vsh/biobox
1
0
Fork 0
Code Issues Pull Requests Actions Packages Projects Releases Wiki Activity

Build branch v0.1 with version v0.1.0 (b84b297)

Browse Source 
Build pipeline: viash-hub.biobox.v0.1-8mh8l

Source commit: b84b29747d

Source message: Bump version to v0.1.0
This commit is contained in:
CI
2024-06-24 09:29:14 +00:00
parent 56a195f1bb
commit 7645430e58
168 changed files with 19904 additions and 2168 deletions
Download Patch File Download Diff File Expand all files Collapse all files

23
CHANGELOG.md
View File

@@ -1,4 +1,4 @@
# base unreleased
# biobox unreleased
## BREAKING CHANGES
@@ -17,6 +17,8 @@
- `busco/busco_list_datasets`: Lists available busco datasets (PR #18).
- `busco/busco_download_datasets`: Download busco datasets (PR #19).
* `cutadapt`: Remove adapter sequences from high-throughput sequencing reads (PR #7).
* `featurecounts`: Assign sequence reads to genomic features (PR #11).
* `bgzip`: Add bgzip functionality to compress and decompress files (PR #13).
@@ -29,7 +31,9 @@
* `multiqc`: Aggregate results from bioinformatics analyses across many samples into a single report (PR #42).
* `star/star_align_reads`: Align reads to a reference genome (PR #22).
* `star`:
- `star/star_align_reads`: Align reads to a reference genome (PR #22).
- `star/star_genome_generate`: Generate a genome index for STAR alignment (PR #58).
* `gffread`: Validate, filter, convert and perform other operations on GFF files (PR #29).
@@ -50,8 +54,9 @@
* `falco`: A C++ drop-in replacement of FastQC to assess the quality of sequence read data (PR #43).
## MAJOR CHANGES
* `bedtools`:
- `bedtools_getfasta`: extract sequences from a FASTA file for each of the
intervals defined in a BED/GFF/VCF file (PR #59).
## MINOR CHANGES
@@ -61,8 +66,16 @@
* Update to Viash 0.9.0-RC3 (PR #51).
* Update to Viash 0.9.0-RC6 (PR #63).
* Switch to viash-hub/toolbox actions (PR #64).
## DOCUMENTATION
* Update README (PR #64).
## BUG FIXES
* Add escaping character before leading hashtag in the description field of the config file (PR #50).
* Add escaping character before leading hashtag in the description field of the config file (PR #50).
* Format URL in biobase/bcl_convert description (PR #55).

30
README.md
View File

@@ -1,15 +1,24 @@
# Base repository for reusable Viash components
This repository is a collection of reproducible and reusable Viash
components.
# 🌱📦 biobox
[![ViashHub](https://img.shields.io/badge/ViashHub-biobox-7a4baa.png)](https://web.viash-hub.com/packages/biobox)
[![GitHub](https://img.shields.io/badge/GitHub-viash--hub%2Fbiobox-blue.png)](https://github.com/viash-hub/biobox)
[![GitHub
License](https://img.shields.io/github/license/viash-hub/biobox.png)](https://github.com/viash-hub/biobox/blob/main/LICENSE)
[![GitHub
Issues](https://img.shields.io/github/issues/viash-hub/biobox.png)](https://github.com/viash-hub/biobox/issues)
[![Viash
version](https://img.shields.io/badge/Viash-v0.9.0--RC6-blue)](https://viash.io)
A collection of bioinformatics tools for working with sequence data.
## Objectives
- **Reusability**: Facilitating the use of components across various
projects and contexts.
- **Reproducibility**: Guaranteeing that bioinformatics analyses can be
reliably replicated.
- **Reproducibility**: Ensuring that components are reproducible and can
be easily shared.
- **Best Practices**: Adhering to established standards in software
development and bioinformatics.
@@ -43,18 +52,21 @@ contribute a component to this repository.
12. Create test script
13. Create a `/var/software_versions.txt` file
See the [CONTRIBUTING](CONTRIBUTING.md) file for more details.
See the
[CONTRIBUTING](https://github.com/viash-hub/biobox/blob/main/CONTRIBUTING.md)
file for more details.
## Support and Community
For support, questions, or to join our community:
- **Issues**: Submit questions or issues via the [GitHub issue
tracker](https://github.com/viash-hub/base/issues).
tracker](https://github.com/viash-hub/biobox/issues).
- **Discussions**: Join our discussions via [GitHub
Discussions](https://github.com/viash-hub/base/discussions).
Discussions](https://github.com/viash-hub/biobox/discussions).
## License
This repository is licensed under an MIT license. See the
[LICENSE](LICENSE) file for details.
[LICENSE](https://github.com/viash-hub/biobox/blob/main/LICENSE) file
for details.

25
README.qmd
View File

@@ -1,14 +1,25 @@
---
title: Base repository for reusable Viash components
format: gfm
---
```{r setup, include=FALSE}
project <- yaml::read_yaml("_viash.yaml")
license <- paste0(project$links$repository, "/blob/main/LICENSE")
contributing <- paste0(project$links$repository, "/blob/main/CONTRIBUTING.md")
```
# 🌱📦 `r project$name`
This repository is a collection of reproducible and reusable Viash components.
[![ViashHub](https://img.shields.io/badge/ViashHub-`r project$name`-7a4baa)](https://web.viash-hub.com/packages/`r project$name`)
[![GitHub](https://img.shields.io/badge/GitHub-viash--hub%2F`r project$name`-blue)](`r project$links$repository`)
[![GitHub License](https://img.shields.io/github/license/viash-hub/`r project$name`)](`r license`)
[![GitHub Issues](https://img.shields.io/github/issues/viash-hub/`r project$name`)](`r project$links$issue_tracker`)
[![Viash version](https://img.shields.io/badge/Viash-v`r gsub("-", "--", project$viash_version)`-blue)](https://viash.io)
`r project$description`
## Objectives
- **Reusability**: Facilitating the use of components across various projects and contexts.
- **Reproducibility**: Guaranteeing that bioinformatics analyses can be reliably replicated.
- **Reproducibility**: Ensuring that components are reproducible and can be easily shared.
- **Best Practices**: Adhering to established standards in software development and bioinformatics.
## Contributing
@@ -37,15 +48,15 @@ knitr::asis_output(
)
```
See the [CONTRIBUTING](CONTRIBUTING.md) file for more details.
See the [CONTRIBUTING](`r contributing`) file for more details.
## Support and Community
For support, questions, or to join our community:
- **Issues**: Submit questions or issues via the [GitHub issue tracker](https://github.com/viash-hub/base/issues).
- **Discussions**: Join our discussions via [GitHub Discussions](https://github.com/viash-hub/base/discussions).
- **Issues**: Submit questions or issues via the [GitHub issue tracker](`r project$links$issue_tracker`).
- **Discussions**: Join our discussions via [GitHub Discussions](`r project$links$repository`/discussions).
## License
This repository is licensed under an MIT license. See the [LICENSE](LICENSE) file for details.
This repository is licensed under an MIT license. See the [LICENSE](`r license`) file for details.

7
_viash.yaml
View File

@@ -1,13 +1,14 @@
name: biobox
version: v0.1.0
description: |
A collection of bioinformatics tools for working with sequence data.
license: MIT
keywords: [bioinformatics, sequence, alignment, variant calling, dna, rna]
keywords: [bioinformatics, modules, sequencing]
links:
issue_tracker: https://github.com/viash-hub/biobox/issues
repository: https://github.com/viash-hub/biobbox
repository: https://github.com/viash-hub/biobox
viash_version: 0.9.0-RC3
viash_version: 0.9.0-RC6
config_mods: |
.requirements.commands := ['ps']

2
nextflow.config
View File

@@ -1,6 +1,6 @@
manifest {
name = "biobox"
version = "v0.1"
version = "v0.1.0"
defaultBranch = "main"
nextflowVersion = "!>=20.12.1-edge"
}

4
src/bcl_convert/config.vsh.yaml
View File

@@ -2,8 +2,8 @@ name: bcl_convert
description: |
Convert bcl files to fastq files using bcl-convert.
Information about upgrading from bcl2fastq via
https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html
and https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html
[Upgrading from bcl2fastq to BCL Convert](https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html)
and [BCL Convert Compatible Products](https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html)
argument_groups:
- name: Input arguments
arguments:

103
src/bedtools/bedtools_getfasta/config.vsh.yaml Normal file
View File

@@ -0,0 +1,103 @@
name: bedtools_getfasta
namespace: bedtools
description: Extract sequences from a FASTA file for each of the intervals defined in a BED/GFF/VCF file.
keywords: [sequencing, fasta, BED, GFF, VCF]
links:
documentation: https://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html
repository: https://github.com/arq5x/bedtools2
references:
doi: 10.1093/bioinformatics/btq033
license: GPL-2.0
requirements:
commands: [bedtools]
argument_groups:
- name: Input arguments
arguments:
- name: --input_fasta
type: file
description: |
FASTA file containing sequences for each interval specified in the input BED file.
The headers in the input FASTA file must exactly match the chromosome column in the BED file.
- name: "--input_bed"
type: file
description: |
BED file containing intervals to extract from the FASTA file.
BED files containing a single region require a newline character
at the end of the line, otherwise a blank output file is produced.
- name: --rna
type: boolean_true
description: |
The FASTA is RNA not DNA. Reverse complementation handled accordingly.
- name: Run arguments
arguments:
- name: "--strandedness"
type: boolean_true
alternatives: ["-s"]
description: |
Force strandedness. If the feature occupies the antisense strand, the output sequence will
be reverse complemented. By default strandedness is not taken into account.
- name: Output arguments
arguments:
- name: --output
alternatives: [-o]
required: true
type: file
direction: output
description: |
Output file where the output from the 'bedtools getfasta' commend will
be written to.
- name: --tab
type: boolean_true
description: |
Report extract sequences in a tab-delimited format instead of in FASTA format.
- name: --bed_out
type: boolean_true
description: |
Report extract sequences in a tab-delimited BED format instead of in FASTA format.
- name: "--name"
type: boolean_true
description: |
Set the FASTA header for each extracted sequence to be the "name" and coordinate columns from the BED feature.
- name: "--name_only"
type: boolean_true
description: |
Set the FASTA header for each extracted sequence to be the "name" columns from the BED feature.
- name: "--split"
type: boolean_true
description: |
When --input is in BED12 format, create a separate fasta entry for each block in a BED12 record,
blocks being described in the 11th and 12th column of the BED.
- name: "--full_header"
type: boolean_true
description: |
Use full fasta header. By default, only the word before the first space or tab is used.
# Arguments not taken into account:
#
# -fo [Specify an output file name. By default, output goes to stdout.
#
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: debian:stable-slim
setup:
- type: apt
packages: [bedtools, procps]
- type: docker
run: |
echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

22
src/bedtools/bedtools_getfasta/script.sh Normal file
View File

@@ -0,0 +1,22 @@
#!/usr/bin/env bash
set -eo pipefail
unset_if_false=( par_rna par_strandedness par_tab par_bed_out par_name par_name_only par_split par_full_header )
for par in ${unset_if_false[@]}; do
test_val="${!par}"
[[ "$test_val" == "false" ]] && unset $par
done
bedtools getfasta \
-fi "$par_input_fasta" \
-bed "$par_input_bed" \
${par_rna:+-rna} \
${par_name:+-name} \
${par_name_only:+-nameOnly} \
${par_tab:+-tab} \
${par_bed_out:+-bedOut} \
${par_strandedness:+-s} \
${par_split:+-split} \
${par_full_header:+-fullHeader} > "$par_output"

119
src/bedtools/bedtools_getfasta/test.sh Normal file
View File

@@ -0,0 +1,119 @@
#!/usr/bin/env bash
set -eo pipefail
TMPDIR=$(mktemp -d)
function clean_up {
[[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
}
trap clean_up EXIT
# Create dummy test fasta file
cat > "$TMPDIR/test.fa" <<EOF
>chr1
AAAAAAAACCCCCCCCCCCCCGCTACTGGGGGGGGGGGGGGGGGG
EOF
TAB="$(printf '\t')"
# Create dummy bed file
cat > "$TMPDIR/test.bed" <<EOF
chr1${TAB}5${TAB}10${TAB}myseq
EOF
# Create expected bed file
cat > "$TMPDIR/expected.fasta" <<EOF
>chr1:5-10
AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--output "$TMPDIR/output.fasta"
cmp --silent "$TMPDIR/output.fasta" "$TMPDIR/expected.fasta" || { echo "files are different:"; exit 1; }
# Create expected bed file for --name
cat > "$TMPDIR/expected_with_name.fasta" <<EOF
>myseq::chr1:5-10
AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--name \
--output "$TMPDIR/output_with_name.fasta"
cmp --silent "$TMPDIR/output_with_name.fasta" "$TMPDIR/expected_with_name.fasta" || { echo "Files when using --name are different."; exit 1; }
# Create expected bed file for --name_only
cat > "$TMPDIR/expected_with_name_only.fasta" <<EOF
>myseq
AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--name_only \
--output "$TMPDIR/output_with_name_only.fasta"
cmp --silent "$TMPDIR/output_with_name_only.fasta" "$TMPDIR/expected_with_name_only.fasta" || { echo "Files when using --name_only are different."; exit 1; }
# Create expected tab-delimited file for --tab
cat > "$TMPDIR/expected_tab.out" <<EOF
myseq${TAB}AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--name_only \
--tab \
--output "$TMPDIR/tab.out"
cmp --silent "$TMPDIR/expected_tab.out" "$TMPDIR/tab.out" || { echo "Files when using --tab are different."; exit 1; }
# Create expected tab-delimited file for --bed_out
cat > "$TMPDIR/expected.bed" <<EOF
chr1${TAB}5${TAB}10${TAB}myseq${TAB}AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--bed_out \
--output "$TMPDIR/output.bed"
cmp --silent "$TMPDIR/expected.bed" "$TMPDIR/output.bed" || { echo "Files when using --bed_out are different."; exit 1; }
# Create dummy bed file for strandedness
cat > "$TMPDIR/test_strandedness.bed" <<EOF
chr1${TAB}20${TAB}25${TAB}forward${TAB}1${TAB}+
chr1${TAB}20${TAB}25${TAB}reverse${TAB}1${TAB}-
EOF
# Create expected tab-delimited file for --bed_out
cat > "$TMPDIR/expected_strandedness.fasta" <<EOF
>forward(+)
CGCTA
>reverse(-)
TAGCG
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test_strandedness.bed" \
--input_fasta "$TMPDIR/test.fa" \
-s \
--name_only \
--output "$TMPDIR/output_strandedness.fasta"
cmp --silent "$TMPDIR/expected_strandedness.fasta" "$TMPDIR/output_strandedness.fasta" || { echo "Files when using -s are different."; exit 1; }

128
src/bgzip/config.vsh.yaml
View File

@@ -1,128 +0,0 @@
name: bgzip
description: Block compression/decompression utility
links:
homepage: https://www.htslib.org/
documentation: https://www.htslib.org/doc/bgzip.html
repository: https://github.com/samtools/htslib
references:
doi: 10.1093/gigascience/giab007
license: MIT
requirements:
commands: [ bgzip ]
argument_groups:
- name: Inputs
arguments:
- name: --input
type: file
direction: input
description: file to be compressed or decompressed
required: true
- name: Outputs
arguments:
- name: --output
type: file
direction: output
description: compressed or decompressed output
required: true
- name: --index_name
alternatives: -I
type: file
direction: output
description: name of BGZF index file [file.gz.gzi]
- name: Arguments
arguments:
- name: --offset
alternatives: -b
type: integer
description: decompress at virtual file pointer (0-based uncompressed offset)
- name: --decompress
alternatives: -d
type: boolean_true
description: decompress the input file
- name: --rebgzip
alternatives: -g
type: boolean_true
description: use an index file to bgzip a file
- name: --index
alternatives: -i
type: boolean_true
description: compress and create BGZF index
- name: --compress_level
alternatives: -l
type: integer
description: compression level to use when compressing; 0 to 9, or -1 for default [-1]
min: -1
max: 9
- name: --reindex
alternatives: -r
type: boolean_true
description: (re)index the output file
- name: --size
alternatives: -s
type: integer
description: decompress INT bytes (uncompressed size)
min: 0
- name: --test
alternatives: -t
type: boolean_true
description: test integrity of compressed file
- name: --binary
type: boolean_true
description: Don't align blocks with text lines
resources:
- type: bash_script
text: |
[[ "$par_decompress" == "false" ]] && unset par_decompress
[[ "$par_rebgzip" == "false" ]] && unset par_rebgzip
[[ "$par_index" == "false" ]] && unset par_index
[[ "$par_reindex" == "false" ]] && unset par_reindex
[[ "$par_test" == "false" ]] && unset par_test
[[ "$par_binary" == "false" ]] && unset par_binary
bgzip -c \
${meta_cpus:+--threads "${meta_cpus}"} \
${par_offset:+-b "${par_offset}"} \
${par_decompress:+-d} \
${par_rebgzip:+-g} \
${par_index:+-i} \
${par_index_name:+-I "${par_index_name}"} \
${par_compress_level:+-l "${par_compress_level}"} \
${par_reindex:+-r} \
${par_size:+-s "${par_size}"} \
${par_test:+-t} \
${par_binary:+--binary} \
"$par_input" > "$par_output"
test_resources:
- type: bash_script
text: |
set -e
"$meta_executable" --input "$meta_resources_dir/test_data/test.vcf" --output "test.vcf.gz"
echo ">> Checking output of compressing"
[ ! -f "test.vcf.gz" ] && echo "Output file test.vcf.gz does not exist" && exit 1
"$meta_executable" --input "test.vcf.gz" --output "test.vcf" --decompress
echo ">> Checking output of decompressing"
[ ! -f "test.vcf" ] && echo "Output file test.vcf does not exist" && exit 1
echo ">> Checking original and decompressed files are the same"
set +e
cmp --silent -- "$meta_resources_dir/test_data/test.vcf" "test.vcf"
[ $? -ne 0 ] && echo "files are different" && exit 1
set -e
echo "> Test successful"
- type: file
path: test_data
engines:
- type: docker
image: quay.io/biocontainers/htslib:1.19--h81da01d_0
setup:
- type: docker
run: |
bgzip -h | grep 'Version:' 2>&1 | sed 's/Version:\s\(.*\)/bgzip: "\1"/' > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

22
src/bgzip/help.txt
View File

@@ -1,22 +0,0 @@
```bash
bgzip -h
```
Version: 1.19
Usage: bgzip [OPTIONS] [FILE] ...
Options:
-b, --offset INT decompress at virtual file pointer (0-based uncompressed offset)
-c, --stdout write on standard output, keep original files unchanged
-d, --decompress decompress
-f, --force overwrite files without asking
-g, --rebgzip use an index file to bgzip a file
-h, --help give this help
-i, --index compress and create BGZF index
-I, --index-name FILE name of BGZF index file [file.gz.gzi]
-k, --keep don't delete input files during operation
-l, --compress-level INT Compression level to use when compressing; 0 to 9, or -1 for default [-1]
-r, --reindex (re)index compressed file
-s, --size INT decompress INT bytes (uncompressed size)
-t, --test test integrity of compressed file
--binary Don't align blocks with text lines
-@, --threads INT number of compression threads to use [1]

10
src/bgzip/test_data/script.sh
View File

@@ -1,10 +0,0 @@
# bgzip test data
# Test data was obtained from https://github.com/snakemake/snakemake-wrappers/tree/master/bio/bgzip/test.
if [ ! -d /tmp/snakemake-wrappers ]; then
git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers
fi
cp -r /tmp/snakemake-wrappers/bio/bgzip/test/* src/bgzip/test_data

23
src/bgzip/test_data/test.vcf
View File

@@ -1,23 +0,0 @@
##fileformat=VCFv4.0
##fileDate=20090805
##source=https://www.internationalgenome.org/wiki/Analysis/vcf4.0/
##reference=1000GenomesPilot-NCBI36
##phasing=partial
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency">
##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129">
##INFO=<ID=H2,Number=0,Type=Flag,Description="HapMap2 membership">
##FILTER=<ID=q10,Description="Quality below 10">
##FILTER=<ID=s50,Description="Less than 50% of samples have data">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003
20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,.
20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3
20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4
20 1230237 . T . 47 PASS NS=3;DP=13;AA=T GT:GQ:DP:HQ 0|0:54:7:56,60 0|0:48:4:51,51 0/0:61:2
20 1234567 microsat1 GTCT G,GTACT 50 PASS NS=3;DP=9;AA=G GT:GQ:DP 0/1:35:4 0/2:17:2 1/1:40:3

463
src/cutadapt/config.vsh.yaml Normal file
View File

@@ -0,0 +1,463 @@
name: cutadapt
description: |
Cutadapt removes adapter sequences from high-throughput sequencing reads.
keywords: [RNA-seq, scRNA-seq, high-throughput]
links:
homepage: https://cutadapt.readthedocs.io
documentation: https://cutadapt.readthedocs.io
repository: https://github.com/marcelm/cutadapt
references:
doi: 10.14806/ej.17.1.200
license: MIT
argument_groups:
####################################################################
- name: Specify Adapters for R1
arguments:
- name: --adapter
alternatives: [-a]
type: string
multiple: true
description: |
Sequence of an adapter ligated to the 3' end (paired data:
of the first read). The adapter and subsequent bases are
trimmed. If a '$' character is appended ('anchoring'), the
adapter is only found if it is a suffix of the read.
required: false
- name: --front
alternatives: [-g]
type: string
multiple: true
description: |
Sequence of an adapter ligated to the 5' end (paired data:
of the first read). The adapter and any preceding bases
are trimmed. Partial matches at the 5' end are allowed. If
a '^' character is prepended ('anchoring'), the adapter is
only found if it is a prefix of the read.
required: false
- name: --anywhere
alternatives: [-b]
type: string
multiple: true
description: |
Sequence of an adapter that may be ligated to the 5' or 3'
end (paired data: of the first read). Both types of
matches as described under -a and -g are allowed. If the
first base of the read is part of the match, the behavior
is as with -g, otherwise as with -a. This option is mostly
for rescuing failed library preparations - do not use if
you know which end your adapter was ligated to!
required: false
####################################################################
- name: Specify Adapters using Fasta files for R1
arguments:
- name: --adapter_fasta
type: file
multiple: true
description: |
Fasta file containing sequences of an adapter ligated to the 3' end (paired data:
of the first read). The adapter and subsequent bases are
trimmed. If a '$' character is appended ('anchoring'), the
adapter is only found if it is a suffix of the read.
required: false
- name: --front_fasta
type: file
description: |
Fasta file containing sequences of an adapter ligated to the 5' end (paired data:
of the first read). The adapter and any preceding bases
are trimmed. Partial matches at the 5' end are allowed. If
a '^' character is prepended ('anchoring'), the adapter is
only found if it is a prefix of the read.
required: false
- name: --anywhere_fasta
type: file
description: |
Fasta file containing sequences of an adapter that may be ligated to the 5' or 3'
end (paired data: of the first read). Both types of
matches as described under -a and -g are allowed. If the
first base of the read is part of the match, the behavior
is as with -g, otherwise as with -a. This option is mostly
for rescuing failed library preparations - do not use if
you know which end your adapter was ligated to!
required: false
####################################################################
- name: Specify Adapters for R2
arguments:
- name: --adapter_r2
alternatives: [-A]
type: string
multiple: true
description: |
Sequence of an adapter ligated to the 3' end (paired data:
of the first read). The adapter and subsequent bases are
trimmed. If a '$' character is appended ('anchoring'), the
adapter is only found if it is a suffix of the read.
required: false
- name: --front_r2
alternatives: [-G]
type: string
multiple: true
description: |
Sequence of an adapter ligated to the 5' end (paired data:
of the first read). The adapter and any preceding bases
are trimmed. Partial matches at the 5' end are allowed. If
a '^' character is prepended ('anchoring'), the adapter is
only found if it is a prefix of the read.
required: false
- name: --anywhere_r2
alternatives: [-B]
type: string
multiple: true
description: |
Sequence of an adapter that may be ligated to the 5' or 3'
end (paired data: of the first read). Both types of
matches as described under -a and -g are allowed. If the
first base of the read is part of the match, the behavior
is as with -g, otherwise as with -a. This option is mostly
for rescuing failed library preparations - do not use if
you know which end your adapter was ligated to!
required: false
####################################################################
- name: Specify Adapters using Fasta files for R2
arguments:
- name: --adapter_r2_fasta
type: file
description: |
Fasta file containing sequences of an adapter ligated to the 3' end (paired data:
of the first read). The adapter and subsequent bases are
trimmed. If a '$' character is appended ('anchoring'), the
adapter is only found if it is a suffix of the read.
required: false
- name: --front_r2_fasta
type: file
description: |
Fasta file containing sequences of an adapter ligated to the 5' end (paired data:
of the first read). The adapter and any preceding bases
are trimmed. Partial matches at the 5' end are allowed. If
a '^' character is prepended ('anchoring'), the adapter is
only found if it is a prefix of the read.
required: false
- name: --anywhere_r2_fasta
type: file
description: |
Fasta file containing sequences of an adapter that may be ligated to the 5' or 3'
end (paired data: of the first read). Both types of
matches as described under -a and -g are allowed. If the
first base of the read is part of the match, the behavior
is as with -g, otherwise as with -a. This option is mostly
for rescuing failed library preparations - do not use if
you know which end your adapter was ligated to!
required: false
####################################################################
- name: Paired-end options
arguments:
- name: --pair_adapters
type: boolean_true
description: |
Treat adapters given with -a/-A etc. as pairs. Either both
or none are removed from each read pair.
- name: --pair_filter
type: string
choices: [any, both, first]
description: |
Which of the reads in a paired-end read have to match the
filtering criterion in order for the pair to be filtered.
- name: --interleaved
type: boolean_true
description: |
Read and/or write interleaved paired-end reads.
####################################################################
- name: Input parameters
arguments:
- name: --input
type: file
required: true
description: |
Input fastq file for single-end reads or R1 for paired-end reads.
- name: --input_r2
type: file
required: false
description: |
Input fastq file for R2 in the case of paired-end reads.
- name: --error_rate
alternatives: [-E, --errors]
type: double
description: |
Maximum allowed error rate (if 0 <= E < 1), or absolute
number of errors for full-length adapter match (if E is an
integer >= 1). Error rate = no. of errors divided by
length of matching region. Default: 0.1 (10%).
example: 0.1
- name: --no_indels
type: boolean_false
description: |
Allow only mismatches in alignments.
- name: --times
type: integer
alternatives: [-n]
description: |
Remove up to COUNT adapters from each read. Default: 1.
example: 1
- name: --overlap
alternatives: [-O]
type: integer
description: |
Require MINLENGTH overlap between read and adapter for an
adapter to be found. The default is 3.
example: 3
- name: --match_read_wildcards
type: boolean_true
description: |
Interpret IUPAC wildcards in reads.
- name: --no_match_adapter_wildcards
type: boolean_false
description: |
Do not interpret IUPAC wildcards in adapters.
- name: --action
type: string
choices:
- trim
- retain
- mask
- lowercase
- none
description: |
What to do if a match was found. trim: trim adapter and
up- or downstream sequence; retain: trim, but retain
adapter; mask: replace with 'N' characters; lowercase:
convert to lowercase; none: leave unchanged.
The default is trim.
example: trim
- name: --revcomp
alternatives: [--rc]
type: boolean_true
description: |
Check both the read and its reverse complement for adapter
matches. If match is on reverse-complemented version,
output that one.
####################################################################
- name: Read modifications
arguments:
- name: --cut
alternatives: [-u]
type: integer
multiple: true
description: |
Remove LEN bases from each read (or R1 if paired; use --cut_r2
option for R2). If LEN is positive, remove bases from the
beginning. If LEN is negative, remove bases from the end.
Can be used twice if LENs have different signs. Applied
*before* adapter trimming.
- name: --cut_r2
type: integer
multiple: true
description: |
Remove LEN bases from each read (for R2). If LEN is positive, remove bases from the
beginning. If LEN is negative, remove bases from the end.
Can be used twice if LENs have different signs. Applied
*before* adapter trimming.
- name: --nextseq_trim
type: string
description: |
NextSeq-specific quality trimming (each read). Trims also
dark cycles appearing as high-quality G bases.
- name: --quality_cutoff
alternatives: [-q]
type: string
description: |
Trim low-quality bases from 5' and/or 3' ends of each read
before adapter removal. Applied to both reads if data is
paired. If one value is given, only the 3' end is trimmed.
If two comma-separated cutoffs are given, the 5' end is
trimmed with the first cutoff, the 3' end with the second.
- name: --quality_cutoff_r2
alternatives: [-Q]
type: string
description: |
Quality-trimming cutoff for R2. Default: same as for R1
- name: --quality_base
type: integer
description: |
Assume that quality values in FASTQ are encoded as
ascii(quality + N). This needs to be set to 64 for some
old Illumina FASTQ files. The default is 33.
example: 33
- name: --poly_a
type: boolean_true
description: Trim poly-A tails
- name: --length
alternatives: [-l]
type: integer
description: |
Shorten reads to LENGTH. Positive values remove bases at
the end while negative ones remove bases at the beginning.
This and the following modifications are applied after
adapter trimming.
- name: --trim_n
type: boolean_true
description: Trim N's on ends of reads.
- name: --length_tag
type: string
description: |
Search for TAG followed by a decimal number in the
description field of the read. Replace the decimal number
with the correct length of the trimmed read. For example,
use --length-tag 'length=' to correct fields like
'length=123'.
example: "length="
- name: --strip_suffix
type: string
description: |
Remove this suffix from read names if present. Can be
given multiple times.
- name: --prefix
alternatives: [-x]
type: string
description: |
Add this prefix to read names. Use {name} to insert the
name of the matching adapter.
- name: --suffix
alternatives: [-y]
type: string
description: |
Add this suffix to read names; can also include {name}
- name: --rename
type: string
description: |
Rename reads using TEMPLATE containing variables such as
{id}, {adapter_name} etc. (see documentation)
- name: --zero_cap
alternatives: [-z]
type: boolean_true
description: Change negative quality values to zero.
####################################################################
- name: Filtering of processed reads
description: |
Filters are applied after above read modifications. Paired-end reads are
always discarded pairwise (see also --pair_filter).
arguments:
- name: --minimum_length
alternatives: [-m]
type: string
description: |
Discard reads shorter than LEN. Default is 0.
When trimming paired-end reads, the minimum lengths for R1 and R2 can be specified separately by separating them with a colon (:).
If the colon syntax is not used, the same minimum length applies to both reads, as discussed above.
Also, one of the values can be omitted to impose no restrictions.
For example, with -m 17:, the length of R1 must be at least 17, but the length of R2 is ignored.
example: "0"
- name: --maximum_length
alternatives: [-M]
type: string
description: |
Discard reads longer than LEN. Default: no limit.
For paired reads, see the remark for --minimum_length
- name: --max_n
type: string
description: |
Discard reads with more than COUNT 'N' bases. If COUNT is
a number between 0 and 1, it is interpreted as a fraction
of the read length.
- name: --max_expected_errors
alternatives: [--max_ee]
type: long
description: |
Discard reads whose expected number of errors (computed
from quality values) exceeds ERRORS.
- name: --max_average_error_rate
alternatives: [--max_aer]
type: long
description: |
as --max_expected_errors (see above), but divided by
length to account for reads of varying length.
- name: --discard_trimmed
alternatives: [--discard]
type: boolean_true
description: |
Discard reads that contain an adapter. Use also -O to
avoid discarding too many randomly matching reads.
- name: --discard_untrimmed
alternatives: [--trimmed_only]
type: boolean_true
description: |
Discard reads that do not contain an adapter.
- name: --discard_casava
type: boolean_true
description: |
Discard reads that did not pass CASAVA filtering (header
has :Y:).
####################################################################
- name: Output parameters
arguments:
- name: --report
type: string
choices: [full, minimal]
description: |
Which type of report to print: 'full' (default) or 'minimal'.
example: full
- name: --json
type: boolean_true
description: |
Write report in JSON format to this file.
- name: --output
type: file
description: |
Glob pattern for matching the expected output files.
Should include `$output_dir`.
example: "fastq/*_001.fast[a,q]"
direction: output
required: true
must_exist: true
multiple: true
- name: --fasta
type: boolean_true
description: |
Output FASTA to standard output even on FASTQ input.
- name: --info_file
type: boolean_true
description: |
Write information about each read and its adapter matches
into info.txt in the output directory.
See the documentation for the file format.
# - name: -Z
# - name: --rest_file
# - name: --wildcard-file
# - name: --too_short_output
# - name: --too_long_output
# - name: --untrimmed_output
# - name: --untrimmed_paired_output
# - name: too_short_paired_output
# - name: too_long_paired_output
- name: Debug
arguments:
- type: boolean_true
name: --debug
description: Print debug information
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: python:3.12
setup:
- type: python
pip:
- cutadapt
- type: docker
run: |
cutadapt --version | sed 's/\(.*\)/cutadapt: "\1"/' > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

218
src/cutadapt/help.txt Normal file
View File

@@ -0,0 +1,218 @@
cutadapt version 4.6
Copyright (C) 2010 Marcel Martin <marcel.martin@scilifelab.se> and contributors
Cutadapt removes adapter sequences from high-throughput sequencing reads.
Usage:
cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq
For paired-end reads:
cutadapt -a ADAPT1 -A ADAPT2 [options] -o out1.fastq -p out2.fastq in1.fastq in2.fastq
Replace "ADAPTER" with the actual sequence of your 3' adapter. IUPAC wildcard
characters are supported. All reads from input.fastq will be written to
output.fastq with the adapter sequence removed. Adapter matching is
error-tolerant. Multiple adapter sequences can be given (use further -a
options), but only the best-matching adapter will be removed.
Input may also be in FASTA format. Compressed input and output is supported and
auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for
standard input/output. Without the -o option, output is sent to standard output.
Citation:
Marcel Martin. Cutadapt removes adapter sequences from high-throughput
sequencing reads. EMBnet.Journal, 17(1):10-12, May 2011.
http://dx.doi.org/10.14806/ej.17.1.200
Run "cutadapt --help" to see all command-line options.
See https://cutadapt.readthedocs.io/ for full documentation.
Options:
-h, --help Show this help message and exit
--version Show version number and exit
--debug Print debug log. Use twice to also print DP matrices
-j CORES, --cores CORES
Number of CPU cores to use. Use 0 to auto-detect. Default:
1
Finding adapters:
Parameters -a, -g, -b specify adapters to be removed from each read (or from
R1 if data is paired-end. If specified multiple times, only the best matching
adapter is trimmed (but see the --times option). Use notation 'file:FILE' to
read adapter sequences from a FASTA file.
-a ADAPTER, --adapter ADAPTER
Sequence of an adapter ligated to the 3' end (paired data:
of the first read). The adapter and subsequent bases are
trimmed. If a '$' character is appended ('anchoring'), the
adapter is only found if it is a suffix of the read.
-g ADAPTER, --front ADAPTER
Sequence of an adapter ligated to the 5' end (paired data:
of the first read). The adapter and any preceding bases
are trimmed. Partial matches at the 5' end are allowed. If
a '^' character is prepended ('anchoring'), the adapter is
only found if it is a prefix of the read.
-b ADAPTER, --anywhere ADAPTER
Sequence of an adapter that may be ligated to the 5' or 3'
end (paired data: of the first read). Both types of
matches as described under -a and -g are allowed. If the
first base of the read is part of the match, the behavior
is as with -g, otherwise as with -a. This option is mostly
for rescuing failed library preparations - do not use if
you know which end your adapter was ligated to!
-e E, --error-rate E, --errors E
Maximum allowed error rate (if 0 <= E < 1), or absolute
number of errors for full-length adapter match (if E is an
integer >= 1). Error rate = no. of errors divided by
length of matching region. Default: 0.1 (10%)
--no-indels Allow only mismatches in alignments. Default: allow both
mismatches and indels
-n COUNT, --times COUNT
Remove up to COUNT adapters from each read. Default: 1
-O MINLENGTH, --overlap MINLENGTH
Require MINLENGTH overlap between read and adapter for an
adapter to be found. Default: 3
--match-read-wildcards
Interpret IUPAC wildcards in reads. Default: False
-N, --no-match-adapter-wildcards
Do not interpret IUPAC wildcards in adapters.
--action {trim,retain,mask,lowercase,none}
What to do if a match was found. trim: trim adapter and
up- or downstream sequence; retain: trim, but retain
adapter; mask: replace with 'N' characters; lowercase:
convert to lowercase; none: leave unchanged. Default: trim
--rc, --revcomp Check both the read and its reverse complement for adapter
matches. If match is on reverse-complemented version,
output that one. Default: check only read
Additional read modifications:
-u LEN, --cut LEN Remove LEN bases from each read (or R1 if paired; use -U
option for R2). If LEN is positive, remove bases from the
beginning. If LEN is negative, remove bases from the end.
Can be used twice if LENs have different signs. Applied
*before* adapter trimming.
--nextseq-trim 3'CUTOFF
NextSeq-specific quality trimming (each read). Trims also
dark cycles appearing as high-quality G bases.
-q [5'CUTOFF,]3'CUTOFF, --quality-cutoff [5'CUTOFF,]3'CUTOFF
Trim low-quality bases from 5' and/or 3' ends of each read
before adapter removal. Applied to both reads if data is
paired. If one value is given, only the 3' end is trimmed.
If two comma-separated cutoffs are given, the 5' end is
trimmed with the first cutoff, the 3' end with the second.
--quality-base N Assume that quality values in FASTQ are encoded as
ascii(quality + N). This needs to be set to 64 for some
old Illumina FASTQ files. Default: 33
--poly-a Trim poly-A tails
--length LENGTH, -l LENGTH
Shorten reads to LENGTH. Positive values remove bases at
the end while negative ones remove bases at the beginning.
This and the following modifications are applied after
adapter trimming.
--trim-n Trim N's on ends of reads.
--length-tag TAG Search for TAG followed by a decimal number in the
description field of the read. Replace the decimal number
with the correct length of the trimmed read. For example,
use --length-tag 'length=' to correct fields like
'length=123'.
--strip-suffix STRIP_SUFFIX
Remove this suffix from read names if present. Can be
given multiple times.
-x PREFIX, --prefix PREFIX
Add this prefix to read names. Use {name} to insert the
name of the matching adapter.
-y SUFFIX, --suffix SUFFIX
Add this suffix to read names; can also include {name}
--rename TEMPLATE Rename reads using TEMPLATE containing variables such as
{id}, {adapter_name} etc. (see documentation)
--zero-cap, -z Change negative quality values to zero.
Filtering of processed reads:
Filters are applied after above read modifications. Paired-end reads are
always discarded pairwise (see also --pair-filter).
-m LEN[:LEN2], --minimum-length LEN[:LEN2]
Discard reads shorter than LEN. Default: 0
-M LEN[:LEN2], --maximum-length LEN[:LEN2]
Discard reads longer than LEN. Default: no limit
--max-n COUNT Discard reads with more than COUNT 'N' bases. If COUNT is
a number between 0 and 1, it is interpreted as a fraction
of the read length.
--max-expected-errors ERRORS, --max-ee ERRORS
Discard reads whose expected number of errors (computed
from quality values) exceeds ERRORS.
--max-average-error-rate ERROR_RATE, --max-aer ERROR_RATE
as --max-expected-errors (see above), but divided by
length to account for reads of varying length.
--discard-trimmed, --discard
Discard reads that contain an adapter. Use also -O to
avoid discarding too many randomly matching reads.
--discard-untrimmed, --trimmed-only
Discard reads that do not contain an adapter.
--discard-casava Discard reads that did not pass CASAVA filtering (header
has :Y:).
Output:
--quiet Print only error messages.
--report {full,minimal}
Which type of report to print: 'full' or 'minimal'.
Default: full
--json FILE Dump report in JSON format to FILE
-o FILE, --output FILE
Write trimmed reads to FILE. FASTQ or FASTA format is
chosen depending on input. Summary report is sent to
standard output. Use '{name}' for demultiplexing (see
docs). Default: write to standard output
--fasta Output FASTA to standard output even on FASTQ input.
-Z Use compression level 1 for gzipped output files (faster,
but uses more space)
--info-file FILE Write information about each read and its adapter matches
into FILE. See the documentation for the file format.
-r FILE, --rest-file FILE
When the adapter matches in the middle of a read, write
the rest (after the adapter) to FILE.
--wildcard-file FILE When the adapter has N wildcard bases, write adapter bases
matching wildcard positions to FILE. (Inaccurate with
indels.)
--too-short-output FILE
Write reads that are too short (according to length
specified by -m) to FILE. Default: discard reads
--too-long-output FILE
Write reads that are too long (according to length
specified by -M) to FILE. Default: discard reads
--untrimmed-output FILE
Write reads that do not contain any adapter to FILE.
Default: output to same file as trimmed reads
Paired-end options:
The -A/-G/-B/-U/-Q options work like their lowercase counterparts, but are
applied to R2 (second read in pair)
-A ADAPTER 3' adapter to be removed from R2
-G ADAPTER 5' adapter to be removed from R2
-B ADAPTER 5'/3 adapter to be removed from R2
-U LENGTH Remove LENGTH bases from R2
-Q [5'CUTOFF,]3'CUTOFF
Quality-trimming cutoff for R2. Default: same as for R1
-p FILE, --paired-output FILE
Write R2 to FILE.
--pair-adapters Treat adapters given with -a/-A etc. as pairs. Either both
or none are removed from each read pair.
--pair-filter {any,both,first}
Which of the reads in a paired-end read have to match the
filtering criterion in order for the pair to be filtered.
Default: any
--interleaved Read and/or write interleaved paired-end reads.
--untrimmed-paired-output FILE
Write second read in a pair to this FILE when no adapter
was found. Use with --untrimmed-output. Default: output to
same file as trimmed reads
--too-short-paired-output FILE
Write second read in a pair to this file if pair is too
short.
--too-long-paired-output FILE
Write second read in a pair to this file if pair is too
long.

237
src/cutadapt/script.sh Normal file
View File

@@ -0,0 +1,237 @@
#!/bin/bash
## VIASH START
par_adapter='AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;GGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
par_input='src/cutadapt/test_data/se/a.fastq'
par_report='full'
par_json='false'
par_fasta='false'
par_info_file='false'
par_debug='true'
## VIASH END
function debug {
[[ "$par_debug" == "true" ]] && echo "DEBUG: $@"
}
output_dir=$(dirname $par_output)
[[ ! -d $output_dir ]] && mkdir -p $output_dir
# Init
###########################################################
echo ">> Paired-end data or not?"
mode=""
if [[ -z $par_input_r2 ]]; then
mode="se"
echo " Single end"
input="$par_input"
else
echo " Paired end"
mode="pe"
input="$par_input $par_input_r2"
fi
# Adapter arguments
# - paired and single-end
# - string and fasta
###########################################################
function add_flags {
local arg=$1
local flag=$2
local prefix=$3
[[ -z $prefix ]] && prefix=""
# This function should not be called if the input is empty
# but check for it just in case
if [[ -z $arg ]]; then
return
fi
local output=""
IFS=';' read -r -a array <<< "$arg"
for a in "${array[@]}"; do
output="$output $flag $prefix$a"
done
echo $output
}
debug ">> Parsing arguments dealing with adapters"
adapter_args=$(echo \
${par_adapter:+$(add_flags "$par_adapter" "--adapter")} \
${par_adapter_fasta:+$(add_flags "$par_adapter_fasta" "--adapter" "file:")} \
${par_front:+$(add_flags "$par_front" "--front")} \
${par_front_fasta:+$(add_flags "$par_front_fasta" "--front" "file:")} \
${par_anywhere:+$(add_flags "$par_anywhere" "--anywhere")} \
${par_anywhere_fasta:+$(add_flags "$par_anywhere_fasta" "--anywhere" "file:")} \
${par_adapter_r2:+$(add_flags "$par_adapter_r2" "-A")} \
${par_adapter_fasta_r2:+$(add_flags "$par_adapter_fasta_r2" "-A" "file:")} \
${par_front_r2:+$(add_flags "$par_front_r2" "-G")} \
${par_front_fasta_r2:+$(add_flags "$par_front_fasta_r2" "-G" "file:")} \
${par_anywhere_r2:+$(add_flags "$par_anywhere_r2" "-B")} \
${par_anywhere_fasta_r2:+$(add_flags "$par_anywhere_fasta_r2" "-B" "file:")} \
)
debug "Arguments to cutadapt:"
debug "$adapter_args"
debug
# Paired-end options
###########################################################
echo ">> Parsing arguments for paired-end reads"
[[ "$par_pair_adapters" == "false" ]] && unset par_pair_adapters
[[ "$par_interleaved" == "false" ]] && unset par_interleaved
paired_args=$(echo \
${par_pair_adapters:+--pair-adapters} \
${par_pair_filter:+--pair-filter "${par_pair_filter}"} \
${par_interleaved:+--interleaved}
)
debug "Arguments to cutadapt:"
debug $paired_args
debug
# Input arguments
###########################################################
echo ">> Parsing input arguments"
[[ "$par_no_indels" == "true" ]] && unset par_no_indels
[[ "$par_match_read_wildcards" == "false" ]] && unset par_match_read_wildcards
[[ "$par_no_match_adapter_wildcards" == "true" ]] && unset par_no_match_adapter_wildcards
[[ "$par_revcomp" == "false" ]] && unset par_revcomp
input_args=$(echo \
${par_error_rate:+--error-rate "${par_error_rate}"} \
${par_no_indels:+--no-indels} \
${par_times:+--times "${par_times}"} \
${par_overlap:+--overlap "${par_overlap}"} \
${par_match_read_wildcards:+--match-read-wildcards} \
${par_no_match_adapter_wildcards:+--no-match-adapter-wildcards} \
${par_action:+--action "${par_action}"} \
${par_revcomp:+--revcomp} \
)
debug "Arguments to cutadapt:"
debug $input_args
debug
# Read modifications
###########################################################
echo ">> Parsing read modification arguments"
[[ "$par_poly_a" == "false" ]] && unset par_poly_a
[[ "$par_trim_n" == "false" ]] && unset par_trim_n
[[ "$par_zero_cap" == "false" ]] && unset par_zero_cap
mod_args=$(echo \
${par_cut:+--cut "${par_cut}"} \
${par_cut_r2:+--cut_r2 "${par_cut_r2}"} \
${par_nextseq_trim:+--nextseq-trim "${par_nextseq_trim}"} \
${par_quality_cutoff:+--quality-cutoff "${par_quality_cutoff}"} \
${par_quality_cutoff_r2:+--quality-cutoff_r2 "${par_quality_cutoff_r2}"} \
${par_quality_base:+--quality-base "${par_quality_base}"} \
${par_poly_a:+--poly-a} \
${par_length:+--length "${par_length}"} \
${par_trim_n:+--trim-n} \
${par_length_tag:+--length-tag "${par_length_tag}"} \
${par_strip_suffix:+--strip-suffix "${par_strip_suffix}"} \
${par_prefix:+--prefix "${par_prefix}"} \
${par_suffix:+--suffix "${par_suffix}"} \
${par_rename:+--rename "${par_rename}"} \
${par_zero_cap:+--zero-cap} \
)
debug "Arguments to cutadapt:"
debug $mod_args
debug
# Filtering of processed reads arguments
###########################################################
echo ">> Filtering of processed reads arguments"
[[ "$par_discard_trimmed" == "false" ]] && unset par_discard_trimmed
[[ "$par_discard_untrimmed" == "false" ]] && unset par_discard_untrimmed
[[ "$par_discard_casava" == "false" ]] && unset par_discard_casava
# Parse and transform the minimum and maximum length arguments
[[ -z $par_minimum_length ]]
filter_args=$(echo \
${par_minimum_length:+--minimum-length "${par_minimum_length}"} \
${par_maximum_length:+--maximum-length "${par_maximum_length}"} \
${par_max_n:+--max-n "${par_max_n}"} \
${par_max_expected_errors:+--max-expected-errors "${par_max_expected_errors}"} \
${par_max_average_error_rate:+--max-average-error-rate "${par_max_average_error_rate}"} \
${par_discard_trimmed:+--discard-trimmed} \
${par_discard_untrimmed:+--discard-untrimmed} \
${par_discard_casava:+--discard-casava} \
)
debug "Arguments to cutadapt:"
debug $filter_args
debug
# Optional output arguments
###########################################################
echo ">> Optional arguments"
[[ "$par_json" == "false" ]] && unset par_json
[[ "$par_fasta" == "false" ]] && unset par_fasta
[[ "$par_info_file" == "false" ]] && unset par_info_file
optional_output_args=$(echo \
${par_report:+--report "${par_report}"} \
${par_json:+--json "report.json"} \
${par_fasta:+--fasta} \
${par_info_file:+--info-file "info.txt"} \
)
debug "Arguments to cutadapt:"
debug $optional_output_args
debug
# Output arguments
# We write the output to a directory rather than
# individual files.
###########################################################
if [[ -z $par_fasta ]]; then
ext="fastq"
else
ext="fasta"
fi
if [ $mode = "se" ]; then
output_args=$(echo \
--output "$output_dir/{name}_001.$ext" \
)
else
output_args=$(echo \
--output "$output_dir/{name}_R1_001.$ext" \
--paired-output "$output_dir/{name}_R2_001.$ext" \
)
fi
debug "Arguments to cutadapt:"
debug $output_args
debug
# Full CLI
# Set the --cores argument to 0 unless meta_cpus is set
###########################################################
echo ">> Running cutadapt"
par_cpus=0
[[ ! -z $meta_cpus ]] && par_cpus=$meta_cpus
cli=$(echo \
$input \
$adapter_args \
$paired_args \
$input_args \
$mod_args \
$filter_args \
$optional_output_args \
$output_args \
--cores $par_cpus
)
debug ">> Full CLI to be run:"
debug cutadapt $cli | sed -e 's/--/\r\n --/g'
debug
cutadapt $cli

256
src/cutadapt/test.sh Normal file
View File

@@ -0,0 +1,256 @@
#!/bin/bash
set -e
#############################################
# helper functions
assert_file_exists() {
[ -f "$1" ] || (echo "File '$1' does not exist" && exit 1)
}
assert_file_doesnt_exist() {
[ ! -f "$1" ] || (echo "File '$1' exists but shouldn't" && exit 1)
}
assert_file_empty() {
[ ! -s "$1" ] || (echo "File '$1' is not empty but should be" && exit 1)
}
assert_file_not_empty() {
[ -s "$1" ] || (echo "File '$1' is empty but shouldn't be" && exit 1)
}
assert_file_contains() {
grep -q "$2" "$1" || (echo "File '$1' does not contain '$2'" && exit 1)
}
assert_file_not_contains() {
grep -q "$2" "$1" && (echo "File '$1' contains '$2' but shouldn't" && exit 1)
}
#############################################
mkdir test_multiple_output
cd test_multiple_output
echo "#############################################"
echo "> Run cutadapt with multiple outputs"
cat > example.fa <<'EOF'
>read1
MYSEQUENCEADAPTER
>read2
MYSEQUENCEADAP
>read3
MYSEQUENCEADAPTERSOMETHINGELSE
>read4
MYSEQUENCEADABTER
>read5
MYSEQUENCEADAPTR
>read6
MYSEQUENCEADAPPTER
>read7
ADAPTERMYSEQUENCE
>read8
PTERMYSEQUENCE
>read9
SOMETHINGADAPTERMYSEQUENCE
EOF
"$meta_executable" \
--report minimal \
--output "out_test/*.fasta" \
--adapter ADAPTER \
--input example.fa \
--fasta \
--no_match_adapter_wildcards \
--json
echo ">> Checking output"
assert_file_exists "report.json"
assert_file_exists "out_test/1_001.fasta"
assert_file_exists "out_test/unknown_001.fasta"
cd ..
echo
#############################################
mkdir test_simple_single_end
cd test_simple_single_end
echo "#############################################"
echo "> Run cutadapt on single-end data"
cat > example.fa <<'EOF'
>read1
MYSEQUENCEADAPTER
>read2
MYSEQUENCEADAP
>read3
MYSEQUENCEADAPTERSOMETHINGELSE
>read4
MYSEQUENCEADABTER
>read5
MYSEQUENCEADAPTR
>read6
MYSEQUENCEADAPPTER
>read7
ADAPTERMYSEQUENCE
>read8
PTERMYSEQUENCE
>read9
SOMETHINGADAPTERMYSEQUENCE
EOF
"$meta_executable" \
--report minimal \
--output "out_test1/*.fasta" \
--adapter ADAPTER \
--input example.fa \
--fasta \
--no_match_adapter_wildcards \
--json
echo ">> Checking output"
assert_file_exists "report.json"
assert_file_exists "out_test1/1_001.fasta"
assert_file_exists "out_test1/unknown_001.fasta"
echo ">> Check if output is empty"
assert_file_not_empty "report.json"
assert_file_not_empty "out_test1/1_001.fasta"
assert_file_not_empty "out_test1/unknown_001.fasta"
echo ">> Check contents"
for i in 1 2 3 7 9; do
assert_file_contains "out_test1/1_001.fasta" ">read$i"
done
for i in 4 5 6 8; do
assert_file_contains "out_test1/unknown_001.fasta" ">read$i"
done
cd ..
echo
#############################################
mkdir test_multiple_single_end
cd test_multiple_single_end
echo "#############################################"
echo "> Run with a combination of inputs"
cat > example.fa <<'EOF'
>read1
ACGTACGTACGTAAAAA
>read2
ACGTACGTACGTCCCCC
>read3
ACGTACGTACGTGGGGG
>read4
ACGTACGTACGTTTTTT
EOF
cat > adapters1.fasta <<'EOF'
>adapter1
CCCCC
EOF
cat > adapters2.fasta <<'EOF'
>adapter2
GGGGG
EOF
"$meta_executable" \
--report minimal \
--output "out_test2/*.fasta" \
--adapter AAAAA \
--adapter_fasta adapters1.fasta \
--adapter_fasta adapters2.fasta \
--input example.fa \
--fasta \
--json
echo ">> Checking output"
assert_file_exists "report.json"
assert_file_exists "out_test2/1_001.fasta"
assert_file_exists "out_test2/adapter1_001.fasta"
assert_file_exists "out_test2/adapter2_001.fasta"
assert_file_exists "out_test2/unknown_001.fasta"
echo ">> Check if output is empty"
assert_file_not_empty "report.json"
assert_file_not_empty "out_test2/1_001.fasta"
assert_file_not_empty "out_test2/adapter1_001.fasta"
assert_file_not_empty "out_test2/adapter2_001.fasta"
assert_file_not_empty "out_test2/unknown_001.fasta"
echo ">> Check contents"
assert_file_contains "out_test2/1_001.fasta" ">read1"
assert_file_contains "out_test2/adapter1_001.fasta" ">read2"
assert_file_contains "out_test2/adapter2_001.fasta" ">read3"
assert_file_contains "out_test2/unknown_001.fasta" ">read4"
cd ..
echo
#############################################
mkdir test_simple_paired_end
cd test_simple_paired_end
echo "#############################################"
echo "> Run cutadapt on paired-end data"
cat > example_R1.fastq <<'EOF'
@read1
ACGTACGTACGTAAAAA
+
IIIIIIIIIIIIIIIII
@read2
ACGTACGTACGTCCCCC
+
IIIIIIIIIIIIIIIII
EOF
cat > example_R2.fastq <<'EOF'
@read1
ACGTACGTACGTGGGGG
+
IIIIIIIIIIIIIIIII
@read2
ACGTACGTACGTTTTTT
+
IIIIIIIIIIIIIIIII
EOF
"$meta_executable" \
--report minimal \
--output "out_test3/*.fastq" \
--adapter AAAAA \
--adapter_r2 GGGGG \
--input example_R1.fastq \
--input_r2 example_R2.fastq \
--quality_cutoff 20 \
--json \
---cpus 1
echo ">> Checking output"
assert_file_exists "report.json"
assert_file_exists "out_test3/1_R1_001.fastq"
assert_file_exists "out_test3/1_R2_001.fastq"
assert_file_exists "out_test3/unknown_R1_001.fastq"
assert_file_exists "out_test3/unknown_R2_001.fastq"
echo ">> Check if output is empty"
assert_file_not_empty "report.json"
assert_file_not_empty "out_test3/1_R1_001.fastq"
assert_file_not_empty "out_test3/1_R2_001.fastq"
assert_file_not_empty "out_test3/unknown_R1_001.fastq"
echo ">> Check contents"
assert_file_contains "out_test3/1_R1_001.fastq" "@read1"
assert_file_contains "out_test3/1_R2_001.fastq" "@read1"
assert_file_contains "out_test3/unknown_R1_001.fastq" "@read2"
assert_file_contains "out_test3/unknown_R2_001.fastq" "@read2"
cd ..
echo
#############################################
echo "#############################################"
echo "> Test successful"

11
src/salmon/salmon_quant/config.vsh.yaml
View File

@@ -42,7 +42,7 @@ argument_groups:
type: file
description: |
Salmon index.
required: true
required: false
example: transcriptome_index
- name: --unmated_reads
alternatives: ["-r"]
@@ -320,12 +320,15 @@ argument_groups:
example: 0.00001
- name: --write_mappings
alternatives: ["-z"]
type: file
direction: output
type: boolean_true
description: |
If this option is provided, then the selective-alignment results will be written out in SAM-compatible format. By default, output will be directed to stdout, but an alternative file name can be provided instead.
- name: --mapping_sam
type: file
description: Path to file that should output the selective-alignment results in SAM-compatible format. THis option must be provided while using --write_mappings
required: false
example: mappings.sam
direction: output
example: mappings.sam
- name: --write_qualities
type: boolean_true
description: |

3
src/salmon/salmon_quant/script.sh
View File

@@ -21,6 +21,7 @@ set -e
[[ "$par_softclip_overhangs" == "false" ]] && unset par_softclip_overhangs
[[ "$par_full_length_alignment" == "false" ]] && unset par_full_length_alignment
[[ "$par_hard_filter" == "false" ]] && unset par_hard_filter
[[ "$par_write_mappings" == "false" ]] && unset par_write_mappings
[[ "$par_write_qualities" == "false" ]] && unset par_write_qualities
[[ "$par_alternative_init_mode" == "false" ]] && unset par_alternative_init_mode
[[ "$par_skip_quant" == "false" ]] && unset par_skip_quant
@@ -96,7 +97,7 @@ salmon quant \
${par_full_length_alignment:+--fullLengthAlignment} \
${par_hard_filter:+--hardFilter} \
${par_min_aln_prob:+--minAlnProb "${par_min_aln_prob}"} \
${par_write_mappings:+-z "${par_write_mappings}"} \
${par_write_mappings:+--write_mappings="${par_mappings_sam}"} \
${par_write_qualities:+--writeQualities} \
${par_hit_filter_policy:+--hitFilterPolicy "${par_hit_filter_policy}"} \
${par_alternative_init_mode:+--alternativeInitMode} \

139
src/star/star_genome_generate/config.vsh.yaml Normal file
View File

@@ -0,0 +1,139 @@
name: star_genome_generate
namespace: star
description: |
Create index for STAR
keywords: [genome, index, align]
links:
repository: https://github.com/alexdobin/STAR
documentation: https://github.com/alexdobin/STAR/blob/master/doc/STARmanual.pdf
references:
doi: 10.1093/bioinformatics/bts635
license: MIT
requirements:
commands: [ STAR ]
argument_groups:
- name: "Input"
arguments:
- name: "--genomeFastaFiles"
type: file
description: |
Path(s) to the fasta files with the genome sequences, separated by spaces. These files should be plain text FASTA files, they *cannot* be zipped.
required: true
multiple: yes
multiple_sep: ;
- name: "--sjdbGTFfile"
type: file
description: Path to the GTF file with annotations
- name: --sjdbOverhang
type: integer
description: Length of the donor/acceptor sequence on each side of the junctions, ideally = (mate_length - 1)
example: 100
- name: --sjdbGTFchrPrefix
type: string
description: Prefix for chromosome names in a GTF file (e.g. 'chr' for using ENSMEBL annotations with UCSC genomes)
- name: --sjdbGTFfeatureExon
type: string
description: Feature type in GTF file to be used as exons for building transcripts
example: exon
- name: --sjdbGTFtagExonParentTranscript
type: string
description: GTF attribute name for parent transcript ID (default "transcript_id" works for GTF files)
example: transcript_id
- name: --sjdbGTFtagExonParentGene
type: string
description: GTF attribute name for parent gene ID (default "gene_id" works for GTF files)
example: gene_id
- name: --sjdbGTFtagExonParentGeneName
type: string
description: GTF attribute name for parent gene name
example: gene_name
multiple: yes
multiple_sep: ;
- name: --sjdbGTFtagExonParentGeneType
type: string
description: GTF attribute name for parent gene type
example:
- gene_type
- gene_biotype
multiple: yes
multiple_sep: ;
- name: --limitGenomeGenerateRAM
type: long
description: Maximum available RAM (bytes) for genome generation
example: '31000000000'
- name: --genomeSAindexNbases
type: integer
description: Length (bases) of the SA pre-indexing string. Typically between 10 and 15. Longer strings will use much more memory, but allow faster searches. For small genomes, this parameter must be scaled down to min(14, log2(GenomeLength)/2 - 1).
example: 14
- name: --genomeChrBinNbits
type: integer
description: Defined as log2(chrBin), where chrBin is the size of the bins for genome storage. Each chromosome will occupy an integer number of bins. For a genome with large number of contigs, it is recommended to scale this parameter as min(18, log2[max(GenomeLength/NumberOfReferences,ReadLength)]).
example: 18
- name: --genomeSAsparseD
type: integer
min: 0
example: 1
description: Suffux array sparsity, i.e. distance between indices. Use bigger numbers to decrease needed RAM at the cost of mapping speed reduction.
- name: --genomeSuffixLengthMax
type: integer
description: Maximum length of the suffixes, has to be longer than read length. Use -1 for infinite length.
example: -1
- name: --genomeTransformType
type: string
description: |
Type of genome transformation
None ... no transformation
Haploid ... replace reference alleles with alternative alleles from VCF file (e.g. consensus allele)
Diploid ... create two haplotypes for each chromosome listed in VCF file, for genotypes 1|2, assumes perfect phasing (e.g. personal genome)
example: None
- name: --genomeTransformVCF
type: file
description: path to VCF file for genome transformation
- name: "Output"
arguments:
- name: "--index"
type: file
direction: output
description: STAR index directory.
default: STAR_index
required: true
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: ubuntu:22.04
setup:
# setup derived from https://github.com/alexdobin/STAR/blob/master/extras/docker/Dockerfile
- type: docker
env:
- STAR_VERSION 2.7.11b
- PACKAGES gcc g++ make wget zlib1g-dev unzip xxd
run: |
apt-get update && \
apt-get install -y --no-install-recommends ${PACKAGES} && \
cd /tmp && \
wget --no-check-certificate https://github.com/alexdobin/STAR/archive/refs/tags/${STAR_VERSION}.zip && \
unzip ${STAR_VERSION}.zip && \
cd STAR-${STAR_VERSION}/source && \
make STARstatic CXXFLAGS_SIMD=-std=c++11 && \
cp STAR /usr/local/bin && \
cd / && \
rm -rf /tmp/STAR-${STAR_VERSION} /tmp/${STAR_VERSION}.zip && \
apt-get --purge autoremove -y ${PACKAGES} && \
apt-get clean
- type: docker
run: |
STAR --version | sed 's#\(.*\)#star: "\1"#' > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

927
src/star/star_genome_generate/help.txt Normal file
View File

@@ -0,0 +1,927 @@
Usage: STAR [options]... --genomeDir /path/to/genome/index/ --readFilesIn R1.fq R2.fq
Spliced Transcripts Alignment to a Reference (c) Alexander Dobin, 2009-2022
STAR version=2.7.11b
STAR compilation time,server,dir=2024-02-11T19:36:26+00:00 :/tmp/STAR-2.7.11b/source
For more details see:
<https://github.com/alexdobin/STAR>
<https://github.com/alexdobin/STAR/blob/master/doc/STARmanual.pdf>
### versions
versionGenome 2.7.4a
string: earliest genome index version compatible with this STAR release. Please do not change this value!
### Parameter Files
parametersFiles -
string: name of a user-defined parameters file, "-": none. Can only be defined on the command line.
### System
sysShell -
string: path to the shell binary, preferably bash, e.g. /bin/bash.
- ... the default shell is executed, typically /bin/sh. This was reported to fail on some Ubuntu systems - then you need to specify path to bash.
### Run Parameters
runMode alignReads
string: type of the run.
alignReads ... map reads
genomeGenerate ... generate genome files
inputAlignmentsFromBAM ... input alignments from BAM. Presently only works with --outWigType and --bamRemoveDuplicates options.
liftOver ... lift-over of GTF files (--sjdbGTFfile) between genome assemblies using chain file(s) from --genomeChainFiles.
soloCellFiltering </path/to/raw/count/dir/> </path/to/output/prefix> ... STARsolo cell filtering ("calling") without remapping, followed by the path to raw count directory and output (filtered) prefix
runThreadN 1
int: number of threads to run STAR
runDirPerm User_RWX
string: permissions for the directories created at the run-time.
User_RWX ... user-read/write/execute
All_RWX ... all-read/write/execute (same as chmod 777)
runRNGseed 777
int: random number generator seed.
### Genome Parameters
genomeDir ./GenomeDir/
string: path to the directory where genome files are stored (for --runMode alignReads) or will be generated (for --runMode generateGenome)
genomeLoad NoSharedMemory
string: mode of shared memory usage for the genome files. Only used with --runMode alignReads.
LoadAndKeep ... load genome into shared and keep it in memory after run
LoadAndRemove ... load genome into shared but remove it after run
LoadAndExit ... load genome into shared memory and exit, keeping the genome in memory for future runs
Remove ... do not map anything, just remove loaded genome from memory
NoSharedMemory ... do not use shared memory, each job will have its own private copy of the genome
genomeFastaFiles -
string(s): path(s) to the fasta files with the genome sequences, separated by spaces. These files should be plain text FASTA files, they *cannot* be zipped.
Required for the genome generation (--runMode genomeGenerate). Can also be used in the mapping (--runMode alignReads) to add extra (new) sequences to the genome (e.g. spike-ins).
genomeChainFiles -
string: chain files for genomic liftover. Only used with --runMode liftOver .
genomeFileSizes 0
uint(s)>0: genome files exact sizes in bytes. Typically, this should not be defined by the user.
genomeTransformOutput None
string(s): which output to transform back to original genome
SAM ... SAM/BAM alignments
SJ ... splice junctions (SJ.out.tab)
Quant ... quantifications (from --quantMode option)
None ... no transformation of the output
genomeChrSetMitochondrial chrM M MT
string(s): names of the mitochondrial chromosomes. Presently only used for STARsolo statistics output/
### Genome Indexing Parameters - only used with --runMode genomeGenerate
genomeChrBinNbits 18
int: =log2(chrBin), where chrBin is the size of the bins for genome storage: each chromosome will occupy an integer number of bins. For a genome with large number of contigs, it is recommended to scale this parameter as min(18, log2[max(GenomeLength/NumberOfReferences,ReadLength)]).
genomeSAindexNbases 14
int: length (bases) of the SA pre-indexing string. Typically between 10 and 15. Longer strings will use much more memory, but allow faster searches. For small genomes, the parameter --genomeSAindexNbases must be scaled down to min(14, log2(GenomeLength)/2 - 1).
genomeSAsparseD 1
int>0: suffux array sparsity, i.e. distance between indices: use bigger numbers to decrease needed RAM at the cost of mapping speed reduction
genomeSuffixLengthMax -1
int: maximum length of the suffixes, has to be longer than read length. -1 = infinite.
genomeTransformType None
string: type of genome transformation
None ... no transformation
Haploid ... replace reference alleles with alternative alleles from VCF file (e.g. consensus allele)
Diploid ... create two haplotypes for each chromosome listed in VCF file, for genotypes 1|2, assumes perfect phasing (e.g. personal genome)
genomeTransformVCF -
string: path to VCF file for genome transformation
#####UnderDevelopment_begin : not supported - do not use
genomeType Full
string: type of genome to generate
Full ... full (normal) genome
Transcriptome ... genome consists of transcript sequences
SuperTransriptome ... genome consists of superTranscript sequences
#####UnderDevelopment_end
# DEPRECATED: please use --genomeTransformVCF and --genomeTransformType options instead.
#genomeConsensusFile -
# string: VCF file with consensus SNPs (i.e. alternative allele is the major (AF>0.5) allele)
# DEPRECATED
### Splice Junctions Database
sjdbFileChrStartEnd -
string(s): path to the files with genomic coordinates (chr <tab> start <tab> end <tab> strand) for the splice junction introns. Multiple files can be supplied and will be concatenated.
sjdbGTFfile -
string: path to the GTF file with annotations
sjdbGTFchrPrefix -
string: prefix for chromosome names in a GTF file (e.g. 'chr' for using ENSMEBL annotations with UCSC genomes)
sjdbGTFfeatureExon exon
string: feature type in GTF file to be used as exons for building transcripts
sjdbGTFtagExonParentTranscript transcript_id
string: GTF attribute name for parent transcript ID (default "transcript_id" works for GTF files)
sjdbGTFtagExonParentGene gene_id
string: GTF attribute name for parent gene ID (default "gene_id" works for GTF files)
sjdbGTFtagExonParentGeneName gene_name
string(s): GTF attribute name for parent gene name
sjdbGTFtagExonParentGeneType gene_type gene_biotype
string(s): GTF attribute name for parent gene type
sjdbOverhang 100
int>0: length of the donor/acceptor sequence on each side of the junctions, ideally = (mate_length - 1)
sjdbScore 2
int: extra alignment score for alignments that cross database junctions
sjdbInsertSave Basic
string: which files to save when sjdb junctions are inserted on the fly at the mapping step
Basic ... only small junction / transcript files
All ... all files including big Genome, SA and SAindex - this will create a complete genome directory
### Variation parameters
varVCFfile -
string: path to the VCF file that contains variation data. The 10th column should contain the genotype information, e.g. 0/1
### Input Files
inputBAMfile -
string: path to BAM input file, to be used with --runMode inputAlignmentsFromBAM
### Read Parameters
readFilesType Fastx
string: format of input read files
Fastx ... FASTA or FASTQ
SAM SE ... SAM or BAM single-end reads; for BAM use --readFilesCommand samtools view
SAM PE ... SAM or BAM paired-end reads; for BAM use --readFilesCommand samtools view
readFilesSAMattrKeep All
string(s): for --readFilesType SAM SE/PE, which SAM tags to keep in the output BAM, e.g.: --readFilesSAMtagsKeep RG PL
All ... keep all tags
None ... do not keep any tags
readFilesIn Read1 Read2
string(s): paths to files that contain input read1 (and, if needed, read2)
readFilesManifest -
string: path to the "manifest" file with the names of read files. The manifest file should contain 3 tab-separated columns:
paired-end reads: read1_file_name $tab$ read2_file_name $tab$ read_group_line.
single-end reads: read1_file_name $tab$ - $tab$ read_group_line.
Spaces, but not tabs are allowed in file names.
If read_group_line does not start with ID:, it can only contain one ID field, and ID: will be added to it.
If read_group_line starts with ID:, it can contain several fields separated by $tab$, and all fields will be be copied verbatim into SAM @RG header line.
readFilesPrefix -
string: prefix for the read files names, i.e. it will be added in front of the strings in --readFilesIn
readFilesCommand -
string(s): command line to execute for each of the input file. This command should generate FASTA or FASTQ text and send it to stdout
For example: zcat - to uncompress .gz files, bzcat - to uncompress .bz2 files, etc.
readMapNumber -1
int: number of reads to map from the beginning of the file
-1: map all reads
readMatesLengthsIn NotEqual
string: Equal/NotEqual - lengths of names,sequences,qualities for both mates are the same / not the same. NotEqual is safe in all situations.
readNameSeparator /
string(s): character(s) separating the part of the read names that will be trimmed in output (read name after space is always trimmed)
readQualityScoreBase 33
int>=0: number to be subtracted from the ASCII code to get Phred quality score
### Read Clipping
clipAdapterType Hamming
string: adapter clipping type
Hamming ... adapter clipping based on Hamming distance, with the number of mismatches controlled by --clip5pAdapterMMp
CellRanger4 ... 5p and 3p adapter clipping similar to CellRanger4. Utilizes Opal package by Martin Šošić: https://github.com/Martinsos/opal
None ... no adapter clipping, all other clip* parameters are disregarded
clip3pNbases 0
int(s): number(s) of bases to clip from 3p of each mate. If one value is given, it will be assumed the same for both mates.
clip3pAdapterSeq -
string(s): adapter sequences to clip from 3p of each mate. If one value is given, it will be assumed the same for both mates.
polyA ... polyA sequence with the length equal to read length
clip3pAdapterMMp 0.1
double(s): max proportion of mismatches for 3p adapter clipping for each mate. If one value is given, it will be assumed the same for both mates.
clip3pAfterAdapterNbases 0
int(s): number of bases to clip from 3p of each mate after the adapter clipping. If one value is given, it will be assumed the same for both mates.
clip5pNbases 0
int(s): number(s) of bases to clip from 5p of each mate. If one value is given, it will be assumed the same for both mates.
#####UnderDevelopment_begin : not supported - do not use
clip5pAdapterSeq -
string(s): adapter sequences to clip from 5p of each mate, separated by space.
clip5pAdapterMMp 0.1
double(s): max proportion of mismatches for 5p adapter clipping for each mate, separated by space
clip5pAfterAdapterNbases 0
int(s): number of bases to clip from 5p of each mate after the adapter clipping, separated by space.
#####UnderDevelopment_end
### Limits
limitGenomeGenerateRAM 31000000000
int>0: maximum available RAM (bytes) for genome generation
limitIObufferSize 30000000 50000000
int(s)>0: max available buffers size (bytes) for input/output, per thread
limitOutSAMoneReadBytes 100000
int>0: max size of the SAM record (bytes) for one read. Recommended value: >(2*(LengthMate1+LengthMate2+100)*outFilterMultimapNmax
limitOutSJoneRead 1000
int>0: max number of junctions for one read (including all multi-mappers)
limitOutSJcollapsed 1000000
int>0: max number of collapsed junctions
limitBAMsortRAM 0
int>=0: maximum available RAM (bytes) for sorting BAM. If =0, it will be set to the genome index size. 0 value can only be used with --genomeLoad NoSharedMemory option.
limitSjdbInsertNsj 1000000
int>=0: maximum number of junctions to be inserted to the genome on the fly at the mapping stage, including those from annotations and those detected in the 1st step of the 2-pass run
limitNreadsSoft -1
int: soft limit on the number of reads
### Output: general
outFileNamePrefix ./
string: output files name prefix (including full or relative path). Can only be defined on the command line.
outTmpDir -
string: path to a directory that will be used as temporary by STAR. All contents of this directory will be removed!
- ... the temp directory will default to outFileNamePrefix_STARtmp
outTmpKeep None
string: whether to keep the temporary files after STAR runs is finished
None ... remove all temporary files
All ... keep all files
outStd Log
string: which output will be directed to stdout (standard out)
Log ... log messages
SAM ... alignments in SAM format (which normally are output to Aligned.out.sam file), normal standard output will go into Log.std.out
BAM_Unsorted ... alignments in BAM format, unsorted. Requires --outSAMtype BAM Unsorted
BAM_SortedByCoordinate ... alignments in BAM format, sorted by coordinate. Requires --outSAMtype BAM SortedByCoordinate
BAM_Quant ... alignments to transcriptome in BAM format, unsorted. Requires --quantMode TranscriptomeSAM
outReadsUnmapped None
string: output of unmapped and partially mapped (i.e. mapped only one mate of a paired end read) reads in separate file(s).
None ... no output
Fastx ... output in separate fasta/fastq files, Unmapped.out.mate1/2
outQSconversionAdd 0
int: add this number to the quality score (e.g. to convert from Illumina to Sanger, use -31)
outMultimapperOrder Old_2.4
string: order of multimapping alignments in the output files
Old_2.4 ... quasi-random order used before 2.5.0
Random ... random order of alignments for each multi-mapper. Read mates (pairs) are always adjacent, all alignment for each read stay together. This option will become default in the future releases.
### Output: SAM and BAM
outSAMtype SAM
strings: type of SAM/BAM output
1st word:
BAM ... output BAM without sorting
SAM ... output SAM without sorting
None ... no SAM/BAM output
2nd, 3rd:
Unsorted ... standard unsorted
SortedByCoordinate ... sorted by coordinate. This option will allocate extra memory for sorting which can be specified by --limitBAMsortRAM.
outSAMmode Full
string: mode of SAM output
None ... no SAM output
Full ... full SAM output
NoQS ... full SAM but without quality scores
outSAMstrandField None
string: Cufflinks-like strand field flag
None ... not used
intronMotif ... strand derived from the intron motif. This option changes the output alignments: reads with inconsistent and/or non-canonical introns are filtered out.
outSAMattributes Standard
string(s): a string of desired SAM attributes, in the order desired for the output SAM. Tags can be listed in any combination/order.
***Presets:
None ... no attributes
Standard ... NH HI AS nM
All ... NH HI AS nM NM MD jM jI MC ch
***Alignment:
NH ... number of loci the reads maps to: =1 for unique mappers, >1 for multimappers. Standard SAM tag.
HI ... multiple alignment index, starts with --outSAMattrIHstart (=1 by default). Standard SAM tag.
AS ... local alignment score, +1/-1 for matches/mismateches, score* penalties for indels and gaps. For PE reads, total score for two mates. Stadnard SAM tag.
nM ... number of mismatches. For PE reads, sum over two mates.
NM ... edit distance to the reference (number of mismatched + inserted + deleted bases) for each mate. Standard SAM tag.
MD ... string encoding mismatched and deleted reference bases (see standard SAM specifications). Standard SAM tag.
jM ... intron motifs for all junctions (i.e. N in CIGAR): 0: non-canonical; 1: GT/AG, 2: CT/AC, 3: GC/AG, 4: CT/GC, 5: AT/AC, 6: GT/AT. If splice junctions database is used, and a junction is annotated, 20 is added to its motif value.
jI ... start and end of introns for all junctions (1-based).
XS ... alignment strand according to --outSAMstrandField.
MC ... mate's CIGAR string. Standard SAM tag.
ch ... marks all segment of all chimeric alingments for --chimOutType WithinBAM output.
cN ... number of bases clipped from the read ends: 5' and 3'
***Variation:
vA ... variant allele
vG ... genomic coordinate of the variant overlapped by the read.
vW ... 1 - alignment passes WASP filtering; 2,3,4,5,6,7 - alignment does not pass WASP filtering. Requires --waspOutputMode SAMtag.
ha ... haplotype (1/2) when mapping to the diploid genome. Requires genome generated with --genomeTransformType Diploid .
***STARsolo:
CR CY UR UY ... sequences and quality scores of cell barcodes and UMIs for the solo* demultiplexing.
GX GN ... gene ID and gene name for unique-gene reads.
gx gn ... gene IDs and gene names for unique- and multi-gene reads.
CB UB ... error-corrected cell barcodes and UMIs for solo* demultiplexing. Requires --outSAMtype BAM SortedByCoordinate.
sM ... assessment of CB and UMI.
sS ... sequence of the entire barcode (CB,UMI,adapter).
sQ ... quality of the entire barcode.
sF ... type of feature overlap and number of features for each alignment
***Unsupported/undocumented:
rB ... alignment block read/genomic coordinates.
vR ... read coordinate of the variant.
outSAMattrIHstart 1
int>=0: start value for the IH attribute. 0 may be required by some downstream software, such as Cufflinks or StringTie.
outSAMunmapped None
string(s): output of unmapped reads in the SAM format
1st word:
None ... no output
Within ... output unmapped reads within the main SAM file (i.e. Aligned.out.sam)
2nd word:
KeepPairs ... record unmapped mate for each alignment, and, in case of unsorted output, keep it adjacent to its mapped mate. Only affects multi-mapping reads.
outSAMorder Paired
string: type of sorting for the SAM output
Paired: one mate after the other for all paired alignments
PairedKeepInputOrder: one mate after the other for all paired alignments, the order is kept the same as in the input FASTQ files
outSAMprimaryFlag OneBestScore
string: which alignments are considered primary - all others will be marked with 0x100 bit in the FLAG
OneBestScore ... only one alignment with the best score is primary
AllBestScore ... all alignments with the best score are primary
outSAMreadID Standard
string: read ID record type
Standard ... first word (until space) from the FASTx read ID line, removing /1,/2 from the end
Number ... read number (index) in the FASTx file
outSAMmapqUnique 255
int: 0 to 255: the MAPQ value for unique mappers
outSAMflagOR 0
int: 0 to 65535: sam FLAG will be bitwise OR'd with this value, i.e. FLAG=FLAG | outSAMflagOR. This is applied after all flags have been set by STAR, and after outSAMflagAND. Can be used to set specific bits that are not set otherwise.
outSAMflagAND 65535
int: 0 to 65535: sam FLAG will be bitwise AND'd with this value, i.e. FLAG=FLAG & outSAMflagOR. This is applied after all flags have been set by STAR, but before outSAMflagOR. Can be used to unset specific bits that are not set otherwise.
outSAMattrRGline -
string(s): SAM/BAM read group line. The first word contains the read group identifier and must start with "ID:", e.g. --outSAMattrRGline ID:xxx CN:yy "DS:z z z".
xxx will be added as RG tag to each output alignment. Any spaces in the tag values have to be double quoted.
Comma separated RG lines correspons to different (comma separated) input files in --readFilesIn. Commas have to be surrounded by spaces, e.g.
--outSAMattrRGline ID:xxx , ID:zzz "DS:z z" , ID:yyy DS:yyyy
outSAMheaderHD -
strings: @HD (header) line of the SAM header
outSAMheaderPG -
strings: extra @PG (software) line of the SAM header (in addition to STAR)
outSAMheaderCommentFile -
string: path to the file with @CO (comment) lines of the SAM header
outSAMfilter None
string(s): filter the output into main SAM/BAM files
KeepOnlyAddedReferences ... only keep the reads for which all alignments are to the extra reference sequences added with --genomeFastaFiles at the mapping stage.
KeepAllAddedReferences ... keep all alignments to the extra reference sequences added with --genomeFastaFiles at the mapping stage.
outSAMmultNmax -1
int: max number of multiple alignments for a read that will be output to the SAM/BAM files. Note that if this value is not equal to -1, the top scoring alignment will be output first
-1 ... all alignments (up to --outFilterMultimapNmax) will be output
outSAMtlen 1
int: calculation method for the TLEN field in the SAM/BAM files
1 ... leftmost base of the (+)strand mate to rightmost base of the (-)mate. (+)sign for the (+)strand mate
2 ... leftmost base of any mate to rightmost base of any mate. (+)sign for the mate with the leftmost base. This is different from 1 for overlapping mates with protruding ends
outBAMcompression 1
int: -1 to 10 BAM compression level, -1=default compression (6?), 0=no compression, 10=maximum compression
outBAMsortingThreadN 0
int: >=0: number of threads for BAM sorting. 0 will default to min(6,--runThreadN).
outBAMsortingBinsN 50
int: >0: number of genome bins for coordinate-sorting
### BAM processing
bamRemoveDuplicatesType -
string: mark duplicates in the BAM file, for now only works with (i) sorted BAM fed with inputBAMfile, and (ii) for paired-end alignments only
- ... no duplicate removal/marking
UniqueIdentical ... mark all multimappers, and duplicate unique mappers. The coordinates, FLAG, CIGAR must be identical
UniqueIdenticalNotMulti ... mark duplicate unique mappers but not multimappers.
bamRemoveDuplicatesMate2basesN 0
int>0: number of bases from the 5' of mate 2 to use in collapsing (e.g. for RAMPAGE)
### Output Wiggle
outWigType None
string(s): type of signal output, e.g. "bedGraph" OR "bedGraph read1_5p". Requires sorted BAM: --outSAMtype BAM SortedByCoordinate .
1st word:
None ... no signal output
bedGraph ... bedGraph format
wiggle ... wiggle format
2nd word:
read1_5p ... signal from only 5' of the 1st read, useful for CAGE/RAMPAGE etc
read2 ... signal from only 2nd read
outWigStrand Stranded
string: strandedness of wiggle/bedGraph output
Stranded ... separate strands, str1 and str2
Unstranded ... collapsed strands
outWigReferencesPrefix -
string: prefix matching reference names to include in the output wiggle file, e.g. "chr", default "-" - include all references
outWigNorm RPM
string: type of normalization for the signal
RPM ... reads per million of mapped reads
None ... no normalization, "raw" counts
### Output Filtering
outFilterType Normal
string: type of filtering
Normal ... standard filtering using only current alignment
BySJout ... keep only those reads that contain junctions that passed filtering into SJ.out.tab
outFilterMultimapScoreRange 1
int: the score range below the maximum score for multimapping alignments
outFilterMultimapNmax 10
int: maximum number of loci the read is allowed to map to. Alignments (all of them) will be output only if the read maps to no more loci than this value.
Otherwise no alignments will be output, and the read will be counted as "mapped to too many loci" in the Log.final.out .
outFilterMismatchNmax 10
int: alignment will be output only if it has no more mismatches than this value.
outFilterMismatchNoverLmax 0.3
real: alignment will be output only if its ratio of mismatches to *mapped* length is less than or equal to this value.
outFilterMismatchNoverReadLmax 1.0
real: alignment will be output only if its ratio of mismatches to *read* length is less than or equal to this value.
outFilterScoreMin 0
int: alignment will be output only if its score is higher than or equal to this value.
outFilterScoreMinOverLread 0.66
real: same as outFilterScoreMin, but normalized to read length (sum of mates' lengths for paired-end reads)
outFilterMatchNmin 0
int: alignment will be output only if the number of matched bases is higher than or equal to this value.
outFilterMatchNminOverLread 0.66
real: sam as outFilterMatchNmin, but normalized to the read length (sum of mates' lengths for paired-end reads).
outFilterIntronMotifs None
string: filter alignment using their motifs
None ... no filtering
RemoveNoncanonical ... filter out alignments that contain non-canonical junctions
RemoveNoncanonicalUnannotated ... filter out alignments that contain non-canonical unannotated junctions when using annotated splice junctions database. The annotated non-canonical junctions will be kept.
outFilterIntronStrands RemoveInconsistentStrands
string: filter alignments
RemoveInconsistentStrands ... remove alignments that have junctions with inconsistent strands
None ... no filtering
### Output splice junctions (SJ.out.tab)
outSJtype Standard
string: type of splice junction output
Standard ... standard SJ.out.tab output
None ... no splice junction output
### Output Filtering: Splice Junctions
outSJfilterReads All
string: which reads to consider for collapsed splice junctions output
All ... all reads, unique- and multi-mappers
Unique ... uniquely mapping reads only
outSJfilterOverhangMin 30 12 12 12
4 integers: minimum overhang length for splice junctions on both sides for: (1) non-canonical motifs, (2) GT/AG and CT/AC motif, (3) GC/AG and CT/GC motif, (4) AT/AC and GT/AT motif. -1 means no output for that motif
does not apply to annotated junctions
outSJfilterCountUniqueMin 3 1 1 1
4 integers: minimum uniquely mapping read count per junction for: (1) non-canonical motifs, (2) GT/AG and CT/AC motif, (3) GC/AG and CT/GC motif, (4) AT/AC and GT/AT motif. -1 means no output for that motif
Junctions are output if one of outSJfilterCountUniqueMin OR outSJfilterCountTotalMin conditions are satisfied
does not apply to annotated junctions
outSJfilterCountTotalMin 3 1 1 1
4 integers: minimum total (multi-mapping+unique) read count per junction for: (1) non-canonical motifs, (2) GT/AG and CT/AC motif, (3) GC/AG and CT/GC motif, (4) AT/AC and GT/AT motif. -1 means no output for that motif
Junctions are output if one of outSJfilterCountUniqueMin OR outSJfilterCountTotalMin conditions are satisfied
does not apply to annotated junctions
outSJfilterDistToOtherSJmin 10 0 5 10
4 integers>=0: minimum allowed distance to other junctions' donor/acceptor
does not apply to annotated junctions
outSJfilterIntronMaxVsReadN 50000 100000 200000
N integers>=0: maximum gap allowed for junctions supported by 1,2,3,,,N reads
i.e. by default junctions supported by 1 read can have gaps <=50000b, by 2 reads: <=100000b, by 3 reads: <=200000. by >=4 reads any gap <=alignIntronMax
does not apply to annotated junctions
### Scoring
scoreGap 0
int: splice junction penalty (independent on intron motif)
scoreGapNoncan -8
int: non-canonical junction penalty (in addition to scoreGap)
scoreGapGCAG -4
int: GC/AG and CT/GC junction penalty (in addition to scoreGap)
scoreGapATAC -8
int: AT/AC and GT/AT junction penalty (in addition to scoreGap)
scoreGenomicLengthLog2scale -0.25
int: extra score logarithmically scaled with genomic length of the alignment: scoreGenomicLengthLog2scale*log2(genomicLength)
scoreDelOpen -2
int: deletion open penalty
scoreDelBase -2
int: deletion extension penalty per base (in addition to scoreDelOpen)
scoreInsOpen -2
int: insertion open penalty
scoreInsBase -2
int: insertion extension penalty per base (in addition to scoreInsOpen)
scoreStitchSJshift 1
int: maximum score reduction while searching for SJ boundaries in the stitching step
### Alignments and Seeding
seedSearchStartLmax 50
int>0: defines the search start point through the read - the read is split into pieces no longer than this value
seedSearchStartLmaxOverLread 1.0
real: seedSearchStartLmax normalized to read length (sum of mates' lengths for paired-end reads)
seedSearchLmax 0
int>=0: defines the maximum length of the seeds, if =0 seed length is not limited
seedMultimapNmax 10000
int>0: only pieces that map fewer than this value are utilized in the stitching procedure
seedPerReadNmax 1000
int>0: max number of seeds per read
seedPerWindowNmax 50
int>0: max number of seeds per window
seedNoneLociPerWindow 10
int>0: max number of one seed loci per window
seedSplitMin 12
int>0: min length of the seed sequences split by Ns or mate gap
seedMapMin 5
int>0: min length of seeds to be mapped
alignIntronMin 21
int: minimum intron size, genomic gap is considered intron if its length>=alignIntronMin, otherwise it is considered Deletion
alignIntronMax 0
int: maximum intron size, if 0, max intron size will be determined by (2^winBinNbits)*winAnchorDistNbins
alignMatesGapMax 0
int: maximum gap between two mates, if 0, max intron gap will be determined by (2^winBinNbits)*winAnchorDistNbins
alignSJoverhangMin 5
int>0: minimum overhang (i.e. block size) for spliced alignments
alignSJstitchMismatchNmax 0 -1 0 0
4*int>=0: maximum number of mismatches for stitching of the splice junctions (-1: no limit).
(1) non-canonical motifs, (2) GT/AG and CT/AC motif, (3) GC/AG and CT/GC motif, (4) AT/AC and GT/AT motif.
alignSJDBoverhangMin 3
int>0: minimum overhang (i.e. block size) for annotated (sjdb) spliced alignments
alignSplicedMateMapLmin 0
int>0: minimum mapped length for a read mate that is spliced
alignSplicedMateMapLminOverLmate 0.66
real>0: alignSplicedMateMapLmin normalized to mate length
alignWindowsPerReadNmax 10000
int>0: max number of windows per read
alignTranscriptsPerWindowNmax 100
int>0: max number of transcripts per window
alignTranscriptsPerReadNmax 10000
int>0: max number of different alignments per read to consider
alignEndsType Local
string: type of read ends alignment
Local ... standard local alignment with soft-clipping allowed
EndToEnd ... force end-to-end read alignment, do not soft-clip
Extend5pOfRead1 ... fully extend only the 5p of the read1, all other ends: local alignment
Extend5pOfReads12 ... fully extend only the 5p of the both read1 and read2, all other ends: local alignment
alignEndsProtrude 0 ConcordantPair
int, string: allow protrusion of alignment ends, i.e. start (end) of the +strand mate downstream of the start (end) of the -strand mate
1st word: int: maximum number of protrusion bases allowed
2nd word: string:
ConcordantPair ... report alignments with non-zero protrusion as concordant pairs
DiscordantPair ... report alignments with non-zero protrusion as discordant pairs
alignSoftClipAtReferenceEnds Yes
string: allow the soft-clipping of the alignments past the end of the chromosomes
Yes ... allow
No ... prohibit, useful for compatibility with Cufflinks
alignInsertionFlush None
string: how to flush ambiguous insertion positions
None ... insertions are not flushed
Right ... insertions are flushed to the right
### Paired-End reads
peOverlapNbasesMin 0
int>=0: minimum number of overlapping bases to trigger mates merging and realignment. Specify >0 value to switch on the "merginf of overlapping mates" algorithm.
peOverlapMMp 0.01
real, >=0 & <1: maximum proportion of mismatched bases in the overlap area
### Windows, Anchors, Binning
winAnchorMultimapNmax 50
int>0: max number of loci anchors are allowed to map to
winBinNbits 16
int>0: =log2(winBin), where winBin is the size of the bin for the windows/clustering, each window will occupy an integer number of bins.
winAnchorDistNbins 9
int>0: max number of bins between two anchors that allows aggregation of anchors into one window
winFlankNbins 4
int>0: log2(winFlank), where win Flank is the size of the left and right flanking regions for each window
winReadCoverageRelativeMin 0.5
real>=0: minimum relative coverage of the read sequence by the seeds in a window, for STARlong algorithm only.
winReadCoverageBasesMin 0
int>0: minimum number of bases covered by the seeds in a window , for STARlong algorithm only.
### Chimeric Alignments
chimOutType Junctions
string(s): type of chimeric output
Junctions ... Chimeric.out.junction
SeparateSAMold ... output old SAM into separate Chimeric.out.sam file
WithinBAM ... output into main aligned BAM files (Aligned.*.bam)
WithinBAM HardClip ... (default) hard-clipping in the CIGAR for supplemental chimeric alignments (default if no 2nd word is present)
WithinBAM SoftClip ... soft-clipping in the CIGAR for supplemental chimeric alignments
chimSegmentMin 0
int>=0: minimum length of chimeric segment length, if ==0, no chimeric output
chimScoreMin 0
int>=0: minimum total (summed) score of the chimeric segments
chimScoreDropMax 20
int>=0: max drop (difference) of chimeric score (the sum of scores of all chimeric segments) from the read length
chimScoreSeparation 10
int>=0: minimum difference (separation) between the best chimeric score and the next one
chimScoreJunctionNonGTAG -1
int: penalty for a non-GT/AG chimeric junction
chimJunctionOverhangMin 20
int>=0: minimum overhang for a chimeric junction
chimSegmentReadGapMax 0
int>=0: maximum gap in the read sequence between chimeric segments
chimFilter banGenomicN
string(s): different filters for chimeric alignments
None ... no filtering
banGenomicN ... Ns are not allowed in the genome sequence around the chimeric junction
chimMainSegmentMultNmax 10
int>=1: maximum number of multi-alignments for the main chimeric segment. =1 will prohibit multimapping main segments.
chimMultimapNmax 0
int>=0: maximum number of chimeric multi-alignments
0 ... use the old scheme for chimeric detection which only considered unique alignments
chimMultimapScoreRange 1
int>=0: the score range for multi-mapping chimeras below the best chimeric score. Only works with --chimMultimapNmax > 1
chimNonchimScoreDropMin 20
int>=0: to trigger chimeric detection, the drop in the best non-chimeric alignment score with respect to the read length has to be greater than this value
chimOutJunctionFormat 0
int: formatting type for the Chimeric.out.junction file
0 ... no comment lines/headers
1 ... comment lines at the end of the file: command line and Nreads: total, unique/multi-mapping
### Quantification of Annotations
quantMode -
string(s): types of quantification requested
- ... none
TranscriptomeSAM ... output SAM/BAM alignments to transcriptome into a separate file
GeneCounts ... count reads per gene
quantTranscriptomeBAMcompression 1
int: -2 to 10 transcriptome BAM compression level
-2 ... no BAM output
-1 ... default compression (6?)
0 ... no compression
10 ... maximum compression
quantTranscriptomeSAMoutput BanSingleEnd_BanIndels_ExtendSoftclip
string: alignment filtering for TranscriptomeSAM output
BanSingleEnd_BanIndels_ExtendSoftclip ... prohibit indels and single-end alignments, extend softclips - compatible with RSEM
BanSingleEnd ... prohibit single-end alignments, allow indels and softclips
BanSingleEnd_ExtendSoftclip ... prohibit single-end alignments, extend softclips, allow indels
### 2-pass Mapping
twopassMode None
string: 2-pass mapping mode.
None ... 1-pass mapping
Basic ... basic 2-pass mapping, with all 1st pass junctions inserted into the genome indices on the fly
twopass1readsN -1
int: number of reads to process for the 1st step. Use very large number (or default -1) to map all reads in the first step.
### WASP parameters
waspOutputMode None
string: WASP allele-specific output type. This is re-implementation of the original WASP mappability filtering by Bryce van de Geijn, Graham McVicker, Yoav Gilad & Jonathan K Pritchard. Please cite the original WASP paper: Nature Methods 12, 1061–1063 (2015), https://www.nature.com/articles/nmeth.3582 .
SAMtag ... add WASP tags to the alignments that pass WASP filtering
### STARsolo (single cell RNA-seq) parameters
soloType None
string(s): type of single-cell RNA-seq
CB_UMI_Simple ... (a.k.a. Droplet) one UMI and one Cell Barcode of fixed length in read2, e.g. Drop-seq and 10X Chromium.
CB_UMI_Complex ... multiple Cell Barcodes of varying length, one UMI of fixed length and one adapter sequence of fixed length are allowed in read2 only (e.g. inDrop, ddSeq).
CB_samTagOut ... output Cell Barcode as CR and/or CB SAm tag. No UMI counting. --readFilesIn cDNA_read1 [cDNA_read2 if paired-end] CellBarcode_read . Requires --outSAMtype BAM Unsorted [and/or SortedByCoordinate]
SmartSeq ... Smart-seq: each cell in a separate FASTQ (paired- or single-end), barcodes are corresponding read-groups, no UMI sequences, alignments deduplicated according to alignment start and end (after extending soft-clipped bases)
soloCBtype Sequence
string: cell barcode type
Sequence: cell barcode is a sequence (standard option)
String: cell barcode is an arbitrary string
soloCBwhitelist -
string(s): file(s) with whitelist(s) of cell barcodes. Only --soloType CB_UMI_Complex allows more than one whitelist file.
None ... no whitelist: all cell barcodes are allowed
soloCBstart 1
int>0: cell barcode start base
soloCBlen 16
int>0: cell barcode length
soloUMIstart 17
int>0: UMI start base
soloUMIlen 10
int>0: UMI length
soloBarcodeReadLength 1
int: length of the barcode read
1 ... equal to sum of soloCBlen+soloUMIlen
0 ... not defined, do not check
soloBarcodeMate 0
int: identifies which read mate contains the barcode (CB+UMI) sequence
0 ... barcode sequence is on separate read, which should always be the last file in the --readFilesIn listed
1 ... barcode sequence is a part of mate 1
2 ... barcode sequence is a part of mate 2
soloCBposition -
strings(s): position of Cell Barcode(s) on the barcode read.
Presently only works with --soloType CB_UMI_Complex, and barcodes are assumed to be on Read2.
Format for each barcode: startAnchor_startPosition_endAnchor_endPosition
start(end)Anchor defines the Anchor Base for the CB: 0: read start; 1: read end; 2: adapter start; 3: adapter end
start(end)Position is the 0-based position with of the CB start(end) with respect to the Anchor Base
String for different barcodes are separated by space.
Example: inDrop (Zilionis et al, Nat. Protocols, 2017):
--soloCBposition 0_0_2_-1 3_1_3_8
soloUMIposition -
string: position of the UMI on the barcode read, same as soloCBposition
Example: inDrop (Zilionis et al, Nat. Protocols, 2017):
--soloCBposition 3_9_3_14
soloAdapterSequence -
string: adapter sequence to anchor barcodes. Only one adapter sequence is allowed.
soloAdapterMismatchesNmax 1
int>0: maximum number of mismatches allowed in adapter sequence.
soloCBmatchWLtype 1MM_multi
string: matching the Cell Barcodes to the WhiteList
Exact ... only exact matches allowed
1MM ... only one match in whitelist with 1 mismatched base allowed. Allowed CBs have to have at least one read with exact match.
1MM_multi ... multiple matches in whitelist with 1 mismatched base allowed, posterior probability calculation is used choose one of the matches.
Allowed CBs have to have at least one read with exact match. This option matches best with CellRanger 2.2.0
1MM_multi_pseudocounts ... same as 1MM_Multi, but pseudocounts of 1 are added to all whitelist barcodes.
1MM_multi_Nbase_pseudocounts ... same as 1MM_multi_pseudocounts, multimatching to WL is allowed for CBs with N-bases. This option matches best with CellRanger >= 3.0.0
EditDist_2 ... allow up to edit distance of 3 fpr each of the barcodes. May include one deletion + one insertion. Only works with --soloType CB_UMI_Complex. Matches to multiple passlist barcdoes are not allowed. Similar to ParseBio Split-seq pipeline.
soloInputSAMattrBarcodeSeq -
string(s): when inputting reads from a SAM file (--readsFileType SAM SE/PE), these SAM attributes mark the barcode sequence (in proper order).
For instance, for 10X CellRanger or STARsolo BAMs, use --soloInputSAMattrBarcodeSeq CR UR .
This parameter is required when running STARsolo with input from SAM.
soloInputSAMattrBarcodeQual -
string(s): when inputting reads from a SAM file (--readsFileType SAM SE/PE), these SAM attributes mark the barcode qualities (in proper order).
For instance, for 10X CellRanger or STARsolo BAMs, use --soloInputSAMattrBarcodeQual CY UY .
If this parameter is '-' (default), the quality 'H' will be assigned to all bases.
soloStrand Forward
string: strandedness of the solo libraries:
Unstranded ... no strand information
Forward ... read strand same as the original RNA molecule
Reverse ... read strand opposite to the original RNA molecule
soloFeatures Gene
string(s): genomic features for which the UMI counts per Cell Barcode are collected
Gene ... genes: reads match the gene transcript
SJ ... splice junctions: reported in SJ.out.tab
GeneFull ... full gene (pre-mRNA): count all reads overlapping genes' exons and introns
GeneFull_ExonOverIntron ... full gene (pre-mRNA): count all reads overlapping genes' exons and introns: prioritize 100% overlap with exons
GeneFull_Ex50pAS ... full gene (pre-RNA): count all reads overlapping genes' exons and introns: prioritize >50% overlap with exons. Do not count reads with 100% exonic overlap in the antisense direction.
#####UnderDevelopment_begin : not supported - do not use
Transcript3p ... quantification of transcript for 3' protocols
#####UnderDevelopment_end
soloMultiMappers Unique
string(s): counting method for reads mapping to multiple genes
Unique ... count only reads that map to unique genes
Uniform ... uniformly distribute multi-genic UMIs to all genes
Rescue ... distribute UMIs proportionally to unique+uniform counts (~ first iteration of EM)
PropUnique ... distribute UMIs proportionally to unique mappers, if present, and uniformly if not.
EM ... multi-gene UMIs are distributed using Expectation Maximization algorithm
soloUMIdedup 1MM_All
string(s): type of UMI deduplication (collapsing) algorithm
1MM_All ... all UMIs with 1 mismatch distance to each other are collapsed (i.e. counted once).
1MM_Directional_UMItools ... follows the "directional" method from the UMI-tools by Smith, Heger and Sudbery (Genome Research 2017).
1MM_Directional ... same as 1MM_Directional_UMItools, but with more stringent criteria for duplicate UMIs
Exact ... only exactly matching UMIs are collapsed.
NoDedup ... no deduplication of UMIs, count all reads.
1MM_CR ... CellRanger2-4 algorithm for 1MM UMI collapsing.
soloUMIfiltering -
string(s): type of UMI filtering (for reads uniquely mapping to genes)
- ... basic filtering: remove UMIs with N and homopolymers (similar to CellRanger 2.2.0).
MultiGeneUMI ... basic + remove lower-count UMIs that map to more than one gene.
MultiGeneUMI_All ... basic + remove all UMIs that map to more than one gene.
MultiGeneUMI_CR ... basic + remove lower-count UMIs that map to more than one gene, matching CellRanger > 3.0.0 .
Only works with --soloUMIdedup 1MM_CR
soloOutFileNames Solo.out/ features.tsv barcodes.tsv matrix.mtx
string(s): file names for STARsolo output:
file_name_prefix gene_names barcode_sequences cell_feature_count_matrix
soloCellFilter CellRanger2.2 3000 0.99 10
string(s): cell filtering type and parameters
None ... do not output filtered cells
TopCells ... only report top cells by UMI count, followed by the exact number of cells
CellRanger2.2 ... simple filtering of CellRanger 2.2.
Can be followed by numbers: number of expected cells, robust maximum percentile for UMI count, maximum to minimum ratio for UMI count
The harcoded values are from CellRanger: nExpectedCells=3000; maxPercentile=0.99; maxMinRatio=10
EmptyDrops_CR ... EmptyDrops filtering in CellRanger flavor. Please cite the original EmptyDrops paper: A.T.L Lun et al, Genome Biology, 20, 63 (2019): https://genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1662-y
Can be followed by 10 numeric parameters: nExpectedCells maxPercentile maxMinRatio indMin indMax umiMin umiMinFracMedian candMaxN FDR simN
The harcoded values are from CellRanger: 3000 0.99 10 45000 90000 500 0.01 20000 0.01 10000
soloOutFormatFeaturesGeneField3 "Gene Expression"
string(s): field 3 in the Gene features.tsv file. If "-", then no 3rd field is output.
soloCellReadStats None
string: Output reads statistics for each CB
Standard ... standard output
#####UnderDevelopment_begin : not supported - do not use
soloClusterCBfile -
string: file containing the cluster information for cell barcodes, two columns: CB cluster_index. Only used with --soloFeatures Transcript3p
#####UnderDevelopment_end

29
src/star/star_genome_generate/script.sh Normal file
View File

@@ -0,0 +1,29 @@
#!/bin/bash
set -e
## VIASH START
## VIASH END
mkdir -p $par_index
STAR \
--runMode genomeGenerate \
--genomeDir $par_index \
--genomeFastaFiles $par_genomeFastaFiles \
${meta_cpus:+--runThreadN "${meta_cpus}"} \
${par_sjdbGTFfile:+--sjdbGTFfile "${par_sjdbGTFfile}"} \
${par_sjdbOverhang:+--sjdbOverhang "${par_sjdbOverhang}"} \
${par_genomeSAindexNbases:+--genomeSAindexNbases "${par_genomeSAindexNbases}"} \
${par_sjdbGTFchrPrefix:+--sjdbGTFchrPrefix "${par_sjdbGTFchrPrefix}"} \
${par_sjdbGTFfeatureExon:+--sjdbGTFfeatureExon "${par_sjdbGTFfeatureExon}"} \
${par_sjdbGTFtagExonParentTranscript:+--sjdbGTFtagExonParentTranscript "${par_sjdbGTFtagExonParentTranscript}"} \
${par_sjdbGTFtagExonParentGene:+--sjdbGTFtagExonParentGene "${par_sjdbGTFtagExonParentGene}"} \
${par_sjdbGTFtagExonParentGeneName:+--sjdbGTFtagExonParentGeneName "${par_sjdbGTFtagExonParentGeneName}"} \
${par_sjdbGTFtagExonParentGeneType:+--sjdbGTFtagExonParentGeneType "${sjdbGTFtagExonParentGeneType}"} \
${par_limitGenomeGenerateRAM:+--limitGenomeGenerateRAM "${par_limitGenomeGenerateRAM}"} \
${par_genomeChrBinNbits:+--genomeChrBinNbits "${par_genomeChrBinNbits}"} \
${par_genomeSAsparseD:+--genomeSAsparseD "${par_genomeSAsparseD}"} \
${par_genomeSuffixLengthMax:+--genomeSuffixLengthMax "${par_genomeSuffixLengthMax}"} \
${par_genomeTransformType:+--genomeTransformType "${par_genomeTransformType}"} \
${par_genomeTransformVCF:+--genomeTransformVCF "${par_genomeTransformVCF}"} \

48
src/star/star_genome_generate/test.sh Normal file
View File

@@ -0,0 +1,48 @@
#!/bin/bash
set -e
## VIASH START
## VIASH END
#########################################################################################
echo "> Prepare test data"
cat > genome.fasta <<'EOF'
>chr1
TGGCATGAGCCAACGAACGCTGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAGCGTTCGTGGG
GCTCGTCACCACTATGGTTGGCCGGTTAGTAGTGTGACTCCTGGTTTTCTGGAGCTTCTTTAAACCGTAGTCCAGTCAA
TGCGAATGGCACTTCACGACGGACTGTCCTTAGCTCAGGGGA
EOF
cat > genes.gtf <<'EOF'
chr1 example_source gene 0 50 . + . gene_id "gene1"; transcript_id "transcript1";
chr1 example_source exon 20 40 . + . gene_id "gene1"; transcript_id "transcript1";
EOF
#########################################################################################
echo "> Generate index"
"$meta_executable" \
${meta_cpus:+---cpus $meta_cpus} \
--index "star_index/" \
--genomeFastaFiles "genome.fasta" \
--sjdbGTFfile "genes.gtf" \
--genomeSAindexNbases 2
files=("Genome" "Log.out" "SA" "SAindex" "chrLength.txt" "chrName.txt" "chrNameLength.txt" "chrStart.txt" "exonGeTrInfo.tab" "exonInfo.tab" "geneInfo.tab" "genomeParameters.txt" "sjdbInfo.txt" "sjdbList.fromGTF.out.tab" "sjdbList.out.tab" "transcriptInfo.tab")
echo ">> Check if output exists"
[ ! -d "star_index" ] && echo "Directory 'star_index' does not exist!" && exit 1
for file in "${files[@]}"; do
[ ! -f "star_index/$file" ] && echo "File '$file' does not exist in 'star_index'." && exit 1
done
echo ">> Check contents of output files"
grep -q "200" "star_index/chrLength.txt" || (echo "Chromosome length in file 'chrLength.txt' is incorrect! " && exit 1)
grep -q "chr1" "star_index/chrName.txt" || (echo "Chromosome name in file 'chrName.txt' is incorrect! " && exit 1)
grep -q "chr1 200" "star_index/chrNameLength.txt" || (echo "Chromosome name in file 'chrNameLength.txt' is incorrect! " && exit 1)
echo ">>> Test finished successfully"
exit 0

19
target/executable/arriba/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "arriba"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -670,7 +670,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/arriba:2.4.0--h0033a41_2"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -688,11 +688,11 @@ build_info:
output: "target/executable/arriba"
executable: "target/executable/arriba/arriba"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -702,16 +702,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/arriba/arriba
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# arriba v0.1
# arriba v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "arriba v0.1"
echo "arriba v0.1.0"
echo ""
echo "Detect gene fusions from RNA-Seq data"
echo ""
@@ -749,10 +749,10 @@ ENTRYPOINT []
RUN arriba -h | grep 'Version:' 2>&1 | sed 's/Version:\s\(.*\)/arriba: "\1"/' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component arriba"
LABEL org.opencontainers.image.created="2024-06-24T08:44:05Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:37Z"
LABEL org.opencontainers.image.source="https://github.com/suhrig/arriba"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -875,7 +875,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "arriba v0.1"
echo "arriba v0.1.0"
exit
;;
--bam)
@@ -1589,7 +1589,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/arriba:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/arriba:v0.1.0'
fi
# print dockerfile

25
target/executable/bcl_convert/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "bcl_convert"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Input arguments"
arguments:
@@ -270,8 +270,8 @@ resources:
path: "script.sh"
is_executable: true
description: "Convert bcl files to fastq files using bcl-convert.\nInformation about\
\ upgrading from bcl2fastq via\nhttps://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html\n\
and https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html\n"
\ upgrading from bcl2fastq via\n[Upgrading from bcl2fastq to BCL Convert](https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html)\n\
and [BCL Convert Compatible Products](https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html)\n"
test_resources:
- type: "bash_script"
path: "test.sh"
@@ -283,7 +283,7 @@ requirements:
- "ps"
license: "MIT"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
runners:
- type: "executable"
id: "executable"
@@ -354,7 +354,7 @@ engines:
id: "docker"
image: "debian:trixie-slim"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "apt"
@@ -386,11 +386,11 @@ build_info:
output: "target/executable/bcl_convert"
executable: "target/executable/bcl_convert/bcl_convert"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -400,16 +400,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

23
target/executable/bcl_convert/bcl_convert
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# bcl_convert v0.1
# bcl_convert v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,13 +171,14 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "bcl_convert v0.1"
echo "bcl_convert v0.1.0"
echo ""
echo "Convert bcl files to fastq files using bcl-convert."
echo "Information about upgrading from bcl2fastq via"
echo "https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html"
echo "and"
echo "https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html"
echo "[Upgrading from bcl2fastq to BCL"
echo "Convert](https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html)"
echo "and [BCL Convert Compatible"
echo "Products](https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html)"
echo ""
echo "Input arguments:"
echo " -i, --bcl_input_directory"
@@ -592,10 +593,10 @@ rm /tmp/bcl-convert.rpm
RUN echo "bcl-convert: \"$(bcl-convert -V 2>&1 >/dev/null | sed -n '/Version/ s/^bcl-convert\ Version //p')\"" > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component bcl_convert"
LABEL org.opencontainers.image.created="2024-06-24T08:43:59Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobbox"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.created="2024-06-24T09:12:31Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -718,7 +719,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "bcl_convert v0.1"
echo "bcl_convert v0.1.0"
exit
;;
--bcl_input_directory)
@@ -1068,7 +1069,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/bcl_convert:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/bcl_convert:v0.1.0'
fi
# print dockerfile

240
target/executable/bgzip/.config.vsh.yaml → target/executable/bedtools/bedtools_getfasta/.config.vsh.yaml
View File

@@ -1,23 +1,57 @@
name: "bgzip"
version: "v0.1"
name: "bedtools_getfasta"
namespace: "bedtools"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
- name: "Input arguments"
arguments:
- type: "file"
name: "--input"
description: "file to be compressed or decompressed"
name: "--input_fasta"
description: "FASTA file containing sequences for each interval specified in the\
\ input BED file.\nThe headers in the input FASTA file must exactly match the\
\ chromosome column in the BED file.\n"
info: null
must_exist: true
create_parent: true
required: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Outputs"
- type: "file"
name: "--input_bed"
description: "BED file containing intervals to extract from the FASTA file.\n\
BED files containing a single region require a newline character\nat the end\
\ of the line, otherwise a blank output file is produced.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--rna"
description: "The FASTA is RNA not DNA. Reverse complementation handled accordingly.\n"
info: null
direction: "input"
- name: "Run arguments"
arguments:
- type: "boolean_true"
name: "--strandedness"
alternatives:
- "-s"
description: "Force strandedness. If the feature occupies the antisense strand,\
\ the output sequence will\nbe reverse complemented. By default strandedness\
\ is not taken into account.\n"
info: null
direction: "input"
- name: "Output arguments"
arguments:
- type: "file"
name: "--output"
description: "compressed or decompressed output"
alternatives:
- "-o"
description: "Output file where the output from the 'bedtools getfasta' commend\
\ will\nbe written to.\n"
info: null
must_exist: true
create_parent: true
@@ -25,149 +59,71 @@ argument_groups:
direction: "output"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--index_name"
alternatives:
- "-I"
description: "name of BGZF index file [file.gz.gzi]"
info: null
must_exist: true
create_parent: true
required: false
direction: "output"
multiple: false
multiple_sep: ";"
- name: "Arguments"
arguments:
- type: "integer"
name: "--offset"
alternatives:
- "-b"
description: "decompress at virtual file pointer (0-based uncompressed offset)"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--decompress"
alternatives:
- "-d"
description: "decompress the input file"
name: "--tab"
description: "Report extract sequences in a tab-delimited format instead of in\
\ FASTA format.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--rebgzip"
alternatives:
- "-g"
description: "use an index file to bgzip a file"
name: "--bed_out"
description: "Report extract sequences in a tab-delimited BED format instead of\
\ in FASTA format.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--index"
alternatives:
- "-i"
description: "compress and create BGZF index"
info: null
direction: "input"
- type: "integer"
name: "--compress_level"
alternatives:
- "-l"
description: "compression level to use when compressing; 0 to 9, or -1 for default\
\ [-1]"
info: null
required: false
min: -1
max: 9
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--reindex"
alternatives:
- "-r"
description: "(re)index the output file"
info: null
direction: "input"
- type: "integer"
name: "--size"
alternatives:
- "-s"
description: "decompress INT bytes (uncompressed size)"
info: null
required: false
min: 0
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--test"
alternatives:
- "-t"
description: "test integrity of compressed file"
name: "--name"
description: "Set the FASTA header for each extracted sequence to be the \"name\"\
\ and coordinate columns from the BED feature.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--binary"
description: "Don't align blocks with text lines"
name: "--name_only"
description: "Set the FASTA header for each extracted sequence to be the \"name\"\
\ columns from the BED feature.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--split"
description: "When --input is in BED12 format, create a separate fasta entry for\
\ each block in a BED12 record,\nblocks being described in the 11th and 12th\
\ column of the BED.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--full_header"
description: "Use full fasta header. By default, only the word before the first\
\ space or tab is used.\n"
info: null
direction: "input"
resources:
- type: "bash_script"
text: |
[[ "$par_decompress" == "false" ]] && unset par_decompress
[[ "$par_rebgzip" == "false" ]] && unset par_rebgzip
[[ "$par_index" == "false" ]] && unset par_index
[[ "$par_reindex" == "false" ]] && unset par_reindex
[[ "$par_test" == "false" ]] && unset par_test
[[ "$par_binary" == "false" ]] && unset par_binary
bgzip -c \
${meta_cpus:+--threads "${meta_cpus}"} \
${par_offset:+-b "${par_offset}"} \
${par_decompress:+-d} \
${par_rebgzip:+-g} \
${par_index:+-i} \
${par_index_name:+-I "${par_index_name}"} \
${par_compress_level:+-l "${par_compress_level}"} \
${par_reindex:+-r} \
${par_size:+-s "${par_size}"} \
${par_test:+-t} \
${par_binary:+--binary} \
"$par_input" > "$par_output"
dest: "./script.sh"
path: "script.sh"
is_executable: true
description: "Block compression/decompression utility"
description: "Extract sequences from a FASTA file for each of the intervals defined\
\ in a BED/GFF/VCF file."
test_resources:
- type: "bash_script"
text: "set -e\n\n\"$meta_executable\" --input \"$meta_resources_dir/test_data/test.vcf\"\
\ --output \"test.vcf.gz\"\n\necho \">> Checking output of compressing\"\n[ !\
\ -f \"test.vcf.gz\" ] && echo \"Output file test.vcf.gz does not exist\" && exit\
\ 1\n\n\"$meta_executable\" --input \"test.vcf.gz\" --output \"test.vcf\" --decompress\n\
\necho \">> Checking output of decompressing\"\n[ ! -f \"test.vcf\" ] && echo\
\ \"Output file test.vcf does not exist\" && exit 1\n\necho \">> Checking original\
\ and decompressed files are the same\"\nset +e\ncmp --silent -- \"$meta_resources_dir/test_data/test.vcf\"\
\ \"test.vcf\"\n[ $? -ne 0 ] && echo \"files are different\" && exit 1\nset -e\n\
\necho \"> Test successful\"\n"
dest: "./script.sh"
path: "test.sh"
is_executable: true
- type: "file"
path: "test_data"
info: null
status: "enabled"
requirements:
commands:
- "ps"
license: "MIT"
keywords:
- "sequencing"
- "fasta"
- "BED"
- "GFF"
- "VCF"
license: "GPL-2.0"
references:
doi:
- "10.1093/gigascience/giab007"
- "10.1093/bioinformatics/btq033"
links:
repository: "https://github.com/samtools/htslib"
homepage: "https://www.htslib.org/"
documentation: "https://www.htslib.org/doc/bgzip.html"
repository: "https://github.com/arq5x/bedtools2"
documentation: "https://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html"
runners:
- type: "executable"
id: "executable"
@@ -236,31 +192,36 @@ runners:
engines:
- type: "docker"
id: "docker"
image: "quay.io/biocontainers/htslib:1.19--h81da01d_0"
image: "debian:stable-slim"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "apt"
packages:
- "bedtools"
- "procps"
interactive: false
- type: "docker"
run:
- "bgzip -h | grep 'Version:' 2>&1 | sed 's/Version:\\s\\(.*\\)/bgzip: \"\\1\"\
/' > /var/software_versions.txt\n"
- "echo \"bedtools: \\\"$(bedtools --version | sed -n 's/^bedtools //p')\\\"\"\
\ > /var/software_versions.txt\n"
entrypoint: []
cmd: null
- type: "native"
id: "native"
build_info:
config: "src/bgzip/config.vsh.yaml"
config: "src/bedtools/bedtools_getfasta/config.vsh.yaml"
runner: "executable"
engine: "docker|native"
output: "target/executable/bgzip"
executable: "target/executable/bgzip/bgzip"
output: "target/executable/bedtools/bedtools_getfasta"
executable: "target/executable/bedtools/bedtools_getfasta/bedtools_getfasta"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -270,16 +231,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

495
target/executable/bgzip/bgzip → target/executable/bedtools/bedtools_getfasta/bedtools_getfasta
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# bgzip v0.1
# bedtools_getfasta v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -162,8 +162,8 @@ VIASH_META_RESOURCES_DIR=`ViashSourceDir ${BASH_SOURCE[0]}`
VIASH_TARGET_DIR=`ViashFindTargetDir $VIASH_META_RESOURCES_DIR`
# define meta fields
VIASH_META_NAME="bgzip"
VIASH_META_FUNCTIONALITY_NAME="bgzip"
VIASH_META_NAME="bedtools_getfasta"
VIASH_META_FUNCTIONALITY_NAME="bedtools_getfasta"
VIASH_META_EXECUTABLE="$VIASH_META_RESOURCES_DIR/$VIASH_META_NAME"
VIASH_META_CONFIG="$VIASH_META_RESOURCES_DIR/.config.vsh.yaml"
VIASH_META_TEMP_DIR="$VIASH_TEMP"
@@ -171,64 +171,73 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "bgzip v0.1"
echo "bedtools_getfasta v0.1.0"
echo ""
echo "Block compression/decompression utility"
echo "Extract sequences from a FASTA file for each of the intervals defined in a"
echo "BED/GFF/VCF file."
echo ""
echo "Inputs:"
echo " --input"
echo " type: file, required parameter, file must exist"
echo " file to be compressed or decompressed"
echo "Input arguments:"
echo " --input_fasta"
echo " type: file, file must exist"
echo " FASTA file containing sequences for each interval specified in the input"
echo " BED file."
echo " The headers in the input FASTA file must exactly match the chromosome"
echo " column in the BED file."
echo ""
echo "Outputs:"
echo " --output"
echo " --input_bed"
echo " type: file, file must exist"
echo " BED file containing intervals to extract from the FASTA file."
echo " BED files containing a single region require a newline character"
echo " at the end of the line, otherwise a blank output file is produced."
echo ""
echo " --rna"
echo " type: boolean_true"
echo " The FASTA is RNA not DNA. Reverse complementation handled accordingly."
echo ""
echo "Run arguments:"
echo " -s, --strandedness"
echo " type: boolean_true"
echo " Force strandedness. If the feature occupies the antisense strand, the"
echo " output sequence will"
echo " be reverse complemented. By default strandedness is not taken into"
echo " account."
echo ""
echo "Output arguments:"
echo " -o, --output"
echo " type: file, required parameter, output, file must exist"
echo " compressed or decompressed output"
echo " Output file where the output from the 'bedtools getfasta' commend will"
echo " be written to."
echo ""
echo " -I, --index_name"
echo " type: file, output, file must exist"
echo " name of BGZF index file [file.gz.gzi]"
echo ""
echo "Arguments:"
echo " -b, --offset"
echo " type: integer"
echo " decompress at virtual file pointer (0-based uncompressed offset)"
echo ""
echo " -d, --decompress"
echo " --tab"
echo " type: boolean_true"
echo " decompress the input file"
echo " Report extract sequences in a tab-delimited format instead of in FASTA"
echo " format."
echo ""
echo " -g, --rebgzip"
echo " --bed_out"
echo " type: boolean_true"
echo " use an index file to bgzip a file"
echo " Report extract sequences in a tab-delimited BED format instead of in"
echo " FASTA format."
echo ""
echo " -i, --index"
echo " --name"
echo " type: boolean_true"
echo " compress and create BGZF index"
echo " Set the FASTA header for each extracted sequence to be the \"name\" and"
echo " coordinate columns from the BED feature."
echo ""
echo " -l, --compress_level"
echo " type: integer"
echo " min: -1"
echo " max: 9"
echo " compression level to use when compressing; 0 to 9, or -1 for default"
echo " [-1]"
echo ""
echo " -r, --reindex"
echo " --name_only"
echo " type: boolean_true"
echo " (re)index the output file"
echo " Set the FASTA header for each extracted sequence to be the \"name\""
echo " columns from the BED feature."
echo ""
echo " -s, --size"
echo " type: integer"
echo " min: 0"
echo " decompress INT bytes (uncompressed size)"
echo ""
echo " -t, --test"
echo " --split"
echo " type: boolean_true"
echo " test integrity of compressed file"
echo " When --input is in BED12 format, create a separate fasta entry for each"
echo " block in a BED12 record,"
echo " blocks being described in the 11th and 12th column of the BED."
echo ""
echo " --binary"
echo " --full_header"
echo " type: boolean_true"
echo " Don't align blocks with text lines"
echo " Use full fasta header. By default, only the word before the first space"
echo " or tab is used."
}
# initialise variables
@@ -503,15 +512,19 @@ function ViashDockerfile {
if [[ "$engine_id" == "docker" ]]; then
cat << 'VIASHDOCKER'
FROM quay.io/biocontainers/htslib:1.19--h81da01d_0
FROM debian:stable-slim
ENTRYPOINT []
RUN bgzip -h | grep 'Version:' 2>&1 | sed 's/Version:\s\(.*\)/bgzip: "\1"/' > /var/software_versions.txt
RUN apt-get update && \
DEBIAN_FRONTEND=noninteractive apt-get install -y bedtools procps && \
rm -rf /var/lib/apt/lists/*
LABEL org.opencontainers.image.description="Companion container for running component bgzip"
LABEL org.opencontainers.image.created="2024-06-24T08:43:58Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/htslib"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_getfasta"
LABEL org.opencontainers.image.created="2024-06-24T09:12:39Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -634,18 +647,44 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "bgzip v0.1"
echo "bedtools_getfasta v0.1.0"
exit
;;
--input)
[ -n "$VIASH_PAR_INPUT" ] && ViashError Bad arguments for option \'--input\': \'$VIASH_PAR_INPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INPUT="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to --input. Use "--help" to get more information on the parameters. && exit 1
--input_fasta)
[ -n "$VIASH_PAR_INPUT_FASTA" ] && ViashError Bad arguments for option \'--input_fasta\': \'$VIASH_PAR_INPUT_FASTA\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INPUT_FASTA="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to --input_fasta. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--input=*)
[ -n "$VIASH_PAR_INPUT" ] && ViashError Bad arguments for option \'--input=*\': \'$VIASH_PAR_INPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INPUT=$(ViashRemoveFlags "$1")
--input_fasta=*)
[ -n "$VIASH_PAR_INPUT_FASTA" ] && ViashError Bad arguments for option \'--input_fasta=*\': \'$VIASH_PAR_INPUT_FASTA\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INPUT_FASTA=$(ViashRemoveFlags "$1")
shift 1
;;
--input_bed)
[ -n "$VIASH_PAR_INPUT_BED" ] && ViashError Bad arguments for option \'--input_bed\': \'$VIASH_PAR_INPUT_BED\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INPUT_BED="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to --input_bed. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--input_bed=*)
[ -n "$VIASH_PAR_INPUT_BED" ] && ViashError Bad arguments for option \'--input_bed=*\': \'$VIASH_PAR_INPUT_BED\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INPUT_BED=$(ViashRemoveFlags "$1")
shift 1
;;
--rna)
[ -n "$VIASH_PAR_RNA" ] && ViashError Bad arguments for option \'--rna\': \'$VIASH_PAR_RNA\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_RNA=true
shift 1
;;
--strandedness)
[ -n "$VIASH_PAR_STRANDEDNESS" ] && ViashError Bad arguments for option \'--strandedness\': \'$VIASH_PAR_STRANDEDNESS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_STRANDEDNESS=true
shift 1
;;
-s)
[ -n "$VIASH_PAR_STRANDEDNESS" ] && ViashError Bad arguments for option \'-s\': \'$VIASH_PAR_STRANDEDNESS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_STRANDEDNESS=true
shift 1
;;
--output)
@@ -659,127 +698,40 @@ while [[ $# -gt 0 ]]; do
VIASH_PAR_OUTPUT=$(ViashRemoveFlags "$1")
shift 1
;;
--index_name)
[ -n "$VIASH_PAR_INDEX_NAME" ] && ViashError Bad arguments for option \'--index_name\': \'$VIASH_PAR_INDEX_NAME\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INDEX_NAME="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to --index_name. Use "--help" to get more information on the parameters. && exit 1
-o)
[ -n "$VIASH_PAR_OUTPUT" ] && ViashError Bad arguments for option \'-o\': \'$VIASH_PAR_OUTPUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_OUTPUT="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to -o. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--index_name=*)
[ -n "$VIASH_PAR_INDEX_NAME" ] && ViashError Bad arguments for option \'--index_name=*\': \'$VIASH_PAR_INDEX_NAME\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INDEX_NAME=$(ViashRemoveFlags "$1")
--tab)
[ -n "$VIASH_PAR_TAB" ] && ViashError Bad arguments for option \'--tab\': \'$VIASH_PAR_TAB\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_TAB=true
shift 1
;;
-I)
[ -n "$VIASH_PAR_INDEX_NAME" ] && ViashError Bad arguments for option \'-I\': \'$VIASH_PAR_INDEX_NAME\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INDEX_NAME="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to -I. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--offset)
[ -n "$VIASH_PAR_OFFSET" ] && ViashError Bad arguments for option \'--offset\': \'$VIASH_PAR_OFFSET\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_OFFSET="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to --offset. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--offset=*)
[ -n "$VIASH_PAR_OFFSET" ] && ViashError Bad arguments for option \'--offset=*\': \'$VIASH_PAR_OFFSET\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_OFFSET=$(ViashRemoveFlags "$1")
--bed_out)
[ -n "$VIASH_PAR_BED_OUT" ] && ViashError Bad arguments for option \'--bed_out\': \'$VIASH_PAR_BED_OUT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_BED_OUT=true
shift 1
;;
-b)
[ -n "$VIASH_PAR_OFFSET" ] && ViashError Bad arguments for option \'-b\': \'$VIASH_PAR_OFFSET\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_OFFSET="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to -b. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--decompress)
[ -n "$VIASH_PAR_DECOMPRESS" ] && ViashError Bad arguments for option \'--decompress\': \'$VIASH_PAR_DECOMPRESS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_DECOMPRESS=true
--name)
[ -n "$VIASH_PAR_NAME" ] && ViashError Bad arguments for option \'--name\': \'$VIASH_PAR_NAME\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_NAME=true
shift 1
;;
-d)
[ -n "$VIASH_PAR_DECOMPRESS" ] && ViashError Bad arguments for option \'-d\': \'$VIASH_PAR_DECOMPRESS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_DECOMPRESS=true
--name_only)
[ -n "$VIASH_PAR_NAME_ONLY" ] && ViashError Bad arguments for option \'--name_only\': \'$VIASH_PAR_NAME_ONLY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_NAME_ONLY=true
shift 1
;;
--rebgzip)
[ -n "$VIASH_PAR_REBGZIP" ] && ViashError Bad arguments for option \'--rebgzip\': \'$VIASH_PAR_REBGZIP\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_REBGZIP=true
--split)
[ -n "$VIASH_PAR_SPLIT" ] && ViashError Bad arguments for option \'--split\': \'$VIASH_PAR_SPLIT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_SPLIT=true
shift 1
;;
-g)
[ -n "$VIASH_PAR_REBGZIP" ] && ViashError Bad arguments for option \'-g\': \'$VIASH_PAR_REBGZIP\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_REBGZIP=true
shift 1
;;
--index)
[ -n "$VIASH_PAR_INDEX" ] && ViashError Bad arguments for option \'--index\': \'$VIASH_PAR_INDEX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INDEX=true
shift 1
;;
-i)
[ -n "$VIASH_PAR_INDEX" ] && ViashError Bad arguments for option \'-i\': \'$VIASH_PAR_INDEX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_INDEX=true
shift 1
;;
--compress_level)
[ -n "$VIASH_PAR_COMPRESS_LEVEL" ] && ViashError Bad arguments for option \'--compress_level\': \'$VIASH_PAR_COMPRESS_LEVEL\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_COMPRESS_LEVEL="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to --compress_level. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--compress_level=*)
[ -n "$VIASH_PAR_COMPRESS_LEVEL" ] && ViashError Bad arguments for option \'--compress_level=*\': \'$VIASH_PAR_COMPRESS_LEVEL\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_COMPRESS_LEVEL=$(ViashRemoveFlags "$1")
shift 1
;;
-l)
[ -n "$VIASH_PAR_COMPRESS_LEVEL" ] && ViashError Bad arguments for option \'-l\': \'$VIASH_PAR_COMPRESS_LEVEL\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_COMPRESS_LEVEL="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to -l. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--reindex)
[ -n "$VIASH_PAR_REINDEX" ] && ViashError Bad arguments for option \'--reindex\': \'$VIASH_PAR_REINDEX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_REINDEX=true
shift 1
;;
-r)
[ -n "$VIASH_PAR_REINDEX" ] && ViashError Bad arguments for option \'-r\': \'$VIASH_PAR_REINDEX\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_REINDEX=true
shift 1
;;
--size)
[ -n "$VIASH_PAR_SIZE" ] && ViashError Bad arguments for option \'--size\': \'$VIASH_PAR_SIZE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_SIZE="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to --size. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--size=*)
[ -n "$VIASH_PAR_SIZE" ] && ViashError Bad arguments for option \'--size=*\': \'$VIASH_PAR_SIZE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_SIZE=$(ViashRemoveFlags "$1")
shift 1
;;
-s)
[ -n "$VIASH_PAR_SIZE" ] && ViashError Bad arguments for option \'-s\': \'$VIASH_PAR_SIZE\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_SIZE="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to -s. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--test)
[ -n "$VIASH_PAR_TEST" ] && ViashError Bad arguments for option \'--test\': \'$VIASH_PAR_TEST\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_TEST=true
shift 1
;;
-t)
[ -n "$VIASH_PAR_TEST" ] && ViashError Bad arguments for option \'-t\': \'$VIASH_PAR_TEST\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_TEST=true
shift 1
;;
--binary)
[ -n "$VIASH_PAR_BINARY" ] && ViashError Bad arguments for option \'--binary\': \'$VIASH_PAR_BINARY\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_BINARY=true
--full_header)
[ -n "$VIASH_PAR_FULL_HEADER" ] && ViashError Bad arguments for option \'--full_header\': \'$VIASH_PAR_FULL_HEADER\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_FULL_HEADER=true
shift 1
;;
---engine)
@@ -858,7 +810,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/bgzip:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/bedtools/bedtools_getfasta:v0.1.0'
fi
# print dockerfile
@@ -938,10 +890,6 @@ fi
# check whether required parameters exist
if [ -z ${VIASH_PAR_INPUT+x} ]; then
ViashError '--input' is a required argument. Use "--help" to get more information on the parameters.
exit 1
fi
if [ -z ${VIASH_PAR_OUTPUT+x} ]; then
ViashError '--output' is a required argument. Use "--help" to get more information on the parameters.
exit 1
@@ -972,95 +920,87 @@ if [ -z ${VIASH_META_TEMP_DIR+x} ]; then
fi
# filling in defaults
if [ -z ${VIASH_PAR_DECOMPRESS+x} ]; then
VIASH_PAR_DECOMPRESS="false"
if [ -z ${VIASH_PAR_RNA+x} ]; then
VIASH_PAR_RNA="false"
fi
if [ -z ${VIASH_PAR_REBGZIP+x} ]; then
VIASH_PAR_REBGZIP="false"
if [ -z ${VIASH_PAR_STRANDEDNESS+x} ]; then
VIASH_PAR_STRANDEDNESS="false"
fi
if [ -z ${VIASH_PAR_INDEX+x} ]; then
VIASH_PAR_INDEX="false"
if [ -z ${VIASH_PAR_TAB+x} ]; then
VIASH_PAR_TAB="false"
fi
if [ -z ${VIASH_PAR_REINDEX+x} ]; then
VIASH_PAR_REINDEX="false"
if [ -z ${VIASH_PAR_BED_OUT+x} ]; then
VIASH_PAR_BED_OUT="false"
fi
if [ -z ${VIASH_PAR_TEST+x} ]; then
VIASH_PAR_TEST="false"
if [ -z ${VIASH_PAR_NAME+x} ]; then
VIASH_PAR_NAME="false"
fi
if [ -z ${VIASH_PAR_BINARY+x} ]; then
VIASH_PAR_BINARY="false"
if [ -z ${VIASH_PAR_NAME_ONLY+x} ]; then
VIASH_PAR_NAME_ONLY="false"
fi
if [ -z ${VIASH_PAR_SPLIT+x} ]; then
VIASH_PAR_SPLIT="false"
fi
if [ -z ${VIASH_PAR_FULL_HEADER+x} ]; then
VIASH_PAR_FULL_HEADER="false"
fi
# check whether required files exist
if [ ! -z "$VIASH_PAR_INPUT" ] && [ ! -e "$VIASH_PAR_INPUT" ]; then
ViashError "Input file '$VIASH_PAR_INPUT' does not exist."
if [ ! -z "$VIASH_PAR_INPUT_FASTA" ] && [ ! -e "$VIASH_PAR_INPUT_FASTA" ]; then
ViashError "Input file '$VIASH_PAR_INPUT_FASTA' does not exist."
exit 1
fi
if [ ! -z "$VIASH_PAR_INPUT_BED" ] && [ ! -e "$VIASH_PAR_INPUT_BED" ]; then
ViashError "Input file '$VIASH_PAR_INPUT_BED' does not exist."
exit 1
fi
# check whether parameters values are of the right type
if [[ -n "$VIASH_PAR_OFFSET" ]]; then
if ! [[ "$VIASH_PAR_OFFSET" =~ ^[-+]?[0-9]+$ ]]; then
ViashError '--offset' has to be an integer. Use "--help" to get more information on the parameters.
if [[ -n "$VIASH_PAR_RNA" ]]; then
if ! [[ "$VIASH_PAR_RNA" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--rna' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
if [[ -n "$VIASH_PAR_DECOMPRESS" ]]; then
if ! [[ "$VIASH_PAR_DECOMPRESS" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--decompress' has to be a boolean_true. Use "--help" to get more information on the parameters.
if [[ -n "$VIASH_PAR_STRANDEDNESS" ]]; then
if ! [[ "$VIASH_PAR_STRANDEDNESS" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--strandedness' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
if [[ -n "$VIASH_PAR_REBGZIP" ]]; then
if ! [[ "$VIASH_PAR_REBGZIP" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--rebgzip' has to be a boolean_true. Use "--help" to get more information on the parameters.
if [[ -n "$VIASH_PAR_TAB" ]]; then
if ! [[ "$VIASH_PAR_TAB" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--tab' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
if [[ -n "$VIASH_PAR_INDEX" ]]; then
if ! [[ "$VIASH_PAR_INDEX" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--index' has to be a boolean_true. Use "--help" to get more information on the parameters.
if [[ -n "$VIASH_PAR_BED_OUT" ]]; then
if ! [[ "$VIASH_PAR_BED_OUT" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--bed_out' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
if [[ -n "$VIASH_PAR_COMPRESS_LEVEL" ]]; then
if ! [[ "$VIASH_PAR_COMPRESS_LEVEL" =~ ^[-+]?[0-9]+$ ]]; then
ViashError '--compress_level' has to be an integer. Use "--help" to get more information on the parameters.
exit 1
fi
if [[ $VIASH_PAR_COMPRESS_LEVEL -lt -1 ]]; then
ViashError '--compress_level' has be more than or equal to -1. Use "--help" to get more information on the parameters.
exit 1
fi
if [[ $VIASH_PAR_COMPRESS_LEVEL -gt 9 ]]; then
ViashError '--compress_level' has be less than or equal to 9. Use "--help" to get more information on the parameters.
if [[ -n "$VIASH_PAR_NAME" ]]; then
if ! [[ "$VIASH_PAR_NAME" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--name' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
if [[ -n "$VIASH_PAR_REINDEX" ]]; then
if ! [[ "$VIASH_PAR_REINDEX" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--reindex' has to be a boolean_true. Use "--help" to get more information on the parameters.
if [[ -n "$VIASH_PAR_NAME_ONLY" ]]; then
if ! [[ "$VIASH_PAR_NAME_ONLY" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--name_only' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
if [[ -n "$VIASH_PAR_SIZE" ]]; then
if ! [[ "$VIASH_PAR_SIZE" =~ ^[-+]?[0-9]+$ ]]; then
ViashError '--size' has to be an integer. Use "--help" to get more information on the parameters.
exit 1
fi
if [[ $VIASH_PAR_SIZE -lt 0 ]]; then
ViashError '--size' has be more than or equal to 0. Use "--help" to get more information on the parameters.
if [[ -n "$VIASH_PAR_SPLIT" ]]; then
if ! [[ "$VIASH_PAR_SPLIT" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--split' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
if [[ -n "$VIASH_PAR_TEST" ]]; then
if ! [[ "$VIASH_PAR_TEST" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--test' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
if [[ -n "$VIASH_PAR_BINARY" ]]; then
if ! [[ "$VIASH_PAR_BINARY" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--binary' has to be a boolean_true. Use "--help" to get more information on the parameters.
if [[ -n "$VIASH_PAR_FULL_HEADER" ]]; then
if ! [[ "$VIASH_PAR_FULL_HEADER" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--full_header' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
@@ -1141,9 +1081,6 @@ fi
if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -d "$(dirname "$VIASH_PAR_OUTPUT")" ]; then
mkdir -p "$(dirname "$VIASH_PAR_OUTPUT")"
fi
if [ ! -z "$VIASH_PAR_INDEX_NAME" ] && [ ! -d "$(dirname "$VIASH_PAR_INDEX_NAME")" ]; then
mkdir -p "$(dirname "$VIASH_PAR_INDEX_NAME")"
fi
if [ "$VIASH_ENGINE_ID" == "native" ] ; then
if [ "$VIASH_MODE" == "run" ]; then
@@ -1157,20 +1094,19 @@ fi
if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# detect volumes from file arguments
VIASH_CHOWN_VARS=()
if [ ! -z "$VIASH_PAR_INPUT" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_INPUT")" )
VIASH_PAR_INPUT=$(ViashDockerAutodetectMount "$VIASH_PAR_INPUT")
if [ ! -z "$VIASH_PAR_INPUT_FASTA" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_INPUT_FASTA")" )
VIASH_PAR_INPUT_FASTA=$(ViashDockerAutodetectMount "$VIASH_PAR_INPUT_FASTA")
fi
if [ ! -z "$VIASH_PAR_INPUT_BED" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_INPUT_BED")" )
VIASH_PAR_INPUT_BED=$(ViashDockerAutodetectMount "$VIASH_PAR_INPUT_BED")
fi
if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_OUTPUT")" )
VIASH_PAR_OUTPUT=$(ViashDockerAutodetectMount "$VIASH_PAR_OUTPUT")
VIASH_CHOWN_VARS+=( "$VIASH_PAR_OUTPUT" )
fi
if [ ! -z "$VIASH_PAR_INDEX_NAME" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_INDEX_NAME")" )
VIASH_PAR_INDEX_NAME=$(ViashDockerAutodetectMount "$VIASH_PAR_INDEX_NAME")
VIASH_CHOWN_VARS+=( "$VIASH_PAR_INDEX_NAME" )
fi
if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_META_RESOURCES_DIR")" )
VIASH_META_RESOURCES_DIR=$(ViashDockerAutodetectMount "$VIASH_META_RESOURCES_DIR")
@@ -1227,7 +1163,7 @@ fi
ViashDebug "Running command: $(echo $VIASH_CMD)"
cat << VIASHEOF | eval $VIASH_CMD
set -e
tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-bgzip-XXXXXX").sh
tempscript=\$(mktemp "$VIASH_META_TEMP_DIR/viash-run-bedtools_getfasta-XXXXXX").sh
function clean_up {
rm "\$tempscript"
}
@@ -1240,18 +1176,17 @@ trap interrupt INT SIGINT
cat > "\$tempscript" << 'VIASHMAIN'
## VIASH START
# The following code has been auto-generated by Viash.
$( if [ ! -z ${VIASH_PAR_INPUT+x} ]; then echo "${VIASH_PAR_INPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_input='&'#" ; else echo "# par_input="; fi )
$( if [ ! -z ${VIASH_PAR_INPUT_FASTA+x} ]; then echo "${VIASH_PAR_INPUT_FASTA}" | sed "s#'#'\"'\"'#g;s#.*#par_input_fasta='&'#" ; else echo "# par_input_fasta="; fi )
$( if [ ! -z ${VIASH_PAR_INPUT_BED+x} ]; then echo "${VIASH_PAR_INPUT_BED}" | sed "s#'#'\"'\"'#g;s#.*#par_input_bed='&'#" ; else echo "# par_input_bed="; fi )
$( if [ ! -z ${VIASH_PAR_RNA+x} ]; then echo "${VIASH_PAR_RNA}" | sed "s#'#'\"'\"'#g;s#.*#par_rna='&'#" ; else echo "# par_rna="; fi )
$( if [ ! -z ${VIASH_PAR_STRANDEDNESS+x} ]; then echo "${VIASH_PAR_STRANDEDNESS}" | sed "s#'#'\"'\"'#g;s#.*#par_strandedness='&'#" ; else echo "# par_strandedness="; fi )
$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\"'\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
$( if [ ! -z ${VIASH_PAR_INDEX_NAME+x} ]; then echo "${VIASH_PAR_INDEX_NAME}" | sed "s#'#'\"'\"'#g;s#.*#par_index_name='&'#" ; else echo "# par_index_name="; fi )
$( if [ ! -z ${VIASH_PAR_OFFSET+x} ]; then echo "${VIASH_PAR_OFFSET}" | sed "s#'#'\"'\"'#g;s#.*#par_offset='&'#" ; else echo "# par_offset="; fi )
$( if [ ! -z ${VIASH_PAR_DECOMPRESS+x} ]; then echo "${VIASH_PAR_DECOMPRESS}" | sed "s#'#'\"'\"'#g;s#.*#par_decompress='&'#" ; else echo "# par_decompress="; fi )
$( if [ ! -z ${VIASH_PAR_REBGZIP+x} ]; then echo "${VIASH_PAR_REBGZIP}" | sed "s#'#'\"'\"'#g;s#.*#par_rebgzip='&'#" ; else echo "# par_rebgzip="; fi )
$( if [ ! -z ${VIASH_PAR_INDEX+x} ]; then echo "${VIASH_PAR_INDEX}" | sed "s#'#'\"'\"'#g;s#.*#par_index='&'#" ; else echo "# par_index="; fi )
$( if [ ! -z ${VIASH_PAR_COMPRESS_LEVEL+x} ]; then echo "${VIASH_PAR_COMPRESS_LEVEL}" | sed "s#'#'\"'\"'#g;s#.*#par_compress_level='&'#" ; else echo "# par_compress_level="; fi )
$( if [ ! -z ${VIASH_PAR_REINDEX+x} ]; then echo "${VIASH_PAR_REINDEX}" | sed "s#'#'\"'\"'#g;s#.*#par_reindex='&'#" ; else echo "# par_reindex="; fi )
$( if [ ! -z ${VIASH_PAR_SIZE+x} ]; then echo "${VIASH_PAR_SIZE}" | sed "s#'#'\"'\"'#g;s#.*#par_size='&'#" ; else echo "# par_size="; fi )
$( if [ ! -z ${VIASH_PAR_TEST+x} ]; then echo "${VIASH_PAR_TEST}" | sed "s#'#'\"'\"'#g;s#.*#par_test='&'#" ; else echo "# par_test="; fi )
$( if [ ! -z ${VIASH_PAR_BINARY+x} ]; then echo "${VIASH_PAR_BINARY}" | sed "s#'#'\"'\"'#g;s#.*#par_binary='&'#" ; else echo "# par_binary="; fi )
$( if [ ! -z ${VIASH_PAR_TAB+x} ]; then echo "${VIASH_PAR_TAB}" | sed "s#'#'\"'\"'#g;s#.*#par_tab='&'#" ; else echo "# par_tab="; fi )
$( if [ ! -z ${VIASH_PAR_BED_OUT+x} ]; then echo "${VIASH_PAR_BED_OUT}" | sed "s#'#'\"'\"'#g;s#.*#par_bed_out='&'#" ; else echo "# par_bed_out="; fi )
$( if [ ! -z ${VIASH_PAR_NAME+x} ]; then echo "${VIASH_PAR_NAME}" | sed "s#'#'\"'\"'#g;s#.*#par_name='&'#" ; else echo "# par_name="; fi )
$( if [ ! -z ${VIASH_PAR_NAME_ONLY+x} ]; then echo "${VIASH_PAR_NAME_ONLY}" | sed "s#'#'\"'\"'#g;s#.*#par_name_only='&'#" ; else echo "# par_name_only="; fi )
$( if [ ! -z ${VIASH_PAR_SPLIT+x} ]; then echo "${VIASH_PAR_SPLIT}" | sed "s#'#'\"'\"'#g;s#.*#par_split='&'#" ; else echo "# par_split="; fi )
$( if [ ! -z ${VIASH_PAR_FULL_HEADER+x} ]; then echo "${VIASH_PAR_FULL_HEADER}" | sed "s#'#'\"'\"'#g;s#.*#par_full_header='&'#" ; else echo "# par_full_header="; fi )
$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\"'\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\"'\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
@@ -1272,25 +1207,27 @@ $( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}"
$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\"'\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
## VIASH END
[[ "\$par_decompress" == "false" ]] && unset par_decompress
[[ "\$par_rebgzip" == "false" ]] && unset par_rebgzip
[[ "\$par_index" == "false" ]] && unset par_index
[[ "\$par_reindex" == "false" ]] && unset par_reindex
[[ "\$par_test" == "false" ]] && unset par_test
[[ "\$par_binary" == "false" ]] && unset par_binary
bgzip -c \\
\${meta_cpus:+--threads "\${meta_cpus}"} \\
\${par_offset:+-b "\${par_offset}"} \\
\${par_decompress:+-d} \\
\${par_rebgzip:+-g} \\
\${par_index:+-i} \\
\${par_index_name:+-I "\${par_index_name}"} \\
\${par_compress_level:+-l "\${par_compress_level}"} \\
\${par_reindex:+-r} \\
\${par_size:+-s "\${par_size}"} \\
\${par_test:+-t} \\
\${par_binary:+--binary} \\
"\$par_input" > "\$par_output"
#!/usr/bin/env bash
set -eo pipefail
unset_if_false=( par_rna par_strandedness par_tab par_bed_out par_name par_name_only par_split par_full_header )
for par in \${unset_if_false[@]}; do
test_val="\${!par}"
[[ "\$test_val" == "false" ]] && unset \$par
done
bedtools getfasta \\
-fi "\$par_input_fasta" \\
-bed "\$par_input_bed" \\
\${par_rna:+-rna} \\
\${par_name:+-name} \\
\${par_name_only:+-nameOnly} \\
\${par_tab:+-tab} \\
\${par_bed_out:+-bedOut} \\
\${par_strandedness:+-s} \\
\${par_split:+-split} \\
\${par_full_header:+-fullHeader} > "\$par_output"
VIASHMAIN
bash "\$tempscript" &
wait "\$!"
@@ -1301,15 +1238,15 @@ VIASHEOF
if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# strip viash automount from file paths
if [ ! -z "$VIASH_PAR_INPUT" ]; then
VIASH_PAR_INPUT=$(ViashDockerStripAutomount "$VIASH_PAR_INPUT")
if [ ! -z "$VIASH_PAR_INPUT_FASTA" ]; then
VIASH_PAR_INPUT_FASTA=$(ViashDockerStripAutomount "$VIASH_PAR_INPUT_FASTA")
fi
if [ ! -z "$VIASH_PAR_INPUT_BED" ]; then
VIASH_PAR_INPUT_BED=$(ViashDockerStripAutomount "$VIASH_PAR_INPUT_BED")
fi
if [ ! -z "$VIASH_PAR_OUTPUT" ]; then
VIASH_PAR_OUTPUT=$(ViashDockerStripAutomount "$VIASH_PAR_OUTPUT")
fi
if [ ! -z "$VIASH_PAR_INDEX_NAME" ]; then
VIASH_PAR_INDEX_NAME=$(ViashDockerStripAutomount "$VIASH_PAR_INDEX_NAME")
fi
if [ ! -z "$VIASH_META_RESOURCES_DIR" ]; then
VIASH_META_RESOURCES_DIR=$(ViashDockerStripAutomount "$VIASH_META_RESOURCES_DIR")
fi
@@ -1330,10 +1267,6 @@ if [ ! -z "$VIASH_PAR_OUTPUT" ] && [ ! -e "$VIASH_PAR_OUTPUT" ]; then
ViashError "Output file '$VIASH_PAR_OUTPUT' does not exist."
exit 1
fi
if [ ! -z "$VIASH_PAR_INDEX_NAME" ] && [ ! -e "$VIASH_PAR_INDEX_NAME" ]; then
ViashError "Output file '$VIASH_PAR_INDEX_NAME' does not exist."
exit 1
fi
exit 0

19
target/executable/busco/busco_download_datasets/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "busco_download_datasets"
namespace: "busco"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -127,7 +127,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/busco:5.6.1--pyhdfd78af_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -144,11 +144,11 @@ build_info:
output: "target/executable/busco/busco_download_datasets"
executable: "target/executable/busco/busco_download_datasets/busco_download_datasets"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -158,16 +158,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/busco/busco_download_datasets/busco_download_datasets
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# busco_download_datasets v0.1
# busco_download_datasets v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "busco_download_datasets v0.1"
echo "busco_download_datasets v0.1.0"
echo ""
echo "Downloads available busco datasets"
echo ""
@@ -470,10 +470,10 @@ ENTRYPOINT []
RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component busco busco_download_datasets"
LABEL org.opencontainers.image.created="2024-06-24T08:44:06Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:39Z"
LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -596,7 +596,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "busco_download_datasets v0.1"
echo "busco_download_datasets v0.1.0"
exit
;;
--download)
@@ -697,7 +697,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/busco/busco_download_datasets:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/busco/busco_download_datasets:v0.1.0'
fi
# print dockerfile

19
target/executable/busco/busco_list_datasets/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "busco_list_datasets"
namespace: "busco"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Outputs"
arguments:
@@ -114,7 +114,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/busco:5.6.1--pyhdfd78af_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -131,11 +131,11 @@ build_info:
output: "target/executable/busco/busco_list_datasets"
executable: "target/executable/busco/busco_list_datasets/busco_list_datasets"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -145,16 +145,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/busco/busco_list_datasets/busco_list_datasets
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# busco_list_datasets v0.1
# busco_list_datasets v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "busco_list_datasets v0.1"
echo "busco_list_datasets v0.1.0"
echo ""
echo "Lists the available busco datasets"
echo ""
@@ -460,10 +460,10 @@ ENTRYPOINT []
RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component busco busco_list_datasets"
LABEL org.opencontainers.image.created="2024-06-24T08:44:05Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:38Z"
LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -586,7 +586,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "busco_list_datasets v0.1"
echo "busco_list_datasets v0.1.0"
exit
;;
--output)
@@ -682,7 +682,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/busco/busco_list_datasets:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/busco/busco_list_datasets:v0.1.0'
fi
# print dockerfile

19
target/executable/busco/busco_run/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "busco_run"
namespace: "busco"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -387,7 +387,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/busco:5.6.1--pyhdfd78af_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -404,11 +404,11 @@ build_info:
output: "target/executable/busco/busco_run"
executable: "target/executable/busco/busco_run/busco_run"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -418,16 +418,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/busco/busco_run/busco_run
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# busco_run v0.1
# busco_run v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "busco_run v0.1"
echo "busco_run v0.1.0"
echo ""
echo "Assessment of genome assembly and annotation completeness with single copy"
echo "orthologs"
@@ -623,10 +623,10 @@ ENTRYPOINT []
RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component busco busco_run"
LABEL org.opencontainers.image.created="2024-06-24T08:44:05Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:38Z"
LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -749,7 +749,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "busco_run v0.1"
echo "busco_run v0.1.0"
exit
;;
--input)
@@ -1087,7 +1087,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/busco/busco_run:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/busco/busco_run:v0.1.0'
fi
# print dockerfile

733
target/executable/cutadapt/.config.vsh.yaml Normal file
View File

@@ -0,0 +1,733 @@
name: "cutadapt"
version: "v0.1.0"
argument_groups:
- name: "Specify Adapters for R1"
arguments:
- type: "string"
name: "--adapter"
alternatives:
- "-a"
description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\
\ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\
\ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\
\ the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--front"
alternatives:
- "-g"
description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\
\ first read). The adapter and any preceding bases\nare trimmed. Partial matches\
\ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\
\ the adapter is\nonly found if it is a prefix of the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--anywhere"
alternatives:
- "-b"
description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\
\ (paired data: of the first read). Both types of\nmatches as described under\
\ -a and -g are allowed. If the\nfirst base of the read is part of the match,\
\ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\
for rescuing failed library preparations - do not use if\nyou know which end\
\ your adapter was ligated to!\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- name: "Specify Adapters using Fasta files for R1"
arguments:
- type: "file"
name: "--adapter_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 3'\
\ end (paired data:\nof the first read). The adapter and subsequent bases are\n\
trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\
\ found if it is a suffix of the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "file"
name: "--front_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 5'\
\ end (paired data:\nof the first read). The adapter and any preceding bases\n\
are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\
\ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\
\ the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--anywhere_fasta"
description: "Fasta file containing sequences of an adapter that may be ligated\
\ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\
\ as described under -a and -g are allowed. If the\nfirst base of the read is\
\ part of the match, the behavior\nis as with -g, otherwise as with -a. This\
\ option is mostly\nfor rescuing failed library preparations - do not use if\n\
you know which end your adapter was ligated to!\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Specify Adapters for R2"
arguments:
- type: "string"
name: "--adapter_r2"
alternatives:
- "-A"
description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\
\ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\
\ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\
\ the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--front_r2"
alternatives:
- "-G"
description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\
\ first read). The adapter and any preceding bases\nare trimmed. Partial matches\
\ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\
\ the adapter is\nonly found if it is a prefix of the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--anywhere_r2"
alternatives:
- "-B"
description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\
\ (paired data: of the first read). Both types of\nmatches as described under\
\ -a and -g are allowed. If the\nfirst base of the read is part of the match,\
\ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\
for rescuing failed library preparations - do not use if\nyou know which end\
\ your adapter was ligated to!\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- name: "Specify Adapters using Fasta files for R2"
arguments:
- type: "file"
name: "--adapter_r2_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 3'\
\ end (paired data:\nof the first read). The adapter and subsequent bases are\n\
trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\
\ found if it is a suffix of the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--front_r2_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 5'\
\ end (paired data:\nof the first read). The adapter and any preceding bases\n\
are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\
\ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\
\ the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--anywhere_r2_fasta"
description: "Fasta file containing sequences of an adapter that may be ligated\
\ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\
\ as described under -a and -g are allowed. If the\nfirst base of the read is\
\ part of the match, the behavior\nis as with -g, otherwise as with -a. This\
\ option is mostly\nfor rescuing failed library preparations - do not use if\n\
you know which end your adapter was ligated to!\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Paired-end options"
arguments:
- type: "boolean_true"
name: "--pair_adapters"
description: "Treat adapters given with -a/-A etc. as pairs. Either both\nor none\
\ are removed from each read pair.\n"
info: null
direction: "input"
- type: "string"
name: "--pair_filter"
description: "Which of the reads in a paired-end read have to match the\nfiltering\
\ criterion in order for the pair to be filtered.\n"
info: null
required: false
choices:
- "any"
- "both"
- "first"
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--interleaved"
description: "Read and/or write interleaved paired-end reads.\n"
info: null
direction: "input"
- name: "Input parameters"
arguments:
- type: "file"
name: "--input"
description: "Input fastq file for single-end reads or R1 for paired-end reads.\n"
info: null
must_exist: true
create_parent: true
required: true
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--input_r2"
description: "Input fastq file for R2 in the case of paired-end reads.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "double"
name: "--error_rate"
alternatives:
- "-E"
- "--errors"
description: "Maximum allowed error rate (if 0 <= E < 1), or absolute\nnumber\
\ of errors for full-length adapter match (if E is an\ninteger >= 1). Error\
\ rate = no. of errors divided by\nlength of matching region. Default: 0.1 (10%).\n"
info: null
example:
- 0.1
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_false"
name: "--no_indels"
description: "Allow only mismatches in alignments.\n"
info: null
direction: "input"
- type: "integer"
name: "--times"
alternatives:
- "-n"
description: "Remove up to COUNT adapters from each read. Default: 1.\n"
info: null
example:
- 1
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--overlap"
alternatives:
- "-O"
description: "Require MINLENGTH overlap between read and adapter for an\nadapter\
\ to be found. The default is 3.\n"
info: null
example:
- 3
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--match_read_wildcards"
description: "Interpret IUPAC wildcards in reads.\n"
info: null
direction: "input"
- type: "boolean_false"
name: "--no_match_adapter_wildcards"
description: "Do not interpret IUPAC wildcards in adapters.\n"
info: null
direction: "input"
- type: "string"
name: "--action"
description: "What to do if a match was found. trim: trim adapter and\nup- or\
\ downstream sequence; retain: trim, but retain\nadapter; mask: replace with\
\ 'N' characters; lowercase:\nconvert to lowercase; none: leave unchanged.\n\
The default is trim.\n"
info: null
example:
- "trim"
required: false
choices:
- "trim"
- "retain"
- "mask"
- "lowercase"
- "none"
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--revcomp"
alternatives:
- "--rc"
description: "Check both the read and its reverse complement for adapter\nmatches.\
\ If match is on reverse-complemented version,\noutput that one.\n"
info: null
direction: "input"
- name: "Read modifications"
arguments:
- type: "integer"
name: "--cut"
alternatives:
- "-u"
description: "Remove LEN bases from each read (or R1 if paired; use --cut_r2\n\
option for R2). If LEN is positive, remove bases from the\nbeginning. If LEN\
\ is negative, remove bases from the end.\nCan be used twice if LENs have different\
\ signs. Applied\n*before* adapter trimming.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "integer"
name: "--cut_r2"
description: "Remove LEN bases from each read (for R2). If LEN is positive, remove\
\ bases from the\nbeginning. If LEN is negative, remove bases from the end.\n\
Can be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--nextseq_trim"
description: "NextSeq-specific quality trimming (each read). Trims also\ndark\
\ cycles appearing as high-quality G bases.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--quality_cutoff"
alternatives:
- "-q"
description: "Trim low-quality bases from 5' and/or 3' ends of each read\nbefore\
\ adapter removal. Applied to both reads if data is\npaired. If one value is\
\ given, only the 3' end is trimmed.\nIf two comma-separated cutoffs are given,\
\ the 5' end is\ntrimmed with the first cutoff, the 3' end with the second.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--quality_cutoff_r2"
alternatives:
- "-Q"
description: "Quality-trimming cutoff for R2. Default: same as for R1\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--quality_base"
description: "Assume that quality values in FASTQ are encoded as\nascii(quality\
\ + N). This needs to be set to 64 for some\nold Illumina FASTQ files. The default\
\ is 33.\n"
info: null
example:
- 33
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--poly_a"
description: "Trim poly-A tails"
info: null
direction: "input"
- type: "integer"
name: "--length"
alternatives:
- "-l"
description: "Shorten reads to LENGTH. Positive values remove bases at\nthe end\
\ while negative ones remove bases at the beginning.\nThis and the following\
\ modifications are applied after\nadapter trimming.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--trim_n"
description: "Trim N's on ends of reads."
info: null
direction: "input"
- type: "string"
name: "--length_tag"
description: "Search for TAG followed by a decimal number in the\ndescription\
\ field of the read. Replace the decimal number\nwith the correct length of\
\ the trimmed read. For example,\nuse --length-tag 'length=' to correct fields\
\ like\n'length=123'.\n"
info: null
example:
- "length="
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--strip_suffix"
description: "Remove this suffix from read names if present. Can be\ngiven multiple\
\ times.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--prefix"
alternatives:
- "-x"
description: "Add this prefix to read names. Use {name} to insert the\nname of\
\ the matching adapter.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--suffix"
alternatives:
- "-y"
description: "Add this suffix to read names; can also include {name}\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--rename"
description: "Rename reads using TEMPLATE containing variables such as\n{id},\
\ {adapter_name} etc. (see documentation)\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--zero_cap"
alternatives:
- "-z"
description: "Change negative quality values to zero."
info: null
direction: "input"
- name: "Filtering of processed reads"
description: "Filters are applied after above read modifications. Paired-end reads\
\ are\nalways discarded pairwise (see also --pair_filter).\n"
arguments:
- type: "string"
name: "--minimum_length"
alternatives:
- "-m"
description: "Discard reads shorter than LEN. Default is 0.\nWhen trimming paired-end\
\ reads, the minimum lengths for R1 and R2 can be specified separately by separating\
\ them with a colon (:).\nIf the colon syntax is not used, the same minimum\
\ length applies to both reads, as discussed above.\nAlso, one of the values\
\ can be omitted to impose no restrictions.\nFor example, with -m 17:, the length\
\ of R1 must be at least 17, but the length of R2 is ignored.\n"
info: null
example:
- "0"
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--maximum_length"
alternatives:
- "-M"
description: "Discard reads longer than LEN. Default: no limit.\nFor paired reads,\
\ see the remark for --minimum_length\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--max_n"
description: "Discard reads with more than COUNT 'N' bases. If COUNT is\na number\
\ between 0 and 1, it is interpreted as a fraction\nof the read length.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "long"
name: "--max_expected_errors"
alternatives:
- "--max_ee"
description: "Discard reads whose expected number of errors (computed\nfrom quality\
\ values) exceeds ERRORS.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "long"
name: "--max_average_error_rate"
alternatives:
- "--max_aer"
description: "as --max_expected_errors (see above), but divided by\nlength to\
\ account for reads of varying length.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--discard_trimmed"
alternatives:
- "--discard"
description: "Discard reads that contain an adapter. Use also -O to\navoid discarding\
\ too many randomly matching reads.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--discard_untrimmed"
alternatives:
- "--trimmed_only"
description: "Discard reads that do not contain an adapter.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--discard_casava"
description: "Discard reads that did not pass CASAVA filtering (header\nhas :Y:).\n"
info: null
direction: "input"
- name: "Output parameters"
arguments:
- type: "string"
name: "--report"
description: "Which type of report to print: 'full' (default) or 'minimal'.\n"
info: null
example:
- "full"
required: false
choices:
- "full"
- "minimal"
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--json"
description: "Write report in JSON format to this file.\n"
info: null
direction: "input"
- type: "file"
name: "--output"
description: "Glob pattern for matching the expected output files.\nShould include\
\ `$output_dir`.\n"
info: null
example:
- "fastq/*_001.fast[a,q]"
must_exist: true
create_parent: true
required: true
direction: "output"
multiple: true
multiple_sep: ";"
- type: "boolean_true"
name: "--fasta"
description: "Output FASTA to standard output even on FASTQ input.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--info_file"
description: "Write information about each read and its adapter matches\ninto\
\ info.txt in the output directory.\nSee the documentation for the file format.\n"
info: null
direction: "input"
- name: "Debug"
arguments:
- type: "boolean_true"
name: "--debug"
description: "Print debug information"
info: null
direction: "input"
resources:
- type: "bash_script"
path: "script.sh"
is_executable: true
description: "Cutadapt removes adapter sequences from high-throughput sequencing reads.\n"
test_resources:
- type: "bash_script"
path: "test.sh"
is_executable: true
info: null
status: "enabled"
requirements:
commands:
- "ps"
keywords:
- "RNA-seq"
- "scRNA-seq"
- "high-throughput"
license: "MIT"
references:
doi:
- "10.14806/ej.17.1.200"
links:
repository: "https://github.com/marcelm/cutadapt"
homepage: "https://cutadapt.readthedocs.io"
documentation: "https://cutadapt.readthedocs.io"
runners:
- type: "executable"
id: "executable"
docker_setup_strategy: "ifneedbepullelsecachedbuild"
- type: "nextflow"
id: "nextflow"
directives:
tag: "$id"
auto:
simplifyInput: true
simplifyOutput: false
transcript: false
publish: false
config:
labels:
mem1gb: "memory = 1000000000.B"
mem2gb: "memory = 2000000000.B"
mem5gb: "memory = 5000000000.B"
mem10gb: "memory = 10000000000.B"
mem20gb: "memory = 20000000000.B"
mem50gb: "memory = 50000000000.B"
mem100gb: "memory = 100000000000.B"
mem200gb: "memory = 200000000000.B"
mem500gb: "memory = 500000000000.B"
mem1tb: "memory = 1000000000000.B"
mem2tb: "memory = 2000000000000.B"
mem5tb: "memory = 5000000000000.B"
mem10tb: "memory = 10000000000000.B"
mem20tb: "memory = 20000000000000.B"
mem50tb: "memory = 50000000000000.B"
mem100tb: "memory = 100000000000000.B"
mem200tb: "memory = 200000000000000.B"
mem500tb: "memory = 500000000000000.B"
mem1gib: "memory = 1073741824.B"
mem2gib: "memory = 2147483648.B"
mem4gib: "memory = 4294967296.B"
mem8gib: "memory = 8589934592.B"
mem16gib: "memory = 17179869184.B"
mem32gib: "memory = 34359738368.B"
mem64gib: "memory = 68719476736.B"
mem128gib: "memory = 137438953472.B"
mem256gib: "memory = 274877906944.B"
mem512gib: "memory = 549755813888.B"
mem1tib: "memory = 1099511627776.B"
mem2tib: "memory = 2199023255552.B"
mem4tib: "memory = 4398046511104.B"
mem8tib: "memory = 8796093022208.B"
mem16tib: "memory = 17592186044416.B"
mem32tib: "memory = 35184372088832.B"
mem64tib: "memory = 70368744177664.B"
mem128tib: "memory = 140737488355328.B"
mem256tib: "memory = 281474976710656.B"
mem512tib: "memory = 562949953421312.B"
cpu1: "cpus = 1"
cpu2: "cpus = 2"
cpu5: "cpus = 5"
cpu10: "cpus = 10"
cpu20: "cpus = 20"
cpu50: "cpus = 50"
cpu100: "cpus = 100"
cpu200: "cpus = 200"
cpu500: "cpus = 500"
cpu1000: "cpus = 1000"
debug: false
container: "docker"
engines:
- type: "docker"
id: "docker"
image: "python:3.12"
target_registry: "images.viash-hub.com"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "python"
user: false
pip:
- "cutadapt"
upgrade: true
- type: "docker"
run:
- "cutadapt --version | sed 's/\\(.*\\)/cutadapt: \"\\1\"/' > /var/software_versions.txt\n"
entrypoint: []
cmd: null
- type: "native"
id: "native"
build_info:
config: "src/cutadapt/config.vsh.yaml"
runner: "executable"
engine: "docker|native"
output: "target/executable/cutadapt"
executable: "target/executable/cutadapt/cutadapt"
viash_version: "0.9.0-RC6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
source: "src"
target: "target"
config_mods:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

2725
target/executable/cutadapt/cutadapt Executable file
View File

File diff suppressed because it is too large Load Diff

19
target/executable/falco/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "falco"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Input arguments"
arguments:
@@ -274,7 +274,7 @@ engines:
id: "docker"
image: "debian:trixie-slim"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "apt"
@@ -304,11 +304,11 @@ build_info:
output: "target/executable/falco"
executable: "target/executable/falco/falco"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -318,16 +318,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/falco/falco
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# falco v0.1
# falco v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "falco v0.1"
echo "falco v0.1.0"
echo ""
echo "A C++ drop-in replacement of FastQC to assess the quality of sequence read data"
echo ""
@@ -584,10 +584,10 @@ make install
RUN echo "falco: \"$(falco -v | sed -n 's/^falco //p')\"" > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component falco"
LABEL org.opencontainers.image.created="2024-06-24T08:44:08Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:42Z"
LABEL org.opencontainers.image.source="https://github.com/smithlabcode/falco"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -710,7 +710,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "falco v0.1"
echo "falco v0.1.0"
exit
;;
--input)
@@ -966,7 +966,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/falco:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/falco:v0.1.0'
fi
# print dockerfile

19
target/executable/fastp/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "fastp"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
description: "`fastp` supports both single-end (SE) and paired-end (PE) input.\n\
@@ -1048,7 +1048,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/fastp:0.23.4--hadf994f_2"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -1065,11 +1065,11 @@ build_info:
output: "target/executable/fastp"
executable: "target/executable/fastp/fastp"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -1079,16 +1079,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/fastp/fastp
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# fastp v0.1
# fastp v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "fastp v0.1"
echo "fastp v0.1.0"
echo ""
echo "An ultra-fast all-in-one FASTQ preprocessor"
echo "(QC/adapters/trimming/filtering/splitting/merging...)."
@@ -1023,10 +1023,10 @@ ENTRYPOINT []
RUN fastp --version 2>&1 | sed 's# #: "#;s#$#"#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component fastp"
LABEL org.opencontainers.image.created="2024-06-24T08:44:06Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:39Z"
LABEL org.opencontainers.image.source="https://github.com/OpenGene/fastp"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -1149,7 +1149,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "fastp v0.1"
echo "fastp v0.1.0"
exit
;;
--in1)
@@ -2153,7 +2153,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/fastp:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/fastp:v0.1.0'
fi
# print dockerfile

19
target/executable/featurecounts/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "featurecounts"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -613,7 +613,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/subread:2.0.6--he4a0461_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -631,11 +631,11 @@ build_info:
output: "target/executable/featurecounts"
executable: "target/executable/featurecounts/featurecounts"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -645,16 +645,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/featurecounts/featurecounts
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# featurecounts v0.1
# featurecounts v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "featurecounts v0.1"
echo "featurecounts v0.1.0"
echo ""
echo "featureCounts is a read summarization program for counting reads generated from"
echo "either RNA or genomic DNA sequencing experiments by implementing highly"
@@ -749,10 +749,10 @@ ENTRYPOINT []
RUN featureCounts -v 2>&1 | sed 's/featureCounts v\([0-9.]*\)/featureCounts: \1/' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component featurecounts"
LABEL org.opencontainers.image.created="2024-06-24T08:43:59Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:30Z"
LABEL org.opencontainers.image.source="https://github.com/ShiLab-Bioinformatics/subread"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -875,7 +875,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "featurecounts v0.1"
echo "featurecounts v0.1.0"
exit
;;
--annotation)
@@ -1467,7 +1467,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/featurecounts:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/featurecounts:v0.1.0'
fi
# print dockerfile

19
target/executable/gffread/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "gffread"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -654,7 +654,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/gffread:0.12.7--hdcf5f25_3"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -671,11 +671,11 @@ build_info:
output: "target/executable/gffread"
executable: "target/executable/gffread/gffread"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -685,16 +685,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/gffread/gffread
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# gffread v0.1
# gffread v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "gffread v0.1"
echo "gffread v0.1.0"
echo ""
echo "Validate, filter, convert and perform various other operations on GFF files."
echo ""
@@ -802,10 +802,10 @@ ENTRYPOINT []
RUN echo "gffread: \"$(gffread --version 2>&1)\"" > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component gffread"
LABEL org.opencontainers.image.created="2024-06-24T08:44:03Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:36Z"
LABEL org.opencontainers.image.source="https://github.com/gpertea/gffread"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -928,7 +928,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "gffread v0.1"
echo "gffread v0.1.0"
exit
;;
--input)
@@ -1655,7 +1655,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/gffread:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/gffread:v0.1.0'
fi
# print dockerfile

21
target/executable/lofreq/lofreq_call/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "lofreq_call"
namespace: "lofreq"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -398,7 +398,7 @@ references:
doi:
- "10.1093/nar/gks918"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
homepage: "https://csb5.github.io/lofreq/"
documentation: "https://csb5.github.io/lofreq/commands/"
runners:
@@ -471,7 +471,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/lofreq:2.1.5--py38h794fc9e_10"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -489,11 +489,11 @@ build_info:
output: "target/executable/lofreq/lofreq_call"
executable: "target/executable/lofreq/lofreq_call/lofreq_call"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -503,16 +503,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

16
target/executable/lofreq/lofreq_call/lofreq_call
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# lofreq_call v0.1
# lofreq_call v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "lofreq_call v0.1"
echo "lofreq_call v0.1.0"
echo ""
echo "Call variants from a BAM file."
echo ""
@@ -651,10 +651,10 @@ RUN version=$(lofreq version | grep 'version' | sed 's/version: //') && \
echo "lofreq: $version" > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_call"
LABEL org.opencontainers.image.created="2024-06-24T08:44:07Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobbox"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.created="2024-06-24T09:12:42Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -777,7 +777,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "lofreq_call v0.1"
echo "lofreq_call v0.1.0"
exit
;;
--input)
@@ -1289,7 +1289,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/lofreq/lofreq_call:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/lofreq/lofreq_call:v0.1.0'
fi
# print dockerfile

21
target/executable/lofreq/lofreq_indelqual/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "lofreq_indelqual"
namespace: "lofreq"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -106,7 +106,7 @@ references:
doi:
- "10.1093/nar/gks918"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
homepage: "https://csb5.github.io/lofreq/"
documentation: "https://csb5.github.io/lofreq/commands/"
runners:
@@ -179,7 +179,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/lofreq:2.1.5--py38h794fc9e_10"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -197,11 +197,11 @@ build_info:
output: "target/executable/lofreq/lofreq_indelqual"
executable: "target/executable/lofreq/lofreq_indelqual/lofreq_indelqual"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -211,16 +211,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

16
target/executable/lofreq/lofreq_indelqual/lofreq_indelqual
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# lofreq_indelqual v0.1
# lofreq_indelqual v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "lofreq_indelqual v0.1"
echo "lofreq_indelqual v0.1.0"
echo ""
echo "Insert indel qualities into BAM file (required for indel predictions)."
echo ""
@@ -496,10 +496,10 @@ RUN version=$(lofreq version | grep 'version' | sed 's/version: //') && \
echo "lofreq: $version" > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_indelqual"
LABEL org.opencontainers.image.created="2024-06-24T08:44:07Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobbox"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.created="2024-06-24T09:12:42Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -622,7 +622,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "lofreq_indelqual v0.1"
echo "lofreq_indelqual v0.1.0"
exit
;;
--input)
@@ -773,7 +773,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/lofreq/lofreq_indelqual:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/lofreq/lofreq_indelqual:v0.1.0'
fi
# print dockerfile

21
target/executable/multiqc/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "multiqc"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Input"
arguments:
@@ -344,7 +344,7 @@ requirements:
- "ps"
license: "MIT"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
runners:
- type: "executable"
id: "executable"
@@ -415,7 +415,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/multiqc:1.21--pyhdfd78af_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -438,11 +438,11 @@ build_info:
output: "target/executable/multiqc"
executable: "target/executable/multiqc/multiqc"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -452,16 +452,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

16
target/executable/multiqc/multiqc
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# multiqc v0.1
# multiqc v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "multiqc v0.1"
echo "multiqc v0.1.0"
echo ""
echo "MultiQC aggregates results from bioinformatics analyses across many samples into"
echo "a single report."
@@ -632,10 +632,10 @@ ENTRYPOINT []
RUN multiqc --version | sed 's/multiqc, version\s\(.*\)/multiqc: "\1"/' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component multiqc"
LABEL org.opencontainers.image.created="2024-06-24T08:44:00Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobbox"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.created="2024-06-24T09:12:32Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -758,7 +758,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "multiqc v0.1"
echo "multiqc v0.1.0"
exit
;;
--input)
@@ -1155,7 +1155,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/multiqc:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/multiqc:v0.1.0'
fi
# print dockerfile

19
target/executable/pear/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "pear"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -362,7 +362,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/pear:0.9.6--h9d449c0_10"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -380,11 +380,11 @@ build_info:
output: "target/executable/pear"
executable: "target/executable/pear/pear"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -394,16 +394,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/pear/pear
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# pear v0.1
# pear v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "pear v0.1"
echo "pear v0.1.0"
echo ""
echo "PEAR is an ultrafast, memory-efficient and highly accurate pair-end read merger."
echo "It is fully parallelized and can run with as low as just a few kilobytes of"
@@ -592,10 +592,10 @@ RUN version=$(pear -h | grep 'PEAR v' | sed 's/PEAR v//' | sed 's/ .*//') && \
echo "pear: $version" > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component pear"
LABEL org.opencontainers.image.created="2024-06-24T08:44:03Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:35Z"
LABEL org.opencontainers.image.source="https://github.com/tseemann/PEAR"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -718,7 +718,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "pear v0.1"
echo "pear v0.1.0"
exit
;;
--forward_fastq)
@@ -1082,7 +1082,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/pear:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/pear:v0.1.0'
fi
# print dockerfile

19
target/executable/salmon/salmon_index/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "salmon_index"
namespace: "salmon"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -246,7 +246,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/salmon:1.10.2--hecfa306_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -263,11 +263,11 @@ build_info:
output: "target/executable/salmon/salmon_index"
executable: "target/executable/salmon/salmon_index/salmon_index"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -277,16 +277,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/salmon/salmon_index/salmon_index
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# salmon_index v0.1
# salmon_index v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "salmon_index v0.1"
echo "salmon_index v0.1.0"
echo ""
echo "Salmon is a tool for wicked-fast transcript quantification from RNA-seq data. It"
echo "can either make use of pre-computed alignments (in the form of a SAM/BAM file)"
@@ -541,10 +541,10 @@ ENTRYPOINT []
RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_index"
LABEL org.opencontainers.image.created="2024-06-24T08:44:04Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:37Z"
LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -667,7 +667,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "salmon_index v0.1"
echo "salmon_index v0.1.0"
exit
;;
--genome)
@@ -889,7 +889,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/salmon/salmon_index:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/salmon/salmon_index:v0.1.0'
fi
# print dockerfile

29
target/executable/salmon/salmon_quant/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "salmon_quant"
namespace: "salmon"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Common input options"
arguments:
@@ -54,7 +54,7 @@ argument_groups:
- "transcriptome_index"
must_exist: true
create_parent: true
required: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
@@ -561,7 +561,7 @@ argument_groups:
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
- type: "boolean_true"
name: "--write_mappings"
alternatives:
- "-z"
@@ -569,6 +569,12 @@ argument_groups:
\ will be written out in SAM-compatible format. By default, output will be directed\
\ to stdout, but an alternative file name can be provided instead.\n"
info: null
direction: "input"
- type: "file"
name: "--mapping_sam"
description: "Path to file that should output the selective-alignment results\
\ in SAM-compatible format. THis option must be provided while using --write_mappings"
info: null
example:
- "mappings.sam"
must_exist: true
@@ -1136,7 +1142,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/salmon:1.10.2--hecfa306_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -1153,11 +1159,11 @@ build_info:
output: "target/executable/salmon/salmon_quant"
executable: "target/executable/salmon/salmon_quant/salmon_quant"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -1167,16 +1173,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

85
target/executable/salmon/salmon_quant/salmon_quant
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# salmon_quant v0.1
# salmon_quant v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "salmon_quant v0.1"
echo "salmon_quant v0.1.0"
echo ""
echo "Salmon is a tool for wicked-fast transcript quantification from RNA-seq data. It"
echo "can either make use of pre-computed alignments (in the form of a SAM/BAM file)"
@@ -203,7 +203,7 @@ function ViashHelp {
echo ""
echo "Mapping input options:"
echo " -i, --index"
echo " type: file, required parameter, file must exist"
echo " type: file, file must exist"
echo " example: transcriptome_index"
echo " Salmon index."
echo ""
@@ -555,13 +555,19 @@ function ViashHelp {
echo " transcriptome for quantification to proceed."
echo ""
echo " -z, --write_mappings"
echo " type: file, output, file must exist"
echo " example: mappings.sam"
echo " type: boolean_true"
echo " If this option is provided, then the selective-alignment results will be"
echo " written out in SAM-compatible format. By default, output will be"
echo " directed to stdout, but an alternative file name can be provided"
echo " instead."
echo ""
echo " --mapping_sam"
echo " type: file, output, file must exist"
echo " example: mappings.sam"
echo " Path to file that should output the selective-alignment results in"
echo " SAM-compatible format. THis option must be provided while using"
echo " --write_mappings"
echo ""
echo " --write_qualities"
echo " type: boolean_true"
echo " This flag only has meaning if mappings are being written (with"
@@ -1157,10 +1163,10 @@ ENTRYPOINT []
RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_quant"
LABEL org.opencontainers.image.created="2024-06-24T08:44:04Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:36Z"
LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -1283,7 +1289,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "salmon_quant v0.1"
echo "salmon_quant v0.1.0"
exit
;;
--lib_type)
@@ -1761,21 +1767,25 @@ while [[ $# -gt 0 ]]; do
;;
--write_mappings)
[ -n "$VIASH_PAR_WRITE_MAPPINGS" ] && ViashError Bad arguments for option \'--write_mappings\': \'$VIASH_PAR_WRITE_MAPPINGS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_WRITE_MAPPINGS="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to --write_mappings. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--write_mappings=*)
[ -n "$VIASH_PAR_WRITE_MAPPINGS" ] && ViashError Bad arguments for option \'--write_mappings=*\': \'$VIASH_PAR_WRITE_MAPPINGS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_WRITE_MAPPINGS=$(ViashRemoveFlags "$1")
VIASH_PAR_WRITE_MAPPINGS=true
shift 1
;;
-z)
[ -n "$VIASH_PAR_WRITE_MAPPINGS" ] && ViashError Bad arguments for option \'-z\': \'$VIASH_PAR_WRITE_MAPPINGS\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_WRITE_MAPPINGS="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to -z. Use "--help" to get more information on the parameters. && exit 1
VIASH_PAR_WRITE_MAPPINGS=true
shift 1
;;
--mapping_sam)
[ -n "$VIASH_PAR_MAPPING_SAM" ] && ViashError Bad arguments for option \'--mapping_sam\': \'$VIASH_PAR_MAPPING_SAM\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_MAPPING_SAM="$2"
[ $# -lt 2 ] && ViashError Not enough arguments passed to --mapping_sam. Use "--help" to get more information on the parameters. && exit 1
shift 2
;;
--mapping_sam=*)
[ -n "$VIASH_PAR_MAPPING_SAM" ] && ViashError Bad arguments for option \'--mapping_sam=*\': \'$VIASH_PAR_MAPPING_SAM\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_MAPPING_SAM=$(ViashRemoveFlags "$1")
shift 1
;;
--write_qualities)
[ -n "$VIASH_PAR_WRITE_QUALITIES" ] && ViashError Bad arguments for option \'--write_qualities\': \'$VIASH_PAR_WRITE_QUALITIES\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_WRITE_QUALITIES=true
@@ -2234,7 +2244,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/salmon/salmon_quant:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/salmon/salmon_quant:v0.1.0'
fi
# print dockerfile
@@ -2314,10 +2324,6 @@ fi
# check whether required parameters exist
if [ -z ${VIASH_PAR_INDEX+x} ]; then
ViashError '--index' is a required argument. Use "--help" to get more information on the parameters.
exit 1
fi
if [ -z ${VIASH_PAR_OUTPUT+x} ]; then
ViashError '--output' is a required argument. Use "--help" to get more information on the parameters.
exit 1
@@ -2403,6 +2409,9 @@ fi
if [ -z ${VIASH_PAR_HARD_FILTER+x} ]; then
VIASH_PAR_HARD_FILTER="false"
fi
if [ -z ${VIASH_PAR_WRITE_MAPPINGS+x} ]; then
VIASH_PAR_WRITE_MAPPINGS="false"
fi
if [ -z ${VIASH_PAR_WRITE_QUALITIES+x} ]; then
VIASH_PAR_WRITE_QUALITIES="false"
fi
@@ -2918,6 +2927,12 @@ if [[ -n "$VIASH_PAR_MIN_ALN_PROB" ]]; then
exit 1
fi
fi
if [[ -n "$VIASH_PAR_WRITE_MAPPINGS" ]]; then
if ! [[ "$VIASH_PAR_WRITE_MAPPINGS" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--write_mappings' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
if [[ -n "$VIASH_PAR_WRITE_QUALITIES" ]]; then
if ! [[ "$VIASH_PAR_WRITE_QUALITIES" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--write_qualities' has to be a boolean_true. Use "--help" to get more information on the parameters.
@@ -3313,8 +3328,8 @@ fi
if [ ! -z "$VIASH_PAR_QUANT_RESULTS" ] && [ ! -d "$(dirname "$VIASH_PAR_QUANT_RESULTS")" ]; then
mkdir -p "$(dirname "$VIASH_PAR_QUANT_RESULTS")"
fi
if [ ! -z "$VIASH_PAR_WRITE_MAPPINGS" ] && [ ! -d "$(dirname "$VIASH_PAR_WRITE_MAPPINGS")" ]; then
mkdir -p "$(dirname "$VIASH_PAR_WRITE_MAPPINGS")"
if [ ! -z "$VIASH_PAR_MAPPING_SAM" ] && [ ! -d "$(dirname "$VIASH_PAR_MAPPING_SAM")" ]; then
mkdir -p "$(dirname "$VIASH_PAR_MAPPING_SAM")"
fi
if [ ! -z "$VIASH_PAR_AUX_DIR" ] && [ ! -d "$(dirname "$VIASH_PAR_AUX_DIR")" ]; then
mkdir -p "$(dirname "$VIASH_PAR_AUX_DIR")"
@@ -3406,10 +3421,10 @@ if [ ! -z "$VIASH_PAR_AUX_TARGET_FILE" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_AUX_TARGET_FILE")" )
VIASH_PAR_AUX_TARGET_FILE=$(ViashDockerAutodetectMount "$VIASH_PAR_AUX_TARGET_FILE")
fi
if [ ! -z "$VIASH_PAR_WRITE_MAPPINGS" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_WRITE_MAPPINGS")" )
VIASH_PAR_WRITE_MAPPINGS=$(ViashDockerAutodetectMount "$VIASH_PAR_WRITE_MAPPINGS")
VIASH_CHOWN_VARS+=( "$VIASH_PAR_WRITE_MAPPINGS" )
if [ ! -z "$VIASH_PAR_MAPPING_SAM" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_MAPPING_SAM")" )
VIASH_PAR_MAPPING_SAM=$(ViashDockerAutodetectMount "$VIASH_PAR_MAPPING_SAM")
VIASH_CHOWN_VARS+=( "$VIASH_PAR_MAPPING_SAM" )
fi
if [ ! -z "$VIASH_PAR_AUX_DIR" ]; then
VIASH_DIRECTORY_MOUNTS+=( "$(ViashDockerAutodetectMountArg "$VIASH_PAR_AUX_DIR")" )
@@ -3533,6 +3548,7 @@ $( if [ ! -z ${VIASH_PAR_FULL_LENGTH_ALIGNMENT+x} ]; then echo "${VIASH_PAR_FULL
$( if [ ! -z ${VIASH_PAR_HARD_FILTER+x} ]; then echo "${VIASH_PAR_HARD_FILTER}" | sed "s#'#'\"'\"'#g;s#.*#par_hard_filter='&'#" ; else echo "# par_hard_filter="; fi )
$( if [ ! -z ${VIASH_PAR_MIN_ALN_PROB+x} ]; then echo "${VIASH_PAR_MIN_ALN_PROB}" | sed "s#'#'\"'\"'#g;s#.*#par_min_aln_prob='&'#" ; else echo "# par_min_aln_prob="; fi )
$( if [ ! -z ${VIASH_PAR_WRITE_MAPPINGS+x} ]; then echo "${VIASH_PAR_WRITE_MAPPINGS}" | sed "s#'#'\"'\"'#g;s#.*#par_write_mappings='&'#" ; else echo "# par_write_mappings="; fi )
$( if [ ! -z ${VIASH_PAR_MAPPING_SAM+x} ]; then echo "${VIASH_PAR_MAPPING_SAM}" | sed "s#'#'\"'\"'#g;s#.*#par_mapping_sam='&'#" ; else echo "# par_mapping_sam="; fi )
$( if [ ! -z ${VIASH_PAR_WRITE_QUALITIES+x} ]; then echo "${VIASH_PAR_WRITE_QUALITIES}" | sed "s#'#'\"'\"'#g;s#.*#par_write_qualities='&'#" ; else echo "# par_write_qualities="; fi )
$( if [ ! -z ${VIASH_PAR_HIT_FILTER_POLICY+x} ]; then echo "${VIASH_PAR_HIT_FILTER_POLICY}" | sed "s#'#'\"'\"'#g;s#.*#par_hit_filter_policy='&'#" ; else echo "# par_hit_filter_policy="; fi )
$( if [ ! -z ${VIASH_PAR_ALTERNATIVE_INIT_MODE+x} ]; then echo "${VIASH_PAR_ALTERNATIVE_INIT_MODE}" | sed "s#'#'\"'\"'#g;s#.*#par_alternative_init_mode='&'#" ; else echo "# par_alternative_init_mode="; fi )
@@ -3616,6 +3632,7 @@ $( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}"
[[ "\$par_softclip_overhangs" == "false" ]] && unset par_softclip_overhangs
[[ "\$par_full_length_alignment" == "false" ]] && unset par_full_length_alignment
[[ "\$par_hard_filter" == "false" ]] && unset par_hard_filter
[[ "\$par_write_mappings" == "false" ]] && unset par_write_mappings
[[ "\$par_write_qualities" == "false" ]] && unset par_write_qualities
[[ "\$par_alternative_init_mode" == "false" ]] && unset par_alternative_init_mode
[[ "\$par_skip_quant" == "false" ]] && unset par_skip_quant
@@ -3691,7 +3708,7 @@ salmon quant \\
\${par_full_length_alignment:+--fullLengthAlignment} \\
\${par_hard_filter:+--hardFilter} \\
\${par_min_aln_prob:+--minAlnProb "\${par_min_aln_prob}"} \\
\${par_write_mappings:+-z "\${par_write_mappings}"} \\
\${par_write_mappings:+--write_mappings="\${par_mappings_sam}"} \\
\${par_write_qualities:+--writeQualities} \\
\${par_hit_filter_policy:+--hitFilterPolicy "\${par_hit_filter_policy}"} \\
\${par_alternative_init_mode:+--alternativeInitMode} \\
@@ -3827,8 +3844,8 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
if [ ! -z "$VIASH_PAR_AUX_TARGET_FILE" ]; then
VIASH_PAR_AUX_TARGET_FILE=$(ViashDockerStripAutomount "$VIASH_PAR_AUX_TARGET_FILE")
fi
if [ ! -z "$VIASH_PAR_WRITE_MAPPINGS" ]; then
VIASH_PAR_WRITE_MAPPINGS=$(ViashDockerStripAutomount "$VIASH_PAR_WRITE_MAPPINGS")
if [ ! -z "$VIASH_PAR_MAPPING_SAM" ]; then
VIASH_PAR_MAPPING_SAM=$(ViashDockerStripAutomount "$VIASH_PAR_MAPPING_SAM")
fi
if [ ! -z "$VIASH_PAR_AUX_DIR" ]; then
VIASH_PAR_AUX_DIR=$(ViashDockerStripAutomount "$VIASH_PAR_AUX_DIR")
@@ -3857,8 +3874,8 @@ if [ ! -z "$VIASH_PAR_QUANT_RESULTS" ] && [ ! -e "$VIASH_PAR_QUANT_RESULTS" ]; t
ViashError "Output file '$VIASH_PAR_QUANT_RESULTS' does not exist."
exit 1
fi
if [ ! -z "$VIASH_PAR_WRITE_MAPPINGS" ] && [ ! -e "$VIASH_PAR_WRITE_MAPPINGS" ]; then
ViashError "Output file '$VIASH_PAR_WRITE_MAPPINGS' does not exist."
if [ ! -z "$VIASH_PAR_MAPPING_SAM" ] && [ ! -e "$VIASH_PAR_MAPPING_SAM" ]; then
ViashError "Output file '$VIASH_PAR_MAPPING_SAM' does not exist."
exit 1
fi
if [ ! -z "$VIASH_PAR_AUX_DIR" ] && [ ! -e "$VIASH_PAR_AUX_DIR" ]; then

19
target/executable/samtools/samtools_collate/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "samtools_collate"
namespace: "samtools"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -232,7 +232,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -250,11 +250,11 @@ build_info:
output: "target/executable/samtools/samtools_collate"
executable: "target/executable/samtools/samtools_collate/samtools_collate"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -264,16 +264,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/samtools/samtools_collate/samtools_collate
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# samtools_collate v0.1
# samtools_collate v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "samtools_collate v0.1"
echo "samtools_collate v0.1.0"
echo ""
echo "Shuffles and groups reads in SAM/BAM/CRAM files together by their names."
echo ""
@@ -514,10 +514,10 @@ RUN samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_collate"
LABEL org.opencontainers.image.created="2024-06-24T08:44:02Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:35Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -640,7 +640,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "samtools_collate v0.1"
echo "samtools_collate v0.1.0"
exit
;;
--input)
@@ -884,7 +884,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_collate:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_collate:v0.1.0'
fi
# print dockerfile

19
target/executable/samtools/samtools_faidx/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "samtools_faidx"
namespace: "samtools"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -211,7 +211,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -229,11 +229,11 @@ build_info:
output: "target/executable/samtools/samtools_faidx"
executable: "target/executable/samtools/samtools_faidx/samtools_faidx"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -243,16 +243,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/samtools/samtools_faidx/samtools_faidx
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# samtools_faidx v0.1
# samtools_faidx v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "samtools_faidx v0.1"
echo "samtools_faidx v0.1.0"
echo ""
echo "Indexes FASTA files to enable random access to fasta and fastq files."
echo ""
@@ -507,10 +507,10 @@ RUN samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_faidx"
LABEL org.opencontainers.image.created="2024-06-24T08:44:00Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:32Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -633,7 +633,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "samtools_faidx v0.1"
echo "samtools_faidx v0.1.0"
exit
;;
--input)
@@ -827,7 +827,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_faidx:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_faidx:v0.1.0'
fi
# print dockerfile

19
target/executable/samtools/samtools_fastq/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "samtools_fastq"
namespace: "samtools"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -399,7 +399,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -417,11 +417,11 @@ build_info:
output: "target/executable/samtools/samtools_fastq"
executable: "target/executable/samtools/samtools_fastq/samtools_fastq"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -431,16 +431,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/samtools/samtools_fastq/samtools_fastq
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# samtools_fastq v0.1
# samtools_fastq v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "samtools_fastq v0.1"
echo "samtools_fastq v0.1.0"
echo ""
echo "Converts a SAM, BAM or CRAM to FASTQ format."
echo ""
@@ -620,10 +620,10 @@ RUN samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_fastq"
LABEL org.opencontainers.image.created="2024-06-24T08:44:03Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:35Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -746,7 +746,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "samtools_fastq v0.1"
echo "samtools_fastq v0.1.0"
exit
;;
--input)
@@ -1185,7 +1185,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_fastq:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_fastq:v0.1.0'
fi
# print dockerfile

19
target/executable/samtools/samtools_flagstat/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "samtools_flagstat"
namespace: "samtools"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -141,7 +141,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -159,11 +159,11 @@ build_info:
output: "target/executable/samtools/samtools_flagstat"
executable: "target/executable/samtools/samtools_flagstat/samtools_flagstat"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -173,16 +173,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/samtools/samtools_flagstat/samtools_flagstat
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# samtools_flagstat v0.1
# samtools_flagstat v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "samtools_flagstat v0.1"
echo "samtools_flagstat v0.1.0"
echo ""
echo "Counts the number of alignments in SAM/BAM/CRAM files for each FLAG type."
echo ""
@@ -469,10 +469,10 @@ RUN samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_flagstat"
LABEL org.opencontainers.image.created="2024-06-24T08:44:02Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:34Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -595,7 +595,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "samtools_flagstat v0.1"
echo "samtools_flagstat v0.1.0"
exit
;;
--bam)
@@ -707,7 +707,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_flagstat:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_flagstat:v0.1.0'
fi
# print dockerfile

19
target/executable/samtools/samtools_idxstats/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "samtools_idxstats"
namespace: "samtools"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -151,7 +151,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -169,11 +169,11 @@ build_info:
output: "target/executable/samtools/samtools_idxstats"
executable: "target/executable/samtools/samtools_idxstats/samtools_idxstats"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -183,16 +183,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/samtools/samtools_idxstats/samtools_idxstats
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# samtools_idxstats v0.1
# samtools_idxstats v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "samtools_idxstats v0.1"
echo "samtools_idxstats v0.1.0"
echo ""
echo "Reports alignment summary statistics for a BAM file."
echo ""
@@ -473,10 +473,10 @@ RUN samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_idxstats"
LABEL org.opencontainers.image.created="2024-06-24T08:44:01Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:33Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -599,7 +599,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "samtools_idxstats v0.1"
echo "samtools_idxstats v0.1.0"
exit
;;
--bam)
@@ -722,7 +722,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_idxstats:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_idxstats:v0.1.0'
fi
# print dockerfile

19
target/executable/samtools/samtools_index/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "samtools_index"
namespace: "samtools"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -157,7 +157,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -175,11 +175,11 @@ build_info:
output: "target/executable/samtools/samtools_index"
executable: "target/executable/samtools/samtools_index/samtools_index"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -189,16 +189,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/samtools/samtools_index/samtools_index
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# samtools_index v0.1
# samtools_index v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "samtools_index v0.1"
echo "samtools_index v0.1.0"
echo ""
echo "Index SAM/BAM/CRAM files."
echo ""
@@ -480,10 +480,10 @@ RUN samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_index"
LABEL org.opencontainers.image.created="2024-06-24T08:44:02Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:34Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -606,7 +606,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "samtools_index v0.1"
echo "samtools_index v0.1.0"
exit
;;
--input)
@@ -750,7 +750,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_index:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_index:v0.1.0'
fi
# print dockerfile

19
target/executable/samtools/samtools_sort/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "samtools_sort"
namespace: "samtools"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -300,7 +300,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -318,11 +318,11 @@ build_info:
output: "target/executable/samtools/samtools_sort"
executable: "target/executable/samtools/samtools_sort/samtools_sort"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -332,16 +332,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/samtools/samtools_sort/samtools_sort
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# samtools_sort v0.1
# samtools_sort v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "samtools_sort v0.1"
echo "samtools_sort v0.1.0"
echo ""
echo "Sort SAM/BAM/CRAM file."
echo ""
@@ -551,10 +551,10 @@ RUN samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_sort"
LABEL org.opencontainers.image.created="2024-06-24T08:44:01Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:33Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -677,7 +677,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "samtools_sort v0.1"
echo "samtools_sort v0.1.0"
exit
;;
--input)
@@ -1005,7 +1005,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_sort:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_sort:v0.1.0'
fi
# print dockerfile

19
target/executable/samtools/samtools_stats/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "samtools_stats"
namespace: "samtools"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -362,7 +362,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -380,11 +380,11 @@ build_info:
output: "target/executable/samtools/samtools_stats"
executable: "target/executable/samtools/samtools_stats/samtools_stats"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -394,16 +394,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/samtools/samtools_stats/samtools_stats
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# samtools_stats v0.1
# samtools_stats v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "samtools_stats v0.1"
echo "samtools_stats v0.1.0"
echo ""
echo "Reports alignment summary statistics for a BAM file."
echo ""
@@ -568,10 +568,10 @@ RUN samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_stats"
LABEL org.opencontainers.image.created="2024-06-24T08:44:01Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:34Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -694,7 +694,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "samtools_stats v0.1"
echo "samtools_stats v0.1.0"
exit
;;
--input)
@@ -1126,7 +1126,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_stats:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_stats:v0.1.0'
fi
# print dockerfile

19
target/executable/samtools/samtools_view/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "samtools_view"
namespace: "samtools"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -633,7 +633,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/samtools:1.19.2--h50ea8bc_1"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -651,11 +651,11 @@ build_info:
output: "target/executable/samtools/samtools_view"
executable: "target/executable/samtools/samtools_view/samtools_view"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -665,16 +665,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/samtools/samtools_view/samtools_view
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# samtools_view v0.1
# samtools_view v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "samtools_view v0.1"
echo "samtools_view v0.1.0"
echo ""
echo "Views and converts SAM/BAM/CRAM files."
echo ""
@@ -820,10 +820,10 @@ RUN samtools --version 2>&1 | grep -E '^(samtools|Using htslib)' | \
sed 's#Using ##;s# \([0-9\.]*\)$#: \1#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component samtools samtools_view"
LABEL org.opencontainers.image.created="2024-06-24T08:44:00Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:32Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/samtools"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -946,7 +946,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "samtools_view v0.1"
echo "samtools_view v0.1.0"
exit
;;
--input)
@@ -1606,7 +1606,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_view:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/samtools/samtools_view:v0.1.0'
fi
# print dockerfile

19
target/executable/star/star_align_reads/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "star_align_reads"
namespace: "star"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Run Parameters"
arguments:
@@ -2061,7 +2061,7 @@ engines:
id: "docker"
image: "python:3.12-slim"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "apt"
@@ -2095,11 +2095,11 @@ build_info:
output: "target/executable/star/star_align_reads"
executable: "target/executable/star/star_align_reads/star_align_reads"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -2109,16 +2109,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

14
target/executable/star/star_align_reads/star_align_reads
View File

@@ -1,6 +1,6 @@
#!/usr/bin/env bash
# star_align_reads v0.1
# star_align_reads v0.1.0
#
# This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
# derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -171,7 +171,7 @@ VIASH_META_TEMP_DIR="$VIASH_TEMP"
# ViashHelp: Display helpful explanation about this executable
function ViashHelp {
echo "star_align_reads v0.1"
echo "star_align_reads v0.1.0"
echo ""
echo "Aligns reads to a reference genome using STAR."
echo ""
@@ -1658,10 +1658,10 @@ RUN apt-get update && \
RUN STAR --version | sed 's#\(.*\)#star: "\1"#' > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component star star_align_reads"
LABEL org.opencontainers.image.created="2024-06-24T08:44:06Z"
LABEL org.opencontainers.image.created="2024-06-24T09:12:40Z"
LABEL org.opencontainers.image.source="https://github.com/alexdobin/STAR"
LABEL org.opencontainers.image.revision="d97e3156feb1839752aa080bfbe8a2153489dfd6"
LABEL org.opencontainers.image.version="v0.1"
LABEL org.opencontainers.image.revision="b84b29747d0635f2ac83ea63b496be9a9edb6724"
LABEL org.opencontainers.image.version="v0.1.0"
VIASHDOCKER
fi
@@ -1784,7 +1784,7 @@ while [[ $# -gt 0 ]]; do
shift 1
;;
--version)
echo "star_align_reads v0.1"
echo "star_align_reads v0.1.0"
exit
;;
--runRNGseed)
@@ -3897,7 +3897,7 @@ if [[ "$VIASH_ENGINE_TYPE" == "docker" ]]; then
# determine docker image id
if [[ "$VIASH_ENGINE_ID" == 'docker' ]]; then
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/star/star_align_reads:v0.1'
VIASH_DOCKER_IMAGE_ID='images.viash-hub.com/vsh/biobox/star/star_align_reads:v0.1.0'
fi
# print dockerfile

345
target/executable/star/star_genome_generate/.config.vsh.yaml Normal file
View File

@@ -0,0 +1,345 @@
name: "star_genome_generate"
namespace: "star"
version: "v0.1.0"
argument_groups:
- name: "Input"
arguments:
- type: "file"
name: "--genomeFastaFiles"
description: "Path(s) to the fasta files with the genome sequences, separated\
\ by spaces. These files should be plain text FASTA files, they *cannot* be\
\ zipped.\n"
info: null
must_exist: true
create_parent: true
required: true
direction: "input"
multiple: true
multiple_sep: ";"
- type: "file"
name: "--sjdbGTFfile"
description: "Path to the GTF file with annotations"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--sjdbOverhang"
description: "Length of the donor/acceptor sequence on each side of the junctions,\
\ ideally = (mate_length - 1)"
info: null
example:
- 100
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--sjdbGTFchrPrefix"
description: "Prefix for chromosome names in a GTF file (e.g. 'chr' for using\
\ ENSMEBL annotations with UCSC genomes)"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--sjdbGTFfeatureExon"
description: "Feature type in GTF file to be used as exons for building transcripts"
info: null
example:
- "exon"
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--sjdbGTFtagExonParentTranscript"
description: "GTF attribute name for parent transcript ID (default \"transcript_id\"\
\ works for GTF files)"
info: null
example:
- "transcript_id"
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--sjdbGTFtagExonParentGene"
description: "GTF attribute name for parent gene ID (default \"gene_id\" works\
\ for GTF files)"
info: null
example:
- "gene_id"
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--sjdbGTFtagExonParentGeneName"
description: "GTF attribute name for parent gene name"
info: null
example:
- "gene_name"
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--sjdbGTFtagExonParentGeneType"
description: "GTF attribute name for parent gene type"
info: null
example:
- "gene_type"
- "gene_biotype"
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "long"
name: "--limitGenomeGenerateRAM"
description: "Maximum available RAM (bytes) for genome generation"
info: null
example:
- 31000000000
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--genomeSAindexNbases"
description: "Length (bases) of the SA pre-indexing string. Typically between\
\ 10 and 15. Longer strings will use much more memory, but allow faster searches.\
\ For small genomes, this parameter must be scaled down to min(14, log2(GenomeLength)/2\
\ - 1)."
info: null
example:
- 14
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--genomeChrBinNbits"
description: "Defined as log2(chrBin), where chrBin is the size of the bins for\
\ genome storage. Each chromosome will occupy an integer number of bins. For\
\ a genome with large number of contigs, it is recommended to scale this parameter\
\ as min(18, log2[max(GenomeLength/NumberOfReferences,ReadLength)])."
info: null
example:
- 18
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--genomeSAsparseD"
description: "Suffux array sparsity, i.e. distance between indices. Use bigger\
\ numbers to decrease needed RAM at the cost of mapping speed reduction."
info: null
example:
- 1
required: false
min: 0
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--genomeSuffixLengthMax"
description: "Maximum length of the suffixes, has to be longer than read length.\
\ Use -1 for infinite length."
info: null
example:
- -1
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--genomeTransformType"
description: "Type of genome transformation\n None ... no transformation\n\
\ Haploid ... replace reference alleles with alternative alleles from VCF\
\ file (e.g. consensus allele)\n Diploid ... create two haplotypes for each\
\ chromosome listed in VCF file, for genotypes 1|2, assumes perfect phasing\
\ (e.g. personal genome)\n"
info: null
example:
- "None"
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--genomeTransformVCF"
description: "path to VCF file for genome transformation"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Output"
arguments:
- type: "file"
name: "--index"
description: "STAR index directory."
info: null
default:
- "STAR_index"
must_exist: true
create_parent: true
required: true
direction: "output"
multiple: false
multiple_sep: ";"
resources:
- type: "bash_script"
path: "script.sh"
is_executable: true
description: "Create index for STAR\n"
test_resources:
- type: "bash_script"
path: "test.sh"
is_executable: true
info: null
status: "enabled"
requirements:
commands:
- "ps"
keywords:
- "genome"
- "index"
- "align"
license: "MIT"
references:
doi:
- "10.1093/bioinformatics/bts635"
links:
repository: "https://github.com/alexdobin/STAR"
documentation: "https://github.com/alexdobin/STAR/blob/master/doc/STARmanual.pdf"
runners:
- type: "executable"
id: "executable"
docker_setup_strategy: "ifneedbepullelsecachedbuild"
- type: "nextflow"
id: "nextflow"
directives:
tag: "$id"
auto:
simplifyInput: true
simplifyOutput: false
transcript: false
publish: false
config:
labels:
mem1gb: "memory = 1000000000.B"
mem2gb: "memory = 2000000000.B"
mem5gb: "memory = 5000000000.B"
mem10gb: "memory = 10000000000.B"
mem20gb: "memory = 20000000000.B"
mem50gb: "memory = 50000000000.B"
mem100gb: "memory = 100000000000.B"
mem200gb: "memory = 200000000000.B"
mem500gb: "memory = 500000000000.B"
mem1tb: "memory = 1000000000000.B"
mem2tb: "memory = 2000000000000.B"
mem5tb: "memory = 5000000000000.B"
mem10tb: "memory = 10000000000000.B"
mem20tb: "memory = 20000000000000.B"
mem50tb: "memory = 50000000000000.B"
mem100tb: "memory = 100000000000000.B"
mem200tb: "memory = 200000000000000.B"
mem500tb: "memory = 500000000000000.B"
mem1gib: "memory = 1073741824.B"
mem2gib: "memory = 2147483648.B"
mem4gib: "memory = 4294967296.B"
mem8gib: "memory = 8589934592.B"
mem16gib: "memory = 17179869184.B"
mem32gib: "memory = 34359738368.B"
mem64gib: "memory = 68719476736.B"
mem128gib: "memory = 137438953472.B"
mem256gib: "memory = 274877906944.B"
mem512gib: "memory = 549755813888.B"
mem1tib: "memory = 1099511627776.B"
mem2tib: "memory = 2199023255552.B"
mem4tib: "memory = 4398046511104.B"
mem8tib: "memory = 8796093022208.B"
mem16tib: "memory = 17592186044416.B"
mem32tib: "memory = 35184372088832.B"
mem64tib: "memory = 70368744177664.B"
mem128tib: "memory = 140737488355328.B"
mem256tib: "memory = 281474976710656.B"
mem512tib: "memory = 562949953421312.B"
cpu1: "cpus = 1"
cpu2: "cpus = 2"
cpu5: "cpus = 5"
cpu10: "cpus = 10"
cpu20: "cpus = 20"
cpu50: "cpus = 50"
cpu100: "cpus = 100"
cpu200: "cpus = 200"
cpu500: "cpus = 500"
cpu1000: "cpus = 1000"
debug: false
container: "docker"
engines:
- type: "docker"
id: "docker"
image: "ubuntu:22.04"
target_registry: "images.viash-hub.com"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
run:
- "apt-get update && \\\n apt-get install -y --no-install-recommends ${PACKAGES}\
\ && \\\n cd /tmp && \\\n wget --no-check-certificate https://github.com/alexdobin/STAR/archive/refs/tags/${STAR_VERSION}.zip\
\ && \\\n unzip ${STAR_VERSION}.zip && \\\n cd STAR-${STAR_VERSION}/source\
\ && \\\n make STARstatic CXXFLAGS_SIMD=-std=c++11 && \\\n cp STAR /usr/local/bin\
\ && \\\n cd / && \\\n rm -rf /tmp/STAR-${STAR_VERSION} /tmp/${STAR_VERSION}.zip\
\ && \\\n apt-get --purge autoremove -y ${PACKAGES} && \\\n apt-get clean\n"
env:
- "STAR_VERSION 2.7.11b"
- "PACKAGES gcc g++ make wget zlib1g-dev unzip xxd"
- type: "docker"
run:
- "STAR --version | sed 's#\\(.*\\)#star: \"\\1\"#' > /var/software_versions.txt\n"
entrypoint: []
cmd: null
- type: "native"
id: "native"
build_info:
config: "src/star/star_genome_generate/config.vsh.yaml"
runner: "executable"
engine: "docker|native"
output: "target/executable/star/star_genome_generate"
executable: "target/executable/star/star_genome_generate/star_genome_generate"
viash_version: "0.9.0-RC6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
source: "src"
target: "target"
config_mods:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

1462
target/executable/star/star_genome_generate/star_genome_generate Executable file
View File

File diff suppressed because it is too large Load Diff

19
target/nextflow/arriba/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "arriba"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -670,7 +670,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/arriba:2.4.0--h0033a41_2"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -688,11 +688,11 @@ build_info:
output: "target/nextflow/arriba"
executable: "target/nextflow/arriba/main.nf"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -702,16 +702,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

23
target/nextflow/arriba/main.nf
View File

@@ -1,4 +1,4 @@
// arriba v0.1
// arriba v0.1.0
//
// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -2779,7 +2779,7 @@ meta = [
"resources_dir": moduleDir.toRealPath().normalize(),
"config": processConfig(readJsonBlob('''{
"name" : "arriba",
"version" : "v0.1",
"version" : "v0.1.0",
"argument_groups" : [
{
"name" : "Inputs",
@@ -3512,7 +3512,7 @@ meta = [
"id" : "docker",
"image" : "quay.io/biocontainers/arriba:2.4.0--h0033a41_2",
"target_registry" : "images.viash-hub.com",
"target_tag" : "v0.1",
"target_tag" : "v0.1.0",
"namespace_separator" : "/",
"setup" : [
{
@@ -3534,12 +3534,12 @@ meta = [
"engine" : "docker|native",
"output" : "target/nextflow/arriba",
"viash_version" : "0.9.0-RC6",
"git_commit" : "d97e3156feb1839752aa080bfbe8a2153489dfd6",
"git_commit" : "b84b29747d0635f2ac83ea63b496be9a9edb6724",
"git_remote" : "https://github.com/viash-hub/biobox"
},
"package_config" : {
"name" : "biobox",
"version" : "v0.1",
"version" : "v0.1.0",
"description" : "A collection of bioinformatics tools for working with sequence data.\n",
"viash_version" : "0.9.0-RC6",
"source" : "src",
@@ -3548,20 +3548,17 @@ meta = [
".requirements.commands := ['ps']\n",
".engines += { type: \\"native\\" }",
".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
".engines[.type == 'docker'].target_tag := 'v0.1'"
".engines[.type == 'docker'].target_tag := 'v0.1.0'"
],
"keywords" : [
"bioinformatics",
"sequence",
"alignment",
"variant calling",
"dna",
"rna"
"modules",
"sequencing"
],
"license" : "MIT",
"organization" : "vsh",
"links" : {
"repository" : "https://github.com/viash-hub/biobbox",
"repository" : "https://github.com/viash-hub/biobox",
"issue_tracker" : "https://github.com/viash-hub/biobox/issues"
}
}
@@ -4044,7 +4041,7 @@ meta["defaults"] = [
"container" : {
"registry" : "images.viash-hub.com",
"image" : "vsh/biobox/arriba",
"tag" : "v0.1"
"tag" : "v0.1.0"
},
"cpus" : 1,
"tag" : "$id"

2
target/nextflow/arriba/nextflow.config
View File

@@ -2,7 +2,7 @@ manifest {
name = 'arriba'
mainScript = 'main.nf'
nextflowVersion = '!>=20.12.1-edge'
version = 'v0.1'
version = 'v0.1.0'
description = 'Detect gene fusions from RNA-Seq data'
}

25
target/nextflow/bcl_convert/.config.vsh.yaml
View File

@@ -1,5 +1,5 @@
name: "bcl_convert"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Input arguments"
arguments:
@@ -270,8 +270,8 @@ resources:
path: "script.sh"
is_executable: true
description: "Convert bcl files to fastq files using bcl-convert.\nInformation about\
\ upgrading from bcl2fastq via\nhttps://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html\n\
and https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html\n"
\ upgrading from bcl2fastq via\n[Upgrading from bcl2fastq to BCL Convert](https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html)\n\
and [BCL Convert Compatible Products](https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html)\n"
test_resources:
- type: "bash_script"
path: "test.sh"
@@ -283,7 +283,7 @@ requirements:
- "ps"
license: "MIT"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
runners:
- type: "executable"
id: "executable"
@@ -354,7 +354,7 @@ engines:
id: "docker"
image: "debian:trixie-slim"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "apt"
@@ -386,11 +386,11 @@ build_info:
output: "target/nextflow/bcl_convert"
executable: "target/nextflow/bcl_convert/main.nf"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -400,16 +400,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

27
target/nextflow/bcl_convert/main.nf
View File

@@ -1,4 +1,4 @@
// bcl_convert v0.1
// bcl_convert v0.1.0
//
// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -2779,7 +2779,7 @@ meta = [
"resources_dir": moduleDir.toRealPath().normalize(),
"config": processConfig(readJsonBlob('''{
"name" : "bcl_convert",
"version" : "v0.1",
"version" : "v0.1.0",
"argument_groups" : [
{
"name" : "Input arguments",
@@ -3111,7 +3111,7 @@ meta = [
"is_executable" : true
}
],
"description" : "Convert bcl files to fastq files using bcl-convert.\nInformation about upgrading from bcl2fastq via\nhttps://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html\nand https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html\n",
"description" : "Convert bcl files to fastq files using bcl-convert.\nInformation about upgrading from bcl2fastq via\n[Upgrading from bcl2fastq to BCL Convert](https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html)\nand [BCL Convert Compatible Products](https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html)\n",
"test_resources" : [
{
"type" : "bash_script",
@@ -3127,7 +3127,7 @@ meta = [
},
"license" : "MIT",
"links" : {
"repository" : "https://github.com/viash-hub/biobbox"
"repository" : "https://github.com/viash-hub/biobox"
},
"runners" : [
{
@@ -3209,7 +3209,7 @@ meta = [
"id" : "docker",
"image" : "debian:trixie-slim",
"target_registry" : "images.viash-hub.com",
"target_tag" : "v0.1",
"target_tag" : "v0.1.0",
"namespace_separator" : "/",
"setup" : [
{
@@ -3249,12 +3249,12 @@ meta = [
"engine" : "docker|native",
"output" : "target/nextflow/bcl_convert",
"viash_version" : "0.9.0-RC6",
"git_commit" : "d97e3156feb1839752aa080bfbe8a2153489dfd6",
"git_commit" : "b84b29747d0635f2ac83ea63b496be9a9edb6724",
"git_remote" : "https://github.com/viash-hub/biobox"
},
"package_config" : {
"name" : "biobox",
"version" : "v0.1",
"version" : "v0.1.0",
"description" : "A collection of bioinformatics tools for working with sequence data.\n",
"viash_version" : "0.9.0-RC6",
"source" : "src",
@@ -3263,20 +3263,17 @@ meta = [
".requirements.commands := ['ps']\n",
".engines += { type: \\"native\\" }",
".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
".engines[.type == 'docker'].target_tag := 'v0.1'"
".engines[.type == 'docker'].target_tag := 'v0.1.0'"
],
"keywords" : [
"bioinformatics",
"sequence",
"alignment",
"variant calling",
"dna",
"rna"
"modules",
"sequencing"
],
"license" : "MIT",
"organization" : "vsh",
"links" : {
"repository" : "https://github.com/viash-hub/biobbox",
"repository" : "https://github.com/viash-hub/biobox",
"issue_tracker" : "https://github.com/viash-hub/biobox/issues"
}
}
@@ -3733,7 +3730,7 @@ meta["defaults"] = [
"container" : {
"registry" : "images.viash-hub.com",
"image" : "vsh/biobox/bcl_convert",
"tag" : "v0.1"
"tag" : "v0.1.0"
},
"tag" : "$id"
}'''),

4
target/nextflow/bcl_convert/nextflow.config
View File

@@ -2,8 +2,8 @@ manifest {
name = 'bcl_convert'
mainScript = 'main.nf'
nextflowVersion = '!>=20.12.1-edge'
version = 'v0.1'
description = 'Convert bcl files to fastq files using bcl-convert.\nInformation about upgrading from bcl2fastq via\nhttps://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html\nand https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html\n'
version = 'v0.1.0'
description = 'Convert bcl files to fastq files using bcl-convert.\nInformation about upgrading from bcl2fastq via\n[Upgrading from bcl2fastq to BCL Convert](https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html)\nand [BCL Convert Compatible Products](https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html)\n'
}
process.container = 'nextflow/bash:latest'

2
target/nextflow/bcl_convert/nextflow_schema.json
View File

@@ -1,7 +1,7 @@
{
"$schema": "http://json-schema.org/draft-07/schema",
"title": "bcl_convert",
"description": "Convert bcl files to fastq files using bcl-convert.\nInformation about upgrading from bcl2fastq via\nhttps://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html\nand https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html\n",
"description": "Convert bcl files to fastq files using bcl-convert.\nInformation about upgrading from bcl2fastq via\n[Upgrading from bcl2fastq to BCL Convert](https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html)\nand [BCL Convert Compatible Products](https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html)\n",
"type": "object",
"definitions": {

240
target/nextflow/bgzip/.config.vsh.yaml → target/nextflow/bedtools/bedtools_getfasta/.config.vsh.yaml
View File

@@ -1,23 +1,57 @@
name: "bgzip"
version: "v0.1"
name: "bedtools_getfasta"
namespace: "bedtools"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
- name: "Input arguments"
arguments:
- type: "file"
name: "--input"
description: "file to be compressed or decompressed"
name: "--input_fasta"
description: "FASTA file containing sequences for each interval specified in the\
\ input BED file.\nThe headers in the input FASTA file must exactly match the\
\ chromosome column in the BED file.\n"
info: null
must_exist: true
create_parent: true
required: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Outputs"
- type: "file"
name: "--input_bed"
description: "BED file containing intervals to extract from the FASTA file.\n\
BED files containing a single region require a newline character\nat the end\
\ of the line, otherwise a blank output file is produced.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--rna"
description: "The FASTA is RNA not DNA. Reverse complementation handled accordingly.\n"
info: null
direction: "input"
- name: "Run arguments"
arguments:
- type: "boolean_true"
name: "--strandedness"
alternatives:
- "-s"
description: "Force strandedness. If the feature occupies the antisense strand,\
\ the output sequence will\nbe reverse complemented. By default strandedness\
\ is not taken into account.\n"
info: null
direction: "input"
- name: "Output arguments"
arguments:
- type: "file"
name: "--output"
description: "compressed or decompressed output"
alternatives:
- "-o"
description: "Output file where the output from the 'bedtools getfasta' commend\
\ will\nbe written to.\n"
info: null
must_exist: true
create_parent: true
@@ -25,149 +59,71 @@ argument_groups:
direction: "output"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--index_name"
alternatives:
- "-I"
description: "name of BGZF index file [file.gz.gzi]"
info: null
must_exist: true
create_parent: true
required: false
direction: "output"
multiple: false
multiple_sep: ";"
- name: "Arguments"
arguments:
- type: "integer"
name: "--offset"
alternatives:
- "-b"
description: "decompress at virtual file pointer (0-based uncompressed offset)"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--decompress"
alternatives:
- "-d"
description: "decompress the input file"
name: "--tab"
description: "Report extract sequences in a tab-delimited format instead of in\
\ FASTA format.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--rebgzip"
alternatives:
- "-g"
description: "use an index file to bgzip a file"
name: "--bed_out"
description: "Report extract sequences in a tab-delimited BED format instead of\
\ in FASTA format.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--index"
alternatives:
- "-i"
description: "compress and create BGZF index"
info: null
direction: "input"
- type: "integer"
name: "--compress_level"
alternatives:
- "-l"
description: "compression level to use when compressing; 0 to 9, or -1 for default\
\ [-1]"
info: null
required: false
min: -1
max: 9
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--reindex"
alternatives:
- "-r"
description: "(re)index the output file"
info: null
direction: "input"
- type: "integer"
name: "--size"
alternatives:
- "-s"
description: "decompress INT bytes (uncompressed size)"
info: null
required: false
min: 0
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--test"
alternatives:
- "-t"
description: "test integrity of compressed file"
name: "--name"
description: "Set the FASTA header for each extracted sequence to be the \"name\"\
\ and coordinate columns from the BED feature.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--binary"
description: "Don't align blocks with text lines"
name: "--name_only"
description: "Set the FASTA header for each extracted sequence to be the \"name\"\
\ columns from the BED feature.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--split"
description: "When --input is in BED12 format, create a separate fasta entry for\
\ each block in a BED12 record,\nblocks being described in the 11th and 12th\
\ column of the BED.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--full_header"
description: "Use full fasta header. By default, only the word before the first\
\ space or tab is used.\n"
info: null
direction: "input"
resources:
- type: "bash_script"
text: |
[[ "$par_decompress" == "false" ]] && unset par_decompress
[[ "$par_rebgzip" == "false" ]] && unset par_rebgzip
[[ "$par_index" == "false" ]] && unset par_index
[[ "$par_reindex" == "false" ]] && unset par_reindex
[[ "$par_test" == "false" ]] && unset par_test
[[ "$par_binary" == "false" ]] && unset par_binary
bgzip -c \
${meta_cpus:+--threads "${meta_cpus}"} \
${par_offset:+-b "${par_offset}"} \
${par_decompress:+-d} \
${par_rebgzip:+-g} \
${par_index:+-i} \
${par_index_name:+-I "${par_index_name}"} \
${par_compress_level:+-l "${par_compress_level}"} \
${par_reindex:+-r} \
${par_size:+-s "${par_size}"} \
${par_test:+-t} \
${par_binary:+--binary} \
"$par_input" > "$par_output"
dest: "./script.sh"
path: "script.sh"
is_executable: true
description: "Block compression/decompression utility"
description: "Extract sequences from a FASTA file for each of the intervals defined\
\ in a BED/GFF/VCF file."
test_resources:
- type: "bash_script"
text: "set -e\n\n\"$meta_executable\" --input \"$meta_resources_dir/test_data/test.vcf\"\
\ --output \"test.vcf.gz\"\n\necho \">> Checking output of compressing\"\n[ !\
\ -f \"test.vcf.gz\" ] && echo \"Output file test.vcf.gz does not exist\" && exit\
\ 1\n\n\"$meta_executable\" --input \"test.vcf.gz\" --output \"test.vcf\" --decompress\n\
\necho \">> Checking output of decompressing\"\n[ ! -f \"test.vcf\" ] && echo\
\ \"Output file test.vcf does not exist\" && exit 1\n\necho \">> Checking original\
\ and decompressed files are the same\"\nset +e\ncmp --silent -- \"$meta_resources_dir/test_data/test.vcf\"\
\ \"test.vcf\"\n[ $? -ne 0 ] && echo \"files are different\" && exit 1\nset -e\n\
\necho \"> Test successful\"\n"
dest: "./script.sh"
path: "test.sh"
is_executable: true
- type: "file"
path: "test_data"
info: null
status: "enabled"
requirements:
commands:
- "ps"
license: "MIT"
keywords:
- "sequencing"
- "fasta"
- "BED"
- "GFF"
- "VCF"
license: "GPL-2.0"
references:
doi:
- "10.1093/gigascience/giab007"
- "10.1093/bioinformatics/btq033"
links:
repository: "https://github.com/samtools/htslib"
homepage: "https://www.htslib.org/"
documentation: "https://www.htslib.org/doc/bgzip.html"
repository: "https://github.com/arq5x/bedtools2"
documentation: "https://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html"
runners:
- type: "executable"
id: "executable"
@@ -236,31 +192,36 @@ runners:
engines:
- type: "docker"
id: "docker"
image: "quay.io/biocontainers/htslib:1.19--h81da01d_0"
image: "debian:stable-slim"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "apt"
packages:
- "bedtools"
- "procps"
interactive: false
- type: "docker"
run:
- "bgzip -h | grep 'Version:' 2>&1 | sed 's/Version:\\s\\(.*\\)/bgzip: \"\\1\"\
/' > /var/software_versions.txt\n"
- "echo \"bedtools: \\\"$(bedtools --version | sed -n 's/^bedtools //p')\\\"\"\
\ > /var/software_versions.txt\n"
entrypoint: []
cmd: null
- type: "native"
id: "native"
build_info:
config: "src/bgzip/config.vsh.yaml"
config: "src/bedtools/bedtools_getfasta/config.vsh.yaml"
runner: "nextflow"
engine: "docker|native"
output: "target/nextflow/bgzip"
executable: "target/nextflow/bgzip/main.nf"
output: "target/nextflow/bedtools/bedtools_getfasta"
executable: "target/nextflow/bedtools/bedtools_getfasta/main.nf"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -270,16 +231,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

292
target/nextflow/bgzip/main.nf → target/nextflow/bedtools/bedtools_getfasta/main.nf
View File

@@ -1,4 +1,4 @@
// bgzip v0.1
// bedtools_getfasta v0.1.0
//
// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -2778,32 +2778,67 @@ nextflow.enable.dsl=2
meta = [
"resources_dir": moduleDir.toRealPath().normalize(),
"config": processConfig(readJsonBlob('''{
"name" : "bgzip",
"version" : "v0.1",
"name" : "bedtools_getfasta",
"namespace" : "bedtools",
"version" : "v0.1.0",
"argument_groups" : [
{
"name" : "Inputs",
"name" : "Input arguments",
"arguments" : [
{
"type" : "file",
"name" : "--input",
"description" : "file to be compressed or decompressed",
"name" : "--input_fasta",
"description" : "FASTA file containing sequences for each interval specified in the input BED file.\nThe headers in the input FASTA file must exactly match the chromosome column in the BED file.\n",
"must_exist" : true,
"create_parent" : true,
"required" : true,
"required" : false,
"direction" : "input",
"multiple" : false,
"multiple_sep" : ";"
},
{
"type" : "file",
"name" : "--input_bed",
"description" : "BED file containing intervals to extract from the FASTA file.\nBED files containing a single region require a newline character\nat the end of the line, otherwise a blank output file is produced.\n",
"must_exist" : true,
"create_parent" : true,
"required" : false,
"direction" : "input",
"multiple" : false,
"multiple_sep" : ";"
},
{
"type" : "boolean_true",
"name" : "--rna",
"description" : "The FASTA is RNA not DNA. Reverse complementation handled accordingly.\n",
"direction" : "input"
}
]
},
{
"name" : "Outputs",
"name" : "Run arguments",
"arguments" : [
{
"type" : "boolean_true",
"name" : "--strandedness",
"alternatives" : [
"-s"
],
"description" : "Force strandedness. If the feature occupies the antisense strand, the output sequence will\nbe reverse complemented. By default strandedness is not taken into account.\n",
"direction" : "input"
}
]
},
{
"name" : "Output arguments",
"arguments" : [
{
"type" : "file",
"name" : "--output",
"description" : "compressed or decompressed output",
"alternatives" : [
"-o"
],
"description" : "Output file where the output from the 'bedtools getfasta' commend will\nbe written to.\n",
"must_exist" : true,
"create_parent" : true,
"required" : true,
@@ -2811,113 +2846,40 @@ meta = [
"multiple" : false,
"multiple_sep" : ";"
},
{
"type" : "file",
"name" : "--index_name",
"alternatives" : [
"-I"
],
"description" : "name of BGZF index file [file.gz.gzi]",
"must_exist" : true,
"create_parent" : true,
"required" : false,
"direction" : "output",
"multiple" : false,
"multiple_sep" : ";"
}
]
},
{
"name" : "Arguments",
"arguments" : [
{
"type" : "integer",
"name" : "--offset",
"alternatives" : [
"-b"
],
"description" : "decompress at virtual file pointer (0-based uncompressed offset)",
"required" : false,
"direction" : "input",
"multiple" : false,
"multiple_sep" : ";"
},
{
"type" : "boolean_true",
"name" : "--decompress",
"alternatives" : [
"-d"
],
"description" : "decompress the input file",
"name" : "--tab",
"description" : "Report extract sequences in a tab-delimited format instead of in FASTA format.\n",
"direction" : "input"
},
{
"type" : "boolean_true",
"name" : "--rebgzip",
"alternatives" : [
"-g"
],
"description" : "use an index file to bgzip a file",
"name" : "--bed_out",
"description" : "Report extract sequences in a tab-delimited BED format instead of in FASTA format.\n",
"direction" : "input"
},
{
"type" : "boolean_true",
"name" : "--index",
"alternatives" : [
"-i"
],
"description" : "compress and create BGZF index",
"direction" : "input"
},
{
"type" : "integer",
"name" : "--compress_level",
"alternatives" : [
"-l"
],
"description" : "compression level to use when compressing; 0 to 9, or -1 for default [-1]",
"required" : false,
"min" : -1,
"max" : 9,
"direction" : "input",
"multiple" : false,
"multiple_sep" : ";"
},
{
"type" : "boolean_true",
"name" : "--reindex",
"alternatives" : [
"-r"
],
"description" : "(re)index the output file",
"direction" : "input"
},
{
"type" : "integer",
"name" : "--size",
"alternatives" : [
"-s"
],
"description" : "decompress INT bytes (uncompressed size)",
"required" : false,
"min" : 0,
"direction" : "input",
"multiple" : false,
"multiple_sep" : ";"
},
{
"type" : "boolean_true",
"name" : "--test",
"alternatives" : [
"-t"
],
"description" : "test integrity of compressed file",
"name" : "--name",
"description" : "Set the FASTA header for each extracted sequence to be the \\"name\\" and coordinate columns from the BED feature.\n",
"direction" : "input"
},
{
"type" : "boolean_true",
"name" : "--binary",
"description" : "Don't align blocks with text lines",
"name" : "--name_only",
"description" : "Set the FASTA header for each extracted sequence to be the \\"name\\" columns from the BED feature.\n",
"direction" : "input"
},
{
"type" : "boolean_true",
"name" : "--split",
"description" : "When --input is in BED12 format, create a separate fasta entry for each block in a BED12 record,\nblocks being described in the 11th and 12th column of the BED.\n",
"direction" : "input"
},
{
"type" : "boolean_true",
"name" : "--full_header",
"description" : "Use full fasta header. By default, only the word before the first space or tab is used.\n",
"direction" : "input"
}
]
@@ -2926,22 +2888,16 @@ meta = [
"resources" : [
{
"type" : "bash_script",
"text" : "[[ \\"$par_decompress\\" == \\"false\\" ]] && unset par_decompress\n[[ \\"$par_rebgzip\\" == \\"false\\" ]] && unset par_rebgzip\n[[ \\"$par_index\\" == \\"false\\" ]] && unset par_index\n[[ \\"$par_reindex\\" == \\"false\\" ]] && unset par_reindex\n[[ \\"$par_test\\" == \\"false\\" ]] && unset par_test\n[[ \\"$par_binary\\" == \\"false\\" ]] && unset par_binary\nbgzip -c \\\\\n ${meta_cpus:+--threads \\"${meta_cpus}\\"} \\\\\n ${par_offset:+-b \\"${par_offset}\\"} \\\\\n ${par_decompress:+-d} \\\\\n ${par_rebgzip:+-g} \\\\\n ${par_index:+-i} \\\\\n ${par_index_name:+-I \\"${par_index_name}\\"} \\\\\n ${par_compress_level:+-l \\"${par_compress_level}\\"} \\\\\n ${par_reindex:+-r} \\\\\n ${par_size:+-s \\"${par_size}\\"} \\\\\n ${par_test:+-t} \\\\\n ${par_binary:+--binary} \\\\\n \\"$par_input\\" > \\"$par_output\\"\n",
"dest" : "./script.sh",
"path" : "script.sh",
"is_executable" : true
}
],
"description" : "Block compression/decompression utility",
"description" : "Extract sequences from a FASTA file for each of the intervals defined in a BED/GFF/VCF file.",
"test_resources" : [
{
"type" : "bash_script",
"text" : "set -e\n\n\\"$meta_executable\\" --input \\"$meta_resources_dir/test_data/test.vcf\\" --output \\"test.vcf.gz\\"\n\necho \\">> Checking output of compressing\\"\n[ ! -f \\"test.vcf.gz\\" ] && echo \\"Output file test.vcf.gz does not exist\\" && exit 1\n\n\\"$meta_executable\\" --input \\"test.vcf.gz\\" --output \\"test.vcf\\" --decompress\n\necho \\">> Checking output of decompressing\\"\n[ ! -f \\"test.vcf\\" ] && echo \\"Output file test.vcf does not exist\\" && exit 1\n\necho \\">> Checking original and decompressed files are the same\\"\nset +e\ncmp --silent -- \\"$meta_resources_dir/test_data/test.vcf\\" \\"test.vcf\\"\n[ $? -ne 0 ] && echo \\"files are different\\" && exit 1\nset -e\n\necho \\"> Test successful\\"\n",
"dest" : "./script.sh",
"path" : "test.sh",
"is_executable" : true
},
{
"type" : "file",
"path" : "test_data"
}
],
"status" : "enabled",
@@ -2950,16 +2906,22 @@ meta = [
"ps"
]
},
"license" : "MIT",
"keywords" : [
"sequencing",
"fasta",
"BED",
"GFF",
"VCF"
],
"license" : "GPL-2.0",
"references" : {
"doi" : [
"10.1093/gigascience/giab007"
"10.1093/bioinformatics/btq033"
]
},
"links" : {
"repository" : "https://github.com/samtools/htslib",
"homepage" : "https://www.htslib.org/",
"documentation" : "https://www.htslib.org/doc/bgzip.html"
"repository" : "https://github.com/arq5x/bedtools2",
"documentation" : "https://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html"
},
"runners" : [
{
@@ -3039,15 +3001,23 @@ meta = [
{
"type" : "docker",
"id" : "docker",
"image" : "quay.io/biocontainers/htslib:1.19--h81da01d_0",
"image" : "debian:stable-slim",
"target_registry" : "images.viash-hub.com",
"target_tag" : "v0.1",
"target_tag" : "v0.1.0",
"namespace_separator" : "/",
"setup" : [
{
"type" : "apt",
"packages" : [
"bedtools",
"procps"
],
"interactive" : false
},
{
"type" : "docker",
"run" : [
"bgzip -h | grep 'Version:' 2>&1 | sed 's/Version:\\\\s\\\\(.*\\\\)/bgzip: \\"\\\\1\\"/' > /var/software_versions.txt\n"
"echo \\"bedtools: \\\\\\"$(bedtools --version | sed -n 's/^bedtools //p')\\\\\\"\\" > /var/software_versions.txt\n"
]
}
]
@@ -3058,17 +3028,17 @@ meta = [
}
],
"build_info" : {
"config" : "/workdir/root/repo/src/bgzip/config.vsh.yaml",
"config" : "/workdir/root/repo/src/bedtools/bedtools_getfasta/config.vsh.yaml",
"runner" : "nextflow",
"engine" : "docker|native",
"output" : "target/nextflow/bgzip",
"output" : "target/nextflow/bedtools/bedtools_getfasta",
"viash_version" : "0.9.0-RC6",
"git_commit" : "d97e3156feb1839752aa080bfbe8a2153489dfd6",
"git_commit" : "b84b29747d0635f2ac83ea63b496be9a9edb6724",
"git_remote" : "https://github.com/viash-hub/biobox"
},
"package_config" : {
"name" : "biobox",
"version" : "v0.1",
"version" : "v0.1.0",
"description" : "A collection of bioinformatics tools for working with sequence data.\n",
"viash_version" : "0.9.0-RC6",
"source" : "src",
@@ -3077,20 +3047,17 @@ meta = [
".requirements.commands := ['ps']\n",
".engines += { type: \\"native\\" }",
".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
".engines[.type == 'docker'].target_tag := 'v0.1'"
".engines[.type == 'docker'].target_tag := 'v0.1.0'"
],
"keywords" : [
"bioinformatics",
"sequence",
"alignment",
"variant calling",
"dna",
"rna"
"modules",
"sequencing"
],
"license" : "MIT",
"organization" : "vsh",
"links" : {
"repository" : "https://github.com/viash-hub/biobbox",
"repository" : "https://github.com/viash-hub/biobox",
"issue_tracker" : "https://github.com/viash-hub/biobox/issues"
}
}
@@ -3108,18 +3075,17 @@ tempscript=".viash_script.sh"
cat > "$tempscript" << VIASHMAIN
## VIASH START
# The following code has been auto-generated by Viash.
$( if [ ! -z ${VIASH_PAR_INPUT+x} ]; then echo "${VIASH_PAR_INPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input='&'#" ; else echo "# par_input="; fi )
$( if [ ! -z ${VIASH_PAR_INPUT_FASTA+x} ]; then echo "${VIASH_PAR_INPUT_FASTA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input_fasta='&'#" ; else echo "# par_input_fasta="; fi )
$( if [ ! -z ${VIASH_PAR_INPUT_BED+x} ]; then echo "${VIASH_PAR_INPUT_BED}" | sed "s#'#'\\"'\\"'#g;s#.*#par_input_bed='&'#" ; else echo "# par_input_bed="; fi )
$( if [ ! -z ${VIASH_PAR_RNA+x} ]; then echo "${VIASH_PAR_RNA}" | sed "s#'#'\\"'\\"'#g;s#.*#par_rna='&'#" ; else echo "# par_rna="; fi )
$( if [ ! -z ${VIASH_PAR_STRANDEDNESS+x} ]; then echo "${VIASH_PAR_STRANDEDNESS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_strandedness='&'#" ; else echo "# par_strandedness="; fi )
$( if [ ! -z ${VIASH_PAR_OUTPUT+x} ]; then echo "${VIASH_PAR_OUTPUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_output='&'#" ; else echo "# par_output="; fi )
$( if [ ! -z ${VIASH_PAR_INDEX_NAME+x} ]; then echo "${VIASH_PAR_INDEX_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#par_index_name='&'#" ; else echo "# par_index_name="; fi )
$( if [ ! -z ${VIASH_PAR_OFFSET+x} ]; then echo "${VIASH_PAR_OFFSET}" | sed "s#'#'\\"'\\"'#g;s#.*#par_offset='&'#" ; else echo "# par_offset="; fi )
$( if [ ! -z ${VIASH_PAR_DECOMPRESS+x} ]; then echo "${VIASH_PAR_DECOMPRESS}" | sed "s#'#'\\"'\\"'#g;s#.*#par_decompress='&'#" ; else echo "# par_decompress="; fi )
$( if [ ! -z ${VIASH_PAR_REBGZIP+x} ]; then echo "${VIASH_PAR_REBGZIP}" | sed "s#'#'\\"'\\"'#g;s#.*#par_rebgzip='&'#" ; else echo "# par_rebgzip="; fi )
$( if [ ! -z ${VIASH_PAR_INDEX+x} ]; then echo "${VIASH_PAR_INDEX}" | sed "s#'#'\\"'\\"'#g;s#.*#par_index='&'#" ; else echo "# par_index="; fi )
$( if [ ! -z ${VIASH_PAR_COMPRESS_LEVEL+x} ]; then echo "${VIASH_PAR_COMPRESS_LEVEL}" | sed "s#'#'\\"'\\"'#g;s#.*#par_compress_level='&'#" ; else echo "# par_compress_level="; fi )
$( if [ ! -z ${VIASH_PAR_REINDEX+x} ]; then echo "${VIASH_PAR_REINDEX}" | sed "s#'#'\\"'\\"'#g;s#.*#par_reindex='&'#" ; else echo "# par_reindex="; fi )
$( if [ ! -z ${VIASH_PAR_SIZE+x} ]; then echo "${VIASH_PAR_SIZE}" | sed "s#'#'\\"'\\"'#g;s#.*#par_size='&'#" ; else echo "# par_size="; fi )
$( if [ ! -z ${VIASH_PAR_TEST+x} ]; then echo "${VIASH_PAR_TEST}" | sed "s#'#'\\"'\\"'#g;s#.*#par_test='&'#" ; else echo "# par_test="; fi )
$( if [ ! -z ${VIASH_PAR_BINARY+x} ]; then echo "${VIASH_PAR_BINARY}" | sed "s#'#'\\"'\\"'#g;s#.*#par_binary='&'#" ; else echo "# par_binary="; fi )
$( if [ ! -z ${VIASH_PAR_TAB+x} ]; then echo "${VIASH_PAR_TAB}" | sed "s#'#'\\"'\\"'#g;s#.*#par_tab='&'#" ; else echo "# par_tab="; fi )
$( if [ ! -z ${VIASH_PAR_BED_OUT+x} ]; then echo "${VIASH_PAR_BED_OUT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_bed_out='&'#" ; else echo "# par_bed_out="; fi )
$( if [ ! -z ${VIASH_PAR_NAME+x} ]; then echo "${VIASH_PAR_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#par_name='&'#" ; else echo "# par_name="; fi )
$( if [ ! -z ${VIASH_PAR_NAME_ONLY+x} ]; then echo "${VIASH_PAR_NAME_ONLY}" | sed "s#'#'\\"'\\"'#g;s#.*#par_name_only='&'#" ; else echo "# par_name_only="; fi )
$( if [ ! -z ${VIASH_PAR_SPLIT+x} ]; then echo "${VIASH_PAR_SPLIT}" | sed "s#'#'\\"'\\"'#g;s#.*#par_split='&'#" ; else echo "# par_split="; fi )
$( if [ ! -z ${VIASH_PAR_FULL_HEADER+x} ]; then echo "${VIASH_PAR_FULL_HEADER}" | sed "s#'#'\\"'\\"'#g;s#.*#par_full_header='&'#" ; else echo "# par_full_header="; fi )
$( if [ ! -z ${VIASH_META_NAME+x} ]; then echo "${VIASH_META_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_name='&'#" ; else echo "# meta_name="; fi )
$( if [ ! -z ${VIASH_META_FUNCTIONALITY_NAME+x} ]; then echo "${VIASH_META_FUNCTIONALITY_NAME}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_functionality_name='&'#" ; else echo "# meta_functionality_name="; fi )
$( if [ ! -z ${VIASH_META_RESOURCES_DIR+x} ]; then echo "${VIASH_META_RESOURCES_DIR}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_resources_dir='&'#" ; else echo "# meta_resources_dir="; fi )
@@ -3140,25 +3106,27 @@ $( if [ ! -z ${VIASH_META_MEMORY_TIB+x} ]; then echo "${VIASH_META_MEMORY_TIB}"
$( if [ ! -z ${VIASH_META_MEMORY_PIB+x} ]; then echo "${VIASH_META_MEMORY_PIB}" | sed "s#'#'\\"'\\"'#g;s#.*#meta_memory_pib='&'#" ; else echo "# meta_memory_pib="; fi )
## VIASH END
[[ "\\$par_decompress" == "false" ]] && unset par_decompress
[[ "\\$par_rebgzip" == "false" ]] && unset par_rebgzip
[[ "\\$par_index" == "false" ]] && unset par_index
[[ "\\$par_reindex" == "false" ]] && unset par_reindex
[[ "\\$par_test" == "false" ]] && unset par_test
[[ "\\$par_binary" == "false" ]] && unset par_binary
bgzip -c \\\\
\\${meta_cpus:+--threads "\\${meta_cpus}"} \\\\
\\${par_offset:+-b "\\${par_offset}"} \\\\
\\${par_decompress:+-d} \\\\
\\${par_rebgzip:+-g} \\\\
\\${par_index:+-i} \\\\
\\${par_index_name:+-I "\\${par_index_name}"} \\\\
\\${par_compress_level:+-l "\\${par_compress_level}"} \\\\
\\${par_reindex:+-r} \\\\
\\${par_size:+-s "\\${par_size}"} \\\\
\\${par_test:+-t} \\\\
\\${par_binary:+--binary} \\\\
"\\$par_input" > "\\$par_output"
#!/usr/bin/env bash
set -eo pipefail
unset_if_false=( par_rna par_strandedness par_tab par_bed_out par_name par_name_only par_split par_full_header )
for par in \\${unset_if_false[@]}; do
test_val="\\${!par}"
[[ "\\$test_val" == "false" ]] && unset \\$par
done
bedtools getfasta \\\\
-fi "\\$par_input_fasta" \\\\
-bed "\\$par_input_bed" \\\\
\\${par_rna:+-rna} \\\\
\\${par_name:+-name} \\\\
\\${par_name_only:+-nameOnly} \\\\
\\${par_tab:+-tab} \\\\
\\${par_bed_out:+-bedOut} \\\\
\\${par_strandedness:+-s} \\\\
\\${par_split:+-split} \\\\
\\${par_full_header:+-fullHeader} > "\\$par_output"
VIASHMAIN
bash "$tempscript"
'''
@@ -3514,8 +3482,8 @@ meta["defaults"] = [
directives: readJsonBlob('''{
"container" : {
"registry" : "images.viash-hub.com",
"image" : "vsh/biobox/bgzip",
"tag" : "v0.1"
"image" : "vsh/biobox/bedtools/bedtools_getfasta",
"tag" : "v0.1.0"
},
"tag" : "$id"
}'''),

125
target/nextflow/bedtools/bedtools_getfasta/nextflow.config Normal file
View File

@@ -0,0 +1,125 @@
manifest {
name = 'bedtools/bedtools_getfasta'
mainScript = 'main.nf'
nextflowVersion = '!>=20.12.1-edge'
version = 'v0.1.0'
description = 'Extract sequences from a FASTA file for each of the intervals defined in a BED/GFF/VCF file.'
}
process.container = 'nextflow/bash:latest'
// detect tempdir
tempDir = java.nio.file.Paths.get(
System.getenv('NXF_TEMP') ?:
System.getenv('VIASH_TEMP') ?:
System.getenv('TEMPDIR') ?:
System.getenv('TMPDIR') ?:
'/tmp'
).toAbsolutePath()
profiles {
no_publish {
process {
withName: '.*' {
publishDir = [
enabled: false
]
}
}
}
mount_temp {
docker.temp = tempDir
podman.temp = tempDir
charliecloud.temp = tempDir
}
docker {
docker.enabled = true
// docker.userEmulation = true
singularity.enabled = false
podman.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
singularity {
singularity.enabled = true
singularity.autoMounts = true
docker.enabled = false
podman.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
podman {
podman.enabled = true
docker.enabled = false
singularity.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
shifter {
shifter.enabled = true
docker.enabled = false
singularity.enabled = false
podman.enabled = false
charliecloud.enabled = false
}
charliecloud {
charliecloud.enabled = true
docker.enabled = false
singularity.enabled = false
podman.enabled = false
shifter.enabled = false
}
}
process{
withLabel: mem1gb { memory = 1000000000.B }
withLabel: mem2gb { memory = 2000000000.B }
withLabel: mem5gb { memory = 5000000000.B }
withLabel: mem10gb { memory = 10000000000.B }
withLabel: mem20gb { memory = 20000000000.B }
withLabel: mem50gb { memory = 50000000000.B }
withLabel: mem100gb { memory = 100000000000.B }
withLabel: mem200gb { memory = 200000000000.B }
withLabel: mem500gb { memory = 500000000000.B }
withLabel: mem1tb { memory = 1000000000000.B }
withLabel: mem2tb { memory = 2000000000000.B }
withLabel: mem5tb { memory = 5000000000000.B }
withLabel: mem10tb { memory = 10000000000000.B }
withLabel: mem20tb { memory = 20000000000000.B }
withLabel: mem50tb { memory = 50000000000000.B }
withLabel: mem100tb { memory = 100000000000000.B }
withLabel: mem200tb { memory = 200000000000000.B }
withLabel: mem500tb { memory = 500000000000000.B }
withLabel: mem1gib { memory = 1073741824.B }
withLabel: mem2gib { memory = 2147483648.B }
withLabel: mem4gib { memory = 4294967296.B }
withLabel: mem8gib { memory = 8589934592.B }
withLabel: mem16gib { memory = 17179869184.B }
withLabel: mem32gib { memory = 34359738368.B }
withLabel: mem64gib { memory = 68719476736.B }
withLabel: mem128gib { memory = 137438953472.B }
withLabel: mem256gib { memory = 274877906944.B }
withLabel: mem512gib { memory = 549755813888.B }
withLabel: mem1tib { memory = 1099511627776.B }
withLabel: mem2tib { memory = 2199023255552.B }
withLabel: mem4tib { memory = 4398046511104.B }
withLabel: mem8tib { memory = 8796093022208.B }
withLabel: mem16tib { memory = 17592186044416.B }
withLabel: mem32tib { memory = 35184372088832.B }
withLabel: mem64tib { memory = 70368744177664.B }
withLabel: mem128tib { memory = 140737488355328.B }
withLabel: mem256tib { memory = 281474976710656.B }
withLabel: mem512tib { memory = 562949953421312.B }
withLabel: cpu1 { cpus = 1 }
withLabel: cpu2 { cpus = 2 }
withLabel: cpu5 { cpus = 5 }
withLabel: cpu10 { cpus = 10 }
withLabel: cpu20 { cpus = 20 }
withLabel: cpu50 { cpus = 50 }
withLabel: cpu100 { cpus = 100 }
withLabel: cpu200 { cpus = 200 }
withLabel: cpu500 { cpus = 500 }
withLabel: cpu1000 { cpus = 1000 }
}

157
target/nextflow/bgzip/nextflow_schema.json → target/nextflow/bedtools/bedtools_getfasta/nextflow_schema.json
View File

@@ -1,34 +1,76 @@
{
"$schema": "http://json-schema.org/draft-07/schema",
"title": "bgzip",
"description": "Block compression/decompression utility",
"title": "bedtools_getfasta",
"description": "Extract sequences from a FASTA file for each of the intervals defined in a BED/GFF/VCF file.",
"type": "object",
"definitions": {
"inputs" : {
"title": "Inputs",
"input arguments" : {
"title": "Input arguments",
"type": "object",
"description": "No description",
"properties": {
"input": {
"input_fasta": {
"type":
"string",
"description": "Type: `file`, required. file to be compressed or decompressed",
"help_text": "Type: `file`, required. file to be compressed or decompressed"
"description": "Type: `file`. FASTA file containing sequences for each interval specified in the input BED file",
"help_text": "Type: `file`. FASTA file containing sequences for each interval specified in the input BED file.\nThe headers in the input FASTA file must exactly match the chromosome column in the BED file.\n"
}
,
"input_bed": {
"type":
"string",
"description": "Type: `file`. BED file containing intervals to extract from the FASTA file",
"help_text": "Type: `file`. BED file containing intervals to extract from the FASTA file.\nBED files containing a single region require a newline character\nat the end of the line, otherwise a blank output file is produced.\n"
}
,
"rna": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. The FASTA is RNA not DNA",
"help_text": "Type: `boolean_true`, default: `false`. The FASTA is RNA not DNA. Reverse complementation handled accordingly.\n"
,
"default": "False"
}
}
},
"outputs" : {
"title": "Outputs",
"run arguments" : {
"title": "Run arguments",
"type": "object",
"description": "No description",
"properties": {
"strandedness": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Force strandedness",
"help_text": "Type: `boolean_true`, default: `false`. Force strandedness. If the feature occupies the antisense strand, the output sequence will\nbe reverse complemented. By default strandedness is not taken into account.\n"
,
"default": "False"
}
}
},
"output arguments" : {
"title": "Output arguments",
"type": "object",
"description": "No description",
"properties": {
@@ -37,125 +79,74 @@
"output": {
"type":
"string",
"description": "Type: `file`, required, default: `$id.$key.output.output`. compressed or decompressed output",
"help_text": "Type: `file`, required, default: `$id.$key.output.output`. compressed or decompressed output"
"description": "Type: `file`, required, default: `$id.$key.output.output`. Output file where the output from the \u0027bedtools getfasta\u0027 commend will\nbe written to",
"help_text": "Type: `file`, required, default: `$id.$key.output.output`. Output file where the output from the \u0027bedtools getfasta\u0027 commend will\nbe written to.\n"
,
"default": "$id.$key.output.output"
}
,
"index_name": {
"type":
"string",
"description": "Type: `file`, default: `$id.$key.index_name.index_name`. name of BGZF index file [file",
"help_text": "Type: `file`, default: `$id.$key.index_name.index_name`. name of BGZF index file [file.gz.gzi]"
,
"default": "$id.$key.index_name.index_name"
}
}
},
"arguments" : {
"title": "Arguments",
"type": "object",
"description": "No description",
"properties": {
"offset": {
"type":
"integer",
"description": "Type: `integer`. decompress at virtual file pointer (0-based uncompressed offset)",
"help_text": "Type: `integer`. decompress at virtual file pointer (0-based uncompressed offset)"
}
,
"decompress": {
"tab": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. decompress the input file",
"help_text": "Type: `boolean_true`, default: `false`. decompress the input file"
"description": "Type: `boolean_true`, default: `false`. Report extract sequences in a tab-delimited format instead of in FASTA format",
"help_text": "Type: `boolean_true`, default: `false`. Report extract sequences in a tab-delimited format instead of in FASTA format.\n"
,
"default": "False"
}
,
"rebgzip": {
"bed_out": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. use an index file to bgzip a file",
"help_text": "Type: `boolean_true`, default: `false`. use an index file to bgzip a file"
"description": "Type: `boolean_true`, default: `false`. Report extract sequences in a tab-delimited BED format instead of in FASTA format",
"help_text": "Type: `boolean_true`, default: `false`. Report extract sequences in a tab-delimited BED format instead of in FASTA format.\n"
,
"default": "False"
}
,
"index": {
"name": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. compress and create BGZF index",
"help_text": "Type: `boolean_true`, default: `false`. compress and create BGZF index"
"description": "Type: `boolean_true`, default: `false`. Set the FASTA header for each extracted sequence to be the \"name\" and coordinate columns from the BED feature",
"help_text": "Type: `boolean_true`, default: `false`. Set the FASTA header for each extracted sequence to be the \"name\" and coordinate columns from the BED feature.\n"
,
"default": "False"
}
,
"compress_level": {
"type":
"integer",
"description": "Type: `integer`. compression level to use when compressing; 0 to 9, or -1 for default [-1]",
"help_text": "Type: `integer`. compression level to use when compressing; 0 to 9, or -1 for default [-1]"
}
,
"reindex": {
"name_only": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. (re)index the output file",
"help_text": "Type: `boolean_true`, default: `false`. (re)index the output file"
"description": "Type: `boolean_true`, default: `false`. Set the FASTA header for each extracted sequence to be the \"name\" columns from the BED feature",
"help_text": "Type: `boolean_true`, default: `false`. Set the FASTA header for each extracted sequence to be the \"name\" columns from the BED feature.\n"
,
"default": "False"
}
,
"size": {
"type":
"integer",
"description": "Type: `integer`. decompress INT bytes (uncompressed size)",
"help_text": "Type: `integer`. decompress INT bytes (uncompressed size)"
}
,
"test": {
"split": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. test integrity of compressed file",
"help_text": "Type: `boolean_true`, default: `false`. test integrity of compressed file"
"description": "Type: `boolean_true`, default: `false`. When --input is in BED12 format, create a separate fasta entry for each block in a BED12 record,\nblocks being described in the 11th and 12th column of the BED",
"help_text": "Type: `boolean_true`, default: `false`. When --input is in BED12 format, create a separate fasta entry for each block in a BED12 record,\nblocks being described in the 11th and 12th column of the BED.\n"
,
"default": "False"
}
,
"binary": {
"full_header": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Don\u0027t align blocks with text lines",
"help_text": "Type: `boolean_true`, default: `false`. Don\u0027t align blocks with text lines"
"description": "Type: `boolean_true`, default: `false`. Use full fasta header",
"help_text": "Type: `boolean_true`, default: `false`. Use full fasta header. By default, only the word before the first space or tab is used.\n"
,
"default": "False"
}
@@ -198,15 +189,15 @@
"allOf": [
{
"$ref": "#/definitions/inputs"
"$ref": "#/definitions/input arguments"
},
{
"$ref": "#/definitions/outputs"
"$ref": "#/definitions/run arguments"
},
{
"$ref": "#/definitions/arguments"
"$ref": "#/definitions/output arguments"
},
{

19
target/nextflow/busco/busco_download_datasets/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "busco_download_datasets"
namespace: "busco"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -127,7 +127,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/busco:5.6.1--pyhdfd78af_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -144,11 +144,11 @@ build_info:
output: "target/nextflow/busco/busco_download_datasets"
executable: "target/nextflow/busco/busco_download_datasets/main.nf"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -158,16 +158,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

23
target/nextflow/busco/busco_download_datasets/main.nf
View File

@@ -1,4 +1,4 @@
// busco_download_datasets v0.1
// busco_download_datasets v0.1.0
//
// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -2780,7 +2780,7 @@ meta = [
"config": processConfig(readJsonBlob('''{
"name" : "busco_download_datasets",
"namespace" : "busco",
"version" : "v0.1",
"version" : "v0.1.0",
"argument_groups" : [
{
"name" : "Inputs",
@@ -2937,7 +2937,7 @@ meta = [
"id" : "docker",
"image" : "quay.io/biocontainers/busco:5.6.1--pyhdfd78af_0",
"target_registry" : "images.viash-hub.com",
"target_tag" : "v0.1",
"target_tag" : "v0.1.0",
"namespace_separator" : "/",
"setup" : [
{
@@ -2959,12 +2959,12 @@ meta = [
"engine" : "docker|native",
"output" : "target/nextflow/busco/busco_download_datasets",
"viash_version" : "0.9.0-RC6",
"git_commit" : "d97e3156feb1839752aa080bfbe8a2153489dfd6",
"git_commit" : "b84b29747d0635f2ac83ea63b496be9a9edb6724",
"git_remote" : "https://github.com/viash-hub/biobox"
},
"package_config" : {
"name" : "biobox",
"version" : "v0.1",
"version" : "v0.1.0",
"description" : "A collection of bioinformatics tools for working with sequence data.\n",
"viash_version" : "0.9.0-RC6",
"source" : "src",
@@ -2973,20 +2973,17 @@ meta = [
".requirements.commands := ['ps']\n",
".engines += { type: \\"native\\" }",
".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
".engines[.type == 'docker'].target_tag := 'v0.1'"
".engines[.type == 'docker'].target_tag := 'v0.1.0'"
],
"keywords" : [
"bioinformatics",
"sequence",
"alignment",
"variant calling",
"dna",
"rna"
"modules",
"sequencing"
],
"license" : "MIT",
"organization" : "vsh",
"links" : {
"repository" : "https://github.com/viash-hub/biobbox",
"repository" : "https://github.com/viash-hub/biobox",
"issue_tracker" : "https://github.com/viash-hub/biobox/issues"
}
}
@@ -3394,7 +3391,7 @@ meta["defaults"] = [
"container" : {
"registry" : "images.viash-hub.com",
"image" : "vsh/biobox/busco/busco_download_datasets",
"tag" : "v0.1"
"tag" : "v0.1.0"
},
"tag" : "$id"
}'''),

2
target/nextflow/busco/busco_download_datasets/nextflow.config
View File

@@ -2,7 +2,7 @@ manifest {
name = 'busco/busco_download_datasets'
mainScript = 'main.nf'
nextflowVersion = '!>=20.12.1-edge'
version = 'v0.1'
version = 'v0.1.0'
description = 'Downloads available busco datasets'
}

19
target/nextflow/busco/busco_list_datasets/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "busco_list_datasets"
namespace: "busco"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Outputs"
arguments:
@@ -114,7 +114,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/busco:5.6.1--pyhdfd78af_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -131,11 +131,11 @@ build_info:
output: "target/nextflow/busco/busco_list_datasets"
executable: "target/nextflow/busco/busco_list_datasets/main.nf"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -145,16 +145,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

23
target/nextflow/busco/busco_list_datasets/main.nf
View File

@@ -1,4 +1,4 @@
// busco_list_datasets v0.1
// busco_list_datasets v0.1.0
//
// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -2780,7 +2780,7 @@ meta = [
"config": processConfig(readJsonBlob('''{
"name" : "busco_list_datasets",
"namespace" : "busco",
"version" : "v0.1",
"version" : "v0.1.0",
"argument_groups" : [
{
"name" : "Outputs",
@@ -2923,7 +2923,7 @@ meta = [
"id" : "docker",
"image" : "quay.io/biocontainers/busco:5.6.1--pyhdfd78af_0",
"target_registry" : "images.viash-hub.com",
"target_tag" : "v0.1",
"target_tag" : "v0.1.0",
"namespace_separator" : "/",
"setup" : [
{
@@ -2945,12 +2945,12 @@ meta = [
"engine" : "docker|native",
"output" : "target/nextflow/busco/busco_list_datasets",
"viash_version" : "0.9.0-RC6",
"git_commit" : "d97e3156feb1839752aa080bfbe8a2153489dfd6",
"git_commit" : "b84b29747d0635f2ac83ea63b496be9a9edb6724",
"git_remote" : "https://github.com/viash-hub/biobox"
},
"package_config" : {
"name" : "biobox",
"version" : "v0.1",
"version" : "v0.1.0",
"description" : "A collection of bioinformatics tools for working with sequence data.\n",
"viash_version" : "0.9.0-RC6",
"source" : "src",
@@ -2959,20 +2959,17 @@ meta = [
".requirements.commands := ['ps']\n",
".engines += { type: \\"native\\" }",
".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
".engines[.type == 'docker'].target_tag := 'v0.1'"
".engines[.type == 'docker'].target_tag := 'v0.1.0'"
],
"keywords" : [
"bioinformatics",
"sequence",
"alignment",
"variant calling",
"dna",
"rna"
"modules",
"sequencing"
],
"license" : "MIT",
"organization" : "vsh",
"links" : {
"repository" : "https://github.com/viash-hub/biobbox",
"repository" : "https://github.com/viash-hub/biobox",
"issue_tracker" : "https://github.com/viash-hub/biobox/issues"
}
}
@@ -3371,7 +3368,7 @@ meta["defaults"] = [
"container" : {
"registry" : "images.viash-hub.com",
"image" : "vsh/biobox/busco/busco_list_datasets",
"tag" : "v0.1"
"tag" : "v0.1.0"
},
"tag" : "$id"
}'''),

2
target/nextflow/busco/busco_list_datasets/nextflow.config
View File

@@ -2,7 +2,7 @@ manifest {
name = 'busco/busco_list_datasets'
mainScript = 'main.nf'
nextflowVersion = '!>=20.12.1-edge'
version = 'v0.1'
version = 'v0.1.0'
description = 'Lists the available busco datasets'
}

19
target/nextflow/busco/busco_run/.config.vsh.yaml
View File

@@ -1,6 +1,6 @@
name: "busco_run"
namespace: "busco"
version: "v0.1"
version: "v0.1.0"
argument_groups:
- name: "Inputs"
arguments:
@@ -387,7 +387,7 @@ engines:
id: "docker"
image: "quay.io/biocontainers/busco:5.6.1--pyhdfd78af_0"
target_registry: "images.viash-hub.com"
target_tag: "v0.1"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "docker"
@@ -404,11 +404,11 @@ build_info:
output: "target/nextflow/busco/busco_run"
executable: "target/nextflow/busco/busco_run/main.nf"
viash_version: "0.9.0-RC6"
git_commit: "d97e3156feb1839752aa080bfbe8a2153489dfd6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
@@ -418,16 +418,13 @@ package_config:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "sequence"
- "alignment"
- "variant calling"
- "dna"
- "rna"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobbox"
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

23
target/nextflow/busco/busco_run/main.nf
View File

@@ -1,4 +1,4 @@
// busco_run v0.1
// busco_run v0.1.0
//
// This wrapper script is auto-generated by viash 0.9.0-RC6 and is thus a
// derivative work thereof. This software comes with ABSOLUTELY NO WARRANTY from
@@ -2780,7 +2780,7 @@ meta = [
"config": processConfig(readJsonBlob('''{
"name" : "busco_run",
"namespace" : "busco",
"version" : "v0.1",
"version" : "v0.1.0",
"argument_groups" : [
{
"name" : "Inputs",
@@ -3229,7 +3229,7 @@ meta = [
"id" : "docker",
"image" : "quay.io/biocontainers/busco:5.6.1--pyhdfd78af_0",
"target_registry" : "images.viash-hub.com",
"target_tag" : "v0.1",
"target_tag" : "v0.1.0",
"namespace_separator" : "/",
"setup" : [
{
@@ -3251,12 +3251,12 @@ meta = [
"engine" : "docker|native",
"output" : "target/nextflow/busco/busco_run",
"viash_version" : "0.9.0-RC6",
"git_commit" : "d97e3156feb1839752aa080bfbe8a2153489dfd6",
"git_commit" : "b84b29747d0635f2ac83ea63b496be9a9edb6724",
"git_remote" : "https://github.com/viash-hub/biobox"
},
"package_config" : {
"name" : "biobox",
"version" : "v0.1",
"version" : "v0.1.0",
"description" : "A collection of bioinformatics tools for working with sequence data.\n",
"viash_version" : "0.9.0-RC6",
"source" : "src",
@@ -3265,20 +3265,17 @@ meta = [
".requirements.commands := ['ps']\n",
".engines += { type: \\"native\\" }",
".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'",
".engines[.type == 'docker'].target_tag := 'v0.1'"
".engines[.type == 'docker'].target_tag := 'v0.1.0'"
],
"keywords" : [
"bioinformatics",
"sequence",
"alignment",
"variant calling",
"dna",
"rna"
"modules",
"sequencing"
],
"license" : "MIT",
"organization" : "vsh",
"links" : {
"repository" : "https://github.com/viash-hub/biobbox",
"repository" : "https://github.com/viash-hub/biobox",
"issue_tracker" : "https://github.com/viash-hub/biobox/issues"
}
}
@@ -3767,7 +3764,7 @@ meta["defaults"] = [
"container" : {
"registry" : "images.viash-hub.com",
"image" : "vsh/biobox/busco/busco_run",
"tag" : "v0.1"
"tag" : "v0.1.0"
},
"tag" : "$id"
}'''),

2
target/nextflow/busco/busco_run/nextflow.config
View File

@@ -2,7 +2,7 @@ manifest {
name = 'busco/busco_run'
mainScript = 'main.nf'
nextflowVersion = '!>=20.12.1-edge'
version = 'v0.1'
version = 'v0.1.0'
description = 'Assessment of genome assembly and annotation completeness with single copy orthologs'
}

733
target/nextflow/cutadapt/.config.vsh.yaml Normal file
View File

@@ -0,0 +1,733 @@
name: "cutadapt"
version: "v0.1.0"
argument_groups:
- name: "Specify Adapters for R1"
arguments:
- type: "string"
name: "--adapter"
alternatives:
- "-a"
description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\
\ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\
\ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\
\ the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--front"
alternatives:
- "-g"
description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\
\ first read). The adapter and any preceding bases\nare trimmed. Partial matches\
\ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\
\ the adapter is\nonly found if it is a prefix of the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--anywhere"
alternatives:
- "-b"
description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\
\ (paired data: of the first read). Both types of\nmatches as described under\
\ -a and -g are allowed. If the\nfirst base of the read is part of the match,\
\ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\
for rescuing failed library preparations - do not use if\nyou know which end\
\ your adapter was ligated to!\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- name: "Specify Adapters using Fasta files for R1"
arguments:
- type: "file"
name: "--adapter_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 3'\
\ end (paired data:\nof the first read). The adapter and subsequent bases are\n\
trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\
\ found if it is a suffix of the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "file"
name: "--front_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 5'\
\ end (paired data:\nof the first read). The adapter and any preceding bases\n\
are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\
\ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\
\ the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--anywhere_fasta"
description: "Fasta file containing sequences of an adapter that may be ligated\
\ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\
\ as described under -a and -g are allowed. If the\nfirst base of the read is\
\ part of the match, the behavior\nis as with -g, otherwise as with -a. This\
\ option is mostly\nfor rescuing failed library preparations - do not use if\n\
you know which end your adapter was ligated to!\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Specify Adapters for R2"
arguments:
- type: "string"
name: "--adapter_r2"
alternatives:
- "-A"
description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\
\ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\
\ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\
\ the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--front_r2"
alternatives:
- "-G"
description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\
\ first read). The adapter and any preceding bases\nare trimmed. Partial matches\
\ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\
\ the adapter is\nonly found if it is a prefix of the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--anywhere_r2"
alternatives:
- "-B"
description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\
\ (paired data: of the first read). Both types of\nmatches as described under\
\ -a and -g are allowed. If the\nfirst base of the read is part of the match,\
\ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\
for rescuing failed library preparations - do not use if\nyou know which end\
\ your adapter was ligated to!\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- name: "Specify Adapters using Fasta files for R2"
arguments:
- type: "file"
name: "--adapter_r2_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 3'\
\ end (paired data:\nof the first read). The adapter and subsequent bases are\n\
trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\
\ found if it is a suffix of the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--front_r2_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 5'\
\ end (paired data:\nof the first read). The adapter and any preceding bases\n\
are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\
\ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\
\ the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--anywhere_r2_fasta"
description: "Fasta file containing sequences of an adapter that may be ligated\
\ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\
\ as described under -a and -g are allowed. If the\nfirst base of the read is\
\ part of the match, the behavior\nis as with -g, otherwise as with -a. This\
\ option is mostly\nfor rescuing failed library preparations - do not use if\n\
you know which end your adapter was ligated to!\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Paired-end options"
arguments:
- type: "boolean_true"
name: "--pair_adapters"
description: "Treat adapters given with -a/-A etc. as pairs. Either both\nor none\
\ are removed from each read pair.\n"
info: null
direction: "input"
- type: "string"
name: "--pair_filter"
description: "Which of the reads in a paired-end read have to match the\nfiltering\
\ criterion in order for the pair to be filtered.\n"
info: null
required: false
choices:
- "any"
- "both"
- "first"
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--interleaved"
description: "Read and/or write interleaved paired-end reads.\n"
info: null
direction: "input"
- name: "Input parameters"
arguments:
- type: "file"
name: "--input"
description: "Input fastq file for single-end reads or R1 for paired-end reads.\n"
info: null
must_exist: true
create_parent: true
required: true
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--input_r2"
description: "Input fastq file for R2 in the case of paired-end reads.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "double"
name: "--error_rate"
alternatives:
- "-E"
- "--errors"
description: "Maximum allowed error rate (if 0 <= E < 1), or absolute\nnumber\
\ of errors for full-length adapter match (if E is an\ninteger >= 1). Error\
\ rate = no. of errors divided by\nlength of matching region. Default: 0.1 (10%).\n"
info: null
example:
- 0.1
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_false"
name: "--no_indels"
description: "Allow only mismatches in alignments.\n"
info: null
direction: "input"
- type: "integer"
name: "--times"
alternatives:
- "-n"
description: "Remove up to COUNT adapters from each read. Default: 1.\n"
info: null
example:
- 1
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--overlap"
alternatives:
- "-O"
description: "Require MINLENGTH overlap between read and adapter for an\nadapter\
\ to be found. The default is 3.\n"
info: null
example:
- 3
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--match_read_wildcards"
description: "Interpret IUPAC wildcards in reads.\n"
info: null
direction: "input"
- type: "boolean_false"
name: "--no_match_adapter_wildcards"
description: "Do not interpret IUPAC wildcards in adapters.\n"
info: null
direction: "input"
- type: "string"
name: "--action"
description: "What to do if a match was found. trim: trim adapter and\nup- or\
\ downstream sequence; retain: trim, but retain\nadapter; mask: replace with\
\ 'N' characters; lowercase:\nconvert to lowercase; none: leave unchanged.\n\
The default is trim.\n"
info: null
example:
- "trim"
required: false
choices:
- "trim"
- "retain"
- "mask"
- "lowercase"
- "none"
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--revcomp"
alternatives:
- "--rc"
description: "Check both the read and its reverse complement for adapter\nmatches.\
\ If match is on reverse-complemented version,\noutput that one.\n"
info: null
direction: "input"
- name: "Read modifications"
arguments:
- type: "integer"
name: "--cut"
alternatives:
- "-u"
description: "Remove LEN bases from each read (or R1 if paired; use --cut_r2\n\
option for R2). If LEN is positive, remove bases from the\nbeginning. If LEN\
\ is negative, remove bases from the end.\nCan be used twice if LENs have different\
\ signs. Applied\n*before* adapter trimming.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "integer"
name: "--cut_r2"
description: "Remove LEN bases from each read (for R2). If LEN is positive, remove\
\ bases from the\nbeginning. If LEN is negative, remove bases from the end.\n\
Can be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--nextseq_trim"
description: "NextSeq-specific quality trimming (each read). Trims also\ndark\
\ cycles appearing as high-quality G bases.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--quality_cutoff"
alternatives:
- "-q"
description: "Trim low-quality bases from 5' and/or 3' ends of each read\nbefore\
\ adapter removal. Applied to both reads if data is\npaired. If one value is\
\ given, only the 3' end is trimmed.\nIf two comma-separated cutoffs are given,\
\ the 5' end is\ntrimmed with the first cutoff, the 3' end with the second.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--quality_cutoff_r2"
alternatives:
- "-Q"
description: "Quality-trimming cutoff for R2. Default: same as for R1\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--quality_base"
description: "Assume that quality values in FASTQ are encoded as\nascii(quality\
\ + N). This needs to be set to 64 for some\nold Illumina FASTQ files. The default\
\ is 33.\n"
info: null
example:
- 33
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--poly_a"
description: "Trim poly-A tails"
info: null
direction: "input"
- type: "integer"
name: "--length"
alternatives:
- "-l"
description: "Shorten reads to LENGTH. Positive values remove bases at\nthe end\
\ while negative ones remove bases at the beginning.\nThis and the following\
\ modifications are applied after\nadapter trimming.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--trim_n"
description: "Trim N's on ends of reads."
info: null
direction: "input"
- type: "string"
name: "--length_tag"
description: "Search for TAG followed by a decimal number in the\ndescription\
\ field of the read. Replace the decimal number\nwith the correct length of\
\ the trimmed read. For example,\nuse --length-tag 'length=' to correct fields\
\ like\n'length=123'.\n"
info: null
example:
- "length="
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--strip_suffix"
description: "Remove this suffix from read names if present. Can be\ngiven multiple\
\ times.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--prefix"
alternatives:
- "-x"
description: "Add this prefix to read names. Use {name} to insert the\nname of\
\ the matching adapter.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--suffix"
alternatives:
- "-y"
description: "Add this suffix to read names; can also include {name}\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--rename"
description: "Rename reads using TEMPLATE containing variables such as\n{id},\
\ {adapter_name} etc. (see documentation)\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--zero_cap"
alternatives:
- "-z"
description: "Change negative quality values to zero."
info: null
direction: "input"
- name: "Filtering of processed reads"
description: "Filters are applied after above read modifications. Paired-end reads\
\ are\nalways discarded pairwise (see also --pair_filter).\n"
arguments:
- type: "string"
name: "--minimum_length"
alternatives:
- "-m"
description: "Discard reads shorter than LEN. Default is 0.\nWhen trimming paired-end\
\ reads, the minimum lengths for R1 and R2 can be specified separately by separating\
\ them with a colon (:).\nIf the colon syntax is not used, the same minimum\
\ length applies to both reads, as discussed above.\nAlso, one of the values\
\ can be omitted to impose no restrictions.\nFor example, with -m 17:, the length\
\ of R1 must be at least 17, but the length of R2 is ignored.\n"
info: null
example:
- "0"
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--maximum_length"
alternatives:
- "-M"
description: "Discard reads longer than LEN. Default: no limit.\nFor paired reads,\
\ see the remark for --minimum_length\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--max_n"
description: "Discard reads with more than COUNT 'N' bases. If COUNT is\na number\
\ between 0 and 1, it is interpreted as a fraction\nof the read length.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "long"
name: "--max_expected_errors"
alternatives:
- "--max_ee"
description: "Discard reads whose expected number of errors (computed\nfrom quality\
\ values) exceeds ERRORS.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "long"
name: "--max_average_error_rate"
alternatives:
- "--max_aer"
description: "as --max_expected_errors (see above), but divided by\nlength to\
\ account for reads of varying length.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--discard_trimmed"
alternatives:
- "--discard"
description: "Discard reads that contain an adapter. Use also -O to\navoid discarding\
\ too many randomly matching reads.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--discard_untrimmed"
alternatives:
- "--trimmed_only"
description: "Discard reads that do not contain an adapter.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--discard_casava"
description: "Discard reads that did not pass CASAVA filtering (header\nhas :Y:).\n"
info: null
direction: "input"
- name: "Output parameters"
arguments:
- type: "string"
name: "--report"
description: "Which type of report to print: 'full' (default) or 'minimal'.\n"
info: null
example:
- "full"
required: false
choices:
- "full"
- "minimal"
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--json"
description: "Write report in JSON format to this file.\n"
info: null
direction: "input"
- type: "file"
name: "--output"
description: "Glob pattern for matching the expected output files.\nShould include\
\ `$output_dir`.\n"
info: null
example:
- "fastq/*_001.fast[a,q]"
must_exist: true
create_parent: true
required: true
direction: "output"
multiple: true
multiple_sep: ";"
- type: "boolean_true"
name: "--fasta"
description: "Output FASTA to standard output even on FASTQ input.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--info_file"
description: "Write information about each read and its adapter matches\ninto\
\ info.txt in the output directory.\nSee the documentation for the file format.\n"
info: null
direction: "input"
- name: "Debug"
arguments:
- type: "boolean_true"
name: "--debug"
description: "Print debug information"
info: null
direction: "input"
resources:
- type: "bash_script"
path: "script.sh"
is_executable: true
description: "Cutadapt removes adapter sequences from high-throughput sequencing reads.\n"
test_resources:
- type: "bash_script"
path: "test.sh"
is_executable: true
info: null
status: "enabled"
requirements:
commands:
- "ps"
keywords:
- "RNA-seq"
- "scRNA-seq"
- "high-throughput"
license: "MIT"
references:
doi:
- "10.14806/ej.17.1.200"
links:
repository: "https://github.com/marcelm/cutadapt"
homepage: "https://cutadapt.readthedocs.io"
documentation: "https://cutadapt.readthedocs.io"
runners:
- type: "executable"
id: "executable"
docker_setup_strategy: "ifneedbepullelsecachedbuild"
- type: "nextflow"
id: "nextflow"
directives:
tag: "$id"
auto:
simplifyInput: true
simplifyOutput: false
transcript: false
publish: false
config:
labels:
mem1gb: "memory = 1000000000.B"
mem2gb: "memory = 2000000000.B"
mem5gb: "memory = 5000000000.B"
mem10gb: "memory = 10000000000.B"
mem20gb: "memory = 20000000000.B"
mem50gb: "memory = 50000000000.B"
mem100gb: "memory = 100000000000.B"
mem200gb: "memory = 200000000000.B"
mem500gb: "memory = 500000000000.B"
mem1tb: "memory = 1000000000000.B"
mem2tb: "memory = 2000000000000.B"
mem5tb: "memory = 5000000000000.B"
mem10tb: "memory = 10000000000000.B"
mem20tb: "memory = 20000000000000.B"
mem50tb: "memory = 50000000000000.B"
mem100tb: "memory = 100000000000000.B"
mem200tb: "memory = 200000000000000.B"
mem500tb: "memory = 500000000000000.B"
mem1gib: "memory = 1073741824.B"
mem2gib: "memory = 2147483648.B"
mem4gib: "memory = 4294967296.B"
mem8gib: "memory = 8589934592.B"
mem16gib: "memory = 17179869184.B"
mem32gib: "memory = 34359738368.B"
mem64gib: "memory = 68719476736.B"
mem128gib: "memory = 137438953472.B"
mem256gib: "memory = 274877906944.B"
mem512gib: "memory = 549755813888.B"
mem1tib: "memory = 1099511627776.B"
mem2tib: "memory = 2199023255552.B"
mem4tib: "memory = 4398046511104.B"
mem8tib: "memory = 8796093022208.B"
mem16tib: "memory = 17592186044416.B"
mem32tib: "memory = 35184372088832.B"
mem64tib: "memory = 70368744177664.B"
mem128tib: "memory = 140737488355328.B"
mem256tib: "memory = 281474976710656.B"
mem512tib: "memory = 562949953421312.B"
cpu1: "cpus = 1"
cpu2: "cpus = 2"
cpu5: "cpus = 5"
cpu10: "cpus = 10"
cpu20: "cpus = 20"
cpu50: "cpus = 50"
cpu100: "cpus = 100"
cpu200: "cpus = 200"
cpu500: "cpus = 500"
cpu1000: "cpus = 1000"
debug: false
container: "docker"
engines:
- type: "docker"
id: "docker"
image: "python:3.12"
target_registry: "images.viash-hub.com"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "python"
user: false
pip:
- "cutadapt"
upgrade: true
- type: "docker"
run:
- "cutadapt --version | sed 's/\\(.*\\)/cutadapt: \"\\1\"/' > /var/software_versions.txt\n"
entrypoint: []
cmd: null
- type: "native"
id: "native"
build_info:
config: "src/cutadapt/config.vsh.yaml"
runner: "nextflow"
engine: "docker|native"
output: "target/nextflow/cutadapt"
executable: "target/nextflow/cutadapt/main.nf"
viash_version: "0.9.0-RC6"
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
git_remote: "https://github.com/viash-hub/biobox"
package_config:
name: "biobox"
version: "v0.1.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0-RC6"
source: "src"
target: "target"
config_mods:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "bioinformatics"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

Some files were not shown because too many files have changed in this diff Show More