memory = 2147483648.B } + withLabel: mem4gib { memory = 4294967296.B } + withLabel: mem8gib { memory = 8589934592.B } + withLabel: mem16gib { memory = 17179869184.B } + withLabel: mem32gib { memory = 34359738368.B } + withLabel: mem64gib { memory = 68719476736.B } + withLabel: mem128gib { memory = 137438953472.B } + withLabel: mem256gib { memory = 274877906944.B } + withLabel: mem512gib { memory = 549755813888.B } + withLabel: mem1tib { memory = 1099511627776.B } + withLabel: mem2tib { memory = 2199023255552.B } + withLabel: mem4tib { memory = 4398046511104.B } + withLabel: mem8tib { memory = 8796093022208.B } + withLabel: mem16tib { memory = 17592186044416.B } + withLabel: mem32tib { memory = 35184372088832.B } + withLabel: mem64tib { memory = 70368744177664.B } + withLabel: mem128tib { memory = 140737488355328.B } + withLabel: mem256tib { memory = 281474976710656.B } + withLabel: mem512tib { memory = 562949953421312.B } + withLabel: cpu1 { cpus = 1 } + withLabel: cpu2 { cpus = 2 } + withLabel: cpu5 { cpus = 5 } + withLabel: cpu10 { cpus = 10 } + withLabel: cpu20 { cpus = 20 } + withLabel: cpu50 { cpus = 50 } + withLabel: cpu100 { cpus = 100 } + withLabel: cpu200 { cpus = 200 } + withLabel: cpu500 { cpus = 500 } + withLabel: cpu1000 { cpus = 1000 } +} + + diff --git a/target/nextflow/workflows/well_demultiplex/nextflow_schema.json b/target/nextflow/workflows/well_demultiplex/nextflow_schema.json new file mode 100644 index 00000000..c9aa6e8b --- /dev/null +++ b/target/nextflow/workflows/well_demultiplex/nextflow_schema.json @@ -0,0 +1,115 @@ +{ +"$schema": "http://json-schema.org/draft-07/schema", +"title": "well_demultiplex", +"description": "Demultiplexing on well level", +"type": "object", +"definitions": { + + + + "input arguments" : { + "title": "Input arguments", + "type": "object", + "description": "No description", + "properties": { + + + "input_r1": { + "type": + "string", + "description": "Type: `file`, required. R1", + "help_text": "Type: `file`, required. R1" + + } + + + , + "input_r2": { + "type": + "string", + "description": "Type: `file`, required. R2", + "help_text": "Type: `file`, required. R2" + + } + + + , + "barcodesFasta": { + "type": + "string", + "description": "Type: `file`, required. ", + "help_text": "Type: `file`, required. " + + } + + +} +}, + + + "output arguments" : { + "title": "Output arguments", + "type": "object", + "description": "No description", + "properties": { + + + "output": { + "type": + "string", + "description": "Type: List of `file`, required, default: `$id.$key.output_*.fastq`, multiple_sep: `\":\"`. List of demultiplexed fastq files", + "help_text": "Type: List of `file`, required, default: `$id.$key.output_*.fastq`, multiple_sep: `\":\"`. List of demultiplexed fastq files" + , + "default": "$id.$key.output_*.fastq" + } + + +} +}, + + + "nextflow input-output arguments" : { + "title": "Nextflow input-output arguments", + "type": "object", + "description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.", + "properties": { + + + "publish_dir": { + "type": + "string", + "description": "Type: `string`, required, example: `output/`. Path to an output directory", + "help_text": "Type: `string`, required, example: `output/`. Path to an output directory." + + } + + + , + "param_list": { + "type": + "string", + "description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel", + "help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.", + "hidden": true + + } + + +} +} +}, +"allOf": [ + + { + "$ref": "#/definitions/input arguments" + }, + + { + "$ref": "#/definitions/output arguments" + }, + + { + "$ref": "#/definitions/nextflow input-output arguments" + } +] +}