Build branch main with version main (237a2e3)

Build pipeline: viash-hub.biobox.main-dqhhg

Source commit: 237a2e3a22

Source message: Fixes the typo raised in issue #132 (#157)

* Fixes the typo raised in issue #132

* Add changelog entry

* fix typo, modify script

---------

Co-authored-by: jakubmajercik <jakub.majercik@gmail.com>
This commit is contained in:
CI
2024-09-27 10:17:59 +00:00
parent 6a8cd85cf3
commit 99b76ba2a1
270 changed files with 11019 additions and 728 deletions

View File

@@ -9,6 +9,10 @@
* `rsem/rsem_calculate_expression`: Calculate expression levels (PR #93).
## BREAKING CHANGES
* `falco`: Fix a typo in the `--reverse_complement` argument (PR #157).
## MINOR CHANGES
* Upgrade to Viash 0.9.0.
@@ -75,6 +79,8 @@
- `kallisto_quant`: Quantifying abundances of transcripts from RNA-Seq data, or more generally of target sequences using high-throughput sequencing reads (PR #152).
* `trimgalore`: Quality and adapter trimming for fastq files (PR #117).
## MINOR CHANGES
* `busco` components: update BUSCO to `5.7.1` (PR #72).

View File

@@ -86,7 +86,7 @@ argument_groups:
bisulfite sequencing, and more Ts and fewer
Cs are therefore expected and will be
accounted for in base content.
- name: --reverse_complliment
- name: --reverse_complement
alternatives: [-r]
type: boolean_true
description: |

View File

@@ -4,7 +4,7 @@ set -eo pipefail
[[ "$par_nogroup" == "false" ]] && unset par_nogroup
[[ "$par_bisulfite" == "false" ]] && unset par_bisulfite
[[ "$par_reverse_compliment" == "false" ]] && unset par_reverse_compliment
[[ "$par_reverse_complement" == "false" ]] && unset par_reverse_complement
IFS=";" read -ra input <<< $par_input
@@ -15,7 +15,7 @@ $(which falco) \
${par_limits:+--limits "$par_limits"} \
${par_subsample:+-subsample $par_subsample} \
${par_bisulfite:+-bisulfite} \
${par_reverse_compliment:+-reverse-compliment} \
${par_reverse_complement:+-reverse-complement} \
${par_outdir:+--outdir "$par_outdir"} \
${par_format:+--format "$par_format"} \
${par_data_filename:+-data-filename "$par_data_filename"} \

View File

@@ -0,0 +1,297 @@
name: trimgalore
description: |
A wrapper tool around Cutadapt and FastQC to consistently apply quality and adapter trimming to FastQ files.
keywords: ["trimming", "adapters"]
links:
homepage: https://github.com/FelixKrueger/TrimGalore
documentation: https://github.com/FelixKrueger/TrimGalore/blob/master/Docs/Trim_Galore_User_Guide.md
repository: https://github.com/FelixKrueger/TrimGalore
references:
doi: 10.5281/zenodo.7598955
license: GPL-3.0
requirements:
commands: [trim_galore]
authors:
- __merge__: /src/_authors/sai_nirmayi_yasa.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Input
arguments:
- name: "--input"
type: file
description: Input files. Note that paired-end files need to be supplied in a pairwise fashion, e.g. file1_1.fq file1_2.fq SRR2_1.fq.gz SRR2_2.fq.gz
required: true
multiple: true
example: sample1_r1.fq;sample1_r2.fq;sample2_r1.fq;sample2_r2.fq
- name: Trimming options
arguments:
- name: --quality
alternatives: -q
type: integer
description: Trim low-quality ends (below the specified Phred score) from reads in addition to adapter removal. For RRBS samples, quality trimming will be performed first, and adapter trimming is carried in a second round. Other files are quality and adapter trimmed in a single pass. The algorithm is the same as the one used by BWA (Subtract INT from all qualities; compute partial sums from all indices to the end of the sequence; cut sequence at the index at which the sum is minimal).
example: 20
- name: --phred33
type: boolean_true
description: Instructs Cutadapt to use ASCII+33 quality scores as Phred scores (Sanger/Illumina 1.9+ encoding) for quality trimming.
- name: --phred64
type: boolean_true
description: Instructs Cutadapt to use ASCII+64 quality scores as Phred scores (Illumina 1.5 encoding) for quality trimming.
- name: --fastqc
type: boolean_true
description: Run FastQC in the default mode on the FastQ file once trimming is complete.
- name: --fastqc_args
type: string
description: Passes extra arguments (excluding files) to FastQC. If more than one argument is to be passed to FastQC they must be in the form "arg1 arg2 ...". Passing extra arguments will automatically invoke FastQC, so --fastqc does not have to be specified separately.
example: "--nogroup --noextract"
- name: --fastqc_contaminants
type: file
description: Specifies a non-default file which contains the list of contaminants for FastQC to screen overrepresented sequences against. The file must contain sets of named contaminants in the form name[tab]sequence. Lines prefixed with a hash will be ignored.
example: "contaminants.txt"
- name: --fastqc_adapters
type: file
description: Specifies a non-default file which contains the list of adapter sequences which which FasstQC will explicity search against the library. The file must contain sets of named adapters in the form name[tab]sequence. Lines prefixed with a hash will be ignored.
example: "adapters.txt"
- name: --fastqc_limits
type: file
description: Specifies a non-default file which contains a set of criteria which FastQC will use to determine the warn/error limits for the various modules. This file can also be used to selectively remove some modules from the output all together. The format needs to mirror the default limits.txt file found in the Configuration folder.
example: "limits.txt"
- name: --adapter
alternatives: -a
type: string
description: |
Adapter sequence to be trimmed. If not specified explicitly, Trim Galore will try to auto-detect whether the Illumina universal, Nextera transposase or Illumina small RNA adapter sequence was used. A single base may also be given as e.g. -a A{10}, to be expanded to -a AAAAAAAAAA.
At a special request, multiple adapters can also be specified like so:
-a " AGCTCCCG -a TTTCATTATAT -a TTTATTCGGATTTAT" -a2 " AGCTAGCG -a TCTCTTATAT -a TTTCGGATTTAT",
or so:
-a "file:../multiple_adapters.fa" -a2 "file:../different_adapters.fa"
Potentially in conjucntion with the parameter "-n 3" to trim all adapters.
example: AGCTCCCG
- name: --adapter2
alternatives: -a2
type: string
description: Optional adapter sequence to be trimmed off read 2 of paired-end files. This option requires '--paired' to be specified as well. If the libraries to be trimmed are smallRNA then a2 will be set to the Illumina small RNA 5' adapter automatically (GATCGTCGGACT). A single base may also be given as e.g. -a2 A{10}, to be expanded to -a2 AAAAAAAAAA.
required: false
example: AGCTCCCG
- name: --illumina
type: boolean_true
description: Adapter sequence to be trimmed is the first 13bp of the Illumina universal adapter 'AGATCGGAAGAGC' instead of the default auto-detection of adapter sequence.
- name: --stranded_illumina
type: boolean_true
description: Adapter sequence to be trimmed is the first 13bp of the Illumina stranded mRNA or Total RNA adapter 'ACTGTCTCTTATA' instead of the default auto-detection of adapter sequence.
- name: --nextera
type: boolean_true
description: Adapter sequence to be trimmed is the first 12bp of the Nextera adapter 'CTGTCTCTTATA' instead of the default auto-detection of adapter sequence.
- name: --small_rna
type: boolean_true
description: Adapter sequence to be trimmed is the first 12bp of the Illumina Small RNA 3' Adapter 'TGGAATTCTCGG' instead of the default auto-detection of adapter sequence. Selecting to trim smallRNA adapters will also lower the --length value to 18bp. If the smallRNA libraries are paired-end then a automatically (GATCGTCGGACT) unless -a 2 had been defined explicitly.
- name: --consider_already_trimmed
type: integer
description: During adapter auto-detection, the limit set by this argument allows the user to set a threshold up to which the file is considered already adapter-trimmed. If no adapter sequence exceeds this threshold, no additional adapter trimming will be performed (technically, the adapter is set to '-a X'). Quality trimming is still performed as usual.
required: false
- name: --max_length
type: integer
description: Discard reads that are longer than the specified value after trimming. This is only advised for smallRNA sequencing to remove non-small RNA sequences.
required: false
- name: --stringency
type: integer
description: Overlap with adapter sequence required to trim a sequence. Defaults to a very stringent setting of 1, i.e. even a single bp of overlapping sequence will be trimmed off from the 3' end of any read.
required: false
example: 1
- name: --error_rate
alternatives: -e
type: double
description: Maximum allowed error rate (no. of errors divided by the length of the matching region)
required: false
example: 0.1
- name: --gzip
type: boolean_true
description: Compress the output file with GZIP. If the input files are GZIP-compressed the output files will automatically be GZIP compressed as well. As of v0.2.8 the compression will take place on the fly.
- name: --dont_gzip
type: boolean_true
description: Output files won't be compressed with GZIP. This option overrides --gzip.
- name: --length
type: integer
description: Discard reads that became shorter than the specified length because of either quality or adapter trimming. A value of '0' effectively disables this behaviour. For paired-end files, both reads of a read-pair need to be longer than the specified length to be printed out to validated paired-end files. If only one read became too short there is the possibility of keeping such unpaired single-end reads using the --retain_unpaired option.
required: false
example: 20
- name: --max_n
type: integer
description: The total number of Ns a read may contain before it will be removed altogether.In a paired-end setting, either read exceeding this limit will result in the entire pair being removed from the trimmed output files. If COUNT is a number between 0 and 1, it is interpreted as a fraction of the read length.
required: false
- name: --trim_n
type: boolean_true
description: Removes Ns from either side of the read. This option does currently not work in RRBS mode.
- name: --no_report_file
type: boolean_true
description: If specified no report file will be generated.
- name: --suppress_warn
type: boolean_true
description: If specified any output to STDOUT or STDERR will be suppressed.
- name: --clip_R1
type: integer
description: Instructs TrimGalore to remove given number of bp from the 5' end of read 1 (or single-end reads). This may be useful if the qualities were very poor, or if there is some sort of unwanted bias at the 5' end.
required: false
- name: --clip_R2
type: integer
description: Instructs TrimGalore to remove given number bp from the 5' end of read 2 (paired-end reads only). This may be useful if the qualities were very poor, or if there is some sort of unwanted bias at the 5' end. For paired-end BS-Seq, it is recommended to remove the first few bp because the end-repair reaction may introduce a bias towards low methylation.
required: false
- name: --three_prime_clip_R1
type: integer
description: Instructs Trim Galore to remove spacified number of bp from the 3' end of read 1 (or single-end reads) AFTER adapter/quality trimming has been performed. This may remove some bias from the 3' end that is not directly related to adapter sequence or basecall quality.
required: false
- name: --three_prime_clip_R2
type: integer
description: Instructs Trim Galore to remove <int> bp from the 3' end of read 2 AFTER adapter/quality trimming has been performed. This may remove some unwanted bias from the 3' end that is not directly related to adapter sequence or basecall quality.
required: false
- name: --nextseq
type: integer
description: This enables the option '--nextseq-trim=3'CUTOFF' within Cutadapt, which will set a quality cutoff (that is normally given with -q instead), but qualities of G bases are ignored. This trimming is in common for the NextSeq- and NovaSeq-platforms, where basecalls without any signal are called as high-quality G bases. This is mutually exlusive with '-q INT'.
required: false
- name: --basename
type: string
description: Use specified name (PREFERRED_NAME) as the basename for output files, instead of deriving the filenames from the input files. Single-end data would be called PREFERRED_NAME_trimmed.fq(.gz), or PREFERRED_NAME_val_1.fq(.gz) and PREFERRED_NAME_val_2.fq(.gz) for paired-end data. --basename only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
required: false
- name: Specific trimming options without adapter/quality trimming
arguments:
- name: --hardtrim5
type: integer
description: Instead of performing adapter-/quality trimming, this option will simply hard-trim sequences to <int> bp at the 5'-end. Once hard-trimming of files is complete, Trim Galore will exit. Hard-trimmed output files will end in .<int>_5prime.fq(.gz).
required: false
- name: --hardtrim3
type: integer
description: Instead of performing adapter-/quality trimming, this option will simply hard-trim sequences to <int> bp at the 3'-end. Once hard-trimming of files is complete, Trim Galore will exit. Hard-trimmed output files will end in .<int>_3prime.fq(.gz).
required: false
- name: --clock
type: boolean_true
description: In this mode, reads are trimmed in a specific way that is currently used for the Mouse Epigenetic Clock.
- name: --polyA
type: boolean_true
description: This is a new, still experimental, trimming mode to identify and remove poly-A tails from sequences. When --polyA is selected, Trim Galore attempts to identify from the first supplied sample whether sequences contain more often a stretch of either 'AAAAAAAAAA' or 'TTTTTTTTTT'. This determines if Read 1 of a paired-end end file, or single-end files, are trimmed for PolyA or PolyT. In case of paired-end sequencing, Read2 is trimmed for the complementary base from the start of the reads. The auto-detection uses a default of A{20} for Read1 (3'-end trimming) and T{150} for Read2 (5'-end trimming). These values may be changed manually using the options -a and -a2. In addition to trimming the sequences, white spaces are replaced with _ and it records in the read ID how many bases were trimmed so it can later be used to identify PolyA trimmed sequences. This is currently done by writing tags to both the start ("32:A:") and end ("_PolyA:32") of the reads. The poly-A trimming mode expects that sequences were both adapter and quality before looking for Poly-A tails, and it is the user's responsibility to carry out an initial round of trimming.
- name: --implicon
type: boolean_true
description: |
This is a special mode of operation for paired-end data, such as required for the IMPLICON method, where a UMI sequence is getting transferred from the start of Read 2 to the readID of both reads. Following this, Trim Galore will exit. In it's current implementation, the UMI carrying reads come in the following format
Read 1 5' FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF 3'
Read 2 3' UUUUUUUUFFFFFFFFFFFFFFFFFFFFFFFFFFFF 5'
Where UUUUUUUU is a random 8-mer unique molecular identifier (UMI) and FFFFFFF... is the actual fragment to be sequenced. The UMI of Read 2 (R2) is written into the read ID of both reads and removed from the actual sequence.
- name: RRBS-specific options
arguments:
- name: --rrbs
type: boolean_true
description: Specifies that the input file was an MspI digested RRBS sample (recognition site is CCGG). Single-end or Read 1 sequences (paired-end) which were adapter-trimmed will have a further 2 bp removed from their 3' end. Sequences which were merely trimmed because of poor quality will not be shortened further. Read 2 of paired-end libraries will in addition have the first 2 bp removed from the 5' end (by setting '--clip_r2 2'). This is to avoid using artificial methylation calls from the filled-in cytosine positions close to the 3' MspI site in sequenced fragments. This option is not recommended for users of the Tecan Ovation RRBS Methyl-Seq with TrueMethyl oxBS 1-16 kit (see below).
- name: --non_directional
type: boolean_true
description: Selecting this option for non-directional RRBS libraries will screen quality-trimmed sequences for 'CAA' or 'CGA' at the start of the read and, if found, removes the first two basepairs. Like with the option '--rrbs' this avoids using cytosine positions that were filled-in during the end-repair step. '--non_directional' requires '--rrbs' to be specified as well. Note that this option does not set '--clip_r2 2' in paired-end mode.
- name: --keep
type: boolean_true
description: Keep the quality trimmed intermediate file.
- name: Paired-end specific options
arguments:
- name: --paired
type: boolean_true
description: This option performs length trimming of quality/adapter/RRBS trimmed reads for paired-end files. To pass the validation test, both sequences of a sequence pair are required to have a certain minimum length which is governed by the option --length (see above). If only one read passes this length threshold the other read can be rescued (see option --retain_unpaired). Using this option lets you discard too short read pairs without disturbing the sequence-by-sequence order of FastQ files which is required by many aligners. Trim Galore expects paired-end files to be supplied in a pairwise fashion, e.g. file1_1.fq file1_2.fq SRR2_1.fq.gz SRR2_2.fq.gz ... .
- name: --retain_unpaired
type: boolean_true
description: If only one of the two paired-end reads became too short, the longer read will be written to either '.unpaired_1.fq' or '.unpaired_2.fq' output files. The length cutoff for unpaired single-end reads is governed by the parameters -r1/--length_1 and -r2/--length_2.
- name: --length_1
alternatives: -r1
type: integer
description: Unpaired single-end read length cutoff needed for read 1 to be written to '.unpaired_1.fq' output file. These reads may be mapped in single-end mode.
example: 35
required: false
- name: --length_2
alternatives: -r2
type: integer
description: Unpaired single-end read length cutoff needed for read 2 to be written to '.unpaired_2.fq' output file. These reads may be mapped in single-end mode.
required: false
example: 35
- name: Output
arguments:
- name: --output_dir
alternatives: -o
type: file
description: If specified all output will be written to this directory instead of the current directory.
direction: output
required: true
default: trimmed_output
- name: --trimmed_r1
type: file
required: false
description: Output file for read 1. Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
example: read_1.fastq
- name: --trimmed_r2
type: file
required: false
description: Output file for read 2. Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
example: read_2.fastq
- name: --trimming_report_r1
type: file
required: false
description: Trimming report for read 1. Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
example: read_1.trimming_report.txt
- name: --trimming_report_r2
type: file
description: Trimming report for read 1. Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
required: false
example: read_2.trimming_report.txt
- name: --trimmed_fastqc_html_1
type: file
required: false
description: FastQC report for trimmed (single-end) reads (or read 1 for paired-end). Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
example: read_1.fastqc.html
- name: --trimmed_fastqc_html_2
type: file
description: FastQC report for trimmed reads (read2 for paired-end). Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
required: false
example: read_2.fastqc.html
- name: --trimmed_fastqc_zip_1
type: file
required: false
description: FastQC results for trimmed (single-end) reads (or read 1 for paired-end). Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
example: read_1.fastqc.zip
- name: --trimmed_fastqc_zip_2
type: file
description: FastQC results for trimmed reads (read2 for paired-end). Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
required: false
example: read_2.fastqc.zip
- name: --unpaired_r1
type: file
required: false
description: Output file for unpired read 1. Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
example: unpaired_read_1.fastq
- name: --unpaired_r2
type: file
required: false
description: Output file for unpaired read 2. Only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
direction: output
example: unpaired_read_2.fastq
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: quay.io/biocontainers/trim-galore:0.6.10--hdfd78af_0
setup:
- type: docker
run: |
echo "TrimGalore: `trim_galore --version | sed -n 's/.*version\s\+\([0-9]\+\.[0-9]\+\.[0-9]\+\).*/\1/p'`" > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

355
src/trimgalore/help.txt Normal file
View File

@@ -0,0 +1,355 @@
USAGE:
trim_galore [options] <filename(s)>
-h/--help Print this help message and exits.
-v/--version Print the version information and exits.
-q/--quality <INT> Trim low-quality ends from reads in addition to adapter removal. For
RRBS samples, quality trimming will be performed first, and adapter
trimming is carried in a second round. Other files are quality and adapter
trimmed in a single pass. The algorithm is the same as the one used by BWA
(Subtract INT from all qualities; compute partial sums from all indices
to the end of the sequence; cut sequence at the index at which the sum is
minimal). Default Phred score: 20.
--phred33 Instructs Cutadapt to use ASCII+33 quality scores as Phred scores
(Sanger/Illumina 1.9+ encoding) for quality trimming. Default: ON.
--phred64 Instructs Cutadapt to use ASCII+64 quality scores as Phred scores
(Illumina 1.5 encoding) for quality trimming.
--fastqc Run FastQC in the default mode on the FastQ file once trimming is complete.
--fastqc_args "<ARGS>" Passes extra arguments to FastQC. If more than one argument is to be passed
to FastQC they must be in the form "arg1 arg2 etc.". An example would be:
--fastqc_args "--nogroup --outdir /home/". Passing extra arguments will
automatically invoke FastQC, so --fastqc does not have to be specified
separately.
-a/--adapter <STRING> Adapter sequence to be trimmed. If not specified explicitly, Trim Galore will
try to auto-detect whether the Illumina universal, Nextera transposase or Illumina
small RNA adapter sequence was used. Also see '--illumina', '--nextera' and
'--small_rna'. If no adapter can be detected within the first 1 million sequences
of the first file specified or if there is a tie between several adapter sequences,
Trim Galore defaults to '--illumina' (as long as the Illumina adapter was one of the
options, else '--nextera' is the default). A single base
may also be given as e.g. -a A{10}, to be expanded to -a AAAAAAAAAA.
At a special request, multiple adapters can also be specified like so:
-a " AGCTCCCG -a TTTCATTATAT -a TTTATTCGGATTTAT"
-a2 " AGCTAGCG -a TCTCTTATAT -a TTTCGGATTTAT", or so:
-a "file:../multiple_adapters.fa"
-a2 "file:../different_adapters.fa"
Potentially in conjucntion with the parameter "-n 3" to trim all adapters. Please note
that this is NOT needed for standard trimming!
More Information here: https://github.com/FelixKrueger/TrimGalore/issues/86
-a2/--adapter2 <STRING> Optional adapter sequence to be trimmed off read 2 of paired-end files. This
option requires '--paired' to be specified as well. If the libraries to be trimmed
are smallRNA then a2 will be set to the Illumina small RNA 5' adapter automatically
(GATCGTCGGACT). A single base may also be given as e.g. -a2 A{10}, to be expanded
to -a2 AAAAAAAAAA.
--illumina Adapter sequence to be trimmed is the first 13bp of the Illumina universal adapter
'AGATCGGAAGAGC' instead of the default auto-detection of adapter sequence.
--stranded_illumina Adapter sequence to be trimmed is the first 13bp of the Illumina stranded mRNA or Total
RNA adapter 'ACTGTCTCTTATA' instead of the default auto-detection of adapter sequence.
Note that this sequence resembles the Nextera sequence with an additional A from A-tailing.
Please also see https://github.com/FelixKrueger/TrimGalore/issues/127 or
https://support.illumina.com/bulletins/2020/06/trimming-t-overhang-options-for-the-illumina-rna-library-prep-wo.html
for further information. This sequence is currently NOT included in the adapter auto-detection.
--nextera Adapter sequence to be trimmed is the first 12bp of the Nextera adapter
'CTGTCTCTTATA' instead of the default auto-detection of adapter sequence.
--small_rna Adapter sequence to be trimmed is the first 12bp of the Illumina Small RNA 3' Adapter
'TGGAATTCTCGG' instead of the default auto-detection of adapter sequence. Selecting
to trim smallRNA adapters will also lower the --length value to 18bp. If the smallRNA
libraries are paired-end then a2 will be set to the Illumina small RNA 5' adapter
automatically (GATCGTCGGACT) unless -a 2 had been defined explicitly.
--consider_already_trimmed <INT> During adapter auto-detection, the limit set by <INT> allows the user to
set a threshold up to which the file is considered already adapter-trimmed. If no adapter
sequence exceeds this threshold, no additional adapter trimming will be performed (technically,
the adapter is set to '-a X'). Quality trimming is still performed as usual.
Default: NOT SELECTED (i.e. normal auto-detection precedence rules apply).
--max_length <INT> Discard reads that are longer than <INT> bp after trimming. This is only advised for
smallRNA sequencing to remove non-small RNA sequences.
--stringency <INT> Overlap with adapter sequence required to trim a sequence. Defaults to a
very stringent setting of 1, i.e. even a single bp of overlapping sequence
will be trimmed off from the 3' end of any read.
-e <ERROR RATE> Maximum allowed error rate (no. of errors divided by the length of the matching
region) (default: 0.1)
--gzip Compress the output file with GZIP. If the input files are GZIP-compressed
the output files will automatically be GZIP compressed as well. As of v0.2.8 the
compression will take place on the fly.
--dont_gzip Output files won't be compressed with GZIP. This option overrides --gzip.
--length <INT> Discard reads that became shorter than length INT because of either
quality or adapter trimming. A value of '0' effectively disables
this behaviour. Default: 20 bp.
For paired-end files, both reads of a read-pair need to be longer than
<INT> bp to be printed out to validated paired-end files (see option --paired).
If only one read became too short there is the possibility of keeping such
unpaired single-end reads (see --retain_unpaired). Default pair-cutoff: 20 bp.
--max_n COUNT The total number of Ns a read may contain before it will be removed altogether.
In a paired-end setting, either read exceeding this limit will result in the entire
pair being removed from the trimmed output files. If COUNT is a number between 0 and 1,
it is interpreted as a fraction of the read length.
--trim-n Removes Ns from either side of the read. This option does currently not work in RRBS mode.
-o/--output_dir <DIR> If specified all output will be written to this directory instead of the current
directory. If the directory doesn't exist it will be created for you.
--no_report_file If specified no report file will be generated.
--suppress_warn If specified any output to STDOUT or STDERR will be suppressed.
--clip_R1 <int> Instructs Trim Galore to remove <int> bp from the 5' end of read 1 (or single-end
reads). This may be useful if the qualities were very poor, or if there is some
sort of unwanted bias at the 5' end. Default: OFF.
--clip_R2 <int> Instructs Trim Galore to remove <int> bp from the 5' end of read 2 (paired-end reads
only). This may be useful if the qualities were very poor, or if there is some sort
of unwanted bias at the 5' end. For paired-end BS-Seq, it is recommended to remove
the first few bp because the end-repair reaction may introduce a bias towards low
methylation. Please refer to the M-bias plot section in the Bismark User Guide for
some examples. Default: OFF.
--three_prime_clip_R1 <int> Instructs Trim Galore to remove <int> bp from the 3' end of read 1 (or single-end
reads) AFTER adapter/quality trimming has been performed. This may remove some unwanted
bias from the 3' end that is not directly related to adapter sequence or basecall quality.
Default: OFF.
--three_prime_clip_R2 <int> Instructs Trim Galore to remove <int> bp from the 3' end of read 2 AFTER
adapter/quality trimming has been performed. This may remove some unwanted bias from
the 3' end that is not directly related to adapter sequence or basecall quality.
Default: OFF.
--2colour/--nextseq INT This enables the option '--nextseq-trim=3'CUTOFF' within Cutadapt, which will set a quality
cutoff (that is normally given with -q instead), but qualities of G bases are ignored.
This trimming is in common for the NextSeq- and NovaSeq-platforms, where basecalls without
any signal are called as high-quality G bases. This is mutually exlusive with '-q INT'.
--path_to_cutadapt </path/to/cutadapt> You may use this option to specify a path to the Cutadapt executable,
e.g. /my/home/cutadapt-1.7.1/bin/cutadapt. Else it is assumed that Cutadapt is in
the PATH.
--basename <PREFERRED_NAME> Use PREFERRED_NAME as the basename for output files, instead of deriving the filenames from
the input files. Single-end data would be called PREFERRED_NAME_trimmed.fq(.gz), or
PREFERRED_NAME_val_1.fq(.gz) and PREFERRED_NAME_val_2.fq(.gz) for paired-end data. --basename
only works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
-j/--cores INT Number of cores to be used for trimming [default: 1]. For Cutadapt to work with multiple cores, it
requires Python 3 as well as parallel gzip (pigz) installed on the system. Trim Galore attempts to detect
the version of Python used by calling Cutadapt. If Python 2 is detected, --cores is set to 1. If the Python
version cannot be detected, Python 3 is assumed and we let Cutadapt handle potential issues itself.
If pigz cannot be detected on your system, Trim Galore reverts to using gzip compression. Please note
that gzip compression will slow down multi-core processes so much that it is hardly worthwhile, please
see: https://github.com/FelixKrueger/TrimGalore/issues/16#issuecomment-458557103 for more info).
Actual core usage: It should be mentioned that the actual number of cores used is a little convoluted.
Assuming that Python 3 is used and pigz is installed, --cores 2 would use 2 cores to read the input
(probably not at a high usage though), 2 cores to write to the output (at moderately high usage), and
2 cores for Cutadapt itself + 2 additional cores for Cutadapt (not sure what they are used for) + 1 core
for Trim Galore itself. So this can be up to 9 cores, even though most of them won't be used at 100% for
most of the time. Paired-end processing uses twice as many cores for the validation (= writing out) step.
--cores 4 would then be: 4 (read) + 4 (write) + 4 (Cutadapt) + 2 (extra Cutadapt) + 1 (Trim Galore) = 15.
It seems that --cores 4 could be a sweet spot, anything above has diminishing returns.
SPECIFIC TRIMMING - without adapter/quality trimming
--hardtrim5 <int> Instead of performing adapter-/quality trimming, this option will simply hard-trim sequences
to <int> bp at the 5'-end. Once hard-trimming of files is complete, Trim Galore will exit.
Hard-trimmed output files will end in .<int>_5prime.fq(.gz). Here is an example:
before: CCTAAGGAAACAAGTACACTCCACACATGCATAAAGGAAATCAAATGTTATTTTTAAGAAAATGGAAAAT
--hardtrim5 20: CCTAAGGAAACAAGTACACT
--hardtrim3 <int> Instead of performing adapter-/quality trimming, this option will simply hard-trim sequences
to <int> bp at the 3'-end. Once hard-trimming of files is complete, Trim Galore will exit.
Hard-trimmed output files will end in .<int>_3prime.fq(.gz). Here is an example:
before: CCTAAGGAAACAAGTACACTCCACACATGCATAAAGGAAATCAAATGTTATTTTTAAGAAAATGGAAAAT
--hardtrim3 20: TTTTTAAGAAAATGGAAAAT
--clock In this mode, reads are trimmed in a specific way that is currently used for the Mouse
Epigenetic Clock (see here: Multi-tissue DNA methylation age predictor in mouse, Stubbs et al.,
Genome Biology, 2017 18:68 https://doi.org/10.1186/s13059-017-1203-5). Following this, Trim Galore
will exit.
In it's current implementation, the dual-UMI RRBS reads come in the following format:
Read 1 5' UUUUUUUU CAGTA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF TACTG UUUUUUUU 3'
Read 2 3' UUUUUUUU GTCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF ATGAC UUUUUUUU 5'
Where UUUUUUUU is a random 8-mer unique molecular identifier (UMI), CAGTA is a constant region,
and FFFFFFF... is the actual RRBS-Fragment to be sequenced. The UMIs for Read 1 (R1) and
Read 2 (R2), as well as the fixed sequences (F1 or F2), are written into the read ID and
removed from the actual sequence. Here is an example:
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT
ATCTAGTTCAGTACGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG
R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT
CAATTTTGCAGTACAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT:R1:ATCTAGTT:R2:CAATTTTG:F1:CAGT:F2:CAGT
CGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG
R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT:R1:ATCTAGTT:R2:CAATTTTG:F1:CAGT:F2:CAGT
CAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA
Following clock trimming, the resulting files (.clock_UMI.R1.fq(.gz) and .clock_UMI.R2.fq(.gz))
should be adapter- and quality trimmed with Trim Galore as usual. In addition, reads need to be trimmed
by 15bp from their 3' end to get rid of potential UMI and fixed sequences. The command is:
trim_galore --paired --three_prime_clip_R1 15 --three_prime_clip_R2 15 *.clock_UMI.R1.fq.gz *.clock_UMI.R2.fq.gz
Following this, reads should be aligned with Bismark and deduplicated with UmiBam
in '--dual_index' mode (see here: https://github.com/FelixKrueger/Umi-Grinder). UmiBam recognises
the UMIs within this pattern: R1:(ATCTAGTT):R2:(CAATTTTG): as (UMI R1) and (UMI R2).
--polyA This is a new, still experimental, trimming mode to identify and remove poly-A tails from sequences.
When --polyA is selected, Trim Galore attempts to identify from the first supplied sample whether
sequences contain more often a stretch of either 'AAAAAAAAAA' or 'TTTTTTTTTT'. This determines
if Read 1 of a paired-end end file, or single-end files, are trimmed for PolyA or PolyT. In case of
paired-end sequencing, Read2 is trimmed for the complementary base from the start of the reads. The
auto-detection uses a default of A{20} for Read1 (3'-end trimming) and T{150} for Read2 (5'-end trimming).
These values may be changed manually using the options -a and -a2.
In addition to trimming the sequences, white spaces are replaced with _ and it records in the read ID
how many bases were trimmed so it can later be used to identify PolyA trimmed sequences. This is currently done
by writing tags to both the start ("32:A:") and end ("_PolyA:32") of the reads in the following example:
@READ-ID:1:1102:22039:36996 1:N:0:CCTAATCC
GCCTAAGGAAACAAGTACACTCCACACATGCATAAAGGAAATCAAATGTTATTTTTAAGAAAATGGAAAATAAAAACTTTATAAACACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
@32:A:READ-ID:1:1102:22039:36996_1:N:0:CCTAATCC_PolyA:32
GCCTAAGGAAACAAGTACACTCCACACATGCATAAAGGAAATCAAATGTTATTTTTAAGAAAATGGAAAATAAAAACTTTATAAACACC
PLEASE NOTE: The poly-A trimming mode expects that sequences were both adapter and quality trimmed
before looking for Poly-A tails, and it is the user's responsibility to carry out an initial round of
trimming. The following sequence:
1) trim_galore file.fastq.gz
2) trim_galore --polyA file_trimmed.fq.gz
3) zcat file_trimmed_trimmed.fq.gz | grep -A 3 PolyA | grep -v ^-- > PolyA_trimmed.fastq
Will 1) trim qualities and Illumina adapter contamination, 2) find and remove PolyA contamination.
Finally, if desired, 3) will specifically find PolyA trimmed sequences to a specific FastQ file of your choice.
--implicon This is a special mode of operation for paired-end data, such as required for the IMPLICON method, where a UMI sequence
is getting transferred from the start of Read 2 to the readID of both reads. Following this, Trim Galore will exit.
In it's current implementation, the UMI carrying reads come in the following format:
Read 1 5' FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF 3'
Read 2 3' UUUUUUUUFFFFFFFFFFFFFFFFFFFFFFFFFFFF 5'
Where UUUUUUUU is a random 8-mer unique molecular identifier (UMI) and FFFFFFF... is the actual fragment to be
sequenced. The UMI of Read 2 (R2) is written into the read ID of both reads and removed from the actual sequence.
Here is an example:
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT
ATCTAGTTCAGTACGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG
R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT
CAATTTTGCAGTACAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA
After --implicon trimming:
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT:CAATTTTG
ATCTAGTTCAGTACGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG
R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT:CAATTTTG
CAGTACAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA
RRBS-specific options (MspI digested material):
--rrbs Specifies that the input file was an MspI digested RRBS sample (recognition
site: CCGG). Single-end or Read 1 sequences (paired-end) which were adapter-trimmed
will have a further 2 bp removed from their 3' end. Sequences which were merely
trimmed because of poor quality will not be shortened further. Read 2 of paired-end
libraries will in addition have the first 2 bp removed from the 5' end (by setting
'--clip_r2 2'). This is to avoid using artificial methylation calls from the filled-in
cytosine positions close to the 3' MspI site in sequenced fragments.
This option is not recommended for users of the Tecan Ovation RRBS Methyl-Seq with TrueMethyl
oxBS 1-16 kit (see below).
--non_directional Selecting this option for non-directional RRBS libraries will screen
quality-trimmed sequences for 'CAA' or 'CGA' at the start of the read
and, if found, removes the first two basepairs. Like with the option
'--rrbs' this avoids using cytosine positions that were filled-in
during the end-repair step. '--non_directional' requires '--rrbs' to
be specified as well. Note that this option does not set '--clip_r2 2' in
paired-end mode.
--keep Keep the quality trimmed intermediate file. Default: off, which means
the temporary file is being deleted after adapter trimming. Only has
an effect for RRBS samples since other FastQ files are not trimmed
for poor qualities separately.
Note for RRBS using the Tecan Ovation RRBS Methyl-Seq with TrueMethyl oxBS 1-16 kit:
Owing to the fact that the Tecan Ovation RRBS kit attaches a varying number of nucleotides (0-3) after each MspI
site Trim Galore should be run WITHOUT the option --rrbs. This trimming is accomplished in a subsequent
diversity trimming step afterwards (see their manual).
Note for RRBS using MseI:
If your DNA material was digested with MseI (recognition motif: TTAA) instead of MspI it is NOT necessary
to specify --rrbs or --non_directional since virtually all reads should start with the sequence
'TAA', and this holds true for both directional and non-directional libraries. As the end-repair of 'TAA'
restricted sites does not involve any cytosines it does not need to be treated especially. Instead, simply
run Trim Galore! in the standard (i.e. non-RRBS) mode.
Paired-end specific options:
--paired This option performs length trimming of quality/adapter/RRBS trimmed reads for
paired-end files. To pass the validation test, both sequences of a sequence pair
are required to have a certain minimum length which is governed by the option
--length (see above). If only one read passes this length threshold the
other read can be rescued (see option --retain_unpaired). Using this option lets
you discard too short read pairs without disturbing the sequence-by-sequence order
of FastQ files which is required by many aligners.
Trim Galore! expects paired-end files to be supplied in a pairwise fashion, e.g.
file1_1.fq file1_2.fq SRR2_1.fq.gz SRR2_2.fq.gz ... .
--retain_unpaired If only one of the two paired-end reads became too short, the longer
read will be written to either '.unpaired_1.fq' or '.unpaired_2.fq'
output files. The length cutoff for unpaired single-end reads is
governed by the parameters -r1/--length_1 and -r2/--length_2. Default: OFF.
-r1/--length_1 <INT> Unpaired single-end read length cutoff needed for read 1 to be written to
'.unpaired_1.fq' output file. These reads may be mapped in single-end mode.
Default: 35 bp.
-r2/--length_2 <INT> Unpaired single-end read length cutoff needed for read 2 to be written to
'.unpaired_2.fq' output file. These reads may be mapped in single-end mode.
Default: 35 bp.
Last modified on 02 02 2023.

126
src/trimgalore/script.sh Executable file
View File

@@ -0,0 +1,126 @@
#!/bin/bash
set -eo pipefail
[[ ! -d $output_dir ]] && mkdir -p $par_output_dir
IFS=";" read -ra input <<< $par_input
unset_if_false=(
par_phred33
par_phred64
par_fastqc
par_illumina
par_stranded_illumina
par_nextera
par_small_rna
par_gzip
par_dont_gzip
par_trim_n
par_no_report_file
par_suppress_warn
par_clock
par_polyA
par_implicon
par_rrbs
par_non_directional
par_keep
par_paired
par_retain_unpaired
)
for par in ${unset_if_false[@]}; do
test_val="${!par}"
[[ "$test_val" == "false" ]] && unset $par
done
# Add FastQC file arguments to fastqc_args
fastqc_args="${par_fastqc_args}"
if [ -f "$par_fastqc_contaminants" ]; then
fastqc_args+=" --contaminants $par_fastqc_contaminants"
fi
if [ -f "$par_fastqc_adapters" ]; then
fastqc_args+=" --adapters $par_fastqc_adapters"
fi
if [ -f "$par_fastqc_limits" ]; then
fastqc_args+=" --limits $par_fastqc_limits"
fi
trim_galore \
${par_quality:+-q "${par_quality}"} \
${par_phred33:+--phred33} \
${par_phred64:+--phred64 } \
${par_fastqc:+--fastqc } \
${fastqc_args:+--fastqc_args "${fastqc_args}"} \
${par_adapter:+-a "${par_adapter}"} \
${par_adapter2:+-a2 "${par_adapter2}"} \
${par_illumina:+--illumina} \
${par_stranded_illumina:+--stranded_illumina} \
${par_nextera:+--nextera} \
${par_small_rna:+--small_rna} \
${par_consider_already_trimmed:+--consider_already_trimmed "${par_consider_already_trimmed}"} \
${par_max_length:+--max_length "${par_max_length}"} \
${par_stringency:+--stringency "${par_stringency}"} \
${par_error_rate:+-e "${par_error_rate}"} \
${par_gzip:+--gzip} \
${par_dont_gzip:+--dont_gzip} \
${par_length:+--length "${par_length}"} \
${par_max_n:+--max_n "${par_max_n}"} \
${par_trim_n:+--trim-n "${par_trim_n}"} \
${par_no_report_file:+--no_report_file} \
${par_suppress_warn:+--suppress_warn} \
${par_clip_R1:+--clip_R1 "${par_clip_R1}"} \
${par_clip_R2:+--clip_R2 "${par_clip_R2}"} \
${par_three_prime_clip_R1:+--three_prime_clip_R1 "${par_three_prime_clip_R1}"} \
${par_three_prime_clip_R2:+--three_prime_clip_R2 "${par_three_prime_clip_R2}"} \
${par_nextseq:+--nextseq "${par_nextseq}"} \
${par_basename:+-basename "${par_basename}"} \
${par_hardtrim5:+--hardtrim5 "${par_hardtrim5}"} \
${par_hardtrim3:+--hardtrim3 "${par_hardtrim3}"} \
${par_clock:+--clock} \
${par_polyA:+--polyA} \
${par_implicon:+--implicon "${par_implicon}"} \
${par_rrbs:+--rrbs} \
${par_non_directional:+--non_directional} \
${par_keep:+--keep} \
${par_paired:+--paired} \
${par_retain_unpaired:+--retain_unpaired} \
${par_length_1:+-r1 "${par_length_1}"} \
${par_length_2:+-r2 "${par_length_2}"} \
${meta_cpus:+-j "${meta_cpus}"} \
-o $par_output_dir \
${input[*]}
if [ $par_paired == "true" ]; then
input_r1=$(basename -- "${input[0]}")
input_r2=$(basename -- "${input[1]}")
[[ ! -z "$par_trimmed_r1" ]] && mv $par_output_dir/*val_1.f*q* $par_trimmed_r1
[[ ! -z "$par_trimmed_r2" ]] && mv $par_output_dir/*val_2.f*q* $par_trimmed_r2
[[ ! -z "$par_trimming_report_r1" ]] && mv $par_output_dir/${input_r1}_trimming_report.txt $par_trimming_report_r1
[[ ! -z "$par_trimming_report_r2" ]] && mv $par_output_dir/${input_r2}_trimming_report.txt $par_trimming_report_r2
if [ "$par_fastqc" == "true" ]; then
[[ ! -z "$par_trimmed_fastqc_html_1" ]] && mv $par_output_dir/*val_1_fastqc.html $par_trimmed_fastqc_html_1
[[ ! -z "$par_trimmed_fastqc_html_2" ]] && mv $par_output_dir/*val_2_fastqc.html $par_trimmed_fastqc_html_2
[[ ! -z "$par_trimmed_fastqc_zip_1" ]] && mv $par_output_dir/*val_1_fastqc.zip $par_trimmed_fastqc_zip_1
[[ ! -z "$par_trimmed_fastqc_zip_2" ]] && mv $par_output_dir/*val_2_fastqc.zip $par_trimmed_fastqc_zip_2
fi
if [ "$par_retain_unpaired" == "true" ]; then
[[ ! -z "$par_unpaired_r1" ]] && mv $par_output_dir/*.unpaired_1.f*q* $par_unpaired_r1
[[ ! -z "$par_unpaired_r2" ]] && mv $par_output_dir/*.unpaired_2.f*q* $par_unpaired_r2
fi
else
input_r1=$(basename -- "${input[0]}")
[[ ! -z "$par_trimmed_r1" ]] && mv $par_output_dir/*_trimmed.fq* $par_trimmed_r1
[[ ! -z "$par_trimming_report_r1" ]] && mv $par_output_dir/${input_r1}_trimming_report.txt $par_trimming_report_r1
if [ "$par_fastqc" == "true" ]; then
[[ ! -z "$par_trimmed_fastqc_html_1" ]] && mv $par_output_dir/*_trimmed_fastqc.html $par_trimmed_fastqc_html_1
[[ ! -z "$par_trimmed_fastqc_zip_1" ]] && mv $par_output_dir/*_trimmed_fastqc.zip $par_trimmed_fastqc_zip_1
fi
fi

125
src/trimgalore/test.sh Normal file
View File

@@ -0,0 +1,125 @@
#!/bin/bash
set -eo pipefail
# helper functions
assert_file_exists() {
[ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
}
assert_file_doesnt_exist() {
[ ! -f "$1" ] || { echo "File '$1' exists but shouldn't" && exit 1; }
}
assert_file_empty() {
[ ! -s "$1" ] || { echo "File '$1' is not empty but should be" && exit 1; }
}
assert_file_not_empty() {
[ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
}
assert_file_contains() {
grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
}
assert_file_not_contains() {
grep -q "$2" "$1" && { echo "File '$1' contains '$2' but shouldn't" && exit 1; }
}
#################################################################
echo ">>> Prepare test data"
cat > example_R1.fastq <<'EOF'
@SRR6357071.22842410 22842410/1 kraken:taxid|4932
CAAGTTTTCATCTTCAACAGCTGATTGACTTCTTTGTGGTATGCCTCGATATATTTTTCTTTTTCTTTAATATCTTTATTATAGGTGATTGCCTCATCGTA
+
BBBBBFFFFFFFFFFFFFFF/BFFFFFFFFFFFFFFFFBFFBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFFBF<
@SRR6357071.52260105 52260105/1 kraken:taxid|4932
TAGACTTACCAGTACCCTTTTCGACGGCGGAAACATTCAAAATACCGTTAGAGTCGACATCGAAAGTGACTTCAATTTGTGGGACACCTCTTGGAGCTGGT
+
BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF/FFFFFFFFFFFFFFFF
EOF
cat > example_R2.fastq <<'EOF'
@SRR6357071.22842410 22842410/2 kraken:taxid|4932
CCGAGATCGAAGAAACGAATTCACCTGATTGCAGCTGTAAAAGCAGTAAAATCAATCAAACCAATACGGACAACCTTACGATACGATGAGGCAATCACCTA
+
BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@SRR6357071.52260105 52260105/2 kraken:taxid|4932
GTTGATTCCAAGAAACTCTACCATTCCAACTAAGAAATCCGAAGTTTTCTCTACTTATGCTGACAACCAACCAGGTGTCTTGATTCAAGTCTTTGAAGGTG
+
BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
EOF
#################################################################
echo ">>> Testing for single-end reads"
"$meta_executable" \
--input "example_R1.fastq" \
--trimmed_fastqc_html_1 output_se_test/example.trimmed.html \
--trimmed_fastqc_zip_1 output_se_test/example.trimmed.zip \
--trimmed_r1 output_se_test/example.trimmed.fastq \
--trimming_report_r1 output_se_test/example.trimming_report.txt \
--fastqc \
--output_dir output_se_test
echo ">> Checking output"
assert_file_exists "output_se_test/example.trimmed.html"
assert_file_exists "output_se_test/example.trimmed.zip"
assert_file_exists "output_se_test/example.trimmed.fastq"
assert_file_exists "output_se_test/example.trimming_report.txt"
echo ">> Check if output is empty"
assert_file_not_empty "output_se_test/example.trimmed.html"
assert_file_not_empty "output_se_test/example.trimmed.zip"
assert_file_not_empty "output_se_test/example.trimmed.fastq"
assert_file_not_empty "output_se_test/example.trimming_report.txt"
echo ">> Check contents"
assert_file_contains "output_se_test/example.trimmed.fastq" "@SRR6357071.22842410 22842410/1"
assert_file_contains "output_se_test/example.trimming_report.txt" "Sequences removed because they became shorter than the length cutoff"
#################################################################
echo ">>> Testing for paired-end reads"
"$meta_executable" \
--paired \
--input "example_R1.fastq;example_R2.fastq" \
--trimmed_fastqc_html_1 output_pe_test/example_R1.trimmed.html \
--trimmed_fastqc_html_2 output_pe_test/example_R2.trimmed.html \
--trimmed_fastqc_zip_1 output_pe_test/example_R1.trimmed.zip \
--trimmed_fastqc_zip_2 output_pe_test/example_R2.trimmed.zip \
--trimmed_r1 output_pe_test/example_R1.trimmed.fastq \
--trimmed_r2 output_pe_test/example_R2.trimmed.fastq \
--trimming_report_r1 output_pe_test/example_R1.trimming_report.txt \
--trimming_report_r2 output_pe_test/example_R2.trimming_report.txt \
--fastqc \
--output_dir output_pe_test
echo ">> Checking output"
assert_file_exists "output_pe_test/example_R1.trimmed.html"
assert_file_exists "output_pe_test/example_R2.trimmed.html"
assert_file_exists "output_pe_test/example_R1.trimmed.zip"
assert_file_exists "output_pe_test/example_R2.trimmed.zip"
assert_file_exists "output_pe_test/example_R1.trimmed.fastq"
assert_file_exists "output_pe_test/example_R2.trimmed.fastq"
assert_file_exists "output_pe_test/example_R1.trimming_report.txt"
assert_file_exists "output_pe_test/example_R2.trimming_report.txt"
echo ">> Check if output is empty"
assert_file_not_empty "output_pe_test/example_R1.trimmed.html"
assert_file_not_empty "output_pe_test/example_R2.trimmed.html"
assert_file_not_empty "output_pe_test/example_R1.trimmed.zip"
assert_file_not_empty "output_pe_test/example_R2.trimmed.zip"
assert_file_not_empty "output_pe_test/example_R1.trimmed.fastq"
assert_file_not_empty "output_pe_test/example_R2.trimmed.fastq"
assert_file_not_empty "output_pe_test/example_R1.trimming_report.txt"
assert_file_not_empty "output_pe_test/example_R2.trimming_report.txt"
echo ">> Check contents"
assert_file_contains "output_pe_test/example_R1.trimmed.fastq" "@SRR6357071.22842410 22842410/1"
assert_file_contains "output_pe_test/example_R2.trimmed.fastq" "@SRR6357071.22842410 22842410/2"
assert_file_contains "output_pe_test/example_R1.trimming_report.txt" "sequences processed in total"
assert_file_contains "output_pe_test/example_R2.trimming_report.txt" "Number of sequence pairs removed because at least one read was shorter than the length cutoff"
#################################################################
echo ">>> Test finished successfully"
exit 0

View File

@@ -235,9 +235,9 @@ build_info:
output: "target/executable/agat/agat_convert_bed2gff"
executable: "target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -515,9 +515,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
LABEL org.opencontainers.image.authors="Leïla Paquay"
LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_bed2gff"
LABEL org.opencontainers.image.created="2024-09-19T03:54:22Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:19Z"
LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -225,9 +225,9 @@ build_info:
output: "target/executable/agat/agat_convert_embl2gff"
executable: "target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -505,9 +505,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
LABEL org.opencontainers.image.authors="Leïla Paquay"
LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_embl2gff"
LABEL org.opencontainers.image.created="2024-09-19T03:54:22Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:19Z"
LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -230,9 +230,9 @@ build_info:
output: "target/executable/agat/agat_convert_genscan2gff"
executable: "target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -514,9 +514,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
LABEL org.opencontainers.image.authors="Leïla Paquay"
LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_genscan2gff"
LABEL org.opencontainers.image.created="2024-09-19T03:54:23Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:20Z"
LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -228,9 +228,9 @@ build_info:
output: "target/executable/agat/agat_convert_sp_gff2gtf"
executable: "target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -519,9 +519,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
LABEL org.opencontainers.image.authors="Leïla Paquay"
LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2gtf"
LABEL org.opencontainers.image.created="2024-09-19T03:54:22Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:20Z"
LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -188,9 +188,9 @@ build_info:
output: "target/executable/agat/agat_convert_sp_gff2tsv"
executable: "target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -484,9 +484,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
LABEL org.opencontainers.image.authors="Leïla Paquay"
LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2tsv"
LABEL org.opencontainers.image.created="2024-09-19T03:54:21Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:19Z"
LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -195,9 +195,9 @@ build_info:
output: "target/executable/agat/agat_convert_sp_gxf2gxf"
executable: "target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -493,9 +493,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t
LABEL org.opencontainers.image.authors="Leïla Paquay"
LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gxf2gxf"
LABEL org.opencontainers.image.created="2024-09-19T03:54:21Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:18Z"
LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -706,9 +706,9 @@ build_info:
output: "target/executable/arriba"
executable: "target/executable/arriba/arriba"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -754,9 +754,9 @@ RUN arriba -h | grep 'Version:' 2>&1 | sed 's/Version:\s\(.*\)/arriba: "\1"/' >
LABEL org.opencontainers.image.authors="Robrecht Cannoodt"
LABEL org.opencontainers.image.description="Companion container for running component arriba"
LABEL org.opencontainers.image.created="2024-09-19T03:54:24Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:22Z"
LABEL org.opencontainers.image.source="https://github.com/suhrig/arriba"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -469,9 +469,9 @@ build_info:
output: "target/executable/bcftools/bcftools_annotate"
executable: "target/executable/bcftools/bcftools_annotate/bcftools_annotate"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -650,9 +650,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_annotate"
LABEL org.opencontainers.image.created="2024-09-19T03:54:15Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:11Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -335,9 +335,9 @@ build_info:
output: "target/executable/bcftools/bcftools_concat"
executable: "target/executable/bcftools/bcftools_concat/bcftools_concat"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -566,9 +566,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_concat"
LABEL org.opencontainers.image.created="2024-09-19T03:54:15Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:12Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -416,9 +416,9 @@ build_info:
output: "target/executable/bcftools/bcftools_norm"
executable: "target/executable/bcftools/bcftools_norm/bcftools_norm"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -589,9 +589,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_norm"
LABEL org.opencontainers.image.created="2024-09-19T03:54:16Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:13Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -185,9 +185,9 @@ build_info:
output: "target/executable/bcftools/bcftools_sort"
executable: "target/executable/bcftools/bcftools_sort/bcftools_sort"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -483,9 +483,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_sort"
LABEL org.opencontainers.image.created="2024-09-19T03:54:14Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:11Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -458,9 +458,9 @@ build_info:
output: "target/executable/bcftools/bcftools_stats"
executable: "target/executable/bcftools/bcftools_stats/bcftools_stats"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -626,9 +626,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_stats"
LABEL org.opencontainers.image.created="2024-09-19T03:54:15Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:12Z"
LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -418,9 +418,9 @@ build_info:
output: "target/executable/bcl_convert"
executable: "target/executable/bcl_convert/bcl_convert"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -599,9 +599,9 @@ RUN echo "bcl-convert: \"$(bcl-convert -V 2>&1 >/dev/null | sed -n '/Version/ s/
LABEL org.opencontainers.image.authors="Toni Verbeiren, Dorien Roosen"
LABEL org.opencontainers.image.description="Companion container for running component bcl_convert"
LABEL org.opencontainers.image.created="2024-09-19T03:54:23Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:21Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -274,9 +274,9 @@ build_info:
output: "target/executable/bd_rhapsody/bd_rhapsody_make_reference"
executable: "target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -554,9 +554,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1)
RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt
LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz"
LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_make_reference"
LABEL org.opencontainers.image.created="2024-09-19T03:54:27Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:26Z"
LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1/Extra_Utilities/"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -1115,9 +1115,9 @@ build_info:
output: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis"
executable: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -954,9 +954,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1)
RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt
LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz"
LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_sequence_analysis"
LABEL org.opencontainers.image.created="2024-09-19T03:54:27Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:25Z"
LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -187,9 +187,9 @@ build_info:
output: "target/executable/bedtools/bedtools_bamtofastq"
executable: "target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -483,9 +483,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bamtofastq"
LABEL org.opencontainers.image.created="2024-09-19T03:54:07Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:04Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -176,9 +176,9 @@ build_info:
output: "target/executable/bedtools/bedtools_bed12tobed6"
executable: "target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -480,9 +480,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bed12tobed6"
LABEL org.opencontainers.image.created="2024-09-19T03:54:06Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:02Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -214,9 +214,9 @@ build_info:
output: "target/executable/bedtools/bedtools_bedtobam"
executable: "target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -496,9 +496,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bedtobam"
LABEL org.opencontainers.image.created="2024-09-19T03:54:08Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:05Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -337,9 +337,9 @@ build_info:
output: "target/executable/bedtools/bedtools_genomecov"
executable: "target/executable/bedtools/bedtools_genomecov/bedtools_genomecov"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -591,9 +591,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_genomecov"
LABEL org.opencontainers.image.created="2024-09-19T03:54:06Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:02Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -232,9 +232,9 @@ build_info:
output: "target/executable/bedtools/bedtools_getfasta"
executable: "target/executable/bedtools/bedtools_getfasta/bedtools_getfasta"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -526,9 +526,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Dries Schaumont"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_getfasta"
LABEL org.opencontainers.image.created="2024-09-19T03:54:06Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:02Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -273,9 +273,9 @@ build_info:
output: "target/executable/bedtools/bedtools_groupby"
executable: "target/executable/bedtools/bedtools_groupby/bedtools_groupby"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -552,9 +552,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_groupby"
LABEL org.opencontainers.image.created="2024-09-19T03:54:08Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:04Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -410,9 +410,9 @@ build_info:
output: "target/executable/bedtools/bedtools_intersect"
executable: "target/executable/bedtools/bedtools_intersect/bedtools_intersect"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -633,9 +633,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_intersect"
LABEL org.opencontainers.image.created="2024-09-19T03:54:07Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:03Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -210,9 +210,9 @@ build_info:
output: "target/executable/bedtools/bedtools_links"
executable: "target/executable/bedtools/bedtools_links/bedtools_links"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -500,9 +500,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_links"
LABEL org.opencontainers.image.created="2024-09-19T03:54:07Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:03Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -279,9 +279,9 @@ build_info:
output: "target/executable/bedtools/bedtools_merge"
executable: "target/executable/bedtools/bedtools_merge/bedtools_merge"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -558,9 +558,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_merge"
LABEL org.opencontainers.image.created="2024-09-19T03:54:05Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:01Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -222,9 +222,9 @@ build_info:
output: "target/executable/bedtools/bedtools_sort"
executable: "target/executable/bedtools/bedtools_sort/bedtools_sort"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -509,9 +509,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_sort"
LABEL org.opencontainers.image.created="2024-09-19T03:54:08Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:04Z"
LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -158,9 +158,9 @@ build_info:
output: "target/executable/busco/busco_download_datasets"
executable: "target/executable/busco/busco_download_datasets/busco_download_datasets"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -475,9 +475,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version
LABEL org.opencontainers.image.authors="Dorien Roosen"
LABEL org.opencontainers.image.description="Companion container for running component busco busco_download_datasets"
LABEL org.opencontainers.image.created="2024-09-19T03:54:19Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:16Z"
LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -145,9 +145,9 @@ build_info:
output: "target/executable/busco/busco_list_datasets"
executable: "target/executable/busco/busco_list_datasets/busco_list_datasets"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -465,9 +465,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version
LABEL org.opencontainers.image.authors="Dorien Roosen"
LABEL org.opencontainers.image.description="Companion container for running component busco busco_list_datasets"
LABEL org.opencontainers.image.created="2024-09-19T03:54:19Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:16Z"
LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -423,9 +423,9 @@ build_info:
output: "target/executable/busco/busco_run"
executable: "target/executable/busco/busco_run/busco_run"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -632,9 +632,9 @@ RUN busco --version | sed 's/BUSCO\s\(.*\)/busco: "\1"/' > /var/software_version
LABEL org.opencontainers.image.authors="Dorien Roosen"
LABEL org.opencontainers.image.description="Companion container for running component busco busco_run"
LABEL org.opencontainers.image.created="2024-09-19T03:54:19Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:16Z"
LABEL org.opencontainers.image.source="https://gitlab.com/ezlab/busco"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -740,9 +740,9 @@ build_info:
output: "target/executable/cutadapt"
executable: "target/executable/cutadapt/cutadapt"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -831,9 +831,9 @@ RUN cutadapt --version | sed 's/\(.*\)/cutadapt: "\1"/' > /var/software_versions
LABEL org.opencontainers.image.authors="Toni Verbeiren"
LABEL org.opencontainers.image.description="Companion container for running component cutadapt"
LABEL org.opencontainers.image.created="2024-09-19T03:54:25Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:24Z"
LABEL org.opencontainers.image.source="https://github.com/marcelm/cutadapt"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -101,7 +101,7 @@ argument_groups:
info: null
direction: "input"
- type: "boolean_true"
name: "--reverse_complliment"
name: "--reverse_complement"
alternatives:
- "-r"
description: "[Falco only] The input is a \nreverse-complement. All modules will\
@@ -317,9 +317,9 @@ build_info:
output: "target/executable/falco"
executable: "target/executable/falco/falco"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -243,7 +243,7 @@ function ViashHelp {
echo " Cs are therefore expected and will be"
echo " accounted for in base content."
echo ""
echo " -r, --reverse_complliment"
echo " -r, --reverse_complement"
echo " type: boolean_true"
echo " [Falco only] The input is a"
echo " reverse-complement. All modules will be"
@@ -589,9 +589,9 @@ RUN echo "falco: \"$(falco -v | sed -n 's/^falco //p')\"" > /var/software_versio
LABEL org.opencontainers.image.authors="Toni Verbeiren"
LABEL org.opencontainers.image.description="Companion container for running component falco"
LABEL org.opencontainers.image.created="2024-09-19T03:54:26Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:25Z"
LABEL org.opencontainers.image.source="https://github.com/smithlabcode/falco"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER
@@ -813,14 +813,14 @@ while [[ $# -gt 0 ]]; do
VIASH_PAR_BISULFITE=true
shift 1
;;
--reverse_complliment)
[ -n "$VIASH_PAR_REVERSE_COMPLLIMENT" ] && ViashError Bad arguments for option \'--reverse_complliment\': \'$VIASH_PAR_REVERSE_COMPLLIMENT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_REVERSE_COMPLLIMENT=true
--reverse_complement)
[ -n "$VIASH_PAR_REVERSE_COMPLEMENT" ] && ViashError Bad arguments for option \'--reverse_complement\': \'$VIASH_PAR_REVERSE_COMPLEMENT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_REVERSE_COMPLEMENT=true
shift 1
;;
-r)
[ -n "$VIASH_PAR_REVERSE_COMPLLIMENT" ] && ViashError Bad arguments for option \'-r\': \'$VIASH_PAR_REVERSE_COMPLLIMENT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_REVERSE_COMPLLIMENT=true
[ -n "$VIASH_PAR_REVERSE_COMPLEMENT" ] && ViashError Bad arguments for option \'-r\': \'$VIASH_PAR_REVERSE_COMPLEMENT\' \& \'$2\' - you should provide exactly one argument for this option. && exit 1
VIASH_PAR_REVERSE_COMPLEMENT=true
shift 1
;;
--outdir)
@@ -1120,8 +1120,8 @@ fi
if [ -z ${VIASH_PAR_BISULFITE+x} ]; then
VIASH_PAR_BISULFITE="false"
fi
if [ -z ${VIASH_PAR_REVERSE_COMPLLIMENT+x} ]; then
VIASH_PAR_REVERSE_COMPLLIMENT="false"
if [ -z ${VIASH_PAR_REVERSE_COMPLEMENT+x} ]; then
VIASH_PAR_REVERSE_COMPLEMENT="false"
fi
# check whether required files exist
@@ -1169,9 +1169,9 @@ if [[ -n "$VIASH_PAR_BISULFITE" ]]; then
exit 1
fi
fi
if [[ -n "$VIASH_PAR_REVERSE_COMPLLIMENT" ]]; then
if ! [[ "$VIASH_PAR_REVERSE_COMPLLIMENT" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--reverse_complliment' has to be a boolean_true. Use "--help" to get more information on the parameters.
if [[ -n "$VIASH_PAR_REVERSE_COMPLEMENT" ]]; then
if ! [[ "$VIASH_PAR_REVERSE_COMPLEMENT" =~ ^(true|True|TRUE|false|False|FALSE|yes|Yes|YES|no|No|NO)$ ]]; then
ViashError '--reverse_complement' has to be a boolean_true. Use "--help" to get more information on the parameters.
exit 1
fi
fi
@@ -1406,7 +1406,7 @@ $( if [ ! -z ${VIASH_PAR_ADAPTERS+x} ]; then echo "${VIASH_PAR_ADAPTERS}" | sed
$( if [ ! -z ${VIASH_PAR_LIMITS+x} ]; then echo "${VIASH_PAR_LIMITS}" | sed "s#'#'\"'\"'#g;s#.*#par_limits='&'#" ; else echo "# par_limits="; fi )
$( if [ ! -z ${VIASH_PAR_SUBSAMPLE+x} ]; then echo "${VIASH_PAR_SUBSAMPLE}" | sed "s#'#'\"'\"'#g;s#.*#par_subsample='&'#" ; else echo "# par_subsample="; fi )
$( if [ ! -z ${VIASH_PAR_BISULFITE+x} ]; then echo "${VIASH_PAR_BISULFITE}" | sed "s#'#'\"'\"'#g;s#.*#par_bisulfite='&'#" ; else echo "# par_bisulfite="; fi )
$( if [ ! -z ${VIASH_PAR_REVERSE_COMPLLIMENT+x} ]; then echo "${VIASH_PAR_REVERSE_COMPLLIMENT}" | sed "s#'#'\"'\"'#g;s#.*#par_reverse_complliment='&'#" ; else echo "# par_reverse_complliment="; fi )
$( if [ ! -z ${VIASH_PAR_REVERSE_COMPLEMENT+x} ]; then echo "${VIASH_PAR_REVERSE_COMPLEMENT}" | sed "s#'#'\"'\"'#g;s#.*#par_reverse_complement='&'#" ; else echo "# par_reverse_complement="; fi )
$( if [ ! -z ${VIASH_PAR_OUTDIR+x} ]; then echo "${VIASH_PAR_OUTDIR}" | sed "s#'#'\"'\"'#g;s#.*#par_outdir='&'#" ; else echo "# par_outdir="; fi )
$( if [ ! -z ${VIASH_PAR_FORMAT+x} ]; then echo "${VIASH_PAR_FORMAT}" | sed "s#'#'\"'\"'#g;s#.*#par_format='&'#" ; else echo "# par_format="; fi )
$( if [ ! -z ${VIASH_PAR_DATA_FILENAME+x} ]; then echo "${VIASH_PAR_DATA_FILENAME}" | sed "s#'#'\"'\"'#g;s#.*#par_data_filename='&'#" ; else echo "# par_data_filename="; fi )
@@ -1438,7 +1438,7 @@ set -eo pipefail
[[ "\$par_nogroup" == "false" ]] && unset par_nogroup
[[ "\$par_bisulfite" == "false" ]] && unset par_bisulfite
[[ "\$par_reverse_compliment" == "false" ]] && unset par_reverse_compliment
[[ "\$par_reverse_complement" == "false" ]] && unset par_reverse_complement
IFS=";" read -ra input <<< \$par_input
@@ -1449,7 +1449,7 @@ IFS=";" read -ra input <<< \$par_input
\${par_limits:+--limits "\$par_limits"} \\
\${par_subsample:+-subsample \$par_subsample} \\
\${par_bisulfite:+-bisulfite} \\
\${par_reverse_compliment:+-reverse-compliment} \\
\${par_reverse_complement:+-reverse-complement} \\
\${par_outdir:+--outdir "\$par_outdir"} \\
\${par_format:+--format "\$par_format"} \\
\${par_data_filename:+-data-filename "\$par_data_filename"} \\

View File

@@ -1083,9 +1083,9 @@ build_info:
output: "target/executable/fastp"
executable: "target/executable/fastp/fastp"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -1028,9 +1028,9 @@ RUN fastp --version 2>&1 | sed 's# #: "#;s#$#"#' > /var/software_versions.txt
LABEL org.opencontainers.image.authors="Robrecht Cannoodt"
LABEL org.opencontainers.image.description="Companion container for running component fastp"
LABEL org.opencontainers.image.created="2024-09-19T03:54:23Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:21Z"
LABEL org.opencontainers.image.source="https://github.com/OpenGene/fastp"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -340,9 +340,9 @@ build_info:
output: "target/executable/fastqc"
executable: "target/executable/fastqc/fastqc"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -601,9 +601,9 @@ RUN echo "fastqc: $(fastqc --version | sed -n 's/^FastQC //p')" > /var/software_
LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
LABEL org.opencontainers.image.description="Companion container for running component fastqc"
LABEL org.opencontainers.image.created="2024-09-19T03:54:13Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:10Z"
LABEL org.opencontainers.image.source="https://github.com/s-andrews/FastQC"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -645,9 +645,9 @@ build_info:
output: "target/executable/featurecounts"
executable: "target/executable/featurecounts/featurecounts"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -754,9 +754,9 @@ RUN featureCounts -v 2>&1 | sed 's/featureCounts v\([0-9.]*\)/featureCounts: \1/
LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
LABEL org.opencontainers.image.description="Companion container for running component featurecounts"
LABEL org.opencontainers.image.created="2024-09-19T03:54:17Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:14Z"
LABEL org.opencontainers.image.source="https://github.com/ShiLab-Bioinformatics/subread"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -190,9 +190,9 @@ build_info:
output: "target/executable/fq_subsample"
executable: "target/executable/fq_subsample/fq_subsample"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -493,9 +493,9 @@ mv target/release/fq /usr/local/bin/ && \
cd / && rm -rf /fq
LABEL org.opencontainers.image.description="Companion container for running component fq_subsample"
LABEL org.opencontainers.image.created="2024-09-19T03:54:13Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:09Z"
LABEL org.opencontainers.image.source="https://github.com/stjude-rust-labs/fq"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -685,9 +685,9 @@ build_info:
output: "target/executable/gffread"
executable: "target/executable/gffread/gffread"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -807,9 +807,9 @@ RUN echo "gffread: \"$(gffread --version 2>&1)\"" > /var/software_versions.txt
LABEL org.opencontainers.image.authors="Emma Rousseau"
LABEL org.opencontainers.image.description="Companion container for running component gffread"
LABEL org.opencontainers.image.created="2024-09-19T03:54:05Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:00Z"
LABEL org.opencontainers.image.source="https://github.com/gpertea/gffread"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -218,9 +218,9 @@ build_info:
output: "target/executable/kallisto/kallisto_index"
executable: "target/executable/kallisto/kallisto_index/kallisto_index"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -506,9 +506,9 @@ tar -xzf kallisto_linux-v0.50.1.tar.gz && \
mv kallisto/kallisto /usr/local/bin/
LABEL org.opencontainers.image.description="Companion container for running component kallisto kallisto_index"
LABEL org.opencontainers.image.created="2024-09-19T03:54:21Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:18Z"
LABEL org.opencontainers.image.source="https://github.com/pachterlab/kallisto"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -234,9 +234,9 @@ build_info:
output: "target/executable/kallisto/kallisto_quant"
executable: "target/executable/kallisto/kallisto_quant/kallisto_quant"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -518,9 +518,9 @@ mv kallisto/kallisto /usr/local/bin/
RUN echo "kallisto: $(kallisto version | sed 's/kallisto, version //')" > /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component kallisto kallisto_quant"
LABEL org.opencontainers.image.created="2024-09-19T03:54:20Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:18Z"
LABEL org.opencontainers.image.source="https://github.com/pachterlab/kallisto"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -507,9 +507,9 @@ build_info:
output: "target/executable/lofreq/lofreq_call"
executable: "target/executable/lofreq/lofreq_call/lofreq_call"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -656,9 +656,9 @@ echo "lofreq: $version" > /var/software_versions.txt
LABEL org.opencontainers.image.authors="Kai Waldrant"
LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_call"
LABEL org.opencontainers.image.created="2024-09-19T03:54:16Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:13Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -215,9 +215,9 @@ build_info:
output: "target/executable/lofreq/lofreq_indelqual"
executable: "target/executable/lofreq/lofreq_indelqual/lofreq_indelqual"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -501,9 +501,9 @@ echo "lofreq: $version" > /var/software_versions.txt
LABEL org.opencontainers.image.authors="Kai Waldrant"
LABEL org.opencontainers.image.description="Companion container for running component lofreq lofreq_indelqual"
LABEL org.opencontainers.image.created="2024-09-19T03:54:16Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:13Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -456,9 +456,9 @@ build_info:
output: "target/executable/multiqc"
executable: "target/executable/multiqc/multiqc"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -637,9 +637,9 @@ RUN multiqc --version | sed 's/multiqc, version\s\(.*\)/multiqc: "\1"/' > /var/s
LABEL org.opencontainers.image.authors="Dorien Roosen"
LABEL org.opencontainers.image.description="Companion container for running component multiqc"
LABEL org.opencontainers.image.created="2024-09-19T03:54:26Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:24Z"
LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -398,9 +398,9 @@ build_info:
output: "target/executable/pear"
executable: "target/executable/pear/pear"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -597,9 +597,9 @@ echo "pear: $version" > /var/software_versions.txt
LABEL org.opencontainers.image.authors="Kai Waldrant"
LABEL org.opencontainers.image.description="Companion container for running component pear"
LABEL org.opencontainers.image.created="2024-09-19T03:54:09Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:05Z"
LABEL org.opencontainers.image.source="https://github.com/tseemann/PEAR"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -264,9 +264,9 @@ build_info:
output: "target/executable/qualimap/qualimap_rnaseq"
executable: "target/executable/qualimap/qualimap_rnaseq/qualimap_rnaseq"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -527,9 +527,9 @@ RUN echo QualiMap: $(qualimap 2>&1 | grep QualiMap | sed 's/^.*QualiMap//') > /v
LABEL org.opencontainers.image.authors="Dorien Roosen"
LABEL org.opencontainers.image.description="Companion container for running component qualimap qualimap_rnaseq"
LABEL org.opencontainers.image.created="2024-09-19T03:54:12Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:09Z"
LABEL org.opencontainers.image.source="https://bitbucket.org/kokonech/qualimap/commits/branch/master"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -852,9 +852,9 @@ build_info:
output: "target/executable/rsem/rsem_calculate_expression"
executable: "target/executable/rsem/rsem_calculate_expression/rsem_calculate_expression"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -991,9 +991,9 @@ echo "bowtie: `bowtie --version | grep -oP 'bowtie-align-s version \K\d+\.\d+\.\
echo "HISAT2: `hisat2 --version | grep -oP 'hisat2-align-s version \K\d+\.\d+\.\d+'`" >> /var/software_versions.txt
LABEL org.opencontainers.image.description="Companion container for running component rsem rsem_calculate_expression"
LABEL org.opencontainers.image.created="2024-09-19T03:54:20Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:17Z"
LABEL org.opencontainers.image.source="https://github.com/deweylab/RSEM"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -416,9 +416,9 @@ build_info:
output: "target/executable/rsem/rsem_prepare_reference"
executable: "target/executable/rsem/rsem_prepare_reference/rsem_prepare_reference"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -656,9 +656,9 @@ echo "HISAT2: `hisat2 --version | grep -oP 'hisat2-align-s version \K\d+\.\d+\.\
LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
LABEL org.opencontainers.image.description="Companion container for running component rsem rsem_prepare_reference"
LABEL org.opencontainers.image.created="2024-09-19T03:54:20Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:17Z"
LABEL org.opencontainers.image.source="https://github.com/deweylab/RSEM"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -277,9 +277,9 @@ build_info:
output: "target/executable/salmon/salmon_index"
executable: "target/executable/salmon/salmon_index/salmon_index"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -546,9 +546,9 @@ RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/softwar
LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_index"
LABEL org.opencontainers.image.created="2024-09-19T03:54:25Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:23Z"
LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -1173,9 +1173,9 @@ build_info:
output: "target/executable/salmon/salmon_quant"
executable: "target/executable/salmon/salmon_quant/salmon_quant"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

View File

@@ -1168,9 +1168,9 @@ RUN salmon index -v 2>&1 | sed 's/salmon \([0-9.]*\)/salmon: \1/' > /var/softwar
LABEL org.opencontainers.image.authors="Sai Nirmayi Yasa"
LABEL org.opencontainers.image.description="Companion container for running component salmon salmon_quant"
LABEL org.opencontainers.image.created="2024-09-19T03:54:25Z"
LABEL org.opencontainers.image.created="2024-09-27T09:55:23Z"
LABEL org.opencontainers.image.source="https://github.com/COMBINE-lab/salmon"
LABEL org.opencontainers.image.revision="bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
LABEL org.opencontainers.image.revision="237a2e3a229ee589d1ebbc282526f87398e26f58"
LABEL org.opencontainers.image.version="main"
VIASHDOCKER

View File

@@ -264,9 +264,9 @@ build_info:
output: "target/executable/samtools/samtools_collate"
executable: "target/executable/samtools/samtools_collate/samtools_collate"
viash_version: "0.9.0"
git_commit: "bc9cc0a6ce4e0b87a4ce47561b4812b449e101ca"
git_remote: "https://x-access-token:ghs_lSKHBbqnO6mkOoPjjavM2ghphcCkFP1NX9Uo@github.com/viash-hub/biobox"
git_tag: "v0.2.0-5-gbc9cc0a"
git_commit: "237a2e3a229ee589d1ebbc282526f87398e26f58"
git_remote: "https://x-access-token:ghs_d8HWKccvaGy0CcM6cBJNV2ku91TvFG4KZuEr@github.com/viash-hub/biobox"
git_tag: "v0.2.0-7-g237a2e3"
package_config:
name: "biobox"
version: "main"

Some files were not shown because too many files have changed in this diff Show More