Build branch add_trimgalore with version add_trimgalore (9073515)

Build pipeline: viash-hub.biobox.add-trimgalore-8w9nv

Source commit: 90735159b7

Source message: separate input fastqc file arguments from other arguments

CHANGELOG.md

@@ -42,11 +42,14 @@
 * `rsem/rsem_prepare_reference`: Prepare transcript references for RSEM (PR #89).
 
 * `bcftools`:
+  - `bcftools/bcftools_concat`: Concatenate or combine VCF/BCF files (PR #145).
+  - `bcftools/bcftools_norm`: Left-align and normalize indels, check if REF alleles match the reference, split multiallelic sites into multiple rows; recover multiallelics from multiple rows (PR #144).
+  - `bcftools/bcftools_annotate`: Add or remove annotations from a VCF/BCF file (PR #143).
+  - `bcftools/bcftools_stats`: Parses VCF or BCF and produces a txt stats file which can be plotted using plot-vcfstats (PR #142).
   - `bcftools/bcftools_sort`: Sorts BCF/VCF files by position and other criteria (PR #141).
 
 * `fastqc`: High throughput sequence quality control analysis tool (PR #92).
 
-
 * `trimgalore`: Quality and adapter trimming for fastq files (PR #117). 
 
 ## MINOR CHANGES

src/bcftools/bcftools_annotate/config.vsh.yaml

@@ -0,0 +1,250 @@
+name: bcftools_annotate
+namespace: bcftools
+description: | 
+  Add or remove annotations from a VCF/BCF file.
+keywords: [Annotate, VCF, BCF]
+links:
+  homepage: https://samtools.github.io/bcftools/
+  documentation: https://samtools.github.io/bcftools/bcftools.html#annotate
+  repository: https://github.com/samtools/bcftools
+  issue_tracker: https://github.com/samtools/bcftools/issues
+references:
+  doi: https://doi.org/10.1093/gigascience/giab008
+license: MIT/Expat, GNU
+requirements:
+  commands: [bcftools]
+authors:
+  - __merge__: /src/_authors/theodoro_gasperin.yaml
+    roles: [author]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --input
+        alternatives: -i
+        type: file
+        multiple: true
+        description: Input VCF/BCF file.
+        required: true
+    
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: -o
+        direction: output
+        type: file
+        description: Output annotated file.
+        required: true
+         
+  - name: Options
+    description: | 
+      For examples on how to use use bcftools annotate see http://samtools.github.io/bcftools/howtos/annotate.html.
+      For more details on the options see https://samtools.github.io/bcftools/bcftools.html#annotate.
+    arguments:
+      
+      - name: --annotations
+        alternatives: --a
+        type: file
+        description: | 
+          VCF file or tabix-indexed FILE with annotations: CHR\tPOS[\tVALUE]+ . 
+
+      - name: --columns
+        alternatives: --c
+        type: string
+        description: | 
+          List of columns in the annotation file, e.g. CHROM,POS,REF,ALT,-,INFO/TAG. 
+          See man page for details.
+
+      - name: --columns_file
+        alternatives: --C
+        type: file
+        description: | 
+          Read -c columns from FILE, one name per row, with optional --merge_logic TYPE: NAME[ TYPE].
+
+      - name: --exclude
+        alternatives: --e
+        type: string
+        description: | 
+          Exclude sites for which the expression is true.
+          See https://samtools.github.io/bcftools/bcftools.html#expressions for details.
+        example: 'QUAL >= 30 && DP >= 10'
+
+      - name: --force
+        type: boolean_true
+        description: | 
+          continue even when parsing errors, such as undefined tags, are encountered. 
+          Note this can be an unsafe operation and can result in corrupted BCF files. 
+          If this option is used, make sure to sanity check the result thoroughly.
+
+      - name: --header_line
+        alternatives: --H
+        type: string
+        description: | 
+          Header line which should be appended to the VCF header, can be given multiple times.
+
+      - name: --header_lines
+        alternatives: --h
+        type: file
+        description: | 
+          File with header lines to append to the VCF header.
+          For example:
+            ##INFO=<ID=NUMERIC_TAG,Number=1,Type=Integer,Description="Example header line">
+            ##INFO=<ID=STRING_TAG,Number=1,Type=String,Description="Yet another header line">
+
+      - name: --set_id
+        alternatives: --I
+        type: string
+        description: | 
+          Set ID column using a `bcftools query`-like expression, see man page for details.
+
+      - name: --include
+        type: string
+        description: | 
+          Select sites for which the expression is true.
+          See https://samtools.github.io/bcftools/bcftools.html#expressions for details.
+        example: 'QUAL >= 30 && DP >= 10'
+      
+      - name: --keep_sites
+        alternatives: --k
+        type: boolean_true
+        description: | 
+          Leave --include/--exclude sites unchanged instead of discarding them.
+
+      - name: --merge_logic
+        alternatives: --l
+        type: string
+        choices: 
+        description: | 
+          When multiple regions overlap a single record, this option defines how to treat multiple annotation values.
+          See man page for more details.
+
+      - name: --mark_sites
+        alternatives: --m
+        type: string
+        description: | 
+          Annotate sites which are present ("+") or absent ("-") in the -a file with a new INFO/TAG flag.
+
+      - name: --min_overlap
+        type: string
+        description: | 
+          Minimum overlap required as a fraction of the variant in the annotation -a file (ANN), 
+          in the target VCF file (:VCF), or both for reciprocal overlap (ANN:VCF). 
+          By default overlaps of arbitrary length are sufficient. 
+          The option can be used only with the tab-delimited annotation -a file and with BEG and END columns present.
+
+      - name: --no_version
+        type: boolean_true
+        description: | 
+          Do not append version and command line information to the output VCF header.
+
+      - name: --output_type
+        alternatives: --O
+        type: string
+        choices: ['u', 'z', 'b', 'v']
+        description: | 
+          Output type:
+            u: uncompressed BCF
+            z: compressed VCF
+            b: compressed BCF
+            v: uncompressed VCF
+      
+      - name: --pair_logic
+        type: string
+        choices: ['snps', 'indels', 'both', 'all', 'some', 'exact']
+        description: | 
+          Controls how to match records from the annotation file to the target VCF. 
+          Effective only when -a is a VCF or BCF file. 
+          The option replaces the former uninuitive --collapse. 
+          See Common Options for more.
+      
+      - name: --regions
+        alternatives: --r
+        type: string
+        description: | 
+          Restrict to comma-separated list of regions. 
+          Following formats are supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].
+        example: '20:1000000-2000000'
+
+      - name: --regions_file
+        alternatives: --R
+        type: file
+        description: | 
+          Restrict to regions listed in a file. 
+          Regions can be specified either on a VCF, BED, or tab-delimited file (the default). 
+          For more information check manual.
+
+      - name: --regions_overlap
+        type: string
+        choices: ['pos', 'record', 'variant', '0', '1', '2']
+        description: | 
+          This option controls how overlapping records are determined: 
+          set to 'pos' or '0' if the VCF record has to have POS inside a region (this corresponds to the default behavior of -t/-T); 
+          set to 'record' or '1' if also overlapping records with POS outside a region should be included (this is the default behavior of -r/-R, 
+          and includes indels with POS at the end of a region, which are technically outside the region); 
+          or set to 'variant' or '2' to include only true overlapping variation (compare the full VCF representation "TA>T-" vs the true sequence variation "A>-").
+
+      - name: --rename_annotations 
+        type: file
+        description: | 
+          Rename annotations: TYPE/old\tnew, where TYPE is one of FILTER,INFO,FORMAT.
+
+      - name: --rename_chromosomes
+        type: file
+        description: | 
+          Rename chromosomes according to the map in file, with "old_name new_name\n" pairs 
+          separated by whitespaces, each on a separate line.
+
+      - name: --samples
+        type: string
+        description: | 
+          Subset of samples to annotate.
+          See also https://samtools.github.io/bcftools/bcftools.html#common_options.
+
+      - name: --samples_file
+        type: file
+        description: | 
+          Subset of samples to annotate in file format.
+          See also https://samtools.github.io/bcftools/bcftools.html#common_options.
+
+      - name: --single_overlaps
+        type: boolean_true
+        description: | 
+          Use this option to keep memory requirements low with very large annotation files. 
+          Note, however, that this comes at a cost, only single overlapping intervals are considered in this mode. 
+          This was the default mode until the commit af6f0c9 (Feb 24 2019).
+
+      - name: --remove
+        alternatives: --x
+        type: string
+        description: | 
+          List of annotations to remove. 
+          Use "FILTER" to remove all filters or "FILTER/SomeFilter" to remove a specific filter. 
+          Similarly, "INFO" can be used to remove all INFO tags and "FORMAT" to remove all FORMAT tags except GT. 
+          To remove all INFO tags except "FOO" and "BAR", use "^INFO/FOO,INFO/BAR" (and similarly for FORMAT and FILTER). 
+          "INFO" can be abbreviated to "INF" and "FORMAT" to "FMT".
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+
+engines:
+  - type: docker
+    image: debian:stable-slim
+    setup:
+      - type: apt
+        packages: [bcftools, procps]
+      - type: docker
+        run: |
+          echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftools //p')\"" > /var/software_versions.txt
+    test_setup:  
+      - type: apt  
+        packages: [tabix]
+
+runners:
+  - type: executable
+  - type: nextflow
+

src/bcftools/bcftools_annotate/help.txt

@@ -0,0 +1,41 @@
+```
+bcftools annotate -h
+```
+
+annotate: option requires an argument -- 'h'
+
+About:   Annotate and edit VCF/BCF files.
+Usage:   bcftools annotate [options] VCF
+
+Options:
+   -a, --annotations FILE          VCF file or tabix-indexed FILE with annotations: CHR\tPOS[\tVALUE]+
+   -c, --columns LIST              List of columns in the annotation file, e.g. CHROM,POS,REF,ALT,-,INFO/TAG. See man page for details
+   -C, --columns-file FILE         Read -c columns from FILE, one name per row, with optional --merge-logic TYPE: NAME[ TYPE]
+   -e, --exclude EXPR              Exclude sites for which the expression is true (see man page for details)
+       --force                     Continue despite parsing error (at your own risk!)
+   -H, --header-line STR           Header line which should be appended to the VCF header, can be given multiple times
+   -h, --header-lines FILE         Lines which should be appended to the VCF header
+   -I, --set-id [+]FORMAT          Set ID column using a `bcftools query`-like expression, see man page for details
+   -i, --include EXPR              Select sites for which the expression is true (see man page for details)
+   -k, --keep-sites                Leave -i/-e sites unchanged instead of discarding them
+   -l, --merge-logic TAG:TYPE      Merge logic for multiple overlapping regions (see man page for details), EXPERIMENTAL
+   -m, --mark-sites [+-]TAG        Add INFO/TAG flag to sites which are ("+") or are not ("-") listed in the -a file
+       --min-overlap ANN:VCF       Required overlap as a fraction of variant in the -a file (ANN), the VCF (:VCF), or reciprocal (ANN:VCF)
+       --no-version                Do not append version and command line to the header
+   -o, --output FILE               Write output to a file [standard output]
+   -O, --output-type u|b|v|z[0-9]  u/b: un/compressed BCF, v/z: un/compressed VCF, 0-9: compression level [v]
+       --pair-logic STR            Matching records by <snps|indels|both|all|some|exact>, see man page for details [some]
+   -r, --regions REGION            Restrict to comma-separated list of regions
+   -R, --regions-file FILE         Restrict to regions listed in FILE
+       --regions-overlap 0|1|2     Include if POS in the region (0), record overlaps (1), variant overlaps (2) [1]
+       --rename-annots FILE        Rename annotations: TYPE/old\tnew, where TYPE is one of FILTER,INFO,FORMAT
+       --rename-chrs FILE          Rename sequences according to the mapping: old\tnew
+   -s, --samples [^]LIST           Comma separated list of samples to annotate (or exclude with "^" prefix)
+   -S, --samples-file [^]FILE      File of samples to annotate (or exclude with "^" prefix)
+       --single-overlaps           Keep memory low by avoiding complexities arising from handling multiple overlapping intervals
+   -x, --remove LIST               List of annotations (e.g. ID,INFO/DP,FORMAT/DP,FILTER) to remove (or keep with "^" prefix). See man page for details
+       --threads INT               Number of extra output compression threads [0]
+
+Examples:
+   http://samtools.github.io/bcftools/howtos/annotate.html
+

src/bcftools/bcftools_annotate/script.sh

@@ -0,0 +1,54 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+# Exit on error
+set -eo pipefail
+
+# Unset parameters
+unset_if_false=(
+    par_force
+    par_keep_sites
+    par_no_version
+    par_single_overlaps
+)
+
+for par in ${unset_if_false[@]}; do
+    test_val="${!par}"
+    [[ "$test_val" == "false" ]] && unset $par
+done
+
+# Execute bcftools annotate with the provided arguments
+bcftools annotate \
+    ${par_annotations:+-a "$par_annotations"} \
+    ${par_columns:+-c "$par_columns"} \
+    ${par_columns_file:+-C "$par_columns_file"} \
+    ${par_exclude:+-e "$par_exclude"} \
+    ${par_force:+--force} \
+    ${par_header_line:+-H "$par_header_line"} \
+    ${par_header_lines:+-h "$par_header_lines"} \
+    ${par_set_id:+-I "$par_set_id"} \
+    ${par_include:+-i "$par_include"} \
+    ${par_keep_sites:+-k} \
+    ${par_merge_logic:+-l "$par_merge_logic"} \
+    ${par_mark_sites:+-m "$par_mark_sites"} \
+    ${par_min_overlap:+--min-overlap "$par_min_overlap"} \
+    ${par_no_version:+--no-version} \
+    ${par_samples_file:+-S "$par_samples_file"} \
+    ${par_output_type:+-O "$par_output_type"} \
+    ${par_pair_logic:+--pair-logic "$par_pair_logic"} \
+    ${par_regions:+-r "$par_regions"} \
+    ${par_regions_file:+-R "$par_regions_file"} \
+    ${par_regions_overlap:+--regions-overlap "$par_regions_overlap"} \
+    ${par_rename_annotations:+--rename-annots "$par_rename_annotations"} \
+    ${par_rename_chromosomes:+--rename-chrs "$par_rename_chromosomes"} \
+    ${par_samples:+-s "$par_samples"} \
+    ${par_single_overlaps:+--single-overlaps} \
+    ${par_threads:+--threads "$par_threads"} \
+    ${par_remove:+-x "$par_remove"} \
+    -o $par_output \
+    $par_input
+    
+
+    

src/bcftools/bcftools_annotate/test.sh

@@ -0,0 +1,305 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+# Exit on error
+set -eo pipefail
+
+#test_data="$meta_resources_dir/test_data"
+
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
+}
+assert_identical_content() {
+  diff -a "$2" "$1" \
+    || (echo "Files are not identical!" && exit 1)
+}
+#############################################
+
+# Create directories for tests
+echo "Creating Test Data..."
+TMPDIR=$(mktemp -d "$meta_temp_dir/XXXXXX")
+function clean_up {
+  [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
+}
+trap clean_up EXIT
+
+# Create test data
+cat <<EOF > "$TMPDIR/example.vcf"
+##fileformat=VCFv4.1
+##contig=<ID=1,length=249250621,assembly=b37>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	SAMPLE1
+1	752567	llama	A	C	.	.	.	.	.
+1	752722	.	G	A	.	.	.	.	.
+EOF
+
+bgzip -c $TMPDIR/example.vcf > $TMPDIR/example.vcf.gz
+tabix -p vcf $TMPDIR/example.vcf.gz
+
+cat <<EOF > "$TMPDIR/annots.tsv"
+1	752567	752567	FooValue1	12345
+1	752722	752722	FooValue2	67890
+EOF
+
+cat <<EOF > "$TMPDIR/rename.tsv"
+INFO/.	Luigi
+EOF
+
+bgzip $TMPDIR/annots.tsv
+tabix -s1 -b2 -e3 $TMPDIR/annots.tsv.gz
+
+cat <<EOF > "$TMPDIR/header.hdr"
+##FORMAT=<ID=FOO,Number=1,Type=String,Description="Some description">
+##INFO=<ID=BAR,Number=1,Type=Integer,Description="Some description">
+EOF
+
+cat <<EOF > "$TMPDIR/rename_chrm.tsv"
+1	chr1
+2	chr2
+EOF
+
+# Test 1: Remove ID annotations
+mkdir "$TMPDIR/test1" && pushd "$TMPDIR/test1" > /dev/null
+
+echo "> Run bcftools_annotate remove annotations"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --remove "ID" \
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "1	752567	.	A	C"
+echo "- test1 succeeded -"
+
+popd > /dev/null
+
+# Test 2: Annotate with -a, -c and -h options
+mkdir "$TMPDIR/test2" && pushd "$TMPDIR/test2" > /dev/null
+
+echo "> Run bcftools_annotate with -a, -c and -h options"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --annotations "../annots.tsv.gz" \
+  --header_lines "../header.hdr" \
+  --columns "CHROM,FROM,TO,FMT/FOO,BAR" \
+  --mark_sites "BAR" \
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" $(echo -e "1\t752567\tllama\tA\tC\t.\t.\tBAR=12345\tFOO\tFooValue1")
+echo "- test2 succeeded -"
+
+popd > /dev/null
+
+# Test 3: 
+mkdir "$TMPDIR/test3" && pushd "$TMPDIR/test3" > /dev/null
+
+echo "> Run bcftools_annotate with --set_id option"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --set_id "+'%CHROM\_%POS\_%REF\_%FIRST_ALT'" \
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "'1_752722_G_A'"
+echo "- test3 succeeded -"
+
+popd > /dev/null
+
+# Test 4:
+mkdir "$TMPDIR/test4" && pushd "$TMPDIR/test4" > /dev/null
+
+echo "> Run bcftools_annotate with --rename-annotations option"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --rename_annotations "../rename.tsv"
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "##bcftools_annotateCommand=annotate --rename-annots ../rename.tsv -o annotated.vcf"
+echo "- test4 succeeded -"
+
+popd > /dev/null
+
+# Test 5: Rename chromosomes
+mkdir "$TMPDIR/test5" && pushd "$TMPDIR/test5" > /dev/null
+
+echo "> Run bcftools_annotate with --rename-chromosomes option"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --rename_chromosomes "../rename_chrm.tsv"
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "chr1"
+echo "- test5 succeeded -"
+
+popd > /dev/null
+
+# Test 6: Sample option
+mkdir "$TMPDIR/test6" && pushd "$TMPDIR/test6" > /dev/null
+
+echo "> Run bcftools_annotate with -s option"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --samples "SAMPLE1"
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "##bcftools_annotateCommand=annotate -s SAMPLE1 -o annotated.vcf ../example.vcf"
+echo "- test6 succeeded -"
+
+popd > /dev/null
+
+# Test 7: Single overlaps
+mkdir "$TMPDIR/test7" && pushd "$TMPDIR/test7" > /dev/null
+
+echo "> Run bcftools_annotate with --single-overlaps option"	
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --single_overlaps \
+  --keep_sites \
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "annotate -k --single-overlaps -o annotated.vcf ../example.vcf"
+echo "- test7 succeeded -"
+
+popd > /dev/null
+
+# Test 8: Min overlap
+mkdir "$TMPDIR/test8" && pushd "$TMPDIR/test8" > /dev/null
+
+echo "> Run bcftools_annotate with --min-overlap option"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --annotations "../annots.tsv.gz" \
+  --columns "CHROM,FROM,TO,FMT/FOO,BAR" \
+  --header_lines "../header.hdr" \
+  --min_overlap "1"
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "annotate -a ../annots.tsv.gz -c CHROM,FROM,TO,FMT/FOO,BAR -h ../header.hdr --min-overlap 1 -o annotated.vcf ../example.vcf"
+echo "- test8 succeeded -"
+
+popd > /dev/null
+
+# Test 9: Regions
+mkdir "$TMPDIR/test9" && pushd "$TMPDIR/test9" > /dev/null
+
+echo "> Run bcftools_annotate with -r option"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --output "annotated.vcf" \
+  --regions "1:752567-752722"
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "annotate -r 1:752567-752722 -o annotated.vcf ../example.vcf.gz"
+echo "- test9 succeeded -"
+
+popd > /dev/null
+
+# Test 10: pair-logic
+mkdir "$TMPDIR/test10" && pushd "$TMPDIR/test10" > /dev/null
+
+echo "> Run bcftools_annotate with --pair-logic option"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --pair_logic "all"
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "annotate --pair-logic all -o annotated.vcf ../example.vcf"
+echo "- test10 succeeded -"
+
+popd > /dev/null
+
+# Test 11: regions-overlap
+mkdir "$TMPDIR/test11" && pushd "$TMPDIR/test11" > /dev/null
+
+echo "> Run bcftools_annotate with --regions-overlap option"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --regions_overlap "1"
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "annotate --regions-overlap 1 -o annotated.vcf ../example.vcf"
+echo "- test11 succeeded -"
+
+popd > /dev/null
+
+# Test 12: include 
+mkdir "$TMPDIR/test12" && pushd "$TMPDIR/test12" > /dev/null
+
+echo "> Run bcftools_annotate with -i option"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --include "FILTER='PASS'" \
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "annotate -i FILTER='PASS' -o annotated.vcf ../example.vcf"
+echo "- test12 succeeded -"
+
+popd > /dev/null
+
+# Test 13: exclude
+mkdir "$TMPDIR/test13" && pushd "$TMPDIR/test13" > /dev/null
+
+echo "> Run bcftools_annotate with -e option"
+"$meta_executable" \
+  --annotations "../annots.tsv.gz" \
+  --input "../example.vcf" \
+  --output "annotated.vcf" \
+  --exclude "FILTER='PASS'" \
+  --header_lines "../header.hdr" \
+  --columns "CHROM,FROM,TO,FMT/FOO,BAR" \
+  --merge_logic "FOO:first" \
+
+# checks
+assert_file_exists "annotated.vcf"
+assert_file_not_empty "annotated.vcf"
+assert_file_contains "annotated.vcf" "annotate -a ../annots.tsv.gz -c CHROM,FROM,TO,FMT/FOO,BAR -e FILTER='PASS' -h ../header.hdr -l FOO:first -o annotated.vcf ../example.vcf"
+echo "- test13 succeeded -"
+
+popd > /dev/null
+
+
+echo "---- All tests succeeded! ----"
+exit 0
+

src/bcftools/bcftools_concat/config.vsh.yaml

@@ -0,0 +1,172 @@
+name: bcftools_concat
+namespace: bcftools
+description: | 
+  Concatenate or combine VCF/BCF files. All source files must have the same sample
+  columns appearing in the same order. The program can be used, for example, to
+  concatenate chromosome VCFs into one VCF, or combine a SNP VCF and an indel
+  VCF into one. The input files must be sorted by chr and position. The files
+  must be given in the correct order to produce sorted VCF on output unless
+  the -a, --allow-overlaps option is specified. With the --naive option, the files
+  are concatenated without being recompressed, which is very fast.
+keywords: [Concatenate, VCF, BCF]
+links:
+  homepage: https://samtools.github.io/bcftools/
+  documentation: https://samtools.github.io/bcftools/bcftools.html#concat
+  repository: https://github.com/samtools/bcftools
+  issue_tracker: https://github.com/samtools/bcftools/issues
+references:
+  doi: https://doi.org/10.1093/gigascience/giab008
+license: MIT/Expat, GNU
+requirements:
+  commands: [bcftools]
+authors:
+  - __merge__: /src/_authors/theodoro_gasperin.yaml
+    roles: [author]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --input
+        alternatives: -i
+        type: file
+        multiple: true
+        description: Input VCF/BCF files to concatenate.
+      
+      - name: --file_list
+        alternatives: -f
+        type: file
+        description: Read the list of VCF/BCF files from a file, one file name per line.
+    
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: -o
+        direction: output
+        type: file
+        description: Output concatenated VCF/BCF file.
+        required: true
+         
+  - name: Options
+    arguments:
+      
+      - name: --allow_overlaps
+        alternatives: -a
+        type: boolean_true
+        description:  | 
+          First coordinate of the next file can precede last record of the current file.
+      
+      - name: --compact_PS
+        alternatives: -c
+        type: boolean_true
+        description: | 
+          Do not output PS tag at each site, only at the start of a new phase set block.
+      
+      - name: --remove_duplicates
+        alternatives: -d
+        type: string
+        choices: ['snps', 'indels', 'both', 'all', 'exact', 'none']
+        description: |
+          Output duplicate records present in multiple files only once: <snps|indels|both|all|exact>.
+              
+      - name: --ligate
+        alternatives: -l
+        type: boolean_true
+        description: Ligate phased VCFs by matching phase at overlapping haplotypes.
+      
+      - name: --ligate_force
+        type: boolean_true
+        description: Ligate even non-overlapping chunks, keep all sites.
+      
+      - name: --ligate_warn
+        type: boolean_true
+        description: Drop sites in imperfect overlaps.
+
+      - name: --no_version
+        type: boolean_true
+        description: Do not append version and command line information to the header.
+        
+      - name: --naive
+        alternatives: -n
+        type: boolean_true
+        description: Concatenate files without recompression, a header check compatibility is performed.
+      
+      - name: --naive_force
+        type: boolean_true
+        description: | 
+          Same as --naive, but header compatibility is not checked. 
+          Dangerous, use with caution.
+
+      - name: --output_type
+        alternatives: -O
+        type: string
+        choices: ['u', 'z', 'b', 'v']
+        description: | 
+          Output type:
+            u: uncompressed BCF
+            z: compressed VCF
+            b: compressed BCF
+            v: uncompressed VCF
+    
+      - name: --min_PQ
+        alternatives: -q
+        type: integer
+        description: Break phase set if phasing quality is lower than <int>.
+        example: 30
+
+      - name: --regions
+        alternatives: -r
+        type: string
+        description: | 
+          Restrict to comma-separated list of regions. 
+          Following formats are supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].
+        example: '20:1000000-2000000'
+
+      - name: --regions_file
+        alternatives: -R
+        type: file
+        description: | 
+          Restrict to regions listed in a file. 
+          Regions can be specified either on a VCF, BED, or tab-delimited file (the default). 
+          For more information check manual.
+
+      - name: --regions_overlap
+        type: string
+        choices: ['pos', 'record', 'variant', '0', '1', '2']
+        description: | 
+          This option controls how overlapping records are determined: 
+          set to 'pos' or '0' if the VCF record has to have POS inside a region (this corresponds to the default behavior of -t/-T); 
+          set to 'record' or '1' if also overlapping records with POS outside a region should be included (this is the default behavior of -r/-R, 
+          and includes indels with POS at the end of a region, which are technically outside the region); 
+          or set to 'variant' or '2' to include only true overlapping variation (compare the full VCF representation "TA>T-" vs the true sequence variation "A>-").
+
+      #PS: Verbose seems to be broken in this version of bcftools
+      # - name: --verbose
+      #   alternatives: -v
+      #   type: integer
+      #   choices: [0, 1]
+      #   description: Set verbosity level.
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+
+engines:
+  - type: docker
+    image: debian:stable-slim
+    setup:
+      - type: apt
+        packages: [bcftools, procps]
+      - type: docker
+        run: |
+          echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftools //p')\"" > /var/software_versions.txt
+    test_setup:  
+      - type: apt  
+        packages: [tabix]
+
+runners:
+  - type: executable
+  - type: nextflow

src/bcftools/bcftools_concat/help.txt

@@ -0,0 +1,36 @@
+```
+bcftools concat -h
+```
+
+concat: option requires an argument -- 'h'
+
+About:   Concatenate or combine VCF/BCF files. All source files must have the same sample
+         columns appearing in the same order. The program can be used, for example, to
+         concatenate chromosome VCFs into one VCF, or combine a SNP VCF and an indel
+         VCF into one. The input files must be sorted by chr and position. The files
+         must be given in the correct order to produce sorted VCF on output unless
+         the -a, --allow-overlaps option is specified. With the --naive option, the files
+         are concatenated without being recompressed, which is very fast.
+Usage:   bcftools concat [options] <A.vcf.gz> [<B.vcf.gz> [...]]
+
+Options:
+   -a, --allow-overlaps           First coordinate of the next file can precede last record of the current file.
+   -c, --compact-PS               Do not output PS tag at each site, only at the start of a new phase set block.
+   -d, --rm-dups STRING           Output duplicate records present in multiple files only once: <snps|indels|both|all|exact>
+   -D, --remove-duplicates        Alias for -d exact
+   -f, --file-list FILE           Read the list of files from a file.
+   -l, --ligate                   Ligate phased VCFs by matching phase at overlapping haplotypes
+       --ligate-force             Ligate even non-overlapping chunks, keep all sites
+       --ligate-warn              Drop sites in imperfect overlaps
+       --no-version               Do not append version and command line to the header
+   -n, --naive                    Concatenate files without recompression, a header check compatibility is performed
+       --naive-force              Same as --naive, but header compatibility is not checked. Dangerous, use with caution.
+   -o, --output FILE              Write output to a file [standard output]
+   -O, --output-type u|b|v|z[0-9] u/b: un/compressed BCF, v/z: un/compressed VCF, 0-9: compression level [v]
+   -q, --min-PQ INT               Break phase set if phasing quality is lower than <int> [30]
+   -r, --regions REGION           Restrict to comma-separated list of regions
+   -R, --regions-file FILE        Restrict to regions listed in a file
+       --regions-overlap 0|1|2    Include if POS in the region (0), record overlaps (1), variant overlaps (2) [1]
+       --threads INT              Use multithreading with <int> worker threads [0]
+   -v, --verbose 0|1              Set verbosity level [1]
+

src/bcftools/bcftools_concat/script.sh

@@ -0,0 +1,54 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+# Exit on error
+set -eo pipefail
+
+# Unset parameters
+unset_if_false=(
+    par_allow_overlaps
+    par_compact_PS
+    par_ligate
+    par_ligate_force
+    par_ligate_warn
+    par_no_version
+    par_naive
+    par_naive_force
+)
+
+for par in ${unset_if_false[@]}; do
+    test_val="${!par}"
+    [[ "$test_val" == "false" ]] && unset $par
+done
+
+# Check to see whether the par_input or the par_file_list is set
+if [[ -z "${par_input}" && -z "${par_file_list}" ]]; then
+    echo "Error: One of the parameters '--input' or '--file_list' must be used."
+    exit 1
+fi
+
+# Create input array 
+IFS=";" read -ra input <<< $par_input
+
+# Execute bcftools concat with the provided arguments
+bcftools concat \
+    ${par_allow_overlaps:+-a} \
+    ${par_compact_PS:+-c} \
+    ${par_remove_duplicates:+-d "$par_remove_duplicates"} \
+    ${par_ligate:+-l} \
+    ${par_ligate_force:+--ligate-force} \
+    ${par_ligate_warn:+--ligate-warn} \
+    ${par_no_version:+--no-version} \
+    ${par_naive:+-n} \
+    ${par_naive_force:+--naive-force} \
+    ${par_output_type:+--O "$par_output_type"} \
+    ${par_min_PQ:+-q "$par_min_PQ"} \
+    ${par_regions:+-r "$par_regions"} \
+    ${par_regions_file:+-R "$par_regions_file"} \
+    ${par_regions_overlap:+--regions-overlap "$par_regions_overlap"} \
+    ${meta_cpus:+--threads "$meta_cpus"} \
+    -o $par_output \
+    ${par_file_list:+-f "$par_file_list"} \
+    ${input[@]} \

src/bcftools/bcftools_concat/test.sh

@@ -0,0 +1,227 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+# Exit on error
+set -eo pipefail
+
+#test_data="$meta_resources_dir/test_data"
+
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
+}
+assert_identical_content() {
+  diff -a "$2" "$1" \
+    || (echo "Files are not identical!" && exit 1)
+}
+#############################################
+
+# Create directories for tests
+echo "Creating Test Data..."
+TMPDIR=$(mktemp -d "$meta_temp_dir/XXXXXX")
+function clean_up {
+  [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
+}
+trap clean_up EXIT
+
+# Create test data
+cat <<EOF > "$TMPDIR/example.vcf"
+##fileformat=VCFv4.1
+##contig=<ID=1,length=249250621,assembly=b37>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	SAMPLE1
+1	752567	llama	G	C,A	15	.	.	.	1/2
+1	752752	.	G	A,AAA	20	.	.	.	./.
+EOF
+
+bgzip -c $TMPDIR/example.vcf > $TMPDIR/example.vcf.gz
+tabix -p vcf $TMPDIR/example.vcf.gz
+
+cat <<EOF > "$TMPDIR/example_2.vcf"
+##fileformat=VCFv4.1
+##contig=<ID=1,length=249250621,assembly=b37>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	SAMPLE1
+1	752569	cat	G	C,A	15	.	.	.	1/2
+1	752739	.	G	A,AAA	20	.	.	.	./.
+EOF
+
+bgzip -c $TMPDIR/example_2.vcf > $TMPDIR/example_2.vcf.gz
+tabix -p vcf $TMPDIR/example_2.vcf.gz
+
+cat <<EOF > "$TMPDIR/file_list.txt"
+$TMPDIR/example.vcf.gz
+$TMPDIR/example_2.vcf.gz
+EOF
+
+# Test 1: Default test
+mkdir "$TMPDIR/test1" && pushd "$TMPDIR/test1" > /dev/null
+
+echo "> Run bcftools_concat default test"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --input "../example_2.vcf" \
+  --output "concatenated.vcf" \
+  &> /dev/null
+
+# checks
+assert_file_exists "concatenated.vcf"
+assert_file_not_empty "concatenated.vcf"
+assert_file_contains "concatenated.vcf" "concat -o concatenated.vcf ../example.vcf ../example_2.vcf"
+echo "- test1 succeeded -"
+
+popd > /dev/null
+
+# Test 2: Allow overlaps, compact PS and remove duplicates
+mkdir "$TMPDIR/test2" && pushd "$TMPDIR/test2" > /dev/null
+
+echo "> Run bcftools_concat test with allow overlaps, and remove duplicates"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --input "../example_2.vcf.gz" \
+  --output "concatenated.vcf" \
+  --allow_overlaps \
+  --remove_duplicates 'none' \
+  &> /dev/null
+
+# checks
+assert_file_exists "concatenated.vcf"
+assert_file_not_empty "concatenated.vcf"
+assert_file_contains "concatenated.vcf" "concat -a -d none -o concatenated.vcf ../example.vcf.gz ../example_2.vcf.gz"  
+echo "- test2 succeeded -"
+
+popd > /dev/null
+
+
+# Test 3: Ligate, ligate force and ligate warn
+mkdir "$TMPDIR/test3" && pushd "$TMPDIR/test3" > /dev/null
+
+echo "> Run bcftools_concat test with ligate, ligate force and ligate warn"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --input "../example_2.vcf.gz" \
+  --output "concatenated.vcf" \
+  --ligate \
+  --compact_PS \
+  &> /dev/null
+
+
+# checks
+assert_file_exists "concatenated.vcf"
+assert_file_not_empty "concatenated.vcf"
+assert_file_contains "concatenated.vcf" "concat -c -l -o concatenated.vcf ../example.vcf.gz ../example_2.vcf.gz"
+echo "- test3 succeeded -"
+
+popd > /dev/null
+
+# Test 4: file list with ligate force and ligate warn
+mkdir "$TMPDIR/test4" && pushd "$TMPDIR/test4" > /dev/null
+
+echo "> Run bcftools_concat test with file list, ligate force and ligate warn"
+"$meta_executable" \
+  --file_list "../file_list.txt" \
+  --output "concatenated.vcf" \
+  --ligate_force \
+  &> /dev/null
+
+# checks
+assert_file_exists "concatenated.vcf"
+assert_file_not_empty "concatenated.vcf"
+assert_file_contains "concatenated.vcf" "concat --ligate-force -o concatenated.vcf -f ../file_list.txt"
+echo "- test4 succeeded -"
+
+popd > /dev/null
+
+# Test 5: ligate warn and naive
+mkdir "$TMPDIR/test5" && pushd "$TMPDIR/test5" > /dev/null
+
+echo "> Run bcftools_concat test with ligate warn and naive"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --input "../example_2.vcf.gz" \
+  --output "concatenated.vcf.gz" \
+  --ligate_warn \
+  --naive \
+  &> /dev/null
+
+bgzip -d concatenated.vcf.gz
+
+# checks
+assert_file_exists "concatenated.vcf"
+assert_file_not_empty "concatenated.vcf"
+assert_file_contains "concatenated.vcf" "##fileformat=VCFv4.1"
+echo "- test5 succeeded -"
+
+popd > /dev/null
+
+# Test 6: minimal PQ
+mkdir "$TMPDIR/test6" && pushd "$TMPDIR/test6" > /dev/null
+
+echo "> Run bcftools_concat test with minimal PQ"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --input "../example_2.vcf.gz" \
+  --output "concatenated.vcf" \
+  --min_PQ 20 \
+  &> /dev/null
+
+# checks
+assert_file_exists "concatenated.vcf"
+assert_file_not_empty "concatenated.vcf"
+assert_file_contains "concatenated.vcf" "concat -q 20 -o concatenated.vcf ../example.vcf.gz ../example_2.vcf.gz"
+echo "- test6 succeeded -"
+
+popd > /dev/null
+
+# Test 7: regions
+mkdir "$TMPDIR/test7" && pushd "$TMPDIR/test7" > /dev/null
+
+echo "> Run bcftools_concat test with regions"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --input "../example_2.vcf.gz" \
+  --output "concatenated.vcf" \
+  --allow_overlaps \
+  --regions "1:752569-752739" \
+  &> /dev/null
+
+# checks
+assert_file_exists "concatenated.vcf"
+assert_file_not_empty "concatenated.vcf"
+assert_file_contains "concatenated.vcf" "concat -a -r 1:752569-752739 -o concatenated.vcf ../example.vcf.gz ../example_2.vcf.gz"
+echo "- test7 succeeded -"
+
+popd > /dev/null
+
+# Test 8: regions overlap
+mkdir "$TMPDIR/test8" && pushd "$TMPDIR/test8" > /dev/null
+
+echo "> Run bcftools_concat test with regions overlap"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --input "../example_2.vcf.gz" \
+  --output "concatenated.vcf" \
+  --allow_overlaps \
+  --regions_overlap 'pos' \
+  &> /dev/null
+
+# checks
+assert_file_exists "concatenated.vcf"
+assert_file_not_empty "concatenated.vcf"
+assert_file_contains "concatenated.vcf" "concat -a --regions-overlap pos -o concatenated.vcf ../example.vcf.gz ../example_2.vcf.gz"
+echo "- test8 succeeded -"
+
+popd > /dev/null
+
+echo "---- All tests succeeded! ----"
+exit 0
+
+
+

src/bcftools/bcftools_norm/config.vsh.yaml

@@ -0,0 +1,194 @@
+name: bcftools_norm
+namespace: bcftools
+description: | 
+  Left-align and normalize indels, check if REF alleles match the reference, split multiallelic sites into multiple rows; 
+  recover multiallelics from multiple rows. 
+keywords: [Normalize, VCF, BCF]
+links:
+  homepage: https://samtools.github.io/bcftools/
+  documentation: https://samtools.github.io/bcftools/bcftools.html#norm
+  repository: https://github.com/samtools/bcftools
+  issue_tracker: https://github.com/samtools/bcftools/issues
+references:
+  doi: https://doi.org/10.1093/gigascience/giab008
+license: MIT/Expat, GNU
+requirements:
+  commands: [bcftools]
+authors:
+  - __merge__: /src/_authors/theodoro_gasperin.yaml
+    roles: [author]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --input
+        alternatives: -i
+        type: file
+        description: Input VCF/BCF file.
+        required: true
+    
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: -o
+        direction: output
+        type: file
+        description: Output normalized VCF/BCF file.
+        required: true
+         
+  - name: Options
+    arguments:
+      
+      - name: --atomize
+        alternatives: -a
+        type: boolean_true
+        description: |
+          Decompose complex variants (e.g., MNVs become consecutive SNVs).
+
+      - name: --atom_overlaps
+        type: string
+        choices: [".", "*"]
+        description: | 
+          Use the star allele (*) for overlapping alleles or set to missing (.).
+
+      - name: --check_ref
+        alternatives: -c
+        type: string
+        choices: ['e', 'w', 'x', 's']
+        description: | 
+          Check REF alleles and exit (e), warn (w), exclude (x), or set (s) bad sites.
+
+      - name: --remove_duplicates
+        alternatives: -d
+        type: string
+        choices: ['snps', 'indels', 'both', 'all', 'exact', 'none']
+        description: Remove duplicate snps, indels, both, all, exact matches, or none (old -D option).
+
+      - name: --fasta_ref
+        alternatives: -f
+        type: file
+        description: Reference fasta sequence file.
+
+      - name: --force
+        type: boolean_true
+        description: | 
+          Try to proceed even if malformed tags are encountered. 
+          Experimental, use at your own risk.
+
+      - name: --keep_sum
+        type: string
+        description: | 
+          Keep vector sum constant when splitting multiallelics (see github issue #360).
+
+      - name: --multiallelics
+        alternatives: -m
+        type: string
+        choices: ['+snps', '+indels', '+both', '+any', '-snps', '-indels', '-both', '-any']
+        description: | 
+          Split multiallelics (-) or join biallelics (+), type: snps, indels, both, any [default: both].
+
+      - name: --no_version
+        type: boolean_true
+        description: Do not append version and command line information to the header.
+
+      - name: --do_not_normalize
+        alternatives: -N
+        type: boolean_true
+        description: Do not normalize indels (with -m or -c s).
+      
+      - name: --output_type
+        alternatives: --O
+        type: string
+        choices: ['u', 'z', 'b', 'v']
+        description: | 
+          Output type:
+            u: uncompressed BCF
+            z: compressed VCF
+            b: compressed BCF
+            v: uncompressed VCF
+      
+      - name: --old_rec_tag
+        type: string
+        description: Annotate modified records with INFO/STR indicating the original variant.
+
+      - name: --regions
+        alternatives: --r
+        type: string
+        description: | 
+          Restrict to comma-separated list of regions. 
+          Following formats are supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].
+        example: '20:1000000-2000000'
+
+      - name: --regions_file
+        alternatives: --R
+        type: file
+        description: | 
+          Restrict to regions listed in a file. 
+          Regions can be specified either on a VCF, BED, or tab-delimited file (the default). 
+          For more information check manual.
+
+      - name: --regions_overlap
+        type: string
+        choices: ['pos', 'record', 'variant', '0', '1', '2']
+        description: | 
+          This option controls how overlapping records are determined: 
+          set to 'pos' or '0' if the VCF record has to have POS inside a region (this corresponds to the default behavior of -t/-T); 
+          set to 'record' or '1' if also overlapping records with POS outside a region should be included (this is the default behavior of -r/-R, 
+          and includes indels with POS at the end of a region, which are technically outside the region); 
+          or set to 'variant' or '2' to include only true overlapping variation (compare the full VCF representation "TA>T-" vs the true sequence variation "A>-").
+
+      - name: --site_win
+        alternatives: -w
+        type: integer
+        description: | 
+          Buffer for sorting lines that changed position during realignment.
+
+      - name: --strict_filter
+        alternatives: -s
+        type: boolean_true
+        description: When merging (-m+), merged site is PASS only if all sites being merged PASS.
+
+      - name: --targets
+        alternatives: -t
+        type: string
+        description: Similar to --regions but streams rather than index-jumps.
+        example: '20:1000000-2000000'
+
+      - name: --targets_file
+        alternatives: -T
+        type: file
+        description: Similar to --regions_file but streams rather than index-jumps.
+
+      - name: --targets_overlap
+        type: string
+        choices: ['pos', 'record', 'variant', '0', '1', '2']
+        description: | 
+          Include if POS in the region (0), record overlaps (1), variant overlaps (2).
+          Similar to --regions_overlap.
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+
+engines:
+  - type: docker
+    image: debian:stable-slim
+    setup:
+      - type: apt
+        packages: [bcftools, procps]
+      - type: docker
+        run: |
+          echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftools //p')\"" > /var/software_versions.txt
+    test_setup:  
+      - type: apt  
+        packages: [tabix]
+
+runners:
+  - type: executable
+  - type: nextflow
+
+

src/bcftools/bcftools_norm/help.txt

@@ -0,0 +1,41 @@
+```
+bcftools norm -h
+```
+
+About:   Left-align and normalize indels; check if REF alleles match the reference;
+         split multiallelic sites into multiple rows; recover multiallelics from
+         multiple rows.
+Usage:   bcftools norm [options] <in.vcf.gz>
+
+Options:
+    -a, --atomize                   Decompose complex variants (e.g. MNVs become consecutive SNVs)
+        --atom-overlaps '*'|.       Use the star allele (*) for overlapping alleles or set to missing (.) [*]
+    -c, --check-ref e|w|x|s         Check REF alleles and exit (e), warn (w), exclude (x), or set (s) bad sites [e]
+    -D, --remove-duplicates         Remove duplicate lines of the same type.
+    -d, --rm-dup TYPE               Remove duplicate snps|indels|both|all|exact
+    -f, --fasta-ref FILE            Reference sequence
+        --force                     Try to proceed even if malformed tags are encountered. Experimental, use at your own risk
+        --keep-sum TAG,..           Keep vector sum constant when splitting multiallelics (see github issue #360)
+    -m, --multiallelics -|+TYPE     Split multiallelics (-) or join biallelics (+), type: snps|indels|both|any [both]
+        --no-version                Do not append version and command line to the header
+    -N, --do-not-normalize          Do not normalize indels (with -m or -c s)
+        --old-rec-tag STR           Annotate modified records with INFO/STR indicating the original variant
+    -o, --output FILE               Write output to a file [standard output]
+    -O, --output-type u|b|v|z[0-9]  u/b: un/compressed BCF, v/z: un/compressed VCF, 0-9: compression level [v]
+    -r, --regions REGION            Restrict to comma-separated list of regions
+    -R, --regions-file FILE         Restrict to regions listed in a file
+        --regions-overlap 0|1|2     Include if POS in the region (0), record overlaps (1), variant overlaps (2) [1]
+    -s, --strict-filter             When merging (-m+), merged site is PASS only if all sites being merged PASS
+    -t, --targets REGION            Similar to -r but streams rather than index-jumps
+    -T, --targets-file FILE         Similar to -R but streams rather than index-jumps
+        --targets-overlap 0|1|2     Include if POS in the region (0), record overlaps (1), variant overlaps (2) [0]
+        --threads INT               Use multithreading with <int> worker threads [0]
+    -w, --site-win INT              Buffer for sorting lines which changed position during realignment [1000]
+
+Examples:
+   # normalize and left-align indels
+   bcftools norm -f ref.fa in.vcf
+
+   # split multi-allelic sites
+   bcftools norm -m- in.vcf
+

src/bcftools/bcftools_norm/script.sh

@@ -0,0 +1,49 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+# Exit on error
+set -eo pipefail
+
+# Unset parameters
+unset_if_false=(
+    par_atomize
+    par_remove_duplicates
+    par_force
+    par_no_version
+    par_do_not_normalize
+    par_strict_filter
+)
+
+for par in ${unset_if_false[@]}; do
+    test_val="${!par}"
+    [[ "$test_val" == "false" ]] && unset $par
+done
+
+# Execute bcftools norm with the provided arguments
+bcftools norm \
+    ${par_atomize:+--atomize} \
+    ${par_atom_overlaps:+--atom-overlaps "$par_atom_overlaps"} \
+    ${par_check_ref:+-c "$par_check_ref"} \
+    ${par_remove_duplicates:+-d "$par_remove_duplicates"} \
+    ${par_fasta_ref:+-f "$par_fasta_ref"} \
+    ${par_force:+--force} \
+    ${par_keep_sum:+--keep-sum "$par_keep_sum"} \
+    ${par_multiallelics:+-m "$par_multiallelics"} \
+    ${par_no_version:+--no-version} \
+    ${par_do_not_normalize:+-N} \
+    ${par_old_rec_tag:+--old-rec-tag "$par_old_rec_tag"} \
+    ${par_regions:+-r "$par_regions"} \
+    ${par_regions_file:+-R "$par_regions_file"} \
+    ${par_regions_overlap:+--regions-overlap "$par_regions_overlap"} \
+    ${par_site_win:+-w "$par_site_win"} \
+    ${par_strict_filter:+-s} \
+    ${par_targets:+-t "$par_targets"} \
+    ${par_targets_file:+-T "$par_targets_file"} \
+    ${par_targets_overlap:+--targets-overlap "$par_targets_overlap"} \
+    ${meta_cpus:+--threads "$meta_cpus"} \
+    ${par_output_type:+-O "$par_output_type"} \
+    -o $par_output \
+    $par_input
+    

src/bcftools/bcftools_norm/test.sh

@@ -0,0 +1,231 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+# Exit on error
+set -eo pipefail
+
+#test_data="$meta_resources_dir/test_data"
+
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
+}
+assert_identical_content() {
+  diff -a "$2" "$1" \
+    || (echo "Files are not identical!" && exit 1)
+}
+#############################################
+
+# Create directories for tests
+echo "Creating Test Data..."
+TMPDIR=$(mktemp -d "$meta_temp_dir/XXXXXX")
+function clean_up {
+  [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
+}
+trap clean_up EXIT
+
+# Create test data
+cat <<EOF > "$TMPDIR/example.vcf"
+##fileformat=VCFv4.1
+##contig=<ID=1,length=249250621,assembly=b37>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	SAMPLE1
+1	752567	llama	G	C,A	.	.	.	.	1/2
+1	752722	.	G	A,AAA	.	.	.	.	./.
+EOF
+
+bgzip -c $TMPDIR/example.vcf > $TMPDIR/example.vcf.gz
+tabix -p vcf $TMPDIR/example.vcf.gz
+
+cat <<EOF > "$TMPDIR/reference.fa"
+>1
+ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
+>2
+CGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT
+EOF
+
+# Test 1: Remove ID annotations
+mkdir "$TMPDIR/test1" && pushd "$TMPDIR/test1" > /dev/null
+
+echo "> Run bcftools_norm"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --atomize \
+  --atom_overlaps "." \
+  &> /dev/null
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "bcftools_normCommand=norm --atomize --atom-overlaps . -o normalized.vcf ../example.vcf"
+echo "- test1 succeeded -"
+
+popd > /dev/null
+
+# Test 2: Check reference
+mkdir "$TMPDIR/test2" && pushd "$TMPDIR/test2" > /dev/null
+
+echo "> Run bcftools_norm with remove duplicates"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --atomize \
+  --remove_duplicates 'all' \
+  &> /dev/null
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm --atomize -d all -o normalized.vcf ../example.vcf"
+echo "- test2 succeeded -"
+
+popd > /dev/null
+
+# Test 3: Check reference and fasta reference
+mkdir "$TMPDIR/test3" && pushd "$TMPDIR/test3" > /dev/null
+
+echo "> Run bcftools_norm with check reference and fasta reference"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --atomize \
+  --fasta_ref "../reference.fa" \
+  --check_ref "e" \
+  &> /dev/null
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm --atomize -c e -f ../reference.fa -o normalized.vcf ../example.vcf"
+echo "- test3 succeeded -"
+
+popd > /dev/null
+
+# Test 4: Multiallelics
+mkdir "$TMPDIR/test4" && pushd "$TMPDIR/test4" > /dev/null
+
+echo "> Run bcftools_norm with multiallelics"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --multiallelics "-any" \
+  --old_rec_tag "wazzaaa" \
+  &> /dev/null
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm -m -any --old-rec-tag wazzaaa -o normalized.vcf ../example.vcf"
+echo "- test4 succeeded -"
+
+popd > /dev/null
+
+# Test 5: Regions
+mkdir "$TMPDIR/test5" && pushd "$TMPDIR/test5" > /dev/null
+
+echo "> Run bcftools_norm with regions"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --output "normalized.vcf" \
+  --atomize \
+  --regions "1:752567-752722" \
+  &> /dev/null
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm --atomize -r 1:752567-752722 -o normalized.vcf ../example.vcf.gz"
+echo "- test5 succeeded -"
+
+popd > /dev/null
+
+# Test 6: Targets
+mkdir "$TMPDIR/test6" && pushd "$TMPDIR/test6" > /dev/null
+
+echo "> Run bcftools_norm with targets"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --atomize \
+  --targets "1:752567-752722" \
+  &> /dev/null
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm --atomize -t 1:752567-752722 -o normalized.vcf ../example.vcf"
+echo "- test6 succeeded -"
+
+popd > /dev/null
+
+# Test 7: Regions overlap
+mkdir "$TMPDIR/test7" && pushd "$TMPDIR/test7" > /dev/null
+
+echo "> Run bcftools_norm with regions overlap"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --atomize \
+  --regions_overlap "pos" \
+  &> /dev/null
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm --atomize --regions-overlap pos -o normalized.vcf ../example.vcf"
+echo "- test7 succeeded -"
+
+popd > /dev/null
+
+# Test 8: Strict filter and targets overlap
+mkdir "$TMPDIR/test8" && pushd "$TMPDIR/test8" > /dev/null
+
+echo "> Run bcftools_norm with strict filter and targets overlap"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --atomize \
+  --strict_filter \
+  --targets_overlap "1" \
+  &> /dev/null
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm --atomize -s --targets-overlap 1 -o normalized.vcf ../example.vcf"
+echo "- test8 succeeded -"
+
+popd > /dev/null
+
+# Test 9: Do not normalize
+mkdir "$TMPDIR/test9" && pushd "$TMPDIR/test9" > /dev/null
+
+echo "> Run bcftools_norm with do not normalize"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "normalized.vcf" \
+  --do_not_normalize \
+  --atomize \
+  &> /dev/null
+
+# checks
+assert_file_exists "normalized.vcf"
+assert_file_not_empty "normalized.vcf"
+assert_file_contains "normalized.vcf" "norm --atomize -N -o normalized.vcf ../example.vcf"
+echo "- test9 succeeded -"
+
+popd > /dev/null
+
+echo "---- All tests succeeded! ----"
+exit 0
+
+

src/bcftools/bcftools_stats/config.vsh.yaml

@@ -0,0 +1,240 @@
+name: bcftools_stats
+namespace: bcftools
+description: | 
+  Parses VCF or BCF and produces a txt stats file which can be plotted using plot-vcfstats.
+  When two files are given, the program generates separate stats for intersection
+  and the complements. By default only sites are compared, -s/-S must given to include
+  also sample columns.
+keywords: [Stats, VCF, BCF]
+links:
+  homepage: https://samtools.github.io/bcftools/
+  documentation: https://samtools.github.io/bcftools/bcftools.html#stats
+  repository: https://github.com/samtools/bcftools
+  issue_tracker: https://github.com/samtools/bcftools/issues
+references:
+  doi: https://doi.org/10.1093/gigascience/giab008
+license: MIT/Expat, GNU
+requirements:
+  commands: [bcftools]
+authors:
+  - __merge__: /src/_authors/theodoro_gasperin.yaml
+    roles: [ author ]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --input
+        alternatives: -i
+        type: file
+        multiple: true
+        description: Input VCF/BCF file. Maximum of two files.
+        required: true
+    
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: -o
+        direction: output
+        type: file
+        description: Output txt statistics file.
+        required: true
+         
+  - name: Options
+    arguments:
+      
+      - name: --allele_frequency_bins
+        alternatives: --af_bins
+        type: string
+        description: | 
+          Allele frequency bins, a list of bin values (0.1,0.5,1).
+        example: 0.1,0.5,1
+
+      - name: --allele_frequency_bins_file
+        alternatives: --af_bins_file
+        type: file
+        description: | 
+          Same as allele_frequency_bins, but in a file.
+          Format of file is one value per line. 
+          e.g. 
+            0.1
+            0.5
+            1
+
+      - name: --allele_frequency_tag
+        alternatives: --af_tag
+        type: string
+        description: | 
+          Allele frequency tag to use, by default estimated from AN,AC or GT.
+
+      - name: --first_allele_only
+        alternatives: --first_only
+        type: boolean_true
+        description: | 
+          Include only 1st allele at multiallelic sites.
+
+      - name: --collapse
+        alternatives: --c
+        type: string
+        choices: [ snps, indels, both, all, some, none ]
+        description: | 
+          Treat as identical records with <snps|indels|both|all|some|none>.
+          See https://samtools.github.io/bcftools/bcftools.html#common_options for details.
+
+      - name: --depth
+        alternatives: --d
+        type: string
+        description: | 
+          Depth distribution: min,max,bin size.
+        example: 0,500,1
+
+      - name: --exclude
+        alternatives: --e
+        type: string
+        description: | 
+          Exclude sites for which the expression is true.
+          See https://samtools.github.io/bcftools/bcftools.html#expressions for details.
+        example: 'QUAL < 30 && DP < 10'
+
+      - name: --exons
+        alternatives: --E
+        type: file
+        description: | 
+          tab-delimited file with exons for indel frameshifts statistics. 
+          The columns of the file are CHR, FROM, TO, with 1-based, inclusive, positions. 
+          The file is BGZF-compressed and indexed with tabix (e.g. tabix -s1 -b2 -e3 file.gz).
+
+      - name: --apply_filters
+        alternatives: --f
+        type: string
+        description: | 
+          Require at least one of the listed FILTER strings (e.g. "PASS,.").
+
+      - name: --fasta_reference
+        alternatives: --F
+        type: file
+        description: | 
+          Faidx indexed reference sequence file to determine INDEL context.
+
+      - name: --include
+        alternatives: --i
+        type: string
+        description: | 
+          Select sites for which the expression is true.
+          See https://samtools.github.io/bcftools/bcftools.html#expressions for details.
+        example: 'QUAL >= 30 && DP >= 10'
+      
+      - name: --split_by_ID
+        alternatives: --I
+        type: boolean_true
+        description: | 
+          Collect stats for sites with ID separately (known vs novel).
+
+      - name: --regions
+        alternatives: --r
+        type: string
+        description: | 
+          Restrict to comma-separated list of regions. 
+          Following formats are supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].
+        example: '20:1000000-2000000'
+
+      - name: --regions_file
+        alternatives: --R
+        type: file
+        description: | 
+          Restrict to regions listed in a file. 
+          Regions can be specified either on a VCF, BED, or tab-delimited file (the default). 
+          For more information check manual.
+
+      - name: --regions_overlap
+        type: string
+        choices: ['pos', 'record', 'variant', '0', '1', '2']
+        description: | 
+          This option controls how overlapping records are determined: 
+          set to 'pos' or '0' if the VCF record has to have POS inside a region (this corresponds to the default behavior of -t/-T); 
+          set to 'record' or '1' if also overlapping records with POS outside a region should be included (this is the default behavior of -r/-R, 
+          and includes indels with POS at the end of a region, which are technically outside the region); 
+          or set to 'variant' or '2' to include only true overlapping variation (compare the full VCF representation "TA>T-" vs the true sequence variation "A>-").
+
+      - name: --samples
+        alternatives: --s
+        type: string
+        description: | 
+          List of samples for sample stats, "-" to include all samples.
+
+      - name: --samples_file
+        alternatives: --S
+        type: file
+        description: | 
+          File of samples to include.
+          e.g. 
+            sample1    1
+            sample2    2
+            sample3    2
+
+      - name: --targets
+        alternatives: --t
+        type: string
+        description: | 
+          Similar as -r, --regions, but the next position is accessed by streaming the whole VCF/BCF 
+          rather than using the tbi/csi index. Both -r and -t options can be applied simultaneously: -r uses the 
+          index to jump to a region and -t discards positions which are not in the targets. Unlike -r, targets 
+          can be prefixed with "^" to request logical complement. For example, "^X,Y,MT" indicates that 
+          sequences X, Y and MT should be skipped. Yet another difference between the -t/-T and -r/-R is 
+          that -r/-R checks for proper overlaps and considers both POS and the end position of an indel, 
+          while -t/-T considers the POS coordinate only (by default; see also --regions-overlap and --targets-overlap). 
+          Note that -t cannot be used in combination with -T.
+          Following formats are supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].
+        example: '20:1000000-2000000'
+      
+      - name: --targets_file
+        alternatives: --T
+        type: file
+        description: | 
+          Similar to --regions_file option but streams rather than index-jumps.
+
+      - name: --targets_overlaps
+        type: string
+        choices: ['pos', 'record', 'variant', '0', '1', '2']
+        description: | 
+          Include if POS in the region (0), record overlaps (1), variant overlaps (2).
+
+      - name: --user_tstv
+        alternatives: --u
+        type: string
+        description: | 
+          Collect Ts/Tv stats for any tag using the given binning [0:1:100].
+          Format is <TAG[:min:max:n]>.
+          A subfield can be selected as e.g. 'PV4[0]', here the first value of the PV4 tag.
+          
+      
+      - name: --verbose 
+        alternatives: --v
+        type: boolean_true
+        description: | 
+          Produce verbose per-site and per-sample output.
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+
+engines:
+  - type: docker
+    image: debian:stable-slim
+    setup:
+      - type: apt
+        packages: [bcftools, procps]
+      - type: docker
+        run: |
+          echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftools //p')\"" > /var/software_versions.txt
+    test_setup:  
+      - type: apt  
+        packages: [tabix]
+
+runners:
+  - type: executable
+  - type: nextflow
+

src/bcftools/bcftools_stats/help.txt

@@ -0,0 +1,35 @@
+```
+bcftools stats -h
+```
+
+About:   Parses VCF or BCF and produces stats which can be plotted using plot-vcfstats.
+         When two files are given, the program generates separate stats for intersection
+         and the complements. By default only sites are compared, -s/-S must given to include
+         also sample columns.
+Usage:   bcftools stats [options] <A.vcf.gz> [<B.vcf.gz>]
+
+Options:
+        --af-bins LIST               Allele frequency bins, a list (0.1,0.5,1) or a file (0.1\n0.5\n1)
+        --af-tag STRING              Allele frequency tag to use, by default estimated from AN,AC or GT
+    -1, --1st-allele-only            Include only 1st allele at multiallelic sites
+    -c, --collapse STRING            Treat as identical records with <snps|indels|both|all|some|none>, see man page for details [none]
+    -d, --depth INT,INT,INT          Depth distribution: min,max,bin size [0,500,1]
+    -e, --exclude EXPR               Exclude sites for which the expression is true (see man page for details)
+    -E, --exons FILE.gz              Tab-delimited file with exons for indel frameshifts (chr,beg,end; 1-based, inclusive, bgzip compressed)
+    -f, --apply-filters LIST         Require at least one of the listed FILTER strings (e.g. "PASS,.")
+    -F, --fasta-ref FILE             Faidx indexed reference sequence file to determine INDEL context
+    -i, --include EXPR               Select sites for which the expression is true (see man page for details)
+    -I, --split-by-ID                Collect stats for sites with ID separately (known vs novel)
+    -r, --regions REGION             Restrict to comma-separated list of regions
+    -R, --regions-file FILE          Restrict to regions listed in a file
+        --regions-overlap 0|1|2      Include if POS in the region (0), record overlaps (1), variant overlaps (2) [1]
+    -s, --samples LIST               List of samples for sample stats, "-" to include all samples
+    -S, --samples-file FILE          File of samples to include
+    -t, --targets REGION             Similar to -r but streams rather than index-jumps
+    -T, --targets-file FILE          Similar to -R but streams rather than index-jumps
+        --targets-overlap 0|1|2      Include if POS in the region (0), record overlaps (1), variant overlaps (2) [0]
+    -u, --user-tstv TAG[:min:max:n]  Collect Ts/Tv stats for any tag using the given binning [0:1:100]
+                                       A subfield can be selected as e.g. 'PV4[0]', here the first value of the PV4 tag
+        --threads INT                Use multithreading with <int> worker threads [0]
+    -v, --verbose                    Produce verbose per-site and per-sample output
+

src/bcftools/bcftools_stats/script.sh

@@ -0,0 +1,56 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+# Exit on error
+set -eo pipefail
+
+# Unset parameters
+unset_if_false=(
+    par_first_allele_only
+    par_split_by_ID
+    par_verbose 
+)
+
+for par in ${unset_if_false[@]}; do
+    test_val="${!par}"
+    [[ "$test_val" == "false" ]] && unset $par
+done
+
+# Create input array 
+IFS=";" read -ra input <<< $par_input
+
+# Check the size of the input array
+if [[ ${#input[@]} -gt 2 ]]; then
+    echo "Error: --input only takes a max of two files!"
+    exit 1
+fi
+
+# Execute bcftools stats with the provided arguments
+bcftools stats \
+    ${par_first_allele_only:+--1st-allele-only} \
+    ${par_split_by_ID:+--split-by-ID} \
+    ${par_verbose:+--verbose} \
+    ${par_allele_frequency_bins:+--af-bins "${par_allele_frequency_bins}"} \
+    ${par_allele_frequency_bins_file:+--af-bins "${par_allele_frequency_bins_file}"} \
+    ${par_allele_frequency_tag:+--af-tag "${par_allele_frequency_tag}"} \
+    ${par_collapse:+-c "${par_collapse}"} \
+    ${par_depth:+-d "${par_depth}"} \
+    ${par_exclude:+-e "${par_exclude}"} \
+    ${par_exons:+-E "${par_exons}"} \
+    ${par_apply_filters:+-f "${par_apply_filters}"} \
+    ${par_fasta_reference:+-F "${par_fasta_reference}"} \
+    ${par_include:+-i "${par_include}"} \
+    ${par_regions:+-r "${par_regions}"} \
+    ${par_regions_file:+-R "${par_regions_file}"} \
+    ${par_regions_overlap:+--regions-overlap "${par_regions_overlap}"} \
+    ${par_samples:+-s "${par_samples}"} \
+    ${par_samples_file:+-S "${par_samples_file}"} \
+    ${par_targets:+-t "${par_targets}"} \
+    ${par_targets_file:+-T "${par_targets_file}"} \
+    ${par_targets_overlaps:+--targets-overlap "${par_targets_overlaps}"} \
+    ${par_user_tstv:+-u "${par_user_tstv}"} \
+    "${input[@]}" \
+    > $par_output
+

src/bcftools/bcftools_stats/test.sh

@@ -0,0 +1,306 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+# Exit on error
+set -eo pipefail
+
+#test_data="$meta_resources_dir/test_data"
+
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
+}
+assert_identical_content() {
+  diff -a "$2" "$1" \
+    || (echo "Files are not identical!" && exit 1)
+}
+#############################################
+
+# Create directories for tests
+echo "Creating Test Data..."
+TMPDIR=$(mktemp -d "$meta_temp_dir/XXXXXX")
+function clean_up {
+  [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
+}
+trap clean_up EXIT
+
+# Create test data
+cat <<EOF > "$TMPDIR/example.vcf"
+##fileformat=VCFv4.0
+##fileDate=20090805
+##source=myImputationProgramV3.1
+##reference=1000GenomesPilot-NCBI36
+##contig=<ID=19,length=58617616>
+##contig=<ID=20,length=58617616>
+##phasing=partial
+##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency">
+##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele">
+##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129">
+##INFO=<ID=H2,Number=0,Type=Flag,Description="HapMap2 membership">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=s50,Description="Less than 50% of samples have data">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality">
+##ALT=<ID=DEL:ME:ALU,Description="Deletion of ALU element">
+##ALT=<ID=CNV,Description="Copy number variable region">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	NA00001	NA00002	NA00003
+19	111	.	A	C	9.6	.	.	GT:HQ	0|0:10,10	0|0:10,10	0/1:3,3
+19	112	.	A	G	10	.	.	GT:HQ	0|0:10,10	0|0:10,10	0/1:3,3
+20	14370	rs6054257	G	A	29	PASS	NS=3;DP=14;AF=0.5;DB;H2	GT:GQ:DP:HQ	0|0:48:1:51,51	1|0:48:8:51,51	1/1:43:5:.,.
+20	17330	.	T	A	3	q10	NS=3;DP=11;AF=0.017	GT:GQ:DP:HQ	0|0:49:3:58,50	0|1:3:5:65,3	0/0:41:3:.,.
+20	1110696	rs6040355	A	G,T	67	PASS	NS=2;DP=10;AF=0.333,0.667;AA=T;DB	GT:GQ:DP:HQ	1|2:21:6:23,27	2|1:2:0:18,2	2/2:35:4:.,.
+20	1230237	.	T	.	47	PASS	NS=3;DP=13;AA=T	GT:GQ:DP:HQ	0|0:54:.:56,60	0|0:48:4:51,51	0/0:61:2:.,.
+20	1234567	microsat1	G	GA,GAC	50	PASS	NS=3;DP=9;AA=G;AN=6;AC=3,1	GT:GQ:DP	0/1:.:4	0/2:17:2	1/1:40:3
+20	1235237	.	T	.	.	.	.	GT	0/0	0|0	./.
+EOF
+
+bgzip -c $TMPDIR/example.vcf > $TMPDIR/example.vcf.gz
+tabix -p vcf $TMPDIR/example.vcf.gz
+
+cat <<EOF > "$TMPDIR/exons.bed"
+chr19	12345	12567
+chr20	23456	23789
+EOF
+
+# Compressing and indexing the exons file
+bgzip -c $TMPDIR/exons.bed > $TMPDIR/exons.bed.gz
+tabix -s1 -b2 -e3 $TMPDIR/exons.bed.gz
+
+# Create fai test file
+# cat <<EOF > "$TMPDIR/reference.fasta.fai"
+# 19	100	895464957	60	61
+# 20	10000	1083893029	60	61
+# EOF
+
+# Create allele frequency bins file
+cat <<EOF > "$TMPDIR/allele_frequency_bins.txt"
+0.1
+0.2
+0.3
+0.4
+0.5
+0.6
+0.7
+0.8
+0.9
+EOF
+
+# Test 1: Default Use
+mkdir "$TMPDIR/test1" && pushd "$TMPDIR/test1" > /dev/null
+
+echo "> Run bcftools_stats on VCF file"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "stats.txt" \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  ../example.vcf"
+echo "- test1 succeeded -"
+
+popd > /dev/null
+
+# Test 2: First allele only
+mkdir "$TMPDIR/test2" && pushd "$TMPDIR/test2" > /dev/null
+
+echo "> Run bcftools_stats on VCF file with first allele only"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "stats.txt" \
+  --first_allele_only \
+  --allele_frequency_bins "0.1,0.2,0.3,0.4,0.5,0.6,0.7,0.8,0.9" \
+  --allele_frequency_tag "AF" \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  --1st-allele-only --af-bins 0.1,0.2,0.3,0.4,0.5,0.6,0.7,0.8,0.9 --af-tag AF ../example.vcf"
+echo "- test2 succeeded -"
+
+popd > /dev/null
+
+# Test 3: Split by ID
+mkdir "$TMPDIR/test3" && pushd "$TMPDIR/test3" > /dev/null
+
+echo "> Run bcftools_stats on VCF file with split by ID"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "stats.txt" \
+  --split_by_ID \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  --split-by-ID ../example.vcf"
+echo "- test3 succeeded -"
+
+popd > /dev/null
+
+# Test 4: Collapse, Depth, Exclude
+mkdir "$TMPDIR/test4" && pushd "$TMPDIR/test4" > /dev/null
+
+echo "> Run bcftools_stats on VCF file with collapse, depth, and exclude"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "stats.txt" \
+  --depth "0,500,1" \
+  --exclude "GT='mis'" \
+  --collapse "snps" \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  -c snps -d 0,500,1 -e GT='mis' ../example.vcf"
+echo "- test4 succeeded -"
+
+popd > /dev/null
+
+# Test 5: Exons, Apply Filters
+mkdir "$TMPDIR/test5" && pushd "$TMPDIR/test5" > /dev/null
+
+echo "> Run bcftools_stats on VCF file with exons, apply filters, and fasta reference"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "stats.txt" \
+  --exons "../exons.bed.gz" \
+  --apply_filters "PASS" \
+#  --fasta_reference "../reference.fasta.fai" \
+
+# NOTE: fasta_reference option not included in testing because of error from bcftools stats.
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  -E ../exons.bed.gz -f PASS ../example.vcf"
+#assert_file_contains "stats.txt" "bcftools stats  -E ../exons.bed.gz -f PASS -F ../reference.fasta.fai ../example.vcf"
+echo "- test5 succeeded -"
+
+popd > /dev/null
+
+# Test 6: Include, Regions
+mkdir "$TMPDIR/test6" && pushd "$TMPDIR/test6" > /dev/null
+
+echo "> Run bcftools_stats on VCF file with include and regions options"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --output "stats.txt" \
+  --include "GT='mis'" \
+  --regions "20:1000000-2000000" \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  -i GT='mis' -r 20:1000000-2000000 ../example.vcf.gz"
+echo "- test6 succeeded -"
+
+popd > /dev/null
+
+# Test 7: Regions Overlap, Samples
+mkdir "$TMPDIR/test7" && pushd "$TMPDIR/test7" > /dev/null
+
+echo "> Run bcftools_stats on VCF file with regions overlap, and samples options"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "stats.txt" \
+  --regions_overlap "record" \
+  --samples "NA00001,NA00002" \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  --regions-overlap record -s NA00001,NA00002 ../example.vcf"
+echo "- test7 succeeded -"
+
+popd > /dev/null
+
+# Test 8: Targets, Targets File, Targets Overlaps
+mkdir "$TMPDIR/test8" && pushd "$TMPDIR/test8" > /dev/null
+
+echo "> Run bcftools_stats on VCF file with targets, targets file, and targets overlaps"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "stats.txt" \
+  --targets "20:1000000-2000000" \
+  --targets_overlaps "pos" \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  -t 20:1000000-2000000 --targets-overlap pos ../example.vcf"
+echo "- test8 succeeded -"
+
+popd > /dev/null
+
+# Test 9: User TSTV and Verbose
+mkdir "$TMPDIR/test9" && pushd "$TMPDIR/test9" > /dev/null
+
+echo "> Run bcftools_stats on VCF file with user TSTV and verbose"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "stats.txt" \
+  --user_tstv "DP" \
+  --verbose \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  --verbose -u DP ../example.vcf"
+echo "- test9 succeeded -"
+
+popd > /dev/null
+
+# Test 10: Two vcf files
+mkdir "$TMPDIR/test10" && pushd "$TMPDIR/test10" > /dev/null
+
+echo "> Run bcftools_stats on two VCF files"
+"$meta_executable" \
+  --input "../example.vcf.gz" \
+  --input "../example.vcf.gz" \
+  --output "stats.txt" \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  ../example.vcf.gz ../example.vcf.gz"
+echo "- test10 succeeded -"
+
+popd > /dev/null
+
+# Test 11: with allele frequency bins file option
+mkdir "$TMPDIR/test11" && pushd "$TMPDIR/test11" > /dev/null
+
+echo "> Run bcftools_stats on VCF file with allele frequency bins file option"
+"$meta_executable" \
+  --input "../example.vcf" \
+  --output "stats.txt" \
+  --allele_frequency_bins "../allele_frequency_bins.txt" \
+
+# checks
+assert_file_exists "stats.txt"
+assert_file_not_empty "stats.txt"
+assert_file_contains "stats.txt" "bcftools stats  --af-bins ../allele_frequency_bins.txt ../example.vcf"
+echo "- test11 succeeded -"
+
+popd > /dev/null
+
+
+echo "---- All tests succeeded! ----"
+exit 0
+
+

src/trimgalore/config.vsh.yaml

@@ -42,8 +42,20 @@ argument_groups:
         description: Run FastQC in the default mode on the FastQ file once trimming is complete.
       - name: --fastqc_args
         type: string
-        description: Passes extra arguments to FastQC. If more than one argument is to be passed to FastQC they must be in the form "arg1 arg2 ...". Passing extra arguments will automatically invoke FastQC, so --fastqc does not have to be specified separately.
-        example: "--nogroup --outdir /home/"
+        description: Passes extra arguments (excluding files) to FastQC. If more than one argument is to be passed to FastQC they must be in the form "arg1 arg2 ...". Passing extra arguments will automatically invoke FastQC, so --fastqc does not have to be specified separately.
+        example: "--nogroup --noextract"
+      - name: --fastqc_contaminants
+        type: file
+        description: Specifies a non-default file which contains the list of contaminants for FastQC to screen overrepresented sequences against. The file must contain sets of named contaminants in the form name[tab]sequence. Lines prefixed with a hash will be ignored.
+        example: "contaminants.txt"
+      - name: --fastqc_adapters
+        type: file
+        description: Specifies a non-default file which contains the list of adapter sequences which which FasstQC will explicity search against the library. The file must contain sets of named adapters in the form name[tab]sequence.  Lines prefixed with a hash will be ignored.
+        example: "adapters.txt"
+      - name: --fastqc_limits
+        type: file
+        description: Specifies a non-default file which contains a set of criteria which FastQC will use to determine the warn/error limits for the various modules. This file can also be used to selectively remove some modules from the output all together.  The format needs to mirror the default limits.txt file found in the Configuration folder.
+        example: "limits.txt"
       - name: --adapter
         alternatives: -a
         type: string
@@ -201,7 +213,7 @@ argument_groups:
         type: file
         description: If specified all output will be written to this directory instead of the current directory. 
         direction: output
-        required: false
+        required: true
         default: trimmed_output
       - name: --trimmed_r1
         type: file

src/trimgalore/script.sh

@@ -34,12 +34,24 @@ for par in ${unset_if_false[@]}; do
     [[ "$test_val" == "false" ]] && unset $par
 done
 
+# Add FastQC file arguments to fastqc_args
+fastqc_args="${par_fastqc_args}"
+if [ -f "$par_fastqc_contaminants" ]; then 
+    fastqc_args+=" --contaminants $par_fastqc_contaminants"
+fi
+if [ -f "$par_fastqc_adapters" ]; then 
+    fastqc_args+=" --adapters $par_fastqc_adapters"
+fi
+if [ -f "$par_fastqc_limits" ]; then 
+    fastqc_args+=" --limits $par_fastqc_limits"
+fi
+
 trim_galore \
     ${par_quality:+-q "${par_quality}"} \
     ${par_phred33:+--phred33} \
     ${par_phred64:+--phred64 } \
     ${par_fastqc:+--fastqc } \
-    ${par_fastqc_args:+--fastqc_args "${par_fastqc_args}"} \
+    ${fastqc_args:+--fastqc_args "${fastqc_args}"} \
     ${par_adapter:+-a "${par_adapter}"} \
     ${par_adapter2:+-a2 "${par_adapter2}"} \
     ${par_illumina:+--illumina} \

target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml

@@ -235,8 +235,8 @@ build_info:
   output: "target/executable/agat/agat_convert_bed2gff"
   executable: "target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff

@@ -515,9 +515,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_bed2gff"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:33Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:04Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml

@@ -225,8 +225,8 @@ build_info:
   output: "target/executable/agat/agat_convert_embl2gff"
   executable: "target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff

@@ -505,9 +505,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_embl2gff"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:33Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:04Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml

@@ -228,8 +228,8 @@ build_info:
   output: "target/executable/agat/agat_convert_sp_gff2gtf"
   executable: "target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf

@@ -519,9 +519,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2gtf"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:34Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:04Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml

@@ -188,8 +188,8 @@ build_info:
   output: "target/executable/agat/agat_convert_sp_gff2tsv"
   executable: "target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv

@@ -484,9 +484,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2tsv"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:33Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:03Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml

@@ -195,8 +195,8 @@ build_info:
   output: "target/executable/agat/agat_convert_sp_gxf2gxf"
   executable: "target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf

@@ -493,9 +493,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
 
 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gxf2gxf"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:32Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:03Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/arriba/.config.vsh.yaml

@@ -706,8 +706,8 @@ build_info:
   output: "target/executable/arriba"
   executable: "target/executable/arriba/arriba"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/arriba/arriba

@@ -754,9 +754,9 @@ RUN arriba -h | grep 'Version:' 2>&1 |  sed 's/Version:\s\(.*\)/arriba: "\1"/' >
 
 LABEL org.opencontainers.image.authors="Robrecht Cannoodt"
 LABEL org.opencontainers.image.description="Companion container for running component arriba"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:36Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:07Z"
 LABEL org.opencontainers.image.source="https://github.com/suhrig/arriba"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bcftools/bcftools_annotate/.config.vsh.yaml

@@ -0,0 +1,495 @@
+name: "bcftools_annotate"
+namespace: "bcftools"
+version: "add_trimgalore"
+authors:
+- name: "Theodoro Gasperin Terra Camargo"
+  roles:
+  - "author"
+  info:
+    links:
+      email: "theodorogtc@gmail.com"
+      github: "tgaspe"
+      linkedin: "theodoro-gasperin-terra-camargo"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--input"
+    alternatives:
+    - "-i"
+    description: "Input VCF/BCF file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: true
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    description: "Output annotated file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Options"
+  description: "For examples on how to use use bcftools annotate see http://samtools.github.io/bcftools/howtos/annotate.html.\n\
+    For more details on the options see https://samtools.github.io/bcftools/bcftools.html#annotate.\n"
+  arguments:
+  - type: "file"
+    name: "--annotations"
+    alternatives:
+    - "--a"
+    description: "VCF file or tabix-indexed FILE with annotations: CHR\\tPOS[\\tVALUE]+\
+      \ . \n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--columns"
+    alternatives:
+    - "--c"
+    description: "List of columns in the annotation file, e.g. CHROM,POS,REF,ALT,-,INFO/TAG.\
+      \ \nSee man page for details.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--columns_file"
+    alternatives:
+    - "--C"
+    description: "Read -c columns from FILE, one name per row, with optional --merge_logic\
+      \ TYPE: NAME[ TYPE].\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--exclude"
+    alternatives:
+    - "--e"
+    description: "Exclude sites for which the expression is true.\nSee https://samtools.github.io/bcftools/bcftools.html#expressions\
+      \ for details.\n"
+    info: null
+    example:
+    - "QUAL >= 30 && DP >= 10"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--force"
+    description: "continue even when parsing errors, such as undefined tags, are encountered.\
+      \ \nNote this can be an unsafe operation and can result in corrupted BCF files.\
+      \ \nIf this option is used, make sure to sanity check the result thoroughly.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--header_line"
+    alternatives:
+    - "--H"
+    description: "Header line which should be appended to the VCF header, can be given\
+      \ multiple times.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--header_lines"
+    alternatives:
+    - "--h"
+    description: "File with header lines to append to the VCF header.\nFor example:\n\
+      \  ##INFO=<ID=NUMERIC_TAG,Number=1,Type=Integer,Description=\"Example header\
+      \ line\">\n  ##INFO=<ID=STRING_TAG,Number=1,Type=String,Description=\"Yet another\
+      \ header line\">\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--set_id"
+    alternatives:
+    - "--I"
+    description: "Set ID column using a `bcftools query`-like expression, see man\
+      \ page for details.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--include"
+    description: "Select sites for which the expression is true.\nSee https://samtools.github.io/bcftools/bcftools.html#expressions\
+      \ for details.\n"
+    info: null
+    example:
+    - "QUAL >= 30 && DP >= 10"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--keep_sites"
+    alternatives:
+    - "--k"
+    description: "Leave --include/--exclude sites unchanged instead of discarding\
+      \ them.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--merge_logic"
+    alternatives:
+    - "--l"
+    description: "When multiple regions overlap a single record, this option defines\
+      \ how to treat multiple annotation values.\nSee man page for more details.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--mark_sites"
+    alternatives:
+    - "--m"
+    description: "Annotate sites which are present (\"+\") or absent (\"-\") in the\
+      \ -a file with a new INFO/TAG flag.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--min_overlap"
+    description: "Minimum overlap required as a fraction of the variant in the annotation\
+      \ -a file (ANN), \nin the target VCF file (:VCF), or both for reciprocal overlap\
+      \ (ANN:VCF). \nBy default overlaps of arbitrary length are sufficient. \nThe\
+      \ option can be used only with the tab-delimited annotation -a file and with\
+      \ BEG and END columns present.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--no_version"
+    description: "Do not append version and command line information to the output\
+      \ VCF header.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--output_type"
+    alternatives:
+    - "--O"
+    description: "Output type:\n  u: uncompressed BCF\n  z: compressed VCF\n  b: compressed\
+      \ BCF\n  v: uncompressed VCF\n"
+    info: null
+    required: false
+    choices:
+    - "u"
+    - "z"
+    - "b"
+    - "v"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--pair_logic"
+    description: "Controls how to match records from the annotation file to the target\
+      \ VCF. \nEffective only when -a is a VCF or BCF file. \nThe option replaces\
+      \ the former uninuitive --collapse. \nSee Common Options for more.\n"
+    info: null
+    required: false
+    choices:
+    - "snps"
+    - "indels"
+    - "both"
+    - "all"
+    - "some"
+    - "exact"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--regions"
+    alternatives:
+    - "--r"
+    description: "Restrict to comma-separated list of regions. \nFollowing formats\
+      \ are supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].\n"
+    info: null
+    example:
+    - "20:1000000-2000000"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--regions_file"
+    alternatives:
+    - "--R"
+    description: "Restrict to regions listed in a file. \nRegions can be specified\
+      \ either on a VCF, BED, or tab-delimited file (the default). \nFor more information\
+      \ check manual.\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--regions_overlap"
+    description: "This option controls how overlapping records are determined: \n\
+      set to 'pos' or '0' if the VCF record has to have POS inside a region (this\
+      \ corresponds to the default behavior of -t/-T); \nset to 'record' or '1' if\
+      \ also overlapping records with POS outside a region should be included (this\
+      \ is the default behavior of -r/-R, \nand includes indels with POS at the end\
+      \ of a region, which are technically outside the region); \nor set to 'variant'\
+      \ or '2' to include only true overlapping variation (compare the full VCF representation\
+      \ \"TA>T-\" vs the true sequence variation \"A>-\").\n"
+    info: null
+    required: false
+    choices:
+    - "pos"
+    - "record"
+    - "variant"
+    - "0"
+    - "1"
+    - "2"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--rename_annotations"
+    description: "Rename annotations: TYPE/old\\tnew, where TYPE is one of FILTER,INFO,FORMAT.\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--rename_chromosomes"
+    description: "Rename chromosomes according to the map in file, with \"old_name\
+      \ new_name\\n\" pairs \nseparated by whitespaces, each on a separate line.\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--samples"
+    description: "Subset of samples to annotate.\nSee also https://samtools.github.io/bcftools/bcftools.html#common_options.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--samples_file"
+    description: "Subset of samples to annotate in file format.\nSee also https://samtools.github.io/bcftools/bcftools.html#common_options.\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--single_overlaps"
+    description: "Use this option to keep memory requirements low with very large\
+      \ annotation files. \nNote, however, that this comes at a cost, only single\
+      \ overlapping intervals are considered in this mode. \nThis was the default\
+      \ mode until the commit af6f0c9 (Feb 24 2019).\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--remove"
+    alternatives:
+    - "--x"
+    description: "List of annotations to remove. \nUse \"FILTER\" to remove all filters\
+      \ or \"FILTER/SomeFilter\" to remove a specific filter. \nSimilarly, \"INFO\"\
+      \ can be used to remove all INFO tags and \"FORMAT\" to remove all FORMAT tags\
+      \ except GT. \nTo remove all INFO tags except \"FOO\" and \"BAR\", use \"^INFO/FOO,INFO/BAR\"\
+      \ (and similarly for FORMAT and FILTER). \n\"INFO\" can be abbreviated to \"\
+      INF\" and \"FORMAT\" to \"FMT\".\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Add or remove annotations from a VCF/BCF file.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "Annotate"
+- "VCF"
+- "BCF"
+license: "MIT/Expat, GNU"
+references:
+  doi:
+  - "https://doi.org/10.1093/gigascience/giab008"
+links:
+  repository: "https://github.com/samtools/bcftools"
+  homepage: "https://samtools.github.io/bcftools/"
+  documentation: "https://samtools.github.io/bcftools/bcftools.html#annotate"
+  issue_tracker: "https://github.com/samtools/bcftools/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "debian:stable-slim"
+  target_registry: "images.viash-hub.com"
+  target_tag: "add_trimgalore"
+  namespace_separator: "/"
+  setup:
+  - type: "apt"
+    packages:
+    - "bcftools"
+    - "procps"
+    interactive: false
+  - type: "docker"
+    run:
+    - "echo \"bcftools: \\\"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftools\
+      \ //p')\\\"\" > /var/software_versions.txt\n"
+  test_setup:
+  - type: "apt"
+    packages:
+    - "tabix"
+    interactive: false
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/bcftools/bcftools_annotate/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/bcftools/bcftools_annotate"
+  executable: "target/executable/bcftools/bcftools_annotate/bcftools_annotate"
+  viash_version: "0.9.0-RC7"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
+package_config:
+  name: "biobox"
+  version: "add_trimgalore"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0-RC7"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'add_trimgalore'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"

target/executable/bcftools/bcftools_concat/.config.vsh.yaml

@@ -0,0 +1,361 @@
+name: "bcftools_concat"
+namespace: "bcftools"
+version: "add_trimgalore"
+authors:
+- name: "Theodoro Gasperin Terra Camargo"
+  roles:
+  - "author"
+  info:
+    links:
+      email: "theodorogtc@gmail.com"
+      github: "tgaspe"
+      linkedin: "theodoro-gasperin-terra-camargo"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--input"
+    alternatives:
+    - "-i"
+    description: "Input VCF/BCF files to concatenate."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: true
+    multiple_sep: ";"
+  - type: "file"
+    name: "--file_list"
+    alternatives:
+    - "-f"
+    description: "Read the list of VCF/BCF files from a file, one file name per line."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    description: "Output concatenated VCF/BCF file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Options"
+  arguments:
+  - type: "boolean_true"
+    name: "--allow_overlaps"
+    alternatives:
+    - "-a"
+    description: "First coordinate of the next file can precede last record of the\
+      \ current file.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--compact_PS"
+    alternatives:
+    - "-c"
+    description: "Do not output PS tag at each site, only at the start of a new phase\
+      \ set block.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--remove_duplicates"
+    alternatives:
+    - "-d"
+    description: "Output duplicate records present in multiple files only once: <snps|indels|both|all|exact>.\n\
+      \    \n"
+    info: null
+    required: false
+    choices:
+    - "snps"
+    - "indels"
+    - "both"
+    - "all"
+    - "exact"
+    - "none"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--ligate"
+    alternatives:
+    - "-l"
+    description: "Ligate phased VCFs by matching phase at overlapping haplotypes."
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--ligate_force"
+    description: "Ligate even non-overlapping chunks, keep all sites."
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--ligate_warn"
+    description: "Drop sites in imperfect overlaps."
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--no_version"
+    description: "Do not append version and command line information to the header."
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--naive"
+    alternatives:
+    - "-n"
+    description: "Concatenate files without recompression, a header check compatibility\
+      \ is performed."
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--naive_force"
+    description: "Same as --naive, but header compatibility is not checked. \nDangerous,\
+      \ use with caution.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--output_type"
+    alternatives:
+    - "-O"
+    description: "Output type:\n  u: uncompressed BCF\n  z: compressed VCF\n  b: compressed\
+      \ BCF\n  v: uncompressed VCF\n"
+    info: null
+    required: false
+    choices:
+    - "u"
+    - "z"
+    - "b"
+    - "v"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--min_PQ"
+    alternatives:
+    - "-q"
+    description: "Break phase set if phasing quality is lower than <int>."
+    info: null
+    example:
+    - 30
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--regions"
+    alternatives:
+    - "-r"
+    description: "Restrict to comma-separated list of regions. \nFollowing formats\
+      \ are supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].\n"
+    info: null
+    example:
+    - "20:1000000-2000000"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--regions_file"
+    alternatives:
+    - "-R"
+    description: "Restrict to regions listed in a file. \nRegions can be specified\
+      \ either on a VCF, BED, or tab-delimited file (the default). \nFor more information\
+      \ check manual.\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--regions_overlap"
+    description: "This option controls how overlapping records are determined: \n\
+      set to 'pos' or '0' if the VCF record has to have POS inside a region (this\
+      \ corresponds to the default behavior of -t/-T); \nset to 'record' or '1' if\
+      \ also overlapping records with POS outside a region should be included (this\
+      \ is the default behavior of -r/-R, \nand includes indels with POS at the end\
+      \ of a region, which are technically outside the region); \nor set to 'variant'\
+      \ or '2' to include only true overlapping variation (compare the full VCF representation\
+      \ \"TA>T-\" vs the true sequence variation \"A>-\").\n"
+    info: null
+    required: false
+    choices:
+    - "pos"
+    - "record"
+    - "variant"
+    - "0"
+    - "1"
+    - "2"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Concatenate or combine VCF/BCF files. All source files must have the\
+  \ same sample\ncolumns appearing in the same order. The program can be used, for\
+  \ example, to\nconcatenate chromosome VCFs into one VCF, or combine a SNP VCF and\
+  \ an indel\nVCF into one. The input files must be sorted by chr and position. The\
+  \ files\nmust be given in the correct order to produce sorted VCF on output unless\n\
+  the -a, --allow-overlaps option is specified. With the --naive option, the files\n\
+  are concatenated without being recompressed, which is very fast.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "Concatenate"
+- "VCF"
+- "BCF"
+license: "MIT/Expat, GNU"
+references:
+  doi:
+  - "https://doi.org/10.1093/gigascience/giab008"
+links:
+  repository: "https://github.com/samtools/bcftools"
+  homepage: "https://samtools.github.io/bcftools/"
+  documentation: "https://samtools.github.io/bcftools/bcftools.html#concat"
+  issue_tracker: "https://github.com/samtools/bcftools/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "debian:stable-slim"
+  target_registry: "images.viash-hub.com"
+  target_tag: "add_trimgalore"
+  namespace_separator: "/"
+  setup:
+  - type: "apt"
+    packages:
+    - "bcftools"
+    - "procps"
+    interactive: false
+  - type: "docker"
+    run:
+    - "echo \"bcftools: \\\"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftools\
+      \ //p')\\\"\" > /var/software_versions.txt\n"
+  test_setup:
+  - type: "apt"
+    packages:
+    - "tabix"
+    interactive: false
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/bcftools/bcftools_concat/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/bcftools/bcftools_concat"
+  executable: "target/executable/bcftools/bcftools_concat/bcftools_concat"
+  viash_version: "0.9.0-RC7"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
+package_config:
+  name: "biobox"
+  version: "add_trimgalore"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0-RC7"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'add_trimgalore'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"

target/executable/bcftools/bcftools_norm/.config.vsh.yaml

@@ -0,0 +1,442 @@
+name: "bcftools_norm"
+namespace: "bcftools"
+version: "add_trimgalore"
+authors:
+- name: "Theodoro Gasperin Terra Camargo"
+  roles:
+  - "author"
+  info:
+    links:
+      email: "theodorogtc@gmail.com"
+      github: "tgaspe"
+      linkedin: "theodoro-gasperin-terra-camargo"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--input"
+    alternatives:
+    - "-i"
+    description: "Input VCF/BCF file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    description: "Output normalized VCF/BCF file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Options"
+  arguments:
+  - type: "boolean_true"
+    name: "--atomize"
+    alternatives:
+    - "-a"
+    description: "Decompose complex variants (e.g., MNVs become consecutive SNVs).\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--atom_overlaps"
+    description: "Use the star allele (*) for overlapping alleles or set to missing\
+      \ (.).\n"
+    info: null
+    required: false
+    choices:
+    - "."
+    - "*"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--check_ref"
+    alternatives:
+    - "-c"
+    description: "Check REF alleles and exit (e), warn (w), exclude (x), or set (s)\
+      \ bad sites.\n"
+    info: null
+    required: false
+    choices:
+    - "e"
+    - "w"
+    - "x"
+    - "s"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--remove_duplicates"
+    alternatives:
+    - "-d"
+    description: "Remove duplicate snps, indels, both, all, exact matches, or none\
+      \ (old -D option)."
+    info: null
+    required: false
+    choices:
+    - "snps"
+    - "indels"
+    - "both"
+    - "all"
+    - "exact"
+    - "none"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--fasta_ref"
+    alternatives:
+    - "-f"
+    description: "Reference fasta sequence file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--force"
+    description: "Try to proceed even if malformed tags are encountered. \nExperimental,\
+      \ use at your own risk.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--keep_sum"
+    description: "Keep vector sum constant when splitting multiallelics (see github\
+      \ issue #360).\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--multiallelics"
+    alternatives:
+    - "-m"
+    description: "Split multiallelics (-) or join biallelics (+), type: snps, indels,\
+      \ both, any [default: both].\n"
+    info: null
+    required: false
+    choices:
+    - "+snps"
+    - "+indels"
+    - "+both"
+    - "+any"
+    - "-snps"
+    - "-indels"
+    - "-both"
+    - "-any"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--no_version"
+    description: "Do not append version and command line information to the header."
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--do_not_normalize"
+    alternatives:
+    - "-N"
+    description: "Do not normalize indels (with -m or -c s)."
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--output_type"
+    alternatives:
+    - "--O"
+    description: "Output type:\n  u: uncompressed BCF\n  z: compressed VCF\n  b: compressed\
+      \ BCF\n  v: uncompressed VCF\n"
+    info: null
+    required: false
+    choices:
+    - "u"
+    - "z"
+    - "b"
+    - "v"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--old_rec_tag"
+    description: "Annotate modified records with INFO/STR indicating the original\
+      \ variant."
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--regions"
+    alternatives:
+    - "--r"
+    description: "Restrict to comma-separated list of regions. \nFollowing formats\
+      \ are supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].\n"
+    info: null
+    example:
+    - "20:1000000-2000000"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--regions_file"
+    alternatives:
+    - "--R"
+    description: "Restrict to regions listed in a file. \nRegions can be specified\
+      \ either on a VCF, BED, or tab-delimited file (the default). \nFor more information\
+      \ check manual.\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--regions_overlap"
+    description: "This option controls how overlapping records are determined: \n\
+      set to 'pos' or '0' if the VCF record has to have POS inside a region (this\
+      \ corresponds to the default behavior of -t/-T); \nset to 'record' or '1' if\
+      \ also overlapping records with POS outside a region should be included (this\
+      \ is the default behavior of -r/-R, \nand includes indels with POS at the end\
+      \ of a region, which are technically outside the region); \nor set to 'variant'\
+      \ or '2' to include only true overlapping variation (compare the full VCF representation\
+      \ \"TA>T-\" vs the true sequence variation \"A>-\").\n"
+    info: null
+    required: false
+    choices:
+    - "pos"
+    - "record"
+    - "variant"
+    - "0"
+    - "1"
+    - "2"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "integer"
+    name: "--site_win"
+    alternatives:
+    - "-w"
+    description: "Buffer for sorting lines that changed position during realignment.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--strict_filter"
+    alternatives:
+    - "-s"
+    description: "When merging (-m+), merged site is PASS only if all sites being\
+      \ merged PASS."
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--targets"
+    alternatives:
+    - "-t"
+    description: "Similar to --regions but streams rather than index-jumps."
+    info: null
+    example:
+    - "20:1000000-2000000"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--targets_file"
+    alternatives:
+    - "-T"
+    description: "Similar to --regions_file but streams rather than index-jumps."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--targets_overlap"
+    description: "Include if POS in the region (0), record overlaps (1), variant overlaps\
+      \ (2).\nSimilar to --regions_overlap.\n"
+    info: null
+    required: false
+    choices:
+    - "pos"
+    - "record"
+    - "variant"
+    - "0"
+    - "1"
+    - "2"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Left-align and normalize indels, check if REF alleles match the reference,\
+  \ split multiallelic sites into multiple rows; \nrecover multiallelics from multiple\
+  \ rows. \n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "Normalize"
+- "VCF"
+- "BCF"
+license: "MIT/Expat, GNU"
+references:
+  doi:
+  - "https://doi.org/10.1093/gigascience/giab008"
+links:
+  repository: "https://github.com/samtools/bcftools"
+  homepage: "https://samtools.github.io/bcftools/"
+  documentation: "https://samtools.github.io/bcftools/bcftools.html#norm"
+  issue_tracker: "https://github.com/samtools/bcftools/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "debian:stable-slim"
+  target_registry: "images.viash-hub.com"
+  target_tag: "add_trimgalore"
+  namespace_separator: "/"
+  setup:
+  - type: "apt"
+    packages:
+    - "bcftools"
+    - "procps"
+    interactive: false
+  - type: "docker"
+    run:
+    - "echo \"bcftools: \\\"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftools\
+      \ //p')\\\"\" > /var/software_versions.txt\n"
+  test_setup:
+  - type: "apt"
+    packages:
+    - "tabix"
+    interactive: false
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/bcftools/bcftools_norm/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/bcftools/bcftools_norm"
+  executable: "target/executable/bcftools/bcftools_norm/bcftools_norm"
+  viash_version: "0.9.0-RC7"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
+package_config:
+  name: "biobox"
+  version: "add_trimgalore"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0-RC7"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'add_trimgalore'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"

target/executable/bcftools/bcftools_sort/.config.vsh.yaml

@@ -185,8 +185,8 @@ build_info:
   output: "target/executable/bcftools/bcftools_sort"
   executable: "target/executable/bcftools/bcftools_sort/bcftools_sort"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bcftools/bcftools_sort/bcftools_sort

@@ -483,9 +483,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_sort"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:28Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:57Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bcftools/bcftools_stats/.config.vsh.yaml

@@ -0,0 +1,484 @@
+name: "bcftools_stats"
+namespace: "bcftools"
+version: "add_trimgalore"
+authors:
+- name: "Theodoro Gasperin Terra Camargo"
+  roles:
+  - "author"
+  info:
+    links:
+      email: "theodorogtc@gmail.com"
+      github: "tgaspe"
+      linkedin: "theodoro-gasperin-terra-camargo"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--input"
+    alternatives:
+    - "-i"
+    description: "Input VCF/BCF file. Maximum of two files."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: true
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    description: "Output txt statistics file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Options"
+  arguments:
+  - type: "string"
+    name: "--allele_frequency_bins"
+    alternatives:
+    - "--af_bins"
+    description: "Allele frequency bins, a list of bin values (0.1,0.5,1).\n"
+    info: null
+    example:
+    - "0.1,0.5,1"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--allele_frequency_bins_file"
+    alternatives:
+    - "--af_bins_file"
+    description: "Same as allele_frequency_bins, but in a file.\nFormat of file is\
+      \ one value per line. \ne.g. \n  0.1\n  0.5\n  1\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--allele_frequency_tag"
+    alternatives:
+    - "--af_tag"
+    description: "Allele frequency tag to use, by default estimated from AN,AC or\
+      \ GT.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--first_allele_only"
+    alternatives:
+    - "--first_only"
+    description: "Include only 1st allele at multiallelic sites.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--collapse"
+    alternatives:
+    - "--c"
+    description: "Treat as identical records with <snps|indels|both|all|some|none>.\n\
+      See https://samtools.github.io/bcftools/bcftools.html#common_options for details.\n"
+    info: null
+    required: false
+    choices:
+    - "snps"
+    - "indels"
+    - "both"
+    - "all"
+    - "some"
+    - "none"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--depth"
+    alternatives:
+    - "--d"
+    description: "Depth distribution: min,max,bin size.\n"
+    info: null
+    example:
+    - "0,500,1"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--exclude"
+    alternatives:
+    - "--e"
+    description: "Exclude sites for which the expression is true.\nSee https://samtools.github.io/bcftools/bcftools.html#expressions\
+      \ for details.\n"
+    info: null
+    example:
+    - "QUAL < 30 && DP < 10"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--exons"
+    alternatives:
+    - "--E"
+    description: "tab-delimited file with exons for indel frameshifts statistics.\
+      \ \nThe columns of the file are CHR, FROM, TO, with 1-based, inclusive, positions.\
+      \ \nThe file is BGZF-compressed and indexed with tabix (e.g. tabix -s1 -b2 -e3\
+      \ file.gz).\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--apply_filters"
+    alternatives:
+    - "--f"
+    description: "Require at least one of the listed FILTER strings (e.g. \"PASS,.\"\
+      ).\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--fasta_reference"
+    alternatives:
+    - "--F"
+    description: "Faidx indexed reference sequence file to determine INDEL context.\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--include"
+    alternatives:
+    - "--i"
+    description: "Select sites for which the expression is true.\nSee https://samtools.github.io/bcftools/bcftools.html#expressions\
+      \ for details.\n"
+    info: null
+    example:
+    - "QUAL >= 30 && DP >= 10"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--split_by_ID"
+    alternatives:
+    - "--I"
+    description: "Collect stats for sites with ID separately (known vs novel).\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--regions"
+    alternatives:
+    - "--r"
+    description: "Restrict to comma-separated list of regions. \nFollowing formats\
+      \ are supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].\n"
+    info: null
+    example:
+    - "20:1000000-2000000"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--regions_file"
+    alternatives:
+    - "--R"
+    description: "Restrict to regions listed in a file. \nRegions can be specified\
+      \ either on a VCF, BED, or tab-delimited file (the default). \nFor more information\
+      \ check manual.\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--regions_overlap"
+    description: "This option controls how overlapping records are determined: \n\
+      set to 'pos' or '0' if the VCF record has to have POS inside a region (this\
+      \ corresponds to the default behavior of -t/-T); \nset to 'record' or '1' if\
+      \ also overlapping records with POS outside a region should be included (this\
+      \ is the default behavior of -r/-R, \nand includes indels with POS at the end\
+      \ of a region, which are technically outside the region); \nor set to 'variant'\
+      \ or '2' to include only true overlapping variation (compare the full VCF representation\
+      \ \"TA>T-\" vs the true sequence variation \"A>-\").\n"
+    info: null
+    required: false
+    choices:
+    - "pos"
+    - "record"
+    - "variant"
+    - "0"
+    - "1"
+    - "2"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--samples"
+    alternatives:
+    - "--s"
+    description: "List of samples for sample stats, \"-\" to include all samples.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--samples_file"
+    alternatives:
+    - "--S"
+    description: "File of samples to include.\ne.g. \n  sample1    1\n  sample2  \
+      \  2\n  sample3    2\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--targets"
+    alternatives:
+    - "--t"
+    description: "Similar as -r, --regions, but the next position is accessed by streaming\
+      \ the whole VCF/BCF \nrather than using the tbi/csi index. Both -r and -t options\
+      \ can be applied simultaneously: -r uses the \nindex to jump to a region and\
+      \ -t discards positions which are not in the targets. Unlike -r, targets \n\
+      can be prefixed with \"^\" to request logical complement. For example, \"^X,Y,MT\"\
+      \ indicates that \nsequences X, Y and MT should be skipped. Yet another difference\
+      \ between the -t/-T and -r/-R is \nthat -r/-R checks for proper overlaps and\
+      \ considers both POS and the end position of an indel, \nwhile -t/-T considers\
+      \ the POS coordinate only (by default; see also --regions-overlap and --targets-overlap).\
+      \ \nNote that -t cannot be used in combination with -T.\nFollowing formats are\
+      \ supported: chr|chr:pos|chr:beg-end|chr:beg-[,…​].\n"
+    info: null
+    example:
+    - "20:1000000-2000000"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--targets_file"
+    alternatives:
+    - "--T"
+    description: "Similar to --regions_file option but streams rather than index-jumps.\n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--targets_overlaps"
+    description: "Include if POS in the region (0), record overlaps (1), variant overlaps\
+      \ (2).\n"
+    info: null
+    required: false
+    choices:
+    - "pos"
+    - "record"
+    - "variant"
+    - "0"
+    - "1"
+    - "2"
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--user_tstv"
+    alternatives:
+    - "--u"
+    description: "Collect Ts/Tv stats for any tag using the given binning [0:1:100].\n\
+      Format is <TAG[:min:max:n]>.\nA subfield can be selected as e.g. 'PV4[0]', here\
+      \ the first value of the PV4 tag.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--verbose"
+    alternatives:
+    - "--v"
+    description: "Produce verbose per-site and per-sample output.\n"
+    info: null
+    direction: "input"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Parses VCF or BCF and produces a txt stats file which can be plotted\
+  \ using plot-vcfstats.\nWhen two files are given, the program generates separate\
+  \ stats for intersection\nand the complements. By default only sites are compared,\
+  \ -s/-S must given to include\nalso sample columns.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "Stats"
+- "VCF"
+- "BCF"
+license: "MIT/Expat, GNU"
+references:
+  doi:
+  - "https://doi.org/10.1093/gigascience/giab008"
+links:
+  repository: "https://github.com/samtools/bcftools"
+  homepage: "https://samtools.github.io/bcftools/"
+  documentation: "https://samtools.github.io/bcftools/bcftools.html#stats"
+  issue_tracker: "https://github.com/samtools/bcftools/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "debian:stable-slim"
+  target_registry: "images.viash-hub.com"
+  target_tag: "add_trimgalore"
+  namespace_separator: "/"
+  setup:
+  - type: "apt"
+    packages:
+    - "bcftools"
+    - "procps"
+    interactive: false
+  - type: "docker"
+    run:
+    - "echo \"bcftools: \\\"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftools\
+      \ //p')\\\"\" > /var/software_versions.txt\n"
+  test_setup:
+  - type: "apt"
+    packages:
+    - "tabix"
+    interactive: false
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/bcftools/bcftools_stats/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/bcftools/bcftools_stats"
+  executable: "target/executable/bcftools/bcftools_stats/bcftools_stats"
+  viash_version: "0.9.0-RC7"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
+package_config:
+  name: "biobox"
+  version: "add_trimgalore"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0-RC7"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'add_trimgalore'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"

target/executable/bcl_convert/.config.vsh.yaml

@@ -418,8 +418,8 @@ build_info:
   output: "target/executable/bcl_convert"
   executable: "target/executable/bcl_convert/bcl_convert"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bcl_convert/bcl_convert

@@ -599,9 +599,9 @@ RUN echo "bcl-convert: \"$(bcl-convert -V 2>&1 >/dev/null | sed -n '/Version/ s/
 
 LABEL org.opencontainers.image.authors="Toni Verbeiren, Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component bcl_convert"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:35Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:06Z"
 LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml

@@ -270,8 +270,8 @@ build_info:
   output: "target/executable/bd_rhapsody/bd_rhapsody_make_reference"
   executable: "target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference

@@ -549,9 +549,9 @@ RUN echo "bdgenomics/rhapsody: 2.2.1" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz"
 LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_make_reference"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:39Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:09Z"
 LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1/Extra_Utilities/"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml

@@ -187,8 +187,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_bamtofastq"
   executable: "target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq

@@ -483,9 +483,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bamtofastq"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:21Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:50Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml

@@ -176,8 +176,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_bed12tobed6"
   executable: "target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6

@@ -480,9 +480,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bed12tobed6"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:19Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:49Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml

@@ -214,8 +214,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_bedtobam"
   executable: "target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam

@@ -496,9 +496,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bedtobam"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:22Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:51Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml

@@ -337,8 +337,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_genomecov"
   executable: "target/executable/bedtools/bedtools_genomecov/bedtools_genomecov"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_genomecov/bedtools_genomecov

@@ -591,9 +591,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_genomecov"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:19Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:48Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml

@@ -232,8 +232,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_getfasta"
   executable: "target/executable/bedtools/bedtools_getfasta/bedtools_getfasta"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_getfasta/bedtools_getfasta

@@ -526,9 +526,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Dries Schaumont"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_getfasta"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:20Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:49Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_groupby/.config.vsh.yaml

@@ -273,8 +273,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_groupby"
   executable: "target/executable/bedtools/bedtools_groupby/bedtools_groupby"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_groupby/bedtools_groupby

@@ -552,9 +552,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_groupby"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:21Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:50Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_intersect/.config.vsh.yaml

@@ -410,8 +410,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_intersect"
   executable: "target/executable/bedtools/bedtools_intersect/bedtools_intersect"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_intersect/bedtools_intersect

@@ -633,9 +633,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_intersect"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:20Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:49Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_links/.config.vsh.yaml

@@ -210,8 +210,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_links"
   executable: "target/executable/bedtools/bedtools_links/bedtools_links"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_links/bedtools_links

@@ -500,9 +500,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_links"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:20Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:50Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_merge/.config.vsh.yaml

@@ -279,8 +279,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_merge"
   executable: "target/executable/bedtools/bedtools_merge/bedtools_merge"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_merge/bedtools_merge

@@ -558,9 +558,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_merge"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:18Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:48Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/bedtools/bedtools_sort/.config.vsh.yaml

@@ -222,8 +222,8 @@ build_info:
   output: "target/executable/bedtools/bedtools_sort"
   executable: "target/executable/bedtools/bedtools_sort/bedtools_sort"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/bedtools/bedtools_sort/bedtools_sort

@@ -509,9 +509,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_sort"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:21Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:51Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/busco/busco_download_datasets/.config.vsh.yaml

@@ -158,8 +158,8 @@ build_info:
   output: "target/executable/busco/busco_download_datasets"
   executable: "target/executable/busco/busco_download_datasets/busco_download_datasets"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/busco/busco_download_datasets/busco_download_datasets

@@ -475,9 +475,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component busco busco_download_datasets"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:31Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:02Z"
 LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/busco/busco_list_datasets/.config.vsh.yaml

@@ -145,8 +145,8 @@ build_info:
   output: "target/executable/busco/busco_list_datasets"
   executable: "target/executable/busco/busco_list_datasets/busco_list_datasets"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/busco/busco_list_datasets/busco_list_datasets

@@ -465,9 +465,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component busco busco_list_datasets"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:31Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:02Z"
 LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/busco/busco_run/.config.vsh.yaml

@@ -423,8 +423,8 @@ build_info:
   output: "target/executable/busco/busco_run"
   executable: "target/executable/busco/busco_run/busco_run"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/busco/busco_run/busco_run

@@ -632,9 +632,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component busco busco_run"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:32Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:02Z"
 LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/cutadapt/.config.vsh.yaml

@@ -740,8 +740,8 @@ build_info:
   output: "target/executable/cutadapt"
   executable: "target/executable/cutadapt/cutadapt"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/cutadapt/cutadapt

@@ -831,9 +831,9 @@ RUN cutadapt --version | sed 's/\(.*\)/cutadapt: "\1"/' > /var/software_versions
 
 LABEL org.opencontainers.image.authors="Toni Verbeiren"
 LABEL org.opencontainers.image.description="Companion container for running component cutadapt"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:37Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:08Z"
 LABEL org.opencontainers.image.source="https://github.com/marcelm/cutadapt"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/falco/.config.vsh.yaml

@@ -317,8 +317,8 @@ build_info:
   output: "target/executable/falco"
   executable: "target/executable/falco/falco"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/falco/falco

@@ -589,9 +589,9 @@ RUN echo "falco: \"$(falco -v | sed -n 's/^falco //p')\"" > /var/software_versio
 
 LABEL org.opencontainers.image.authors="Toni Verbeiren"
 LABEL org.opencontainers.image.description="Companion container for running component falco"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:38Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:09Z"
 LABEL org.opencontainers.image.source="https://github.com/smithlabcode/falco"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/fastp/.config.vsh.yaml

@@ -1083,8 +1083,8 @@ build_info:
   output: "target/executable/fastp"
   executable: "target/executable/fastp/fastp"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/fastp/fastp

@@ -1028,9 +1028,9 @@ RUN fastp --version 2>&1 | sed 's# #: "#;s#$#"#' > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Robrecht Cannoodt"
 LABEL org.opencontainers.image.description="Companion container for running component fastp"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:34Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:05Z"
 LABEL org.opencontainers.image.source="https://github.com/OpenGene/fastp"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/fastqc/.config.vsh.yaml

@@ -340,8 +340,8 @@ build_info:
   output: "target/executable/fastqc"
   executable: "target/executable/fastqc/fastqc"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/fastqc/fastqc

@@ -601,9 +601,9 @@ RUN echo "fastqc: $(fastqc --version | sed -n 's/^FastQC //p')" > /var/software_
 
 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component fastqc"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:27Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:56Z"
 LABEL org.opencontainers.image.source="https://github.com/s-andrews/FastQC"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/featurecounts/.config.vsh.yaml

@@ -645,8 +645,8 @@ build_info:
   output: "target/executable/featurecounts"
   executable: "target/executable/featurecounts/featurecounts"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/featurecounts/featurecounts

@@ -754,9 +754,9 @@ RUN featureCounts -v 2>&1 | sed 's/featureCounts v\([0-9.]*\)/featureCounts: \1/
 
 LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
 LABEL org.opencontainers.image.description="Companion container for running component featurecounts"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:29Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:00Z"
 LABEL org.opencontainers.image.source="https://github.com/ShiLab-Bioinformatics/subread"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/fq_subsample/.config.vsh.yaml

@@ -190,8 +190,8 @@ build_info:
   output: "target/executable/fq_subsample"
   executable: "target/executable/fq_subsample/fq_subsample"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/fq_subsample/fq_subsample

@@ -493,9 +493,9 @@ mv target/release/fq /usr/local/bin/ && \
 cd / && rm -rf /fq
 
 LABEL org.opencontainers.image.description="Companion container for running component fq_subsample"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:26Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:56Z"
 LABEL org.opencontainers.image.source="https://github.com/stjude-rust-labs/fq"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/gffread/.config.vsh.yaml

@@ -685,8 +685,8 @@ build_info:
   output: "target/executable/gffread"
   executable: "target/executable/gffread/gffread"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/gffread/gffread

@@ -807,9 +807,9 @@ RUN echo "gffread: \"$(gffread --version 2>&1)\"" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Emma Rousseau"
 LABEL org.opencontainers.image.description="Companion container for running component gffread"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:18Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:47Z"
 LABEL org.opencontainers.image.source="https://github.com/gpertea/gffread"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/lofreq/lofreq_call/.config.vsh.yaml

@@ -507,8 +507,8 @@ build_info:
   output: "target/executable/lofreq/lofreq_call"
   executable: "target/executable/lofreq/lofreq_call/lofreq_call"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/lofreq/lofreq_call/lofreq_call

@@ -656,9 +656,9 @@ echo "lofreq: $version" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Kai Waldrant"
 LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_call"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:29Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:59Z"
 LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml

@@ -215,8 +215,8 @@ build_info:
   output: "target/executable/lofreq/lofreq_indelqual"
   executable: "target/executable/lofreq/lofreq_indelqual/lofreq_indelqual"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/lofreq/lofreq_indelqual/lofreq_indelqual

@@ -501,9 +501,9 @@ echo "lofreq: $version" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Kai Waldrant"
 LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_indelqual"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:28Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:59Z"
 LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/multiqc/.config.vsh.yaml

@@ -456,8 +456,8 @@ build_info:
   output: "target/executable/multiqc"
   executable: "target/executable/multiqc/multiqc"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/multiqc/multiqc

@@ -637,9 +637,9 @@ RUN multiqc --version | sed 's/multiqc, version\s\(.*\)/multiqc: "\1"/' > /var/s
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component multiqc"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:38Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:08Z"
 LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/pear/.config.vsh.yaml

@@ -398,8 +398,8 @@ build_info:
   output: "target/executable/pear"
   executable: "target/executable/pear/pear"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/pear/pear

@@ -597,9 +597,9 @@ echo "pear: $version" > /var/software_versions.txt
 
 LABEL org.opencontainers.image.authors="Kai Waldrant"
 LABEL org.opencontainers.image.description="Companion container for running component pear"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:22Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:51Z"
 LABEL org.opencontainers.image.source="https://github.com/tseemann/PEAR"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/qualimap/qualimap_rnaseq/.config.vsh.yaml

@@ -264,8 +264,8 @@ build_info:
   output: "target/executable/qualimap/qualimap_rnaseq"
   executable: "target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq

@@ -527,9 +527,9 @@ RUN echo QualiMap: $(qualimap 2>&1 | grep QualiMap | sed 's/^.*QualiMap//') > /v
 
 LABEL org.opencontainers.image.authors="Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component qualimap qualimap_rnaseq"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:26Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:35:55Z"
 LABEL org.opencontainers.image.source="https://bitbucket.org/kokonech/qualimap/commits/branch/master"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/rsem/rsem_prepare_reference/.config.vsh.yaml

@@ -416,8 +416,8 @@ build_info:
   output: "target/executable/rsem/rsem_prepare_reference"
   executable: "target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference

@@ -656,9 +656,9 @@ echo "HISAT2: `hisat2 --version | grep -oP 'hisat2-align-s version \K\d+\.\d+\.\
 
 LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
 LABEL org.opencontainers.image.description="Companion container for running component rsem rsem_prepare_reference"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:32Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:03Z"
 LABEL org.opencontainers.image.source="https://github.com/deweylab/RSEM"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/salmon/salmon_index/.config.vsh.yaml

@@ -277,8 +277,8 @@ build_info:
   output: "target/executable/salmon/salmon_index"
   executable: "target/executable/salmon/salmon_index/salmon_index"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"

target/executable/salmon/salmon_index/salmon_index

@@ -546,9 +546,9 @@ RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/softwar
 
 LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
 LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_index"
-LABEL org.opencontainers.image.created="2024-09-10T07:43:36Z"
+LABEL org.opencontainers.image.created="2024-09-19T08:36:07Z"
 LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon"
-LABEL org.opencontainers.image.revision="89fb3575f697065135a647a21efb3815efe66e44"
+LABEL org.opencontainers.image.revision="90735159b7bafa4aa8643eb132534d078ea299cf"
 LABEL org.opencontainers.image.version="add_trimgalore"
 
 VIASHDOCKER

target/executable/salmon/salmon_quant/.config.vsh.yaml

@@ -1173,8 +1173,8 @@ build_info:
   output: "target/executable/salmon/salmon_quant"
   executable: "target/executable/salmon/salmon_quant/salmon_quant"
   viash_version: "0.9.0-RC7"
-  git_commit: "89fb3575f697065135a647a21efb3815efe66e44"
-  git_remote: "https://github.com/viash-hub/biobox"
+  git_commit: "90735159b7bafa4aa8643eb132534d078ea299cf"
+  git_remote: "https://x-access-token:ghs_f5MGzzY8TnzQWjJSiZ9z9t1HGTq1aI25g7mw@github.com/viash-hub/biobox"
 package_config:
   name: "biobox"
   version: "add_trimgalore"