Build branch main with version main (21831c2)
Build pipeline: viash-hub.htrnaseq.main-n8w4c
Source commit: 21831c2104
Source message: Fix well_demultiplex test
This commit is contained in:
7
.gitignore
vendored
Normal file
7
.gitignore
vendored
Normal file
@@ -0,0 +1,7 @@
|
||||
target
|
||||
testData
|
||||
|
||||
# Nextflow related files
|
||||
.nextflow
|
||||
.nextflow.log*
|
||||
work
|
||||
124
README.md
Normal file
124
README.md
Normal file
@@ -0,0 +1,124 @@
|
||||
# HT-RNAseq - A pipeline for processing high-throughput RNA-seq data
|
||||
|
||||
## Introduction
|
||||
__TODO__: Add a description of the pipeline here.
|
||||
|
||||
## Test data
|
||||
|
||||
As test data, we use [a DRUGseq dataset](https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE176150) from the [NCBI Sequence Read Archive](https://www.ncbi.nlm.nih.gov/sra).
|
||||
|
||||
The original data has been (partly) subsampled to reduce the test runtime. We used [seqtk](https://github.com/lh3/seqtk) for this with a seed of 1, e.g.:
|
||||
|
||||
```bash
|
||||
seqtk sample -s1 orig/SRR14730302/VH02001614_S8_R1_001.fastq.gz 10000 > 10k/SRR14730302/VH02001614_S8_R1_001.fastq.gz
|
||||
```
|
||||
|
||||
The data is available at: `gs://viash-hub-test-data/htrnaseq/v1/`:
|
||||
|
||||
```
|
||||
❯ gcstree -f viash-hub-test-data/htrnaseq/v1/
|
||||
viash-hub-test-data
|
||||
└── htrnaseq
|
||||
└── v1
|
||||
├── [ 48] 2-wells.fasta
|
||||
├── [465.3K] GSE176150_metadata.csv
|
||||
├── 100k
|
||||
│ ├── SRR14730301
|
||||
│ │ ├── [8.5M] VH02001612_S9_R1_001.fastq
|
||||
│ │ └── [14.9M] VH02001612_S9_R2_001.fastq
|
||||
│ └── SRR14730302
|
||||
│ ├── [8.5M] VH02001614_S8_R1_001.fastq.gz
|
||||
│ └── [14.9M] VH02001614_S8_R2_001.fastq.gz
|
||||
├── 10k
|
||||
│ ├── SRR14730301
|
||||
│ │ ├── [845.4K] VH02001612_S9_R1_001.fastq
|
||||
│ │ └── [1.5M] VH02001612_S9_R2_001.fastq
|
||||
│ └── SRR14730302
|
||||
│ ├── [845.3K] VH02001614_S8_R1_001.fastq.gz
|
||||
│ └── [1.5M] VH02001614_S8_R2_001.fastq.gz
|
||||
└── orig
|
||||
├── [20.4G] SRR14730301
|
||||
│ └── [20.4G] SRR14730301
|
||||
├── SRR14730301
|
||||
│ ├── [9.1G] VH02001612_S9_R1_001.fastq.gz
|
||||
│ └── [22.0G] VH02001612_S9_R2_001.fastq.gz
|
||||
├── [16.9G] SRR14730302
|
||||
│ └── [16.9G] SRR14730302
|
||||
├── SRR14730302
|
||||
│ ├── [7.6G] VH02001614_S8_R1_001.fastq.gz
|
||||
│ └── [18.0G] VH02001614_S8_R2_001.fastq.gz
|
||||
├── [18.0G] SRR14730303
|
||||
│ └── [18.0G] SRR14730303
|
||||
├── SRR14730303
|
||||
│ ├── [8.1G] VH02001618_S7_R1_001.fastq.gz
|
||||
│ └── [19.2G] VH02001618_S7_R2_001.fastq.gz
|
||||
├── [16.5G] SRR14730304
|
||||
│ └── [16.5G] SRR14730304
|
||||
├── SRR14730304
|
||||
│ ├── [7.5G] VH02001700_S6_R1_001.fastq.gz
|
||||
│ └── [17.8G] VH02001700_S6_R2_001.fastq.gz
|
||||
├── [19.0G] SRR14730305
|
||||
│ └── [19.0G] SRR14730305
|
||||
├── SRR14730305
|
||||
│ ├── [8.4G] VH02001702_S5_R1_001.fastq.gz
|
||||
│ └── [20.6G] VH02001702_S5_R2_001.fastq.gz
|
||||
├── [14.6G] SRR14730306
|
||||
│ └── [14.6G] SRR14730306
|
||||
├── SRR14730306
|
||||
│ ├── [6.6G] VH02001704_S4_R1_001.fastq.gz
|
||||
│ └── [16.0G] VH02001704_S4_R2_001.fastq.gz
|
||||
├── [21.5G] SRR14730307
|
||||
│ └── [21.5G] SRR14730307
|
||||
├── SRR14730307
|
||||
│ ├── [9.6G] VH02001708_S3_R1_001.fastq.gz
|
||||
│ └── [23.2G] VH02001708_S3_R2_001.fastq.gz
|
||||
├── [20.7G] SRR14730308
|
||||
│ └── [20.7G] SRR14730308
|
||||
├── SRR14730308
|
||||
│ ├── [9.3G] VH02001710_S2_R1_001.fastq.gz
|
||||
│ └── [22.1G] VH02001710_S2_R2_001.fastq.gz
|
||||
├── [15.8G] SRR14730309
|
||||
│ └── [15.8G] SRR14730309
|
||||
└── SRR14730309
|
||||
├── [7.2G] VH02001712_S1_R1_001.fastq.gz
|
||||
└── [16.9G] VH02001712_S1_R2_001.fastq.gz
|
||||
|
||||
18 directories, 37 files
|
||||
```
|
||||
|
||||
|
||||
The `orig` directory contains the original fastq files. The fastq files are available for 10k and 100k subsamples in the `10k` and `100k` directories, respectively.
|
||||
|
||||
The `2-wells.fasta` file contains the barcodes for 2 wells.
|
||||
|
||||
## Test run
|
||||
|
||||
The pipeline can be run by creating a `params.yaml` file like this:
|
||||
|
||||
```yaml
|
||||
param_list:
|
||||
- input_r1: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730301/VH02001612_S9_R1_001.fastq"
|
||||
input_r2: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730301/VH02001612_S9_R2_001.fastq"
|
||||
genomeDir: "gs://viash-hub-test-data/htrnaseq/v1/genomeDir/gencode.v41.star.sparse"
|
||||
barcodesFasta: "gs://viash-hub-test-data/htrnaseq/v1/2-wells.fasta"
|
||||
id: sample_one
|
||||
- input_r1: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730302/VH02001614_S8_R1_001.fastq"
|
||||
input_r2: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730302/VH02001614_S8_R2_001.fastq"
|
||||
genomeDir: "gs://viash-hub-test-data/htrnaseq/v1/genomeDir/gencode.v41.star.sparse"
|
||||
barcodesFasta: "gs://viash-hub-test-data/htrnaseq/v1/2-wells.fasta"
|
||||
id: sample_two
|
||||
```
|
||||
|
||||
and then:
|
||||
|
||||
```bash
|
||||
viash ns build --setup cb
|
||||
nextflow run . -main-script target/nextflow/workflows/htrnaseq/main.nf \
|
||||
-profile docker \
|
||||
-c target/nextflow/workflows/htrnaseq/nextflow.config \
|
||||
-params-file params.yaml \
|
||||
-resume \
|
||||
--publish_dir output
|
||||
```
|
||||
|
||||
Or, by running `src/workflows/htrnaseq/integration_test.sh`.
|
||||
15
_viash.yaml
Normal file
15
_viash.yaml
Normal file
@@ -0,0 +1,15 @@
|
||||
name: htrnaseq
|
||||
description: |
|
||||
High-throughput pipeline [WIP]
|
||||
license: MIT
|
||||
keywords: [bioinformatics, sequence, high-throughput, mapping, counting, pipeline]
|
||||
links:
|
||||
issue_tracker: https://github.com/viash-hub/htrnaseq/issues
|
||||
repository: https://github.com/viash-hub/htrnaseq
|
||||
|
||||
viash_version: 0.9.0-RC7
|
||||
|
||||
config_mods: |
|
||||
.requirements.commands := ['ps']
|
||||
.runners[.type == 'nextflow'].config.script := 'includeConfig("nextflow_labels.config")'
|
||||
.resources += {path: '/src/config/labels.config', dest: 'nextflow_labels.config'}
|
||||
3
main.nf
Normal file
3
main.nf
Normal file
@@ -0,0 +1,3 @@
|
||||
workflow {
|
||||
print("This is a dummy placeholder for pipeline execution. Please use the corresponding nf files for running pipelines.")
|
||||
}
|
||||
6
nextflow.config
Normal file
6
nextflow.config
Normal file
@@ -0,0 +1,6 @@
|
||||
manifest {
|
||||
name = "htrnaseq"
|
||||
version = "main"
|
||||
defaultBranch = "main"
|
||||
nextflowVersion = "!>=20.12.1-edge"
|
||||
}
|
||||
43
src/config/labels.config
Normal file
43
src/config/labels.config
Normal file
@@ -0,0 +1,43 @@
|
||||
process {
|
||||
// Default resources for components that hardly do any processing
|
||||
memory = { 2.GB * task.attempt }
|
||||
cpus = 1
|
||||
|
||||
// Retry for exit codes that have something to do with memory issues
|
||||
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
|
||||
maxRetries = 3
|
||||
maxMemory = null
|
||||
|
||||
// Resource labels
|
||||
withLabel: singlecpu { cpus = 1 }
|
||||
withLabel: lowcpu { cpus = 4 }
|
||||
withLabel: midcpu { cpus = 10 }
|
||||
withLabel: highcpu { cpus = 20 }
|
||||
|
||||
withLabel: lowmem { memory = { get_memory( 4.GB * task.attempt ) } }
|
||||
withLabel: midmem { memory = { get_memory( 25.GB * task.attempt ) } }
|
||||
withLabel: highmem { memory = { get_memory( 50.GB * task.attempt ) } }
|
||||
withLabel: veryhighmem { memory = { get_memory( 75.GB * task.attempt ) } }
|
||||
|
||||
}
|
||||
|
||||
def get_memory(to_compare) {
|
||||
if (!process.containsKey("maxMemory") || !process.maxMemory) {
|
||||
return to_compare
|
||||
}
|
||||
|
||||
try {
|
||||
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
|
||||
return process.maxMemory
|
||||
}
|
||||
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
|
||||
return max_memory as nextflow.util.MemoryUnit
|
||||
}
|
||||
else {
|
||||
return to_compare
|
||||
}
|
||||
} catch (all) {
|
||||
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
|
||||
System.exit(1)
|
||||
}
|
||||
}
|
||||
38
src/config/tests.config
Normal file
38
src/config/tests.config
Normal file
@@ -0,0 +1,38 @@
|
||||
|
||||
process.container = 'nextflow/bash:latest'
|
||||
profiles {
|
||||
// detect tempdir
|
||||
tempDir = java.nio.file.Paths.get(
|
||||
System.getenv('NXF_TEMP') ?:
|
||||
System.getenv('VIASH_TEMP') ?:
|
||||
System.getenv('TEMPDIR') ?:
|
||||
System.getenv('TMPDIR') ?:
|
||||
'/tmp'
|
||||
).toAbsolutePath()
|
||||
|
||||
mount_temp {
|
||||
docker.temp = tempDir
|
||||
podman.temp = tempDir
|
||||
charliecloud.temp = tempDir
|
||||
}
|
||||
|
||||
no_publish {
|
||||
process {
|
||||
withName: '.*' {
|
||||
publishDir = [
|
||||
enabled: false
|
||||
]
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
docker {
|
||||
docker.fixOwnership = true
|
||||
docker.enabled = true
|
||||
// docker.userEmulation = true
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
}
|
||||
101
src/parallel_map/config.vsh.yaml
Normal file
101
src/parallel_map/config.vsh.yaml
Normal file
@@ -0,0 +1,101 @@
|
||||
name: parallel_map
|
||||
description: |
|
||||
Map wells in batch, using STAR
|
||||
Spliced Transcripts Alignment to a Reference (C) Alexander Dobin
|
||||
https://github.com/alexdobin/STAR
|
||||
argument_groups:
|
||||
- name: Input arguments
|
||||
arguments:
|
||||
- name: "--input_r1"
|
||||
type: file
|
||||
required: true
|
||||
multiple: true
|
||||
- name: "--input_r2"
|
||||
type: file
|
||||
required: true
|
||||
multiple: true
|
||||
- name: "--genomeDir"
|
||||
type: file
|
||||
required: true
|
||||
description: STAR reference directory
|
||||
- name: "--barcodes"
|
||||
type: string
|
||||
multiple: true
|
||||
required: true
|
||||
description: The barcodes/wells to process
|
||||
- name: Barcode arguments
|
||||
arguments:
|
||||
- name: "--wellBarcodesLength"
|
||||
type: integer
|
||||
required: true
|
||||
description: The length of the well barcodes
|
||||
- name: "--umiLength"
|
||||
type: integer
|
||||
required: true
|
||||
description: The length of the UMIs
|
||||
- name: "--limitBAMsortRAM"
|
||||
type: string
|
||||
default: "10000000000"
|
||||
- name: Runtime arguments
|
||||
arguments:
|
||||
- name: "--runThreadN"
|
||||
description: "Number of threads to use for a single STAR execution."
|
||||
type: integer
|
||||
default: 1
|
||||
- name: Output arguments
|
||||
arguments:
|
||||
- name: "--output"
|
||||
type: file
|
||||
description: |
|
||||
Location of the output folders, 1 folder per barcode. The value used
|
||||
for this argument must contain a '*', which will be replaced with the
|
||||
barcode to form the final output location for that barcode.
|
||||
required: true
|
||||
multiple: true
|
||||
direction: output
|
||||
default: './*'
|
||||
- name: "--joblog"
|
||||
type: file
|
||||
description: Where to store the log file listing all the jobs.
|
||||
required: false
|
||||
direction: output
|
||||
default: "execution_log.txt"
|
||||
|
||||
resources:
|
||||
- type: bash_script
|
||||
path: script.sh
|
||||
|
||||
test_resources:
|
||||
- type: bash_script
|
||||
path: test.sh
|
||||
|
||||
engines:
|
||||
- type: docker
|
||||
image: debian:stable-slim
|
||||
setup:
|
||||
- type: apt
|
||||
packages:
|
||||
- procps
|
||||
- gzip
|
||||
- bzip2
|
||||
- parallel
|
||||
- wget
|
||||
- zlib1g-dev
|
||||
- unzip
|
||||
- xxd
|
||||
- file
|
||||
- type: docker
|
||||
env:
|
||||
- STAR_VERSION "2.7.11b"
|
||||
- STAR_SOURCE "https://github.com/alexdobin/STAR/releases/download/$STAR_VERSION/STAR_$STAR_VERSION.zip"
|
||||
- STAR_TARGET "/tmp/star.zip"
|
||||
- STAR_BINARY "STAR"
|
||||
run: |
|
||||
wget -O $STAR_TARGET $STAR_SOURCE && \
|
||||
unzip $STAR_TARGET -d /tmp && \
|
||||
mv /tmp/STAR_$STAR_VERSION/Linux_x86_64_static/STAR /usr/local/bin/$STAR_BINARY && \
|
||||
chmod +x /usr/local/bin/$STAR_BINARY && \
|
||||
rm $STAR_TARGET && rm -rf /tmp/STAR_$STAR_VERSION
|
||||
runners:
|
||||
- type: executable
|
||||
- type: nextflow
|
||||
292
src/parallel_map/script.sh
Executable file
292
src/parallel_map/script.sh
Executable file
@@ -0,0 +1,292 @@
|
||||
#!/bin/bash
|
||||
|
||||
## VIASH START
|
||||
par_input_r1="work/2c/5b8b3a2dd4a988b8838e3f72d38a37/_viash_par/input_r1_1/two__ACACCGAATT.concat_text_r1.output.txt"
|
||||
par_input_r2="work/2c/5b8b3a2dd4a988b8838e3f72d38a37/_viash_par/input_r2_1/two__ACACCGAATT.concat_text_r2.output.txt"
|
||||
par_barcodes="ACACCGAATT;GGCTATTGAT"
|
||||
par_output="./*"
|
||||
par_genomeDir="star"
|
||||
par_wellBarcodesLength=10
|
||||
par_umiLength=10
|
||||
par_limitBAMsortRAM="10000000000"
|
||||
meta_cpus=2
|
||||
par_runThreadN=1
|
||||
## VIASH END
|
||||
|
||||
set -eo pipefail
|
||||
|
||||
# Check if wildcard character is present in output folder template
|
||||
printf "Checking if output folder template ($par_output) contains a single wildcard character '*'. "
|
||||
output_glob_character="${par_output//[^\*]}"
|
||||
if [[ "${#output_glob_character}" -ne "1" ]]; then
|
||||
echo "The value for --output must contain exactly one '*' character. Exiting..."
|
||||
exit 1
|
||||
else
|
||||
echo "Done, wildcard character found!"
|
||||
fi
|
||||
|
||||
# Split the delimited strings into arrays
|
||||
IFS=';' read -r -a barcodes <<< "$par_barcodes"
|
||||
IFS=';' read -r -a input_r1 <<< "$par_input_r1"
|
||||
IFS=';' read -r -a input_r2 <<< "$par_input_r2"
|
||||
|
||||
# Check that the number of values provided for the barcodes and the fastq files are the same.
|
||||
num_barcodes="${#barcodes[@]}"
|
||||
num_r1_inputs="${#input_r1[@]}"
|
||||
num_r2_inputs="${#input_r2[@]}"
|
||||
|
||||
if [ ! "$num_barcodes" -eq "$num_r1_inputs" ] || [ ! "$num_r1_inputs" -eq "$num_r2_inputs" ]; then
|
||||
echo "The number of values for arguments 'barcodes' ($num_barcodes), "\
|
||||
"'input_r1' ($num_r1_inputs) and 'input_r2' ($num_r2_inputs) "\
|
||||
"should be the same, and their order should match."
|
||||
exit 1
|
||||
else
|
||||
echo "Checked if length of barcodes input ($num_barcodes) is "\
|
||||
"the same as R1 reads ($num_r1_inputs) and R2 reads "\
|
||||
"($num_r2_inputs). Seems OK!"
|
||||
fi
|
||||
|
||||
# Function to test for unique values in array
|
||||
function arrayContainsUniqueValues {
|
||||
# Pass the argument by reference
|
||||
local -n arr=$1
|
||||
# Create a temporary associative array
|
||||
# in order to use its uniqueness of keys
|
||||
# 'declare' in a function is automatically local
|
||||
declare -A uniq_tmp
|
||||
for item in "${arr[@]}"; do
|
||||
uniq_tmp[$item]=0 # assigning a placeholder
|
||||
done
|
||||
local unique_array_values=(${!uniq_tmp[@]})
|
||||
if [ "${#unique_array_values[@]}" -eq "${#arr[@]}" ]; then
|
||||
return
|
||||
fi
|
||||
false
|
||||
}
|
||||
arrayContainsUniqueValues barcodes
|
||||
is_array_unique_exit_code=$?
|
||||
if ! (exit $is_array_unique_exit_code); then
|
||||
echo "The provided barcodes should be unique!"
|
||||
echo "Values: $par_barcodes"
|
||||
exit 1
|
||||
fi
|
||||
|
||||
# Define the function that will be used to run a single job
|
||||
function _run() {
|
||||
local par_wellBarcodeLength="$1"
|
||||
local par_UMIlength="$2"
|
||||
local par_output="$3"
|
||||
local par_genomeDir="$4"
|
||||
local par_limitBAMsortRAM="$5"
|
||||
local par_runThreadN="$6"
|
||||
local barcode="$7"
|
||||
local input_R1="$8"
|
||||
local input_R2="$9"
|
||||
local par_UMIstart=$(($par_wellBarcodeLength + 1))
|
||||
|
||||
set -eo pipefail
|
||||
|
||||
echo <<-EOF
|
||||
Processing $barcode
|
||||
For the following inputs (lanes):
|
||||
"$star_readFilesIn
|
||||
EOF
|
||||
|
||||
echo "Writing barcode '$barcode' to $barcode.txt and using it as input".
|
||||
# Note that there is no possible conflict between jobs here
|
||||
# because the barcodes are unique (and the barcode is part of the name
|
||||
# of the file).
|
||||
echo "$barcode" > "$barcode.txt"
|
||||
|
||||
local dir="${par_output//\*/$barcode}/"
|
||||
echo "Setting output for barcode '$barcode' to '$dir'."
|
||||
mkdir -p "$dir"
|
||||
|
||||
# check if files are compressed
|
||||
local TMPDIR=$(mktemp -d "$meta_temp_dir/parallel_map-$barcode-XXXXXX")
|
||||
function clean_up {
|
||||
[[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
|
||||
}
|
||||
trap clean_up RETURN
|
||||
|
||||
# Decompress the input files when needed
|
||||
# NOTE: for some reason, using STAR's --readFilesCommand does not always work
|
||||
# This might be because STAR creates fifo files (see https://man7.org/linux/man-pages/man7/fifo.7.html)
|
||||
# and this requires a filesystem that supports this. Another cause might be that the input files
|
||||
# are symlinks. When testing this, using '--readFilesCommand "zcat"'
|
||||
# always produced empty BAM files, but also a succesfull exit code (0) so the problem is not reported.
|
||||
# However, the logs showed the following error: "gzip -: unexpected end of file".
|
||||
|
||||
function is_gzipped {
|
||||
printf "Checking if input '$1' (barcode '$barcode') is gzipped... "
|
||||
if file "$1" | grep -q 'gzip'; then
|
||||
echo "Done, detected compressed file."
|
||||
return
|
||||
fi
|
||||
echo "Done, file does not need decompression."
|
||||
false
|
||||
}
|
||||
|
||||
# Resolve symbolic links to actual file paths
|
||||
input_R1=$(realpath $input_R1)
|
||||
input_R2=$(realpath $input_R2)
|
||||
|
||||
if is_gzipped $input_R1; then
|
||||
local compressed_file_name_r1="$(basename -- $input_R1)"
|
||||
local uncompressed_file_r1="$TMPDIR/${compressed_file_name_r1%.gz}"
|
||||
printf "Unpacking input to $uncompressed_file_r1... "
|
||||
zcat "$input_R1" > "$uncompressed_file_r1"
|
||||
echo "Decompression done."
|
||||
else
|
||||
local uncompressed_file_r1="$input_R1"
|
||||
fi
|
||||
|
||||
if is_gzipped $input_R2; then
|
||||
local compressed_file_name_r2="$(basename -- $input_R2)"
|
||||
local uncompressed_file_r2="$TMPDIR/${compressed_file_name_r2%.gz}"
|
||||
printf "Unpacking input to $uncompressed_file_r2... "
|
||||
zcat "$input_R2" > "$uncompressed_file_r2"
|
||||
echo "Decompression done."
|
||||
else
|
||||
local uncompressed_file_r2="$input_R2"
|
||||
fi
|
||||
|
||||
local n_input_lines_r1=$(wc -l < "$uncompressed_file_r1")
|
||||
local n_input_lines_r2=$(wc -l < "$uncompressed_file_r2")
|
||||
|
||||
printf "Checking if length of input file mates match. "
|
||||
if (( $n_input_lines_r1 != n_input_lines_r2 )); then
|
||||
echo "The length of file $input_R1 ($n_input_lines_r1) does not match with $input_R2 ($n_input_lines_r2)"
|
||||
return 1
|
||||
else
|
||||
echo "Seems OK, $n_input_lines_r1 input lines."
|
||||
fi
|
||||
echo "Starting STAR for barcode '$barcode'"
|
||||
# soloType 'Droplet' is the same as 'CB_UMI_Simple': one UMI and one cell barcode of fixed length.
|
||||
# By default in this mode, STAR will look for the cell barcode and the UMI int the last files specified with --readFilesIn
|
||||
# So we need to specify R2 first and R1 second, because R1 contains the barcode and UMI.
|
||||
# Also, you might be tempted to use '--soloBarcodeMate 1' to alter this behavior, but this requires the clipping
|
||||
# the barcode from this mate by specifying --clip5pNbases and/or --clip3pNbases, which we do not want to do.
|
||||
STAR \
|
||||
--readFilesIn "$uncompressed_file_r2" "$uncompressed_file_r1" \
|
||||
--soloType Droplet \
|
||||
--quantMode GeneCounts \
|
||||
--genomeLoad LoadAndKeep \
|
||||
--limitBAMsortRAM "$par_limitBAMsortRAM" \
|
||||
--runThreadN "$par_runThreadN" \
|
||||
--outFilterMultimapNmax 1 \
|
||||
--outSAMtype BAM SortedByCoordinate \
|
||||
--soloCBstart 1 \
|
||||
--readFilesType "Fastx" \
|
||||
--soloCBlen "$par_wellBarcodeLength" \
|
||||
--soloUMIstart "$par_UMIstart" \
|
||||
--soloUMIlen "$par_UMIlength" \
|
||||
--soloBarcodeReadLength 0 \
|
||||
--soloStrand Unstranded \
|
||||
--soloFeatures Gene \
|
||||
--genomeDir "$par_genomeDir" \
|
||||
--outReadsUnmapped Fastx \
|
||||
--outSAMunmapped Within \
|
||||
--outSAMattributes NH HI nM AS CR UR CB UB GX GN \
|
||||
--soloCBwhitelist "$barcode.txt" \
|
||||
--outFileNamePrefix "$dir" \
|
||||
--outTmpDir "$TMPDIR/STARtemp/"
|
||||
|
||||
printf "Done running STAR. "
|
||||
# Check if the number of processed reads is equal to the number of input reads
|
||||
local n_input_reads=$(($n_input_lines_r1 / 4))
|
||||
local nr_output_reads=$(grep -Po "Number\ of\ input\ reads \\|\W*\K\d+" "$dir/Log.final.out")
|
||||
if (( $nr_output_reads != $n_input_reads )); then
|
||||
echo "Not all input reads were processed for barcode $barcode."
|
||||
return 1
|
||||
else
|
||||
echo "Processed $nr_output_reads reads for barcode $barcode".
|
||||
fi
|
||||
|
||||
printf "Making sure that the output has the proper permissions."
|
||||
find "$dir" -type d -exec chmod o+x {} \;
|
||||
chmod -R o+r "$dir"
|
||||
echo "Done"
|
||||
}
|
||||
|
||||
# Export the function - requires bash
|
||||
export -f _run
|
||||
|
||||
# Load reference genome
|
||||
echo "Loading reference genome"
|
||||
STAR --genomeLoad LoadAndExit --genomeDir "$par_genomeDir"
|
||||
|
||||
# Run the concurrent jobs using GNU parallel
|
||||
|
||||
# Make sure that parallel uses the correct shell
|
||||
export PARALLEL_SHELL="/bin/bash"
|
||||
|
||||
# Some notes:
|
||||
# --halt now,fail=1: instruct parallel to exit when a job has failed and kill remaining running jobs.
|
||||
#
|
||||
# ::: is a special syntax for GNU parallel to delineate inputs
|
||||
# If multiple ::: are given, each group will be treated as an input source, and all combinations of input
|
||||
# sources will be generated. E.g. ::: 1 2 ::: a b c will result in the combinations (1,a) (1,b) (1,c) (2,a) (2,b) (2,c)
|
||||
# The delimiter :::+ (note the extra '+') links the argument to the previous argument, and one argument from each of the input
|
||||
# sources will be read.
|
||||
parallel_cmd=("parallel" "--jobs" "80%" "--verbose" "--memfree" "2G"
|
||||
"--tmpdir" "$meta_temp_dir"
|
||||
"--retry-failed" "--retries" "4" "--halt" "soon,fail=1"
|
||||
"--joblog" "$par_joblog" "_run" "{}")
|
||||
|
||||
# Arguments for which there is one value, so these will not create extra jobs
|
||||
parallel_cmd+=(":::" "$par_wellBarcodesLength" ":::" "$par_umiLength" ":::" "$par_output" ":::" "$par_genomeDir" ":::" "$par_limitBAMsortRAM" ":::" "$par_runThreadN")
|
||||
|
||||
# Argument which in fact will cause extra jobs to be spawned, per job one item from each argument will be selected
|
||||
# Thus, these argument lists should have the same length.
|
||||
parallel_cmd+=(":::" "${barcodes[@]}" ":::+" "${input_r1[@]}" ":::+" "${input_r2[@]}")
|
||||
|
||||
set +eo pipefail
|
||||
"${parallel_cmd[@]}"
|
||||
exit_code=$?
|
||||
set -eo pipefail
|
||||
|
||||
echo "GNU parallel finished!"
|
||||
|
||||
# Unload reference
|
||||
printf "Unloading reference genome. "
|
||||
STAR --genomeLoad Remove --genomeDir "$par_genomeDir"
|
||||
echo "Done!"
|
||||
|
||||
# Exit code from GNU parallel:
|
||||
# If fail=1 is used, the exit status will be the exit status of the failing job.
|
||||
echo "Checking exit code"
|
||||
if ((exit_code>0)); then
|
||||
# Note that the ending HERE must be indented with TAB characters (not spaces)
|
||||
# in order to remove leading indentation
|
||||
MESSAGE=$(
|
||||
cat <<-HERE
|
||||
==================================================================
|
||||
|
||||
!!! An error occurred for one of the jobs.
|
||||
Exit code of the failing job: $exit_code.
|
||||
|
||||
%s
|
||||
|
||||
==================================================================
|
||||
|
||||
HERE
|
||||
)
|
||||
printf "$MESSAGE" "$(<$par_joblog)"
|
||||
exit 1
|
||||
else
|
||||
cat <<-HERE
|
||||
==================================================================
|
||||
|
||||
Mapping went fine (exit code '$exit_code'), zero errors occurred
|
||||
|
||||
==================================================================
|
||||
HERE
|
||||
|
||||
fi
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
356
src/parallel_map/test.sh
Executable file
356
src/parallel_map/test.sh
Executable file
@@ -0,0 +1,356 @@
|
||||
set -eo pipefail
|
||||
|
||||
## VIASH START
|
||||
meta_executable="target/executable/parallel_map/parallel_map"
|
||||
## VIASH END
|
||||
|
||||
# Some helper functions
|
||||
assert_directory_exists() {
|
||||
[ -d "$1" ] || { echo "File '$1' does not exist" && exit 1; }
|
||||
}
|
||||
|
||||
assert_file_exists() {
|
||||
[ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
|
||||
}
|
||||
|
||||
assert_file_contains() {
|
||||
grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
|
||||
}
|
||||
|
||||
assert_file_contains_regex() {
|
||||
grep -q -E "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
|
||||
}
|
||||
|
||||
echo "> Prepare test data in $meta_temp_dir"
|
||||
TMPDIR=$(mktemp -d --tmpdir="$meta_temp_dir")
|
||||
function clean_up {
|
||||
[[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
|
||||
}
|
||||
trap clean_up EXIT
|
||||
|
||||
# Sample 1, barcode ACAGTCACAG, UMI CTACGGATGA
|
||||
cat > "$TMPDIR/sample1_R1.fastq" <<'EOF'
|
||||
@SAMPLE_1_SEQ_ID1
|
||||
ACAGTCACAGCTACGGATGAGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAG
|
||||
+
|
||||
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
|
||||
@SAMPLE_1_SEQ_ID2
|
||||
ACAGTCACAGCTACGGATGAGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAG
|
||||
+
|
||||
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
|
||||
EOF
|
||||
|
||||
cat > "$TMPDIR/sample1_R2.fastq" <<'EOF'
|
||||
@SAMPLE_1_SEQ_ID1
|
||||
CTCACAGAGAGTCACAACATAGGCGCGGATGTGTGAGGCTTATGAGGC
|
||||
+
|
||||
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
|
||||
@SAMPLE_1_SEQ_ID2
|
||||
CTCACAGAGAGTCACAACATAGGCGCGGATGTGTGAGGCTTATGAGGC
|
||||
+
|
||||
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
|
||||
EOF
|
||||
|
||||
# Sample 2, barcode CGGGTTTACC, UMI GCTAGCTAGC
|
||||
cat > "$TMPDIR/sample2_R1.fastq" << 'EOF'
|
||||
@SAMPLE_2_SEQ_ID1
|
||||
CGGGTTTACCGCTAGCTAGCCACCACTATGGTTGGCCGGTTAGTAGTGT
|
||||
+
|
||||
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
|
||||
@SAMPLE_2_SEQ_ID2
|
||||
CGGGTTTACCGCTAGCTAGCCACCACTATGGTTGGCCGGTTAGTAGTGT
|
||||
+
|
||||
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
|
||||
EOF
|
||||
|
||||
cat > "$TMPDIR/sample2_R2.fastq" <<'EOF'
|
||||
@SAMPLE_2_SEQ_ID1
|
||||
ACACTACTAACCGGCCAACCATAGTGGTG
|
||||
+
|
||||
IIIIIIIIIIIIIIIIIIIIIIIIIIIII
|
||||
@SAMPLE_2_SEQ_ID2
|
||||
ACACTACTAACCGGCCAACCATAGTGGTG
|
||||
+
|
||||
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
|
||||
EOF
|
||||
|
||||
# Note that there is a sjdbGTFchrPrefix argument for STAR:
|
||||
# prefix for chromosome names in a GTF file (default: '-')
|
||||
cat > "$TMPDIR/genome.fasta" <<'EOF'
|
||||
>1
|
||||
TGGCATGAGCCAACGAACGCTGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAGCGTTCGTGGG
|
||||
GCTCGTCACCACTATGGTTGGCCGGTTAGTAGTGTGACTCCTGGTTTTCTGGAGCTTCTTTAAACCGTAGTCCAGTCAA
|
||||
TGCGAATGGCACTTCACGACGGACTGTCCTTAGCTCAGGGGA
|
||||
EOF
|
||||
|
||||
cat > "$TMPDIR/genes.gtf" <<'EOF'
|
||||
1 example_source gene 0 72 . + . gene_id "gene1"; gene_name: "GENE1;
|
||||
1 example_source exon 20 71 . + . gene_id "gene1"; gene_name: "GENE1"; exon_id: gene1_exon1;
|
||||
1 example_source gene 80 160 . + . gene_id "gene2"; gene_name: "GENE2;
|
||||
1 example_source exon 80 159 . + . gene_id "gene2"; gene_name: "GENE2"; exon_id: gene2_exon1;
|
||||
|
||||
EOF
|
||||
|
||||
echo "> Generate index"
|
||||
STAR \
|
||||
${meta_cpus:+--runThreadN $meta_cpus} \
|
||||
--runMode genomeGenerate \
|
||||
--genomeDir "$TMPDIR/index/" \
|
||||
--genomeFastaFiles "$TMPDIR/genome.fasta" \
|
||||
--sjdbGTFfile "$TMPDIR/genes.gtf" \
|
||||
--genomeSAindexNbases 2 > /dev/null 2>&1
|
||||
|
||||
|
||||
echo "> Run test 1"
|
||||
run_1_dir="$TMPDIR/run_1"
|
||||
mkdir -p "$run_1_dir"
|
||||
pushd "$run_1_dir" > /dev/null
|
||||
"$meta_executable" \
|
||||
--input_r1 "$TMPDIR/sample1_R1.fastq;$TMPDIR/sample2_R1.fastq" \
|
||||
--input_r2 "$TMPDIR/sample1_R2.fastq;$TMPDIR/sample2_R2.fastq" \
|
||||
--genomeDir "$TMPDIR/index/" \
|
||||
--barcodes "ACAGTCACAG;CGGGTTTACC" \
|
||||
--wellBarcodesLength 10 \
|
||||
--umiLength 10 \
|
||||
--runThreadN 2 \
|
||||
--output "$TMPDIR/output_*" > /dev/null 2>&1
|
||||
popd
|
||||
|
||||
echo ">> Check if output directories exists"
|
||||
sample1_out="$TMPDIR/output_ACAGTCACAG"
|
||||
sample2_out="$TMPDIR/output_CGGGTTTACC"
|
||||
assert_directory_exists "$sample1_out"
|
||||
assert_directory_exists "$sample2_out"
|
||||
|
||||
echo ">> Check if output files have been created"
|
||||
for sample in "$sample1_out" "$sample2_out"; do
|
||||
assert_file_exists "$sample/Aligned.sortedByCoord.out.bam"
|
||||
assert_file_exists "$sample/Unmapped.out.mate1"
|
||||
assert_file_exists "$sample/Unmapped.out.mate2"
|
||||
assert_file_exists "$sample/Log.out"
|
||||
assert_file_exists "$sample/Log.final.out"
|
||||
assert_file_exists "$sample/ReadsPerGene.out.tab"
|
||||
done
|
||||
|
||||
|
||||
echo ">> Check if Solo output is present"
|
||||
for sample in "$sample1_out" "$sample2_out"; do
|
||||
assert_directory_exists "$sample1_out/Solo.out"
|
||||
assert_directory_exists "$sample1_out/Solo.out/Gene"
|
||||
assert_file_exists "$sample1_out/Solo.out/Barcodes.stats"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/raw/barcodes.tsv"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/raw/features.tsv"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/raw/matrix.mtx"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/features.tsv"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/matrix.mtx"
|
||||
done
|
||||
|
||||
echo ">> Check contents of output"
|
||||
echo ">>> Sample 1"
|
||||
assert_file_contains "$sample1_out/Solo.out/Barcodes.stats" "yesWLmatchExact 2"
|
||||
assert_file_contains "$sample1_out/Log.final.out" "Uniquely mapped reads number | 2"
|
||||
assert_file_contains "$sample1_out/Log.final.out" "Number of input reads | 2"
|
||||
|
||||
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; }
|
||||
ACAGTCACAG
|
||||
EOF
|
||||
|
||||
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; }
|
||||
gene1 gene1 Gene Expression
|
||||
gene2 gene2 Gene Expression
|
||||
EOF
|
||||
|
||||
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; }
|
||||
%%MatrixMarket matrix coordinate integer general
|
||||
%
|
||||
2 1 1
|
||||
1 1 1
|
||||
EOF
|
||||
|
||||
echo ">>> Sample 2"
|
||||
assert_file_contains "$sample2_out/Solo.out/Barcodes.stats" "yesWLmatchExact 2"
|
||||
assert_file_contains "$sample2_out/Log.final.out" "Uniquely mapped reads number | 2"
|
||||
assert_file_contains "$sample2_out/Log.final.out" "Number of input reads | 2"
|
||||
|
||||
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; }
|
||||
CGGGTTTACC
|
||||
EOF
|
||||
|
||||
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; }
|
||||
gene1 gene1 Gene Expression
|
||||
gene2 gene2 Gene Expression
|
||||
EOF
|
||||
|
||||
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; }
|
||||
%%MatrixMarket matrix coordinate integer general
|
||||
%
|
||||
2 1 1
|
||||
2 1 1
|
||||
EOF
|
||||
|
||||
echo "> Run test 2 (compressed input)"
|
||||
gzip -c "$TMPDIR/sample1_R1.fastq" > "$TMPDIR/sample1_R1.fastq.gz"
|
||||
gzip -c "$TMPDIR/sample2_R1.fastq" > "$TMPDIR/sample2_R1.fastq.gz"
|
||||
gzip -c "$TMPDIR/sample1_R2.fastq" > "$TMPDIR/sample1_R2.fastq.gz"
|
||||
gzip -c "$TMPDIR/sample2_R2.fastq" > "$TMPDIR/sample2_R2.fastq.gz"
|
||||
|
||||
run_2_dir="$TMPDIR/run_2"
|
||||
mkdir -p "$run_2_dir"
|
||||
pushd "$run_2_dir" > /dev/null
|
||||
"$meta_executable" \
|
||||
--input_r1 "$TMPDIR/sample1_R1.fastq.gz;$TMPDIR/sample2_R1.fastq.gz" \
|
||||
--input_r2 "$TMPDIR/sample1_R2.fastq.gz;$TMPDIR/sample2_R2.fastq.gz" \
|
||||
--genomeDir "$TMPDIR/index/" \
|
||||
--barcodes "ACAGTCACAG;CGGGTTTACC" \
|
||||
--wellBarcodesLength 10 \
|
||||
--umiLength 10 \
|
||||
--runThreadN 2 \
|
||||
--output "$TMPDIR/output_gz_*" > /dev/null 2>&1
|
||||
popd > /dev/null
|
||||
|
||||
echo ">> Check if output directories exists"
|
||||
sample1_out="$TMPDIR/output_gz_ACAGTCACAG"
|
||||
sample2_out="$TMPDIR/output_gz_CGGGTTTACC"
|
||||
assert_directory_exists "$sample1_out"
|
||||
assert_directory_exists "$sample2_out"
|
||||
|
||||
echo ">> Check if output files have been created"
|
||||
for sample in "$sample1_out" "$sample2_out"; do
|
||||
assert_file_exists "$sample/Aligned.sortedByCoord.out.bam"
|
||||
assert_file_exists "$sample/Unmapped.out.mate1"
|
||||
assert_file_exists "$sample/Unmapped.out.mate2"
|
||||
assert_file_exists "$sample/Log.out"
|
||||
assert_file_exists "$sample/Log.final.out"
|
||||
assert_file_exists "$sample/ReadsPerGene.out.tab"
|
||||
done
|
||||
|
||||
|
||||
echo ">> Check if Solo output is present"
|
||||
for sample in "$sample1_out" "$sample2_out"; do
|
||||
assert_directory_exists "$sample1_out/Solo.out"
|
||||
assert_directory_exists "$sample1_out/Solo.out/Gene"
|
||||
assert_file_exists "$sample1_out/Solo.out/Barcodes.stats"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/raw/barcodes.tsv"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/raw/features.tsv"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/raw/matrix.mtx"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/features.tsv"
|
||||
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/matrix.mtx"
|
||||
done
|
||||
|
||||
echo ">> Check contents of output"
|
||||
echo ">>> Sample 1"
|
||||
assert_file_contains "$sample1_out/Solo.out/Barcodes.stats" "yesWLmatchExact 2"
|
||||
assert_file_contains "$sample1_out/Log.final.out" "Uniquely mapped reads number | 2"
|
||||
assert_file_contains "$sample1_out/Log.final.out" "Number of input reads | 2"
|
||||
|
||||
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; }
|
||||
ACAGTCACAG
|
||||
EOF
|
||||
|
||||
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; }
|
||||
gene1 gene1 Gene Expression
|
||||
gene2 gene2 Gene Expression
|
||||
EOF
|
||||
|
||||
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; }
|
||||
%%MatrixMarket matrix coordinate integer general
|
||||
%
|
||||
2 1 1
|
||||
1 1 1
|
||||
EOF
|
||||
|
||||
echo ">>> Sample 2"
|
||||
assert_file_contains "$sample2_out/Solo.out/Barcodes.stats" "yesWLmatchExact 2"
|
||||
assert_file_contains "$sample2_out/Log.final.out" "Uniquely mapped reads number | 2"
|
||||
assert_file_contains "$sample2_out/Log.final.out" "Number of input reads | 2"
|
||||
|
||||
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; }
|
||||
CGGGTTTACC
|
||||
EOF
|
||||
|
||||
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; }
|
||||
gene1 gene1 Gene Expression
|
||||
gene2 gene2 Gene Expression
|
||||
EOF
|
||||
|
||||
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; }
|
||||
%%MatrixMarket matrix coordinate integer general
|
||||
%
|
||||
2 1 1
|
||||
2 1 1
|
||||
EOF
|
||||
|
||||
|
||||
echo "> Check that wrong number of barcodes are detected."
|
||||
run_3_dir="$TMPDIR/run_3"
|
||||
mkdir -p "$run_3_dir"
|
||||
pushd "$run_3_dir" > /dev/null
|
||||
set +eo pipefail
|
||||
"$meta_executable" \
|
||||
--input_r1 "$TMPDIR/sample1_R1.fastq.gz;$TMPDIR/sample2_R1.fastq.gz" \
|
||||
--input_r2 "$TMPDIR/sample1_R2.fastq.gz;$TMPDIR/sample2_R2.fastq.gz" \
|
||||
--genomeDir "$TMPDIR/index/" \
|
||||
--barcodes "ACAGTCACAG" \
|
||||
--wellBarcodesLength 10 \
|
||||
--umiLength 10 \
|
||||
--runThreadN 2 \
|
||||
--output "$TMPDIR/output_gz_*" > /dev/null 2>&1 && echo "Expected non-zero exit code " && exit 1
|
||||
set -eo pipefail
|
||||
popd > /dev/null
|
||||
|
||||
echo "> Check that missing wildcard character is detected."
|
||||
run_4_dir="$TMPDIR/run_4"
|
||||
mkdir -p "$run_4_dir"
|
||||
pushd "$run_4_dir" > /dev/null
|
||||
set +eo pipefail
|
||||
"$meta_executable" \
|
||||
--input_r1 "$TMPDIR/sample1_R1.fastq.gz;$TMPDIR/sample2_R1.fastq.gz" \
|
||||
--input_r2 "$TMPDIR/sample1_R2.fastq.gz;$TMPDIR/sample2_R2.fastq.gz" \
|
||||
--genomeDir "$TMPDIR/index/" \
|
||||
--barcodes "ACAGTCACAG;CGGGTTTACC" \
|
||||
--wellBarcodesLength 10 \
|
||||
--umiLength 10 \
|
||||
--runThreadN 2 \
|
||||
--output "$TMPDIR/output_run4" > /dev/null 2>&1 && echo "Expected non-zero exit code." && exit 1
|
||||
set -eo pipefail
|
||||
popd > /dev/null
|
||||
|
||||
echo "> Check that a mismatch in the length of the input mates is detected."
|
||||
empty_input_file="$TMPDIR/empty.fastq"
|
||||
touch "$empty_input_file"
|
||||
run_5_dir="$TMPDIR/run_5"
|
||||
mkdir -p "$run_5_dir"
|
||||
pushd "$run_5_dir" > /dev/null
|
||||
set +eo pipefail
|
||||
"$meta_executable" \
|
||||
--input_r1 "$TMPDIR/sample1_R1.fastq;$empty_input_file" \
|
||||
--input_r2 "$TMPDIR/sample1_R2.fastq;$TMPDIR/sample2_R2.fastq" \
|
||||
--genomeDir "$TMPDIR/index/" \
|
||||
--barcodes "ACAGTCACAG;CGGGTTTACC" \
|
||||
--wellBarcodesLength 10 \
|
||||
--umiLength 10 \
|
||||
--runThreadN 2 \
|
||||
--output "$TMPDIR/output_run5_*" > /dev/null 2>&1 && echo "Expected non-zero exit code " && exit 1
|
||||
set -eo pipefail
|
||||
popd > /dev/null
|
||||
|
||||
echo "> Check that wrong number of input files is detected."
|
||||
run_6_dir="$TMPDIR/run_6"
|
||||
mkdir -p "$run_6_dir"
|
||||
pushd "$run_6_dir" > /dev/null
|
||||
set +eo pipefail
|
||||
"$meta_executable" \
|
||||
--input_r1 "$TMPDIR/sample1_R1.fastq" \
|
||||
--input_r2 "$TMPDIR/sample1_R2.fastq;$TMPDIR/sample2_R2.fastq" \
|
||||
--genomeDir "$TMPDIR/index/" \
|
||||
--barcodes "ACAGTCACAG;CGGGTTTACC" \
|
||||
--wellBarcodesLength 10 \
|
||||
--umiLength 10 \
|
||||
--runThreadN 2 \
|
||||
--output "$TMPDIR/output_run_6_*" > /dev/null 2>&1 && echo "Expected non-zero exit code " && exit 1
|
||||
set -eo pipefail
|
||||
popd > /dev/null
|
||||
|
||||
|
||||
78
src/workflows/htrnaseq/config.vsh.yaml
Normal file
78
src/workflows/htrnaseq/config.vsh.yaml
Normal file
@@ -0,0 +1,78 @@
|
||||
name: htrnaseq
|
||||
namespace: workflows
|
||||
argument_groups:
|
||||
- name: Input arguments
|
||||
arguments:
|
||||
- name: --input_r1
|
||||
description: R1
|
||||
type: file
|
||||
required: true
|
||||
- name: --input_r2
|
||||
description: R2
|
||||
type: file
|
||||
required: true
|
||||
- name: --barcodesFasta
|
||||
type: file
|
||||
required: true
|
||||
- name: --genomeDir
|
||||
type: file
|
||||
required: true
|
||||
- name: Output arguments
|
||||
arguments:
|
||||
- name: --fastq_output_r1
|
||||
description: List of demultiplexed fastq files
|
||||
type: file
|
||||
direction: output
|
||||
multiple: true
|
||||
required: true
|
||||
default: "fastq/*_R1_001.fastq"
|
||||
- name: --fastq_output_r2
|
||||
description: List of demultiplexed fastq files
|
||||
type: file
|
||||
direction: output
|
||||
multiple: true
|
||||
required: true
|
||||
default: "fastq/*_R2_001.fastq"
|
||||
- name: --star_output
|
||||
description: Output from mapping with STAR
|
||||
type: file
|
||||
direction: output
|
||||
multiple: true
|
||||
required: true
|
||||
default: $id/star/*
|
||||
resources:
|
||||
- type: nextflow_script
|
||||
path: main.nf
|
||||
entrypoint: run_wf
|
||||
|
||||
# test_resources:
|
||||
# - type: nextflow_script
|
||||
# path: test.nf
|
||||
# entrypoint: test_wf
|
||||
|
||||
dependencies:
|
||||
- name: workflows/well_demultiplex
|
||||
repository: local
|
||||
- name: workflows/parallel_map_wf
|
||||
repository: local
|
||||
- name: workflows/utils/groupWells
|
||||
repository: local
|
||||
- name: concat_text
|
||||
repository: cb
|
||||
repositories:
|
||||
- name: local
|
||||
type: local
|
||||
- name: bb
|
||||
type: vsh
|
||||
repo: biobox
|
||||
tag: v0.1.0
|
||||
- name: cb
|
||||
type: vsh
|
||||
repo: craftbox
|
||||
tag: concat_text
|
||||
|
||||
runners:
|
||||
- type: nextflow
|
||||
|
||||
engines:
|
||||
- type: native
|
||||
32
src/workflows/htrnaseq/integration_test.sh
Executable file
32
src/workflows/htrnaseq/integration_test.sh
Executable file
@@ -0,0 +1,32 @@
|
||||
#!/bin/bash
|
||||
|
||||
# get the root of the directory
|
||||
REPO_ROOT=$(git rev-parse --show-toplevel)
|
||||
|
||||
# ensure that the command below is run from the root of the repository
|
||||
cd "$REPO_ROOT"
|
||||
|
||||
# Make sure the workflow is built
|
||||
viash ns build --setup cb
|
||||
|
||||
export NXF_VER=24.04.4
|
||||
|
||||
nextflow run . \
|
||||
-main-script target/nextflow/workflows/htrnaseq/main.nf \
|
||||
-params-file ./src/workflows/htrnaseq/params.yaml \
|
||||
-config ./src/config/tests.config \
|
||||
-profile docker \
|
||||
--publish_dir output \
|
||||
-resume
|
||||
|
||||
# bin/nextflow run . \
|
||||
# -main-script src/workflows/htrnaseq_wf/test.nf \
|
||||
# -entry test_wf_NextSeq550 \
|
||||
# -profile docker,local \
|
||||
# -resume \
|
||||
# --mappingReferenceRoot testData/genomeDir/subset \
|
||||
# --barcodesReferenceRoot testData \
|
||||
# --compoundAnnotationRoot testData \
|
||||
# -ansi-log false \
|
||||
# --publish_dir htrnaseq_test_results
|
||||
#
|
||||
80
src/workflows/htrnaseq/main.nf
Normal file
80
src/workflows/htrnaseq/main.nf
Normal file
@@ -0,0 +1,80 @@
|
||||
workflow run_wf {
|
||||
take:
|
||||
input_ch
|
||||
|
||||
main:
|
||||
output_ch = input_ch
|
||||
| well_demultiplex.run(
|
||||
fromState: { id, state ->
|
||||
[
|
||||
input_r1: state.input_r1,
|
||||
input_r2: state.input_r2,
|
||||
barcodesFasta: state.barcodesFasta,
|
||||
]
|
||||
},
|
||||
toState: { id, result, state ->
|
||||
state + result + [
|
||||
fastq_output_r1: result.output_r1,
|
||||
fastq_output_r2: result.output_r2,
|
||||
input_r1: result.output_r1,
|
||||
input_r2: result.output_r2,
|
||||
]
|
||||
},
|
||||
directives: [label: ["midmem", "midcpu"]]
|
||||
)
|
||||
|
||||
// TODO: Expand this into matching a whitelist/blacklist of barcodes
|
||||
// ... and turn into separate component
|
||||
| filter{ id, state -> state.barcode != "unknown" }
|
||||
| concat_text.run(
|
||||
key: "concat_txt_r1",
|
||||
runIf: {id, state -> state.input_r1.size() > 1},
|
||||
fromState: { id, state ->
|
||||
[
|
||||
input: state.input_r1,
|
||||
gzip_output: true,
|
||||
]
|
||||
},
|
||||
toState: { id, result, state ->
|
||||
state + [ input_r1: [ result.output ] ]
|
||||
}
|
||||
)
|
||||
| concat_text.run(
|
||||
key: "concat_text_r2",
|
||||
runIf: {id, state -> state.input_r2.size() > 1},
|
||||
fromState: { id, state ->
|
||||
[
|
||||
input: state.input_r2,
|
||||
gzip_output: true
|
||||
]
|
||||
},
|
||||
toState: { id, result, state ->
|
||||
state + [ input_r2: [ result.output ] ]
|
||||
}
|
||||
)
|
||||
| parallel_map_wf.run(
|
||||
fromState: {id, state ->
|
||||
def star_output = state.star_output[0]
|
||||
[
|
||||
"input_r1": state.input_r1[0],
|
||||
"input_r2": state.input_r2[0],
|
||||
"barcode": state.barcode,
|
||||
"pool": state.pool,
|
||||
"output": state.star_output[0],
|
||||
"genomeDir": state.genomeDir,
|
||||
]
|
||||
},
|
||||
toState: {id, result, state ->
|
||||
state + ["star_output": result.output]
|
||||
},
|
||||
)
|
||||
| niceView()
|
||||
| setState(["star_output", "fastq_output_r1", "fastq_output_r2", "star_output"])
|
||||
|
||||
//| niceView()
|
||||
//
|
||||
//| setState( [ "output": "out" ] )
|
||||
|
||||
emit:
|
||||
output_ch
|
||||
}
|
||||
11
src/workflows/htrnaseq/params.yaml
Normal file
11
src/workflows/htrnaseq/params.yaml
Normal file
@@ -0,0 +1,11 @@
|
||||
param_list:
|
||||
- input_r1: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730301/VH02001612_S9_R1_001.fastq"
|
||||
input_r2: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730301/VH02001612_S9_R2_001.fastq"
|
||||
genomeDir: "gs://viash-hub-test-data/htrnaseq/v1/genomeDir/gencode.v41.star.sparse"
|
||||
barcodesFasta: "gs://viash-hub-test-data/htrnaseq/v1/2-wells.fasta"
|
||||
id: sample_one
|
||||
- input_r1: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730302/VH02001614_S8_R1_001.fastq"
|
||||
input_r2: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730302/VH02001614_S8_R2_001.fastq"
|
||||
genomeDir: "gs://viash-hub-test-data/htrnaseq/v1/genomeDir/gencode.v41.star.sparse"
|
||||
barcodesFasta: "gs://viash-hub-test-data/htrnaseq/v1/2-wells.fasta"
|
||||
id: sample_two
|
||||
58
src/workflows/parallel_map_wf/config.vsh.yaml
Normal file
58
src/workflows/parallel_map_wf/config.vsh.yaml
Normal file
@@ -0,0 +1,58 @@
|
||||
name: parallel_map_wf
|
||||
namespace: workflows
|
||||
description: |
|
||||
Map RNA sequencing data, provided as fastq files (paired-end) to a reference genome using STAR Solo.
|
||||
Input data must have been demultiplexed beforehand, meaning that a single fastq pair provides data for
|
||||
one barcode (one well). Multiple wells can be mapped in parallel by providing multiple events to the
|
||||
workflow. Output is provided as mapped output per pool, i.e. one output is provided per pool.xx
|
||||
argument_groups:
|
||||
- name: "Arguments"
|
||||
arguments:
|
||||
- name: "--input_r1"
|
||||
type: file
|
||||
direction: input
|
||||
required: true
|
||||
- name: "--input_r2"
|
||||
type: file
|
||||
direction: input
|
||||
required: true
|
||||
- name: "--barcode"
|
||||
type: string
|
||||
required: true
|
||||
- name: "--pool"
|
||||
type: string
|
||||
required: true
|
||||
- name: "--genomeDir"
|
||||
type: file
|
||||
required: true
|
||||
direction: input
|
||||
- name: "--output"
|
||||
type: file
|
||||
direction: output
|
||||
multiple: true
|
||||
required: true
|
||||
resources:
|
||||
- type: nextflow_script
|
||||
path: main.nf
|
||||
entrypoint: run_wf
|
||||
|
||||
# test_resources:
|
||||
# - type: nextflow_script
|
||||
# path: test.nf
|
||||
# entrypoint: test_wf
|
||||
|
||||
dependencies:
|
||||
- name: parallel_map
|
||||
repository: local
|
||||
- name: workflows/utils/groupWells
|
||||
repository: local
|
||||
repositories:
|
||||
- name: local
|
||||
type: local
|
||||
|
||||
runners:
|
||||
- type: nextflow
|
||||
|
||||
engines:
|
||||
- type: native
|
||||
|
||||
50
src/workflows/parallel_map_wf/main.nf
Normal file
50
src/workflows/parallel_map_wf/main.nf
Normal file
@@ -0,0 +1,50 @@
|
||||
workflow run_wf {
|
||||
take:
|
||||
input_ch
|
||||
|
||||
main:
|
||||
output_ch = input_ch
|
||||
| map {id, state -> [id, state + ["orig_id": id]]}
|
||||
| groupWells.run(
|
||||
fromState: { id, state ->
|
||||
[
|
||||
"input_r1": state.input_r1,
|
||||
"input_r2": state.input_r2,
|
||||
"well": state.barcode,
|
||||
"pool": state.pool,
|
||||
]
|
||||
},
|
||||
toState: { id, result, state ->
|
||||
state + [
|
||||
"wells": result.wells,
|
||||
"input_r1": result.output_r1,
|
||||
"input_r2": result.output_r2,
|
||||
"_meta": ["join_id": state.orig_id]
|
||||
]
|
||||
}
|
||||
)
|
||||
| parallel_map.run(
|
||||
fromState: { id, state ->
|
||||
[
|
||||
"input_r1": state.input_r1,
|
||||
"input_r2": state.input_r2,
|
||||
"genomeDir": state.genomeDir,
|
||||
"barcodes": state.wells,
|
||||
"pool": state.pool,
|
||||
"wellBarcodesLength": 10,
|
||||
"umiLength": 10,
|
||||
"output": state.output[0],
|
||||
]
|
||||
},
|
||||
toState: { id, result, state ->
|
||||
state + [
|
||||
output: result.output,
|
||||
]
|
||||
},
|
||||
directives: [label: ["midmem", "midcpu"]]
|
||||
)
|
||||
| setState(["output", "_meta"])
|
||||
|
||||
emit:
|
||||
output_ch
|
||||
}
|
||||
53
src/workflows/utils/groupWells/config.vsh.yaml
Normal file
53
src/workflows/utils/groupWells/config.vsh.yaml
Normal file
@@ -0,0 +1,53 @@
|
||||
name: groupWells
|
||||
namespace: workflows/utils
|
||||
description: |
|
||||
N/A
|
||||
argument_groups:
|
||||
- name: Inputs
|
||||
arguments:
|
||||
- name: "--well"
|
||||
type: string
|
||||
description: Barcode identifier for a well
|
||||
required: true
|
||||
example: barcode_1
|
||||
- name: "--pool"
|
||||
type: string
|
||||
description: Identifier of the pool
|
||||
required: true
|
||||
example: pool_1
|
||||
- name: "--input_r1"
|
||||
type: file
|
||||
description: Path to the input for R1
|
||||
required: true
|
||||
example: input.fastq.gz
|
||||
- name: "--input_r2"
|
||||
type: file
|
||||
description: Path to the input for R1
|
||||
required: true
|
||||
example: input.fastq.gz
|
||||
|
||||
- name: Output
|
||||
arguments:
|
||||
- name: "--wells"
|
||||
type: string
|
||||
description: List of grouped wells (by means of barcodes)
|
||||
multiple: true
|
||||
direction: output
|
||||
example: input.fastq.gz
|
||||
- name: "--output_r1"
|
||||
type: file
|
||||
description: Path to output for R2
|
||||
multiple: true
|
||||
direction: output
|
||||
- name: "--output_r2"
|
||||
type: file
|
||||
description: Path to the output for R2
|
||||
multiple: true
|
||||
direction: output
|
||||
resources:
|
||||
- type: nextflow_script
|
||||
path: main.nf
|
||||
entrypoint: run_wf
|
||||
|
||||
runners:
|
||||
- type: nextflow
|
||||
25
src/workflows/utils/groupWells/main.nf
Normal file
25
src/workflows/utils/groupWells/main.nf
Normal file
@@ -0,0 +1,25 @@
|
||||
workflow run_wf {
|
||||
|
||||
take: in_
|
||||
|
||||
main:
|
||||
|
||||
out_ = in_
|
||||
| map{ id, state -> [state.pool, state, id]}
|
||||
| groupTuple(sort: "hash")
|
||||
| map{ new_id, inputs, original_ids ->
|
||||
[
|
||||
new_id,
|
||||
[
|
||||
output_r1: inputs.collect{it.input_r1},
|
||||
output_r2: inputs.collect{it.input_r2},
|
||||
wells: inputs.collect{it.well},
|
||||
_meta: [ join_id: original_ids[0] ]
|
||||
]
|
||||
]
|
||||
}
|
||||
|
||||
emit: out_
|
||||
|
||||
}
|
||||
|
||||
72
src/workflows/well_demultiplex/config.vsh.yaml
Normal file
72
src/workflows/well_demultiplex/config.vsh.yaml
Normal file
@@ -0,0 +1,72 @@
|
||||
name: well_demultiplex
|
||||
namespace: workflows
|
||||
description: Demultiplexing on well level
|
||||
argument_groups:
|
||||
- name: Input arguments
|
||||
arguments:
|
||||
- name: --input_r1
|
||||
description: R1
|
||||
type: file
|
||||
required: true
|
||||
- name: --input_r2
|
||||
description: R2
|
||||
type: file
|
||||
required: true
|
||||
- name: --barcodesFasta
|
||||
type: file
|
||||
required: true
|
||||
- name: Output arguments
|
||||
arguments:
|
||||
- name: --output_r1
|
||||
description: List of demultiplexed fastq files
|
||||
type: file
|
||||
direction: output
|
||||
multiple: true
|
||||
required: true
|
||||
default: "fastq/*_R1_001.fastq"
|
||||
- name: "--output_r2"
|
||||
description: List of demultiplexed fastq files
|
||||
type: file
|
||||
direction: output
|
||||
multiple: true
|
||||
required: true
|
||||
default: "fastq/*_R2_001.fastq"
|
||||
- name: "--pool"
|
||||
type: string
|
||||
description: The original pool / sample name
|
||||
direction: output
|
||||
- name: "--barcode"
|
||||
type: string
|
||||
direction: output
|
||||
- name: "--lane"
|
||||
type: string
|
||||
direction: output
|
||||
- name: "--pair_end"
|
||||
type: string
|
||||
direction: output
|
||||
resources:
|
||||
- type: nextflow_script
|
||||
path: main.nf
|
||||
entrypoint: run_wf
|
||||
|
||||
# Test dataset: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM5357044
|
||||
test_resources:
|
||||
- type: nextflow_script
|
||||
path: test.nf
|
||||
entrypoint: test_wf
|
||||
|
||||
dependencies:
|
||||
- name: cutadapt
|
||||
repository: bb
|
||||
repositories:
|
||||
- name: bb
|
||||
type: vsh
|
||||
repo: biobox
|
||||
tag: v0.1.0
|
||||
|
||||
runners:
|
||||
- type: nextflow
|
||||
|
||||
engines:
|
||||
- type: native
|
||||
|
||||
66
src/workflows/well_demultiplex/main.nf
Normal file
66
src/workflows/well_demultiplex/main.nf
Normal file
@@ -0,0 +1,66 @@
|
||||
workflow run_wf {
|
||||
take:
|
||||
input_ch
|
||||
|
||||
main:
|
||||
output_ch = input_ch
|
||||
| cutadapt.run(
|
||||
// TODO: Remove hard-coded directives and replace with profiles
|
||||
directives: [
|
||||
cpus: 4
|
||||
],
|
||||
fromState: { id, state ->
|
||||
[
|
||||
input: state.input_r1,
|
||||
input_r2: state.input_r2,
|
||||
no_indels: true,
|
||||
action: "none",
|
||||
front_fasta: state.barcodesFasta,
|
||||
output: "fastq/*_001.fastq"
|
||||
]
|
||||
},
|
||||
toState: { id, result, state ->
|
||||
[
|
||||
output: result.output,
|
||||
]
|
||||
}
|
||||
)
|
||||
// Parse the file names to obtain metadata about the output
|
||||
| flatMap{ id, state ->
|
||||
state.output.collect{ p ->
|
||||
def barcode = (p =~ /.*\\/([ACTG]*|unknown)_R?.*/)[0][1]
|
||||
def pair_end = (p =~ /.*_(R[12])_.*/)[0][1]
|
||||
def lane = (p =~ /.*_(L\d+).*/) ? (p =~ /.*_(L\d+).*/)[0][1] : "NA"
|
||||
def new_id = id + "__" + barcode
|
||||
[
|
||||
new_id,
|
||||
[
|
||||
pool: id,
|
||||
barcode: barcode,
|
||||
output: p,
|
||||
lane: lane,
|
||||
pair_end: pair_end,
|
||||
_meta: [ join_id: id ]
|
||||
]
|
||||
]
|
||||
}
|
||||
}
|
||||
// Group the outputs from across lanes
|
||||
| groupTuple(by: 0, sort: "hash")
|
||||
| map {id, states ->
|
||||
def r1_output = states.findAll{ it.pair_end == "R1" }.collect{it.output}
|
||||
def r2_output = states.findAll{ it.pair_end == "R2" }.collect{it.output}
|
||||
assert r1_output.size() == r2_output.size()
|
||||
// Here we pick the state from the first item in the list of states
|
||||
// and overwrite the keys which are different across states
|
||||
// TODO: we can assert that these keys are the same
|
||||
def first_state = states[0]
|
||||
def new_id = first_state.pool + "__" + first_state.barcode
|
||||
def new_state = first_state + ["output_r1": r1_output, "output_r2": r2_output]
|
||||
[new_id, new_state]
|
||||
}
|
||||
| setState(["pool", "barcode", "lane", "_meta", "output_r1", "output_r2"])
|
||||
|
||||
emit:
|
||||
output_ch
|
||||
}
|
||||
9
src/workflows/well_demultiplex/nextflow.config
Normal file
9
src/workflows/well_demultiplex/nextflow.config
Normal file
@@ -0,0 +1,9 @@
|
||||
manifest {
|
||||
nextflowVersion = '!>=20.12.1-edge'
|
||||
}
|
||||
|
||||
params {
|
||||
rootDir = java.nio.file.Paths.get("$projectDir/../../../").toAbsolutePath().normalize().toString()
|
||||
}
|
||||
|
||||
|
||||
41
src/workflows/well_demultiplex/test.nf
Normal file
41
src/workflows/well_demultiplex/test.nf
Normal file
@@ -0,0 +1,41 @@
|
||||
include { well_demultiplex } from params.rootDir + "/target/nextflow/workflows/well_demultiplex/main.nf"
|
||||
|
||||
base = "gs://viash-hub-test-data/htrnaseq/v1/"
|
||||
|
||||
workflow test_wf {
|
||||
output_ch = Channel.fromList([
|
||||
[
|
||||
id: "SRR14730301",
|
||||
input_r1: base + "100k/SRR14730301/VH02001612_S9_R1_001.fastq",
|
||||
input_r2: base + "100k/SRR14730301/VH02001612_S9_R2_001.fastq",
|
||||
barcodesFasta: base + "2-wells.fasta",
|
||||
],
|
||||
[
|
||||
id: "SRR14730302",
|
||||
input_r1: base + "100k/SRR14730302/VH02001614_S8_R1_001.fastq",
|
||||
input_r2: base + "100k/SRR14730302/VH02001614_S8_R2_001.fastq",
|
||||
barcodesFasta: base + "2-wells.fasta",
|
||||
],
|
||||
])
|
||||
| map { state -> [ state.id, state ] }
|
||||
| well_demultiplex.run(
|
||||
fromState: { id, state ->
|
||||
[
|
||||
input_r1: state.input_r1,
|
||||
input_r2: state.input_r2,
|
||||
barcodesFasta: state.barcodesFasta,
|
||||
]
|
||||
},
|
||||
toState: { id, output, state ->
|
||||
output }
|
||||
)
|
||||
| view { output ->
|
||||
assert output.size() == 2 : "outputs should contain two elements; [id, file]"
|
||||
"Output: $output"
|
||||
}
|
||||
| toSortedList()
|
||||
| view { output ->
|
||||
assert output.size() == 6 : "2 samples, each with 2 barcodes and 1 unkown"
|
||||
}
|
||||
}
|
||||
|
||||
0
target/.build.yaml
Normal file
0
target/.build.yaml
Normal file
@@ -0,0 +1,733 @@
|
||||
name: "cutadapt"
|
||||
version: "v0.1.0"
|
||||
argument_groups:
|
||||
- name: "Specify Adapters for R1"
|
||||
arguments:
|
||||
- type: "string"
|
||||
name: "--adapter"
|
||||
alternatives:
|
||||
- "-a"
|
||||
description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\
|
||||
\ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\
|
||||
\ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\
|
||||
\ the read.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--front"
|
||||
alternatives:
|
||||
- "-g"
|
||||
description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\
|
||||
\ first read). The adapter and any preceding bases\nare trimmed. Partial matches\
|
||||
\ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\
|
||||
\ the adapter is\nonly found if it is a prefix of the read.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--anywhere"
|
||||
alternatives:
|
||||
- "-b"
|
||||
description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\
|
||||
\ (paired data: of the first read). Both types of\nmatches as described under\
|
||||
\ -a and -g are allowed. If the\nfirst base of the read is part of the match,\
|
||||
\ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\
|
||||
for rescuing failed library preparations - do not use if\nyou know which end\
|
||||
\ your adapter was ligated to!\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- name: "Specify Adapters using Fasta files for R1"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--adapter_fasta"
|
||||
description: "Fasta file containing sequences of an adapter ligated to the 3'\
|
||||
\ end (paired data:\nof the first read). The adapter and subsequent bases are\n\
|
||||
trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\
|
||||
\ found if it is a suffix of the read.\n"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--front_fasta"
|
||||
description: "Fasta file containing sequences of an adapter ligated to the 5'\
|
||||
\ end (paired data:\nof the first read). The adapter and any preceding bases\n\
|
||||
are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\
|
||||
\ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\
|
||||
\ the read.\n"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--anywhere_fasta"
|
||||
description: "Fasta file containing sequences of an adapter that may be ligated\
|
||||
\ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\
|
||||
\ as described under -a and -g are allowed. If the\nfirst base of the read is\
|
||||
\ part of the match, the behavior\nis as with -g, otherwise as with -a. This\
|
||||
\ option is mostly\nfor rescuing failed library preparations - do not use if\n\
|
||||
you know which end your adapter was ligated to!\n"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- name: "Specify Adapters for R2"
|
||||
arguments:
|
||||
- type: "string"
|
||||
name: "--adapter_r2"
|
||||
alternatives:
|
||||
- "-A"
|
||||
description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\
|
||||
\ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\
|
||||
\ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\
|
||||
\ the read.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--front_r2"
|
||||
alternatives:
|
||||
- "-G"
|
||||
description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\
|
||||
\ first read). The adapter and any preceding bases\nare trimmed. Partial matches\
|
||||
\ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\
|
||||
\ the adapter is\nonly found if it is a prefix of the read.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--anywhere_r2"
|
||||
alternatives:
|
||||
- "-B"
|
||||
description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\
|
||||
\ (paired data: of the first read). Both types of\nmatches as described under\
|
||||
\ -a and -g are allowed. If the\nfirst base of the read is part of the match,\
|
||||
\ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\
|
||||
for rescuing failed library preparations - do not use if\nyou know which end\
|
||||
\ your adapter was ligated to!\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- name: "Specify Adapters using Fasta files for R2"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--adapter_r2_fasta"
|
||||
description: "Fasta file containing sequences of an adapter ligated to the 3'\
|
||||
\ end (paired data:\nof the first read). The adapter and subsequent bases are\n\
|
||||
trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\
|
||||
\ found if it is a suffix of the read.\n"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--front_r2_fasta"
|
||||
description: "Fasta file containing sequences of an adapter ligated to the 5'\
|
||||
\ end (paired data:\nof the first read). The adapter and any preceding bases\n\
|
||||
are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\
|
||||
\ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\
|
||||
\ the read.\n"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--anywhere_r2_fasta"
|
||||
description: "Fasta file containing sequences of an adapter that may be ligated\
|
||||
\ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\
|
||||
\ as described under -a and -g are allowed. If the\nfirst base of the read is\
|
||||
\ part of the match, the behavior\nis as with -g, otherwise as with -a. This\
|
||||
\ option is mostly\nfor rescuing failed library preparations - do not use if\n\
|
||||
you know which end your adapter was ligated to!\n"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- name: "Paired-end options"
|
||||
arguments:
|
||||
- type: "boolean_true"
|
||||
name: "--pair_adapters"
|
||||
description: "Treat adapters given with -a/-A etc. as pairs. Either both\nor none\
|
||||
\ are removed from each read pair.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "string"
|
||||
name: "--pair_filter"
|
||||
description: "Which of the reads in a paired-end read have to match the\nfiltering\
|
||||
\ criterion in order for the pair to be filtered.\n"
|
||||
info: null
|
||||
required: false
|
||||
choices:
|
||||
- "any"
|
||||
- "both"
|
||||
- "first"
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_true"
|
||||
name: "--interleaved"
|
||||
description: "Read and/or write interleaved paired-end reads.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- name: "Input parameters"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--input"
|
||||
description: "Input fastq file for single-end reads or R1 for paired-end reads.\n"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--input_r2"
|
||||
description: "Input fastq file for R2 in the case of paired-end reads.\n"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "double"
|
||||
name: "--error_rate"
|
||||
alternatives:
|
||||
- "-E"
|
||||
- "--errors"
|
||||
description: "Maximum allowed error rate (if 0 <= E < 1), or absolute\nnumber\
|
||||
\ of errors for full-length adapter match (if E is an\ninteger >= 1). Error\
|
||||
\ rate = no. of errors divided by\nlength of matching region. Default: 0.1 (10%).\n"
|
||||
info: null
|
||||
example:
|
||||
- 0.1
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_false"
|
||||
name: "--no_indels"
|
||||
description: "Allow only mismatches in alignments.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "integer"
|
||||
name: "--times"
|
||||
alternatives:
|
||||
- "-n"
|
||||
description: "Remove up to COUNT adapters from each read. Default: 1.\n"
|
||||
info: null
|
||||
example:
|
||||
- 1
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "integer"
|
||||
name: "--overlap"
|
||||
alternatives:
|
||||
- "-O"
|
||||
description: "Require MINLENGTH overlap between read and adapter for an\nadapter\
|
||||
\ to be found. The default is 3.\n"
|
||||
info: null
|
||||
example:
|
||||
- 3
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_true"
|
||||
name: "--match_read_wildcards"
|
||||
description: "Interpret IUPAC wildcards in reads.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "boolean_false"
|
||||
name: "--no_match_adapter_wildcards"
|
||||
description: "Do not interpret IUPAC wildcards in adapters.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "string"
|
||||
name: "--action"
|
||||
description: "What to do if a match was found. trim: trim adapter and\nup- or\
|
||||
\ downstream sequence; retain: trim, but retain\nadapter; mask: replace with\
|
||||
\ 'N' characters; lowercase:\nconvert to lowercase; none: leave unchanged.\n\
|
||||
The default is trim.\n"
|
||||
info: null
|
||||
example:
|
||||
- "trim"
|
||||
required: false
|
||||
choices:
|
||||
- "trim"
|
||||
- "retain"
|
||||
- "mask"
|
||||
- "lowercase"
|
||||
- "none"
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_true"
|
||||
name: "--revcomp"
|
||||
alternatives:
|
||||
- "--rc"
|
||||
description: "Check both the read and its reverse complement for adapter\nmatches.\
|
||||
\ If match is on reverse-complemented version,\noutput that one.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- name: "Read modifications"
|
||||
arguments:
|
||||
- type: "integer"
|
||||
name: "--cut"
|
||||
alternatives:
|
||||
- "-u"
|
||||
description: "Remove LEN bases from each read (or R1 if paired; use --cut_r2\n\
|
||||
option for R2). If LEN is positive, remove bases from the\nbeginning. If LEN\
|
||||
\ is negative, remove bases from the end.\nCan be used twice if LENs have different\
|
||||
\ signs. Applied\n*before* adapter trimming.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "integer"
|
||||
name: "--cut_r2"
|
||||
description: "Remove LEN bases from each read (for R2). If LEN is positive, remove\
|
||||
\ bases from the\nbeginning. If LEN is negative, remove bases from the end.\n\
|
||||
Can be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--nextseq_trim"
|
||||
description: "NextSeq-specific quality trimming (each read). Trims also\ndark\
|
||||
\ cycles appearing as high-quality G bases.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--quality_cutoff"
|
||||
alternatives:
|
||||
- "-q"
|
||||
description: "Trim low-quality bases from 5' and/or 3' ends of each read\nbefore\
|
||||
\ adapter removal. Applied to both reads if data is\npaired. If one value is\
|
||||
\ given, only the 3' end is trimmed.\nIf two comma-separated cutoffs are given,\
|
||||
\ the 5' end is\ntrimmed with the first cutoff, the 3' end with the second.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--quality_cutoff_r2"
|
||||
alternatives:
|
||||
- "-Q"
|
||||
description: "Quality-trimming cutoff for R2. Default: same as for R1\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "integer"
|
||||
name: "--quality_base"
|
||||
description: "Assume that quality values in FASTQ are encoded as\nascii(quality\
|
||||
\ + N). This needs to be set to 64 for some\nold Illumina FASTQ files. The default\
|
||||
\ is 33.\n"
|
||||
info: null
|
||||
example:
|
||||
- 33
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_true"
|
||||
name: "--poly_a"
|
||||
description: "Trim poly-A tails"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "integer"
|
||||
name: "--length"
|
||||
alternatives:
|
||||
- "-l"
|
||||
description: "Shorten reads to LENGTH. Positive values remove bases at\nthe end\
|
||||
\ while negative ones remove bases at the beginning.\nThis and the following\
|
||||
\ modifications are applied after\nadapter trimming.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_true"
|
||||
name: "--trim_n"
|
||||
description: "Trim N's on ends of reads."
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "string"
|
||||
name: "--length_tag"
|
||||
description: "Search for TAG followed by a decimal number in the\ndescription\
|
||||
\ field of the read. Replace the decimal number\nwith the correct length of\
|
||||
\ the trimmed read. For example,\nuse --length-tag 'length=' to correct fields\
|
||||
\ like\n'length=123'.\n"
|
||||
info: null
|
||||
example:
|
||||
- "length="
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--strip_suffix"
|
||||
description: "Remove this suffix from read names if present. Can be\ngiven multiple\
|
||||
\ times.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--prefix"
|
||||
alternatives:
|
||||
- "-x"
|
||||
description: "Add this prefix to read names. Use {name} to insert the\nname of\
|
||||
\ the matching adapter.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--suffix"
|
||||
alternatives:
|
||||
- "-y"
|
||||
description: "Add this suffix to read names; can also include {name}\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--rename"
|
||||
description: "Rename reads using TEMPLATE containing variables such as\n{id},\
|
||||
\ {adapter_name} etc. (see documentation)\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_true"
|
||||
name: "--zero_cap"
|
||||
alternatives:
|
||||
- "-z"
|
||||
description: "Change negative quality values to zero."
|
||||
info: null
|
||||
direction: "input"
|
||||
- name: "Filtering of processed reads"
|
||||
description: "Filters are applied after above read modifications. Paired-end reads\
|
||||
\ are\nalways discarded pairwise (see also --pair_filter).\n"
|
||||
arguments:
|
||||
- type: "string"
|
||||
name: "--minimum_length"
|
||||
alternatives:
|
||||
- "-m"
|
||||
description: "Discard reads shorter than LEN. Default is 0.\nWhen trimming paired-end\
|
||||
\ reads, the minimum lengths for R1 and R2 can be specified separately by separating\
|
||||
\ them with a colon (:).\nIf the colon syntax is not used, the same minimum\
|
||||
\ length applies to both reads, as discussed above.\nAlso, one of the values\
|
||||
\ can be omitted to impose no restrictions.\nFor example, with -m 17:, the length\
|
||||
\ of R1 must be at least 17, but the length of R2 is ignored.\n"
|
||||
info: null
|
||||
example:
|
||||
- "0"
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--maximum_length"
|
||||
alternatives:
|
||||
- "-M"
|
||||
description: "Discard reads longer than LEN. Default: no limit.\nFor paired reads,\
|
||||
\ see the remark for --minimum_length\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--max_n"
|
||||
description: "Discard reads with more than COUNT 'N' bases. If COUNT is\na number\
|
||||
\ between 0 and 1, it is interpreted as a fraction\nof the read length.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "long"
|
||||
name: "--max_expected_errors"
|
||||
alternatives:
|
||||
- "--max_ee"
|
||||
description: "Discard reads whose expected number of errors (computed\nfrom quality\
|
||||
\ values) exceeds ERRORS.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "long"
|
||||
name: "--max_average_error_rate"
|
||||
alternatives:
|
||||
- "--max_aer"
|
||||
description: "as --max_expected_errors (see above), but divided by\nlength to\
|
||||
\ account for reads of varying length.\n"
|
||||
info: null
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_true"
|
||||
name: "--discard_trimmed"
|
||||
alternatives:
|
||||
- "--discard"
|
||||
description: "Discard reads that contain an adapter. Use also -O to\navoid discarding\
|
||||
\ too many randomly matching reads.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "boolean_true"
|
||||
name: "--discard_untrimmed"
|
||||
alternatives:
|
||||
- "--trimmed_only"
|
||||
description: "Discard reads that do not contain an adapter.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "boolean_true"
|
||||
name: "--discard_casava"
|
||||
description: "Discard reads that did not pass CASAVA filtering (header\nhas :Y:).\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- name: "Output parameters"
|
||||
arguments:
|
||||
- type: "string"
|
||||
name: "--report"
|
||||
description: "Which type of report to print: 'full' (default) or 'minimal'.\n"
|
||||
info: null
|
||||
example:
|
||||
- "full"
|
||||
required: false
|
||||
choices:
|
||||
- "full"
|
||||
- "minimal"
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_true"
|
||||
name: "--json"
|
||||
description: "Write report in JSON format to this file.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "file"
|
||||
name: "--output"
|
||||
description: "Glob pattern for matching the expected output files.\nShould include\
|
||||
\ `$output_dir`.\n"
|
||||
info: null
|
||||
example:
|
||||
- "fastq/*_001.fast[a,q]"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "boolean_true"
|
||||
name: "--fasta"
|
||||
description: "Output FASTA to standard output even on FASTQ input.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "boolean_true"
|
||||
name: "--info_file"
|
||||
description: "Write information about each read and its adapter matches\ninto\
|
||||
\ info.txt in the output directory.\nSee the documentation for the file format.\n"
|
||||
info: null
|
||||
direction: "input"
|
||||
- name: "Debug"
|
||||
arguments:
|
||||
- type: "boolean_true"
|
||||
name: "--debug"
|
||||
description: "Print debug information"
|
||||
info: null
|
||||
direction: "input"
|
||||
resources:
|
||||
- type: "bash_script"
|
||||
path: "script.sh"
|
||||
is_executable: true
|
||||
description: "Cutadapt removes adapter sequences from high-throughput sequencing reads.\n"
|
||||
test_resources:
|
||||
- type: "bash_script"
|
||||
path: "test.sh"
|
||||
is_executable: true
|
||||
info: null
|
||||
status: "enabled"
|
||||
requirements:
|
||||
commands:
|
||||
- "ps"
|
||||
keywords:
|
||||
- "RNA-seq"
|
||||
- "scRNA-seq"
|
||||
- "high-throughput"
|
||||
license: "MIT"
|
||||
references:
|
||||
doi:
|
||||
- "10.14806/ej.17.1.200"
|
||||
links:
|
||||
repository: "https://github.com/marcelm/cutadapt"
|
||||
homepage: "https://cutadapt.readthedocs.io"
|
||||
documentation: "https://cutadapt.readthedocs.io"
|
||||
runners:
|
||||
- type: "executable"
|
||||
id: "executable"
|
||||
docker_setup_strategy: "ifneedbepullelsecachedbuild"
|
||||
- type: "nextflow"
|
||||
id: "nextflow"
|
||||
directives:
|
||||
tag: "$id"
|
||||
auto:
|
||||
simplifyInput: true
|
||||
simplifyOutput: false
|
||||
transcript: false
|
||||
publish: false
|
||||
config:
|
||||
labels:
|
||||
mem1gb: "memory = 1000000000.B"
|
||||
mem2gb: "memory = 2000000000.B"
|
||||
mem5gb: "memory = 5000000000.B"
|
||||
mem10gb: "memory = 10000000000.B"
|
||||
mem20gb: "memory = 20000000000.B"
|
||||
mem50gb: "memory = 50000000000.B"
|
||||
mem100gb: "memory = 100000000000.B"
|
||||
mem200gb: "memory = 200000000000.B"
|
||||
mem500gb: "memory = 500000000000.B"
|
||||
mem1tb: "memory = 1000000000000.B"
|
||||
mem2tb: "memory = 2000000000000.B"
|
||||
mem5tb: "memory = 5000000000000.B"
|
||||
mem10tb: "memory = 10000000000000.B"
|
||||
mem20tb: "memory = 20000000000000.B"
|
||||
mem50tb: "memory = 50000000000000.B"
|
||||
mem100tb: "memory = 100000000000000.B"
|
||||
mem200tb: "memory = 200000000000000.B"
|
||||
mem500tb: "memory = 500000000000000.B"
|
||||
mem1gib: "memory = 1073741824.B"
|
||||
mem2gib: "memory = 2147483648.B"
|
||||
mem4gib: "memory = 4294967296.B"
|
||||
mem8gib: "memory = 8589934592.B"
|
||||
mem16gib: "memory = 17179869184.B"
|
||||
mem32gib: "memory = 34359738368.B"
|
||||
mem64gib: "memory = 68719476736.B"
|
||||
mem128gib: "memory = 137438953472.B"
|
||||
mem256gib: "memory = 274877906944.B"
|
||||
mem512gib: "memory = 549755813888.B"
|
||||
mem1tib: "memory = 1099511627776.B"
|
||||
mem2tib: "memory = 2199023255552.B"
|
||||
mem4tib: "memory = 4398046511104.B"
|
||||
mem8tib: "memory = 8796093022208.B"
|
||||
mem16tib: "memory = 17592186044416.B"
|
||||
mem32tib: "memory = 35184372088832.B"
|
||||
mem64tib: "memory = 70368744177664.B"
|
||||
mem128tib: "memory = 140737488355328.B"
|
||||
mem256tib: "memory = 281474976710656.B"
|
||||
mem512tib: "memory = 562949953421312.B"
|
||||
cpu1: "cpus = 1"
|
||||
cpu2: "cpus = 2"
|
||||
cpu5: "cpus = 5"
|
||||
cpu10: "cpus = 10"
|
||||
cpu20: "cpus = 20"
|
||||
cpu50: "cpus = 50"
|
||||
cpu100: "cpus = 100"
|
||||
cpu200: "cpus = 200"
|
||||
cpu500: "cpus = 500"
|
||||
cpu1000: "cpus = 1000"
|
||||
debug: false
|
||||
container: "docker"
|
||||
engines:
|
||||
- type: "docker"
|
||||
id: "docker"
|
||||
image: "python:3.12"
|
||||
target_registry: "images.viash-hub.com"
|
||||
target_tag: "v0.1.0"
|
||||
namespace_separator: "/"
|
||||
setup:
|
||||
- type: "python"
|
||||
user: false
|
||||
pip:
|
||||
- "cutadapt"
|
||||
upgrade: true
|
||||
- type: "docker"
|
||||
run:
|
||||
- "cutadapt --version | sed 's/\\(.*\\)/cutadapt: \"\\1\"/' > /var/software_versions.txt\n"
|
||||
entrypoint: []
|
||||
cmd: null
|
||||
- type: "native"
|
||||
id: "native"
|
||||
build_info:
|
||||
config: "src/cutadapt/config.vsh.yaml"
|
||||
runner: "nextflow"
|
||||
engine: "docker|native"
|
||||
output: "target/nextflow/cutadapt"
|
||||
executable: "target/nextflow/cutadapt/main.nf"
|
||||
viash_version: "0.9.0-RC6"
|
||||
git_commit: "b84b29747d0635f2ac83ea63b496be9a9edb6724"
|
||||
git_remote: "https://github.com/viash-hub/biobox"
|
||||
package_config:
|
||||
name: "biobox"
|
||||
version: "v0.1.0"
|
||||
description: "A collection of bioinformatics tools for working with sequence data.\n"
|
||||
info: null
|
||||
viash_version: "0.9.0-RC6"
|
||||
source: "src"
|
||||
target: "target"
|
||||
config_mods:
|
||||
- ".requirements.commands := ['ps']\n"
|
||||
- ".engines += { type: \"native\" }"
|
||||
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
|
||||
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
|
||||
keywords:
|
||||
- "bioinformatics"
|
||||
- "modules"
|
||||
- "sequencing"
|
||||
license: "MIT"
|
||||
organization: "vsh"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/biobox"
|
||||
issue_tracker: "https://github.com/viash-hub/biobox/issues"
|
||||
4371
target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/main.nf
Normal file
4371
target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt/main.nf
Normal file
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,125 @@
|
||||
manifest {
|
||||
name = 'cutadapt'
|
||||
mainScript = 'main.nf'
|
||||
nextflowVersion = '!>=20.12.1-edge'
|
||||
version = 'v0.1.0'
|
||||
description = 'Cutadapt removes adapter sequences from high-throughput sequencing reads.\n'
|
||||
}
|
||||
|
||||
process.container = 'nextflow/bash:latest'
|
||||
|
||||
// detect tempdir
|
||||
tempDir = java.nio.file.Paths.get(
|
||||
System.getenv('NXF_TEMP') ?:
|
||||
System.getenv('VIASH_TEMP') ?:
|
||||
System.getenv('TEMPDIR') ?:
|
||||
System.getenv('TMPDIR') ?:
|
||||
'/tmp'
|
||||
).toAbsolutePath()
|
||||
|
||||
profiles {
|
||||
no_publish {
|
||||
process {
|
||||
withName: '.*' {
|
||||
publishDir = [
|
||||
enabled: false
|
||||
]
|
||||
}
|
||||
}
|
||||
}
|
||||
mount_temp {
|
||||
docker.temp = tempDir
|
||||
podman.temp = tempDir
|
||||
charliecloud.temp = tempDir
|
||||
}
|
||||
docker {
|
||||
docker.enabled = true
|
||||
// docker.userEmulation = true
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
singularity {
|
||||
singularity.enabled = true
|
||||
singularity.autoMounts = true
|
||||
docker.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
podman {
|
||||
podman.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
shifter {
|
||||
shifter.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
charliecloud {
|
||||
charliecloud.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
}
|
||||
}
|
||||
|
||||
process{
|
||||
withLabel: mem1gb { memory = 1000000000.B }
|
||||
withLabel: mem2gb { memory = 2000000000.B }
|
||||
withLabel: mem5gb { memory = 5000000000.B }
|
||||
withLabel: mem10gb { memory = 10000000000.B }
|
||||
withLabel: mem20gb { memory = 20000000000.B }
|
||||
withLabel: mem50gb { memory = 50000000000.B }
|
||||
withLabel: mem100gb { memory = 100000000000.B }
|
||||
withLabel: mem200gb { memory = 200000000000.B }
|
||||
withLabel: mem500gb { memory = 500000000000.B }
|
||||
withLabel: mem1tb { memory = 1000000000000.B }
|
||||
withLabel: mem2tb { memory = 2000000000000.B }
|
||||
withLabel: mem5tb { memory = 5000000000000.B }
|
||||
withLabel: mem10tb { memory = 10000000000000.B }
|
||||
withLabel: mem20tb { memory = 20000000000000.B }
|
||||
withLabel: mem50tb { memory = 50000000000000.B }
|
||||
withLabel: mem100tb { memory = 100000000000000.B }
|
||||
withLabel: mem200tb { memory = 200000000000000.B }
|
||||
withLabel: mem500tb { memory = 500000000000000.B }
|
||||
withLabel: mem1gib { memory = 1073741824.B }
|
||||
withLabel: mem2gib { memory = 2147483648.B }
|
||||
withLabel: mem4gib { memory = 4294967296.B }
|
||||
withLabel: mem8gib { memory = 8589934592.B }
|
||||
withLabel: mem16gib { memory = 17179869184.B }
|
||||
withLabel: mem32gib { memory = 34359738368.B }
|
||||
withLabel: mem64gib { memory = 68719476736.B }
|
||||
withLabel: mem128gib { memory = 137438953472.B }
|
||||
withLabel: mem256gib { memory = 274877906944.B }
|
||||
withLabel: mem512gib { memory = 549755813888.B }
|
||||
withLabel: mem1tib { memory = 1099511627776.B }
|
||||
withLabel: mem2tib { memory = 2199023255552.B }
|
||||
withLabel: mem4tib { memory = 4398046511104.B }
|
||||
withLabel: mem8tib { memory = 8796093022208.B }
|
||||
withLabel: mem16tib { memory = 17592186044416.B }
|
||||
withLabel: mem32tib { memory = 35184372088832.B }
|
||||
withLabel: mem64tib { memory = 70368744177664.B }
|
||||
withLabel: mem128tib { memory = 140737488355328.B }
|
||||
withLabel: mem256tib { memory = 281474976710656.B }
|
||||
withLabel: mem512tib { memory = 562949953421312.B }
|
||||
withLabel: cpu1 { cpus = 1 }
|
||||
withLabel: cpu2 { cpus = 2 }
|
||||
withLabel: cpu5 { cpus = 5 }
|
||||
withLabel: cpu10 { cpus = 10 }
|
||||
withLabel: cpu20 { cpus = 20 }
|
||||
withLabel: cpu50 { cpus = 50 }
|
||||
withLabel: cpu100 { cpus = 100 }
|
||||
withLabel: cpu200 { cpus = 200 }
|
||||
withLabel: cpu500 { cpus = 500 }
|
||||
withLabel: cpu1000 { cpus = 1000 }
|
||||
}
|
||||
|
||||
|
||||
@@ -0,0 +1,749 @@
|
||||
{
|
||||
"$schema": "http://json-schema.org/draft-07/schema",
|
||||
"title": "cutadapt",
|
||||
"description": "Cutadapt removes adapter sequences from high-throughput sequencing reads.\n",
|
||||
"type": "object",
|
||||
"definitions": {
|
||||
|
||||
|
||||
|
||||
"specify adapters for r1" : {
|
||||
"title": "Specify Adapters for R1",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"adapter": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)",
|
||||
"help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"front": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)",
|
||||
"help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"anywhere": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)",
|
||||
"help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"specify adapters using fasta files for r1" : {
|
||||
"title": "Specify Adapters using Fasta files for R1",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"adapter_fasta": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, multiple_sep: `\":\"`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)",
|
||||
"help_text": "Type: List of `file`, multiple_sep: `\":\"`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"front_fasta": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)",
|
||||
"help_text": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"anywhere_fasta": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)",
|
||||
"help_text": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"specify adapters for r2" : {
|
||||
"title": "Specify Adapters for R2",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"adapter_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)",
|
||||
"help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"front_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)",
|
||||
"help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"anywhere_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)",
|
||||
"help_text": "Type: List of `string`, multiple_sep: `\":\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"specify adapters using fasta files for r2" : {
|
||||
"title": "Specify Adapters using Fasta files for R2",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"adapter_r2_fasta": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)",
|
||||
"help_text": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"front_r2_fasta": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)",
|
||||
"help_text": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"anywhere_r2_fasta": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)",
|
||||
"help_text": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"paired-end options" : {
|
||||
"title": "Paired-end options",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"pair_adapters": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Treat adapters given with -a/-A etc",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Treat adapters given with -a/-A etc. as pairs. Either both\nor none are removed from each read pair.\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"pair_filter": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, choices: ``any`, `both`, `first``. Which of the reads in a paired-end read have to match the\nfiltering criterion in order for the pair to be filtered",
|
||||
"help_text": "Type: `string`, choices: ``any`, `both`, `first``. Which of the reads in a paired-end read have to match the\nfiltering criterion in order for the pair to be filtered.\n",
|
||||
"enum": ["any", "both", "first"]
|
||||
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"interleaved": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Read and/or write interleaved paired-end reads",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Read and/or write interleaved paired-end reads.\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"input parameters" : {
|
||||
"title": "Input parameters",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"input": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. Input fastq file for single-end reads or R1 for paired-end reads",
|
||||
"help_text": "Type: `file`, required. Input fastq file for single-end reads or R1 for paired-end reads.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"input_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`. Input fastq file for R2 in the case of paired-end reads",
|
||||
"help_text": "Type: `file`. Input fastq file for R2 in the case of paired-end reads.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"error_rate": {
|
||||
"type":
|
||||
"number",
|
||||
"description": "Type: `double`, example: `0.1`. Maximum allowed error rate (if 0 \u003c= E \u003c 1), or absolute\nnumber of errors for full-length adapter match (if E is an\ninteger \u003e= 1)",
|
||||
"help_text": "Type: `double`, example: `0.1`. Maximum allowed error rate (if 0 \u003c= E \u003c 1), or absolute\nnumber of errors for full-length adapter match (if E is an\ninteger \u003e= 1). Error rate = no. of errors divided by\nlength of matching region. Default: 0.1 (10%).\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"no_indels": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_false`, default: `true`. Allow only mismatches in alignments",
|
||||
"help_text": "Type: `boolean_false`, default: `true`. Allow only mismatches in alignments.\n"
|
||||
,
|
||||
"default": "True"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"times": {
|
||||
"type":
|
||||
"integer",
|
||||
"description": "Type: `integer`, example: `1`. Remove up to COUNT adapters from each read",
|
||||
"help_text": "Type: `integer`, example: `1`. Remove up to COUNT adapters from each read. Default: 1.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"overlap": {
|
||||
"type":
|
||||
"integer",
|
||||
"description": "Type: `integer`, example: `3`. Require MINLENGTH overlap between read and adapter for an\nadapter to be found",
|
||||
"help_text": "Type: `integer`, example: `3`. Require MINLENGTH overlap between read and adapter for an\nadapter to be found. The default is 3.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"match_read_wildcards": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Interpret IUPAC wildcards in reads",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Interpret IUPAC wildcards in reads.\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"no_match_adapter_wildcards": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_false`, default: `true`. Do not interpret IUPAC wildcards in adapters",
|
||||
"help_text": "Type: `boolean_false`, default: `true`. Do not interpret IUPAC wildcards in adapters.\n"
|
||||
,
|
||||
"default": "True"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"action": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `trim`, choices: ``trim`, `retain`, `mask`, `lowercase`, `none``. What to do if a match was found",
|
||||
"help_text": "Type: `string`, example: `trim`, choices: ``trim`, `retain`, `mask`, `lowercase`, `none``. What to do if a match was found. trim: trim adapter and\nup- or downstream sequence; retain: trim, but retain\nadapter; mask: replace with \u0027N\u0027 characters; lowercase:\nconvert to lowercase; none: leave unchanged.\nThe default is trim.\n",
|
||||
"enum": ["trim", "retain", "mask", "lowercase", "none"]
|
||||
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"revcomp": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Check both the read and its reverse complement for adapter\nmatches",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Check both the read and its reverse complement for adapter\nmatches. If match is on reverse-complemented version,\noutput that one.\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"read modifications" : {
|
||||
"title": "Read modifications",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"cut": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `integer`, multiple_sep: `\":\"`. Remove LEN bases from each read (or R1 if paired; use --cut_r2\noption for R2)",
|
||||
"help_text": "Type: List of `integer`, multiple_sep: `\":\"`. Remove LEN bases from each read (or R1 if paired; use --cut_r2\noption for R2). If LEN is positive, remove bases from the\nbeginning. If LEN is negative, remove bases from the end.\nCan be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"cut_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `integer`, multiple_sep: `\":\"`. Remove LEN bases from each read (for R2)",
|
||||
"help_text": "Type: List of `integer`, multiple_sep: `\":\"`. Remove LEN bases from each read (for R2). If LEN is positive, remove bases from the\nbeginning. If LEN is negative, remove bases from the end.\nCan be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"nextseq_trim": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. NextSeq-specific quality trimming (each read)",
|
||||
"help_text": "Type: `string`. NextSeq-specific quality trimming (each read). Trims also\ndark cycles appearing as high-quality G bases.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"quality_cutoff": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. Trim low-quality bases from 5\u0027 and/or 3\u0027 ends of each read\nbefore adapter removal",
|
||||
"help_text": "Type: `string`. Trim low-quality bases from 5\u0027 and/or 3\u0027 ends of each read\nbefore adapter removal. Applied to both reads if data is\npaired. If one value is given, only the 3\u0027 end is trimmed.\nIf two comma-separated cutoffs are given, the 5\u0027 end is\ntrimmed with the first cutoff, the 3\u0027 end with the second.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"quality_cutoff_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. Quality-trimming cutoff for R2",
|
||||
"help_text": "Type: `string`. Quality-trimming cutoff for R2. Default: same as for R1\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"quality_base": {
|
||||
"type":
|
||||
"integer",
|
||||
"description": "Type: `integer`, example: `33`. Assume that quality values in FASTQ are encoded as\nascii(quality + N)",
|
||||
"help_text": "Type: `integer`, example: `33`. Assume that quality values in FASTQ are encoded as\nascii(quality + N). This needs to be set to 64 for some\nold Illumina FASTQ files. The default is 33.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"poly_a": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Trim poly-A tails",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Trim poly-A tails"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"length": {
|
||||
"type":
|
||||
"integer",
|
||||
"description": "Type: `integer`. Shorten reads to LENGTH",
|
||||
"help_text": "Type: `integer`. Shorten reads to LENGTH. Positive values remove bases at\nthe end while negative ones remove bases at the beginning.\nThis and the following modifications are applied after\nadapter trimming.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"trim_n": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Trim N\u0027s on ends of reads",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Trim N\u0027s on ends of reads."
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"length_tag": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `length=`. Search for TAG followed by a decimal number in the\ndescription field of the read",
|
||||
"help_text": "Type: `string`, example: `length=`. Search for TAG followed by a decimal number in the\ndescription field of the read. Replace the decimal number\nwith the correct length of the trimmed read. For example,\nuse --length-tag \u0027length=\u0027 to correct fields like\n\u0027length=123\u0027.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"strip_suffix": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. Remove this suffix from read names if present",
|
||||
"help_text": "Type: `string`. Remove this suffix from read names if present. Can be\ngiven multiple times.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"prefix": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. Add this prefix to read names",
|
||||
"help_text": "Type: `string`. Add this prefix to read names. Use {name} to insert the\nname of the matching adapter.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"suffix": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. Add this suffix to read names; can also include {name}\n",
|
||||
"help_text": "Type: `string`. Add this suffix to read names; can also include {name}\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"rename": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. Rename reads using TEMPLATE containing variables such as\n{id}, {adapter_name} etc",
|
||||
"help_text": "Type: `string`. Rename reads using TEMPLATE containing variables such as\n{id}, {adapter_name} etc. (see documentation)\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"zero_cap": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Change negative quality values to zero",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Change negative quality values to zero."
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"filtering of processed reads" : {
|
||||
"title": "Filtering of processed reads",
|
||||
"type": "object",
|
||||
"description": "Filters are applied after above read modifications. Paired-end reads are\nalways discarded pairwise (see also --pair_filter).\n",
|
||||
"properties": {
|
||||
|
||||
|
||||
"minimum_length": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `0`. Discard reads shorter than LEN",
|
||||
"help_text": "Type: `string`, example: `0`. Discard reads shorter than LEN. Default is 0.\nWhen trimming paired-end reads, the minimum lengths for R1 and R2 can be specified separately by separating them with a colon (:).\nIf the colon syntax is not used, the same minimum length applies to both reads, as discussed above.\nAlso, one of the values can be omitted to impose no restrictions.\nFor example, with -m 17:, the length of R1 must be at least 17, but the length of R2 is ignored.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"maximum_length": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. Discard reads longer than LEN",
|
||||
"help_text": "Type: `string`. Discard reads longer than LEN. Default: no limit.\nFor paired reads, see the remark for --minimum_length\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"max_n": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. Discard reads with more than COUNT \u0027N\u0027 bases",
|
||||
"help_text": "Type: `string`. Discard reads with more than COUNT \u0027N\u0027 bases. If COUNT is\na number between 0 and 1, it is interpreted as a fraction\nof the read length.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"max_expected_errors": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `long`. Discard reads whose expected number of errors (computed\nfrom quality values) exceeds ERRORS",
|
||||
"help_text": "Type: `long`. Discard reads whose expected number of errors (computed\nfrom quality values) exceeds ERRORS.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"max_average_error_rate": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `long`. as --max_expected_errors (see above), but divided by\nlength to account for reads of varying length",
|
||||
"help_text": "Type: `long`. as --max_expected_errors (see above), but divided by\nlength to account for reads of varying length.\n"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"discard_trimmed": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Discard reads that contain an adapter",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Discard reads that contain an adapter. Use also -O to\navoid discarding too many randomly matching reads.\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"discard_untrimmed": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Discard reads that do not contain an adapter",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Discard reads that do not contain an adapter.\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"discard_casava": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Discard reads that did not pass CASAVA filtering (header\nhas :Y:)",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Discard reads that did not pass CASAVA filtering (header\nhas :Y:).\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"output parameters" : {
|
||||
"title": "Output parameters",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"report": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `full`, choices: ``full`, `minimal``. Which type of report to print: \u0027full\u0027 (default) or \u0027minimal\u0027",
|
||||
"help_text": "Type: `string`, example: `full`, choices: ``full`, `minimal``. Which type of report to print: \u0027full\u0027 (default) or \u0027minimal\u0027.\n",
|
||||
"enum": ["full", "minimal"]
|
||||
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"json": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Write report in JSON format to this file",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Write report in JSON format to this file.\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"output": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, default: `$id.$key.output_*.fast[a,q]`, example: `fastq/*_001.fast[a,q]`, multiple_sep: `\":\"`. Glob pattern for matching the expected output files",
|
||||
"help_text": "Type: List of `file`, required, default: `$id.$key.output_*.fast[a,q]`, example: `fastq/*_001.fast[a,q]`, multiple_sep: `\":\"`. Glob pattern for matching the expected output files.\nShould include `$output_dir`.\n"
|
||||
,
|
||||
"default": "$id.$key.output_*.fast[a,q]"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"fasta": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Output FASTA to standard output even on FASTQ input",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Output FASTA to standard output even on FASTQ input.\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"info_file": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Write information about each read and its adapter matches\ninto info",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Write information about each read and its adapter matches\ninto info.txt in the output directory.\nSee the documentation for the file format.\n"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"debug" : {
|
||||
"title": "Debug",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"debug": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Print debug information",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Print debug information"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"nextflow input-output arguments" : {
|
||||
"title": "Nextflow input-output arguments",
|
||||
"type": "object",
|
||||
"description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
|
||||
"properties": {
|
||||
|
||||
|
||||
"publish_dir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required, example: `output/`. Path to an output directory",
|
||||
"help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"param_list": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
|
||||
"help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
|
||||
"hidden": true
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
}
|
||||
},
|
||||
"allOf": [
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/specify adapters for r1"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/specify adapters using fasta files for r1"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/specify adapters for r2"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/specify adapters using fasta files for r2"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/paired-end options"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/input parameters"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/read modifications"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/filtering of processed reads"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/output parameters"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/debug"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/nextflow input-output arguments"
|
||||
}
|
||||
]
|
||||
}
|
||||
@@ -0,0 +1,197 @@
|
||||
name: "concat_text"
|
||||
version: "concat_text"
|
||||
authors:
|
||||
- name: "Toni Verbeiren"
|
||||
roles:
|
||||
- "author"
|
||||
- "maintainer"
|
||||
info:
|
||||
links:
|
||||
github: "tverbeiren"
|
||||
linkedin: "verbeiren"
|
||||
organizations:
|
||||
- name: "Data Intuitive"
|
||||
href: "https://www.data-intuitive.com"
|
||||
role: "Data Scientist and CEO"
|
||||
- name: "Dries Schaumont"
|
||||
roles:
|
||||
- "reviewer"
|
||||
info:
|
||||
links:
|
||||
email: "dries@data-intuitive.com"
|
||||
github: "DriesSchaumont"
|
||||
orcid: "0000-0002-4389-0440"
|
||||
linkedin: "dries-schaumont"
|
||||
organizations:
|
||||
- name: "Data Intuitive"
|
||||
href: "https://www.data-intuitive.com"
|
||||
role: "Data Scientist"
|
||||
argument_groups:
|
||||
- name: "Input arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--input"
|
||||
description: "A list of (gzipped) text files."
|
||||
info: null
|
||||
example:
|
||||
- "input?.txt.gz"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- name: "Output arguments"
|
||||
arguments:
|
||||
- type: "boolean_true"
|
||||
name: "--gzip_output"
|
||||
description: "Should the output be zipped?"
|
||||
info: null
|
||||
direction: "input"
|
||||
- type: "file"
|
||||
name: "--output"
|
||||
description: "File to write the output to, optionally gzipped."
|
||||
info: null
|
||||
example:
|
||||
- "output.txt"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
resources:
|
||||
- type: "bash_script"
|
||||
path: "script.sh"
|
||||
is_executable: true
|
||||
description: "Concatenate a number of text files, handle gzipped text files gracefully\
|
||||
\ and\noptionally gzip the output text file.\n\nThis component is useful for concatening\
|
||||
\ fastq files from different lanes, for instance.\n"
|
||||
test_resources:
|
||||
- type: "bash_script"
|
||||
path: "test.sh"
|
||||
is_executable: true
|
||||
info:
|
||||
improvements: "This component could be improved in 2 ways:\n 1. Allow for a mix\
|
||||
\ of zipped and plain input files\n 2. Allow to specify a compression algorithm\
|
||||
\ for the output\n"
|
||||
status: "enabled"
|
||||
requirements:
|
||||
commands:
|
||||
- "ps"
|
||||
license: "MIT"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/craftbox"
|
||||
runners:
|
||||
- type: "executable"
|
||||
id: "executable"
|
||||
docker_setup_strategy: "ifneedbepullelsecachedbuild"
|
||||
- type: "nextflow"
|
||||
id: "nextflow"
|
||||
directives:
|
||||
tag: "$id"
|
||||
auto:
|
||||
simplifyInput: true
|
||||
simplifyOutput: false
|
||||
transcript: false
|
||||
publish: false
|
||||
config:
|
||||
labels:
|
||||
mem1gb: "memory = 1000000000.B"
|
||||
mem2gb: "memory = 2000000000.B"
|
||||
mem5gb: "memory = 5000000000.B"
|
||||
mem10gb: "memory = 10000000000.B"
|
||||
mem20gb: "memory = 20000000000.B"
|
||||
mem50gb: "memory = 50000000000.B"
|
||||
mem100gb: "memory = 100000000000.B"
|
||||
mem200gb: "memory = 200000000000.B"
|
||||
mem500gb: "memory = 500000000000.B"
|
||||
mem1tb: "memory = 1000000000000.B"
|
||||
mem2tb: "memory = 2000000000000.B"
|
||||
mem5tb: "memory = 5000000000000.B"
|
||||
mem10tb: "memory = 10000000000000.B"
|
||||
mem20tb: "memory = 20000000000000.B"
|
||||
mem50tb: "memory = 50000000000000.B"
|
||||
mem100tb: "memory = 100000000000000.B"
|
||||
mem200tb: "memory = 200000000000000.B"
|
||||
mem500tb: "memory = 500000000000000.B"
|
||||
mem1gib: "memory = 1073741824.B"
|
||||
mem2gib: "memory = 2147483648.B"
|
||||
mem4gib: "memory = 4294967296.B"
|
||||
mem8gib: "memory = 8589934592.B"
|
||||
mem16gib: "memory = 17179869184.B"
|
||||
mem32gib: "memory = 34359738368.B"
|
||||
mem64gib: "memory = 68719476736.B"
|
||||
mem128gib: "memory = 137438953472.B"
|
||||
mem256gib: "memory = 274877906944.B"
|
||||
mem512gib: "memory = 549755813888.B"
|
||||
mem1tib: "memory = 1099511627776.B"
|
||||
mem2tib: "memory = 2199023255552.B"
|
||||
mem4tib: "memory = 4398046511104.B"
|
||||
mem8tib: "memory = 8796093022208.B"
|
||||
mem16tib: "memory = 17592186044416.B"
|
||||
mem32tib: "memory = 35184372088832.B"
|
||||
mem64tib: "memory = 70368744177664.B"
|
||||
mem128tib: "memory = 140737488355328.B"
|
||||
mem256tib: "memory = 281474976710656.B"
|
||||
mem512tib: "memory = 562949953421312.B"
|
||||
cpu1: "cpus = 1"
|
||||
cpu2: "cpus = 2"
|
||||
cpu5: "cpus = 5"
|
||||
cpu10: "cpus = 10"
|
||||
cpu20: "cpus = 20"
|
||||
cpu50: "cpus = 50"
|
||||
cpu100: "cpus = 100"
|
||||
cpu200: "cpus = 200"
|
||||
cpu500: "cpus = 500"
|
||||
cpu1000: "cpus = 1000"
|
||||
debug: false
|
||||
container: "docker"
|
||||
engines:
|
||||
- type: "docker"
|
||||
id: "docker"
|
||||
image: "alpine:latest"
|
||||
target_registry: "images.viash-hub.com"
|
||||
target_tag: "concat_text"
|
||||
namespace_separator: "/"
|
||||
setup:
|
||||
- type: "apk"
|
||||
packages:
|
||||
- "bash"
|
||||
- "procps"
|
||||
- "file"
|
||||
entrypoint: []
|
||||
cmd: null
|
||||
- type: "native"
|
||||
id: "native"
|
||||
build_info:
|
||||
config: "src/concat_text/config.vsh.yaml"
|
||||
runner: "nextflow"
|
||||
engine: "docker|native"
|
||||
output: "target/nextflow/concat_text"
|
||||
executable: "target/nextflow/concat_text/main.nf"
|
||||
viash_version: "0.9.0-RC6"
|
||||
git_commit: "53228705a20c6764e3f0ae9ed2147e99009d7c34"
|
||||
git_remote: "https://github.com/viash-hub/craftbox"
|
||||
package_config:
|
||||
name: "craftbox"
|
||||
version: "concat_text"
|
||||
description: "A collection of custom-tailored scripts and applied tools.\n"
|
||||
info: null
|
||||
viash_version: "0.9.0-RC6"
|
||||
source: "src"
|
||||
target: "target"
|
||||
config_mods:
|
||||
- ".requirements.commands := ['ps']\n"
|
||||
- ".engines += { type: \"native\" }"
|
||||
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
|
||||
- ".engines[.type == 'docker'].target_tag := 'concat_text'"
|
||||
keywords:
|
||||
- "scripts"
|
||||
- "custom"
|
||||
- "implementations"
|
||||
license: "MIT"
|
||||
organization: "vsh"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/craftbox"
|
||||
issue_tracker: "https://github.com/viash-hub/craftbox/issues"
|
||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,126 @@
|
||||
manifest {
|
||||
name = 'concat_text'
|
||||
mainScript = 'main.nf'
|
||||
nextflowVersion = '!>=20.12.1-edge'
|
||||
version = 'concat_text'
|
||||
description = 'Concatenate a number of text files, handle gzipped text files gracefully and\noptionally gzip the output text file.\n\nThis component is useful for concatening fastq files from different lanes, for instance.\n'
|
||||
author = 'Toni Verbeiren, Dries Schaumont'
|
||||
}
|
||||
|
||||
process.container = 'nextflow/bash:latest'
|
||||
|
||||
// detect tempdir
|
||||
tempDir = java.nio.file.Paths.get(
|
||||
System.getenv('NXF_TEMP') ?:
|
||||
System.getenv('VIASH_TEMP') ?:
|
||||
System.getenv('TEMPDIR') ?:
|
||||
System.getenv('TMPDIR') ?:
|
||||
'/tmp'
|
||||
).toAbsolutePath()
|
||||
|
||||
profiles {
|
||||
no_publish {
|
||||
process {
|
||||
withName: '.*' {
|
||||
publishDir = [
|
||||
enabled: false
|
||||
]
|
||||
}
|
||||
}
|
||||
}
|
||||
mount_temp {
|
||||
docker.temp = tempDir
|
||||
podman.temp = tempDir
|
||||
charliecloud.temp = tempDir
|
||||
}
|
||||
docker {
|
||||
docker.enabled = true
|
||||
// docker.userEmulation = true
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
singularity {
|
||||
singularity.enabled = true
|
||||
singularity.autoMounts = true
|
||||
docker.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
podman {
|
||||
podman.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
shifter {
|
||||
shifter.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
charliecloud {
|
||||
charliecloud.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
}
|
||||
}
|
||||
|
||||
process{
|
||||
withLabel: mem1gb { memory = 1000000000.B }
|
||||
withLabel: mem2gb { memory = 2000000000.B }
|
||||
withLabel: mem5gb { memory = 5000000000.B }
|
||||
withLabel: mem10gb { memory = 10000000000.B }
|
||||
withLabel: mem20gb { memory = 20000000000.B }
|
||||
withLabel: mem50gb { memory = 50000000000.B }
|
||||
withLabel: mem100gb { memory = 100000000000.B }
|
||||
withLabel: mem200gb { memory = 200000000000.B }
|
||||
withLabel: mem500gb { memory = 500000000000.B }
|
||||
withLabel: mem1tb { memory = 1000000000000.B }
|
||||
withLabel: mem2tb { memory = 2000000000000.B }
|
||||
withLabel: mem5tb { memory = 5000000000000.B }
|
||||
withLabel: mem10tb { memory = 10000000000000.B }
|
||||
withLabel: mem20tb { memory = 20000000000000.B }
|
||||
withLabel: mem50tb { memory = 50000000000000.B }
|
||||
withLabel: mem100tb { memory = 100000000000000.B }
|
||||
withLabel: mem200tb { memory = 200000000000000.B }
|
||||
withLabel: mem500tb { memory = 500000000000000.B }
|
||||
withLabel: mem1gib { memory = 1073741824.B }
|
||||
withLabel: mem2gib { memory = 2147483648.B }
|
||||
withLabel: mem4gib { memory = 4294967296.B }
|
||||
withLabel: mem8gib { memory = 8589934592.B }
|
||||
withLabel: mem16gib { memory = 17179869184.B }
|
||||
withLabel: mem32gib { memory = 34359738368.B }
|
||||
withLabel: mem64gib { memory = 68719476736.B }
|
||||
withLabel: mem128gib { memory = 137438953472.B }
|
||||
withLabel: mem256gib { memory = 274877906944.B }
|
||||
withLabel: mem512gib { memory = 549755813888.B }
|
||||
withLabel: mem1tib { memory = 1099511627776.B }
|
||||
withLabel: mem2tib { memory = 2199023255552.B }
|
||||
withLabel: mem4tib { memory = 4398046511104.B }
|
||||
withLabel: mem8tib { memory = 8796093022208.B }
|
||||
withLabel: mem16tib { memory = 17592186044416.B }
|
||||
withLabel: mem32tib { memory = 35184372088832.B }
|
||||
withLabel: mem64tib { memory = 70368744177664.B }
|
||||
withLabel: mem128tib { memory = 140737488355328.B }
|
||||
withLabel: mem256tib { memory = 281474976710656.B }
|
||||
withLabel: mem512tib { memory = 562949953421312.B }
|
||||
withLabel: cpu1 { cpus = 1 }
|
||||
withLabel: cpu2 { cpus = 2 }
|
||||
withLabel: cpu5 { cpus = 5 }
|
||||
withLabel: cpu10 { cpus = 10 }
|
||||
withLabel: cpu20 { cpus = 20 }
|
||||
withLabel: cpu50 { cpus = 50 }
|
||||
withLabel: cpu100 { cpus = 100 }
|
||||
withLabel: cpu200 { cpus = 200 }
|
||||
withLabel: cpu500 { cpus = 500 }
|
||||
withLabel: cpu1000 { cpus = 1000 }
|
||||
}
|
||||
|
||||
|
||||
@@ -0,0 +1,106 @@
|
||||
{
|
||||
"$schema": "http://json-schema.org/draft-07/schema",
|
||||
"title": "concat_text",
|
||||
"description": "Concatenate a number of text files, handle gzipped text files gracefully and\noptionally gzip the output text file.\n\nThis component is useful for concatening fastq files from different lanes, for instance.\n",
|
||||
"type": "object",
|
||||
"definitions": {
|
||||
|
||||
|
||||
|
||||
"input arguments" : {
|
||||
"title": "Input arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"input": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, example: `input?.txt.gz`, multiple_sep: `\":\"`. A list of (gzipped) text files",
|
||||
"help_text": "Type: List of `file`, required, example: `input?.txt.gz`, multiple_sep: `\":\"`. A list of (gzipped) text files."
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"output arguments" : {
|
||||
"title": "Output arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"gzip_output": {
|
||||
"type":
|
||||
"boolean",
|
||||
"description": "Type: `boolean_true`, default: `false`. Should the output be zipped?",
|
||||
"help_text": "Type: `boolean_true`, default: `false`. Should the output be zipped?"
|
||||
,
|
||||
"default": "False"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"output": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, default: `$id.$key.output.txt`, example: `output.txt`. File to write the output to, optionally gzipped",
|
||||
"help_text": "Type: `file`, default: `$id.$key.output.txt`, example: `output.txt`. File to write the output to, optionally gzipped."
|
||||
,
|
||||
"default": "$id.$key.output.txt"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"nextflow input-output arguments" : {
|
||||
"title": "Nextflow input-output arguments",
|
||||
"type": "object",
|
||||
"description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
|
||||
"properties": {
|
||||
|
||||
|
||||
"publish_dir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required, example: `output/`. Path to an output directory",
|
||||
"help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"param_list": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
|
||||
"help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
|
||||
"hidden": true
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
}
|
||||
},
|
||||
"allOf": [
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/input arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/output arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/nextflow input-output arguments"
|
||||
}
|
||||
]
|
||||
}
|
||||
267
target/executable/parallel_map/.config.vsh.yaml
Normal file
267
target/executable/parallel_map/.config.vsh.yaml
Normal file
@@ -0,0 +1,267 @@
|
||||
name: "parallel_map"
|
||||
version: "main"
|
||||
argument_groups:
|
||||
- name: "Input arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--input_r1"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--input_r2"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--genomeDir"
|
||||
description: "STAR reference directory"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--barcodes"
|
||||
description: "The barcodes/wells to process"
|
||||
info: null
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- name: "Barcode arguments"
|
||||
arguments:
|
||||
- type: "integer"
|
||||
name: "--wellBarcodesLength"
|
||||
description: "The length of the well barcodes"
|
||||
info: null
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "integer"
|
||||
name: "--umiLength"
|
||||
description: "The length of the UMIs"
|
||||
info: null
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--limitBAMsortRAM"
|
||||
info: null
|
||||
default:
|
||||
- "10000000000"
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- name: "Runtime arguments"
|
||||
arguments:
|
||||
- type: "integer"
|
||||
name: "--runThreadN"
|
||||
description: "Number of threads to use for a single STAR execution."
|
||||
info: null
|
||||
default:
|
||||
- 1
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- name: "Output arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--output"
|
||||
description: "Location of the output folders, 1 folder per barcode. The value\
|
||||
\ used\nfor this argument must contain a '*', which will be replaced with the\n\
|
||||
barcode to form the final output location for that barcode.\n"
|
||||
info: null
|
||||
default:
|
||||
- "./*"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--joblog"
|
||||
description: "Where to store the log file listing all the jobs."
|
||||
info: null
|
||||
default:
|
||||
- "execution_log.txt"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
resources:
|
||||
- type: "bash_script"
|
||||
path: "script.sh"
|
||||
is_executable: true
|
||||
- type: "file"
|
||||
path: "nextflow_labels.config"
|
||||
dest: "nextflow_labels.config"
|
||||
description: "Map wells in batch, using STAR\nSpliced Transcripts Alignment to a Reference\
|
||||
\ (C) Alexander Dobin\nhttps://github.com/alexdobin/STAR\n"
|
||||
test_resources:
|
||||
- type: "bash_script"
|
||||
path: "test.sh"
|
||||
is_executable: true
|
||||
info: null
|
||||
status: "enabled"
|
||||
requirements:
|
||||
commands:
|
||||
- "ps"
|
||||
license: "MIT"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
runners:
|
||||
- type: "executable"
|
||||
id: "executable"
|
||||
docker_setup_strategy: "ifneedbepullelsecachedbuild"
|
||||
- type: "nextflow"
|
||||
id: "nextflow"
|
||||
directives:
|
||||
tag: "$id"
|
||||
auto:
|
||||
simplifyInput: true
|
||||
simplifyOutput: false
|
||||
transcript: false
|
||||
publish: false
|
||||
config:
|
||||
labels:
|
||||
mem1gb: "memory = 1000000000.B"
|
||||
mem2gb: "memory = 2000000000.B"
|
||||
mem5gb: "memory = 5000000000.B"
|
||||
mem10gb: "memory = 10000000000.B"
|
||||
mem20gb: "memory = 20000000000.B"
|
||||
mem50gb: "memory = 50000000000.B"
|
||||
mem100gb: "memory = 100000000000.B"
|
||||
mem200gb: "memory = 200000000000.B"
|
||||
mem500gb: "memory = 500000000000.B"
|
||||
mem1tb: "memory = 1000000000000.B"
|
||||
mem2tb: "memory = 2000000000000.B"
|
||||
mem5tb: "memory = 5000000000000.B"
|
||||
mem10tb: "memory = 10000000000000.B"
|
||||
mem20tb: "memory = 20000000000000.B"
|
||||
mem50tb: "memory = 50000000000000.B"
|
||||
mem100tb: "memory = 100000000000000.B"
|
||||
mem200tb: "memory = 200000000000000.B"
|
||||
mem500tb: "memory = 500000000000000.B"
|
||||
mem1gib: "memory = 1073741824.B"
|
||||
mem2gib: "memory = 2147483648.B"
|
||||
mem4gib: "memory = 4294967296.B"
|
||||
mem8gib: "memory = 8589934592.B"
|
||||
mem16gib: "memory = 17179869184.B"
|
||||
mem32gib: "memory = 34359738368.B"
|
||||
mem64gib: "memory = 68719476736.B"
|
||||
mem128gib: "memory = 137438953472.B"
|
||||
mem256gib: "memory = 274877906944.B"
|
||||
mem512gib: "memory = 549755813888.B"
|
||||
mem1tib: "memory = 1099511627776.B"
|
||||
mem2tib: "memory = 2199023255552.B"
|
||||
mem4tib: "memory = 4398046511104.B"
|
||||
mem8tib: "memory = 8796093022208.B"
|
||||
mem16tib: "memory = 17592186044416.B"
|
||||
mem32tib: "memory = 35184372088832.B"
|
||||
mem64tib: "memory = 70368744177664.B"
|
||||
mem128tib: "memory = 140737488355328.B"
|
||||
mem256tib: "memory = 281474976710656.B"
|
||||
mem512tib: "memory = 562949953421312.B"
|
||||
cpu1: "cpus = 1"
|
||||
cpu2: "cpus = 2"
|
||||
cpu5: "cpus = 5"
|
||||
cpu10: "cpus = 10"
|
||||
cpu20: "cpus = 20"
|
||||
cpu50: "cpus = 50"
|
||||
cpu100: "cpus = 100"
|
||||
cpu200: "cpus = 200"
|
||||
cpu500: "cpus = 500"
|
||||
cpu1000: "cpus = 1000"
|
||||
script:
|
||||
- "includeConfig(\"nextflow_labels.config\")"
|
||||
debug: false
|
||||
container: "docker"
|
||||
engines:
|
||||
- type: "docker"
|
||||
id: "docker"
|
||||
image: "debian:stable-slim"
|
||||
target_registry: "images.viash-hub.com"
|
||||
target_tag: "main"
|
||||
namespace_separator: "/"
|
||||
setup:
|
||||
- type: "apt"
|
||||
packages:
|
||||
- "procps"
|
||||
- "gzip"
|
||||
- "bzip2"
|
||||
- "parallel"
|
||||
- "wget"
|
||||
- "zlib1g-dev"
|
||||
- "unzip"
|
||||
- "xxd"
|
||||
- "file"
|
||||
interactive: false
|
||||
- type: "docker"
|
||||
run:
|
||||
- "wget -O $STAR_TARGET $STAR_SOURCE && \\\n unzip $STAR_TARGET -d /tmp && \\\
|
||||
\n mv /tmp/STAR_$STAR_VERSION/Linux_x86_64_static/STAR /usr/local/bin/$STAR_BINARY\
|
||||
\ && \\\n chmod +x /usr/local/bin/$STAR_BINARY && \\\n rm $STAR_TARGET &&\
|
||||
\ rm -rf /tmp/STAR_$STAR_VERSION\n"
|
||||
env:
|
||||
- "STAR_VERSION \"2.7.11b\""
|
||||
- "STAR_SOURCE \"https://github.com/alexdobin/STAR/releases/download/$STAR_VERSION/STAR_$STAR_VERSION.zip\""
|
||||
- "STAR_TARGET \"/tmp/star.zip\""
|
||||
- "STAR_BINARY \"STAR\""
|
||||
entrypoint: []
|
||||
cmd: null
|
||||
- type: "native"
|
||||
id: "native"
|
||||
build_info:
|
||||
config: "src/parallel_map/config.vsh.yaml"
|
||||
runner: "executable"
|
||||
engine: "docker|native"
|
||||
output: "target/executable/parallel_map"
|
||||
executable: "target/executable/parallel_map/parallel_map"
|
||||
viash_version: "0.9.0-RC7"
|
||||
git_commit: "21831c2104098ecce57aa9b372e49f865296cc48"
|
||||
git_remote: "https://github.com/viash-hub/htrnaseq"
|
||||
package_config:
|
||||
name: "htrnaseq"
|
||||
version: "main"
|
||||
description: "High-throughput pipeline [WIP]\n"
|
||||
info: null
|
||||
viash_version: "0.9.0-RC7"
|
||||
source: "src"
|
||||
target: "target"
|
||||
config_mods:
|
||||
- ".requirements.commands := ['ps']\n.runners[.type == 'nextflow'].config.script\
|
||||
\ := 'includeConfig(\"nextflow_labels.config\")'\n.resources += {path: '/src/config/labels.config',\
|
||||
\ dest: 'nextflow_labels.config'}\n"
|
||||
- ".engines += { type: \"native\" }"
|
||||
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
|
||||
- ".engines[.type == 'docker'].target_tag := 'main'"
|
||||
keywords:
|
||||
- "bioinformatics"
|
||||
- "sequence"
|
||||
- "high-throughput"
|
||||
- "mapping"
|
||||
- "counting"
|
||||
- "pipeline"
|
||||
license: "MIT"
|
||||
organization: "vsh"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
issue_tracker: "https://github.com/viash-hub/htrnaseq/issues"
|
||||
43
target/executable/parallel_map/nextflow_labels.config
Normal file
43
target/executable/parallel_map/nextflow_labels.config
Normal file
@@ -0,0 +1,43 @@
|
||||
process {
|
||||
// Default resources for components that hardly do any processing
|
||||
memory = { 2.GB * task.attempt }
|
||||
cpus = 1
|
||||
|
||||
// Retry for exit codes that have something to do with memory issues
|
||||
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
|
||||
maxRetries = 3
|
||||
maxMemory = null
|
||||
|
||||
// Resource labels
|
||||
withLabel: singlecpu { cpus = 1 }
|
||||
withLabel: lowcpu { cpus = 4 }
|
||||
withLabel: midcpu { cpus = 10 }
|
||||
withLabel: highcpu { cpus = 20 }
|
||||
|
||||
withLabel: lowmem { memory = { get_memory( 4.GB * task.attempt ) } }
|
||||
withLabel: midmem { memory = { get_memory( 25.GB * task.attempt ) } }
|
||||
withLabel: highmem { memory = { get_memory( 50.GB * task.attempt ) } }
|
||||
withLabel: veryhighmem { memory = { get_memory( 75.GB * task.attempt ) } }
|
||||
|
||||
}
|
||||
|
||||
def get_memory(to_compare) {
|
||||
if (!process.containsKey("maxMemory") || !process.maxMemory) {
|
||||
return to_compare
|
||||
}
|
||||
|
||||
try {
|
||||
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
|
||||
return process.maxMemory
|
||||
}
|
||||
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
|
||||
return max_memory as nextflow.util.MemoryUnit
|
||||
}
|
||||
else {
|
||||
return to_compare
|
||||
}
|
||||
} catch (all) {
|
||||
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
|
||||
System.exit(1)
|
||||
}
|
||||
}
|
||||
1660
target/executable/parallel_map/parallel_map
Executable file
1660
target/executable/parallel_map/parallel_map
Executable file
File diff suppressed because it is too large
Load Diff
267
target/nextflow/parallel_map/.config.vsh.yaml
Normal file
267
target/nextflow/parallel_map/.config.vsh.yaml
Normal file
@@ -0,0 +1,267 @@
|
||||
name: "parallel_map"
|
||||
version: "main"
|
||||
argument_groups:
|
||||
- name: "Input arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--input_r1"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--input_r2"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--genomeDir"
|
||||
description: "STAR reference directory"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--barcodes"
|
||||
description: "The barcodes/wells to process"
|
||||
info: null
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- name: "Barcode arguments"
|
||||
arguments:
|
||||
- type: "integer"
|
||||
name: "--wellBarcodesLength"
|
||||
description: "The length of the well barcodes"
|
||||
info: null
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "integer"
|
||||
name: "--umiLength"
|
||||
description: "The length of the UMIs"
|
||||
info: null
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--limitBAMsortRAM"
|
||||
info: null
|
||||
default:
|
||||
- "10000000000"
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- name: "Runtime arguments"
|
||||
arguments:
|
||||
- type: "integer"
|
||||
name: "--runThreadN"
|
||||
description: "Number of threads to use for a single STAR execution."
|
||||
info: null
|
||||
default:
|
||||
- 1
|
||||
required: false
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- name: "Output arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--output"
|
||||
description: "Location of the output folders, 1 folder per barcode. The value\
|
||||
\ used\nfor this argument must contain a '*', which will be replaced with the\n\
|
||||
barcode to form the final output location for that barcode.\n"
|
||||
info: null
|
||||
default:
|
||||
- "./*"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--joblog"
|
||||
description: "Where to store the log file listing all the jobs."
|
||||
info: null
|
||||
default:
|
||||
- "execution_log.txt"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
resources:
|
||||
- type: "bash_script"
|
||||
path: "script.sh"
|
||||
is_executable: true
|
||||
- type: "file"
|
||||
path: "nextflow_labels.config"
|
||||
dest: "nextflow_labels.config"
|
||||
description: "Map wells in batch, using STAR\nSpliced Transcripts Alignment to a Reference\
|
||||
\ (C) Alexander Dobin\nhttps://github.com/alexdobin/STAR\n"
|
||||
test_resources:
|
||||
- type: "bash_script"
|
||||
path: "test.sh"
|
||||
is_executable: true
|
||||
info: null
|
||||
status: "enabled"
|
||||
requirements:
|
||||
commands:
|
||||
- "ps"
|
||||
license: "MIT"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
runners:
|
||||
- type: "executable"
|
||||
id: "executable"
|
||||
docker_setup_strategy: "ifneedbepullelsecachedbuild"
|
||||
- type: "nextflow"
|
||||
id: "nextflow"
|
||||
directives:
|
||||
tag: "$id"
|
||||
auto:
|
||||
simplifyInput: true
|
||||
simplifyOutput: false
|
||||
transcript: false
|
||||
publish: false
|
||||
config:
|
||||
labels:
|
||||
mem1gb: "memory = 1000000000.B"
|
||||
mem2gb: "memory = 2000000000.B"
|
||||
mem5gb: "memory = 5000000000.B"
|
||||
mem10gb: "memory = 10000000000.B"
|
||||
mem20gb: "memory = 20000000000.B"
|
||||
mem50gb: "memory = 50000000000.B"
|
||||
mem100gb: "memory = 100000000000.B"
|
||||
mem200gb: "memory = 200000000000.B"
|
||||
mem500gb: "memory = 500000000000.B"
|
||||
mem1tb: "memory = 1000000000000.B"
|
||||
mem2tb: "memory = 2000000000000.B"
|
||||
mem5tb: "memory = 5000000000000.B"
|
||||
mem10tb: "memory = 10000000000000.B"
|
||||
mem20tb: "memory = 20000000000000.B"
|
||||
mem50tb: "memory = 50000000000000.B"
|
||||
mem100tb: "memory = 100000000000000.B"
|
||||
mem200tb: "memory = 200000000000000.B"
|
||||
mem500tb: "memory = 500000000000000.B"
|
||||
mem1gib: "memory = 1073741824.B"
|
||||
mem2gib: "memory = 2147483648.B"
|
||||
mem4gib: "memory = 4294967296.B"
|
||||
mem8gib: "memory = 8589934592.B"
|
||||
mem16gib: "memory = 17179869184.B"
|
||||
mem32gib: "memory = 34359738368.B"
|
||||
mem64gib: "memory = 68719476736.B"
|
||||
mem128gib: "memory = 137438953472.B"
|
||||
mem256gib: "memory = 274877906944.B"
|
||||
mem512gib: "memory = 549755813888.B"
|
||||
mem1tib: "memory = 1099511627776.B"
|
||||
mem2tib: "memory = 2199023255552.B"
|
||||
mem4tib: "memory = 4398046511104.B"
|
||||
mem8tib: "memory = 8796093022208.B"
|
||||
mem16tib: "memory = 17592186044416.B"
|
||||
mem32tib: "memory = 35184372088832.B"
|
||||
mem64tib: "memory = 70368744177664.B"
|
||||
mem128tib: "memory = 140737488355328.B"
|
||||
mem256tib: "memory = 281474976710656.B"
|
||||
mem512tib: "memory = 562949953421312.B"
|
||||
cpu1: "cpus = 1"
|
||||
cpu2: "cpus = 2"
|
||||
cpu5: "cpus = 5"
|
||||
cpu10: "cpus = 10"
|
||||
cpu20: "cpus = 20"
|
||||
cpu50: "cpus = 50"
|
||||
cpu100: "cpus = 100"
|
||||
cpu200: "cpus = 200"
|
||||
cpu500: "cpus = 500"
|
||||
cpu1000: "cpus = 1000"
|
||||
script:
|
||||
- "includeConfig(\"nextflow_labels.config\")"
|
||||
debug: false
|
||||
container: "docker"
|
||||
engines:
|
||||
- type: "docker"
|
||||
id: "docker"
|
||||
image: "debian:stable-slim"
|
||||
target_registry: "images.viash-hub.com"
|
||||
target_tag: "main"
|
||||
namespace_separator: "/"
|
||||
setup:
|
||||
- type: "apt"
|
||||
packages:
|
||||
- "procps"
|
||||
- "gzip"
|
||||
- "bzip2"
|
||||
- "parallel"
|
||||
- "wget"
|
||||
- "zlib1g-dev"
|
||||
- "unzip"
|
||||
- "xxd"
|
||||
- "file"
|
||||
interactive: false
|
||||
- type: "docker"
|
||||
run:
|
||||
- "wget -O $STAR_TARGET $STAR_SOURCE && \\\n unzip $STAR_TARGET -d /tmp && \\\
|
||||
\n mv /tmp/STAR_$STAR_VERSION/Linux_x86_64_static/STAR /usr/local/bin/$STAR_BINARY\
|
||||
\ && \\\n chmod +x /usr/local/bin/$STAR_BINARY && \\\n rm $STAR_TARGET &&\
|
||||
\ rm -rf /tmp/STAR_$STAR_VERSION\n"
|
||||
env:
|
||||
- "STAR_VERSION \"2.7.11b\""
|
||||
- "STAR_SOURCE \"https://github.com/alexdobin/STAR/releases/download/$STAR_VERSION/STAR_$STAR_VERSION.zip\""
|
||||
- "STAR_TARGET \"/tmp/star.zip\""
|
||||
- "STAR_BINARY \"STAR\""
|
||||
entrypoint: []
|
||||
cmd: null
|
||||
- type: "native"
|
||||
id: "native"
|
||||
build_info:
|
||||
config: "src/parallel_map/config.vsh.yaml"
|
||||
runner: "nextflow"
|
||||
engine: "docker|native"
|
||||
output: "target/nextflow/parallel_map"
|
||||
executable: "target/nextflow/parallel_map/main.nf"
|
||||
viash_version: "0.9.0-RC7"
|
||||
git_commit: "21831c2104098ecce57aa9b372e49f865296cc48"
|
||||
git_remote: "https://github.com/viash-hub/htrnaseq"
|
||||
package_config:
|
||||
name: "htrnaseq"
|
||||
version: "main"
|
||||
description: "High-throughput pipeline [WIP]\n"
|
||||
info: null
|
||||
viash_version: "0.9.0-RC7"
|
||||
source: "src"
|
||||
target: "target"
|
||||
config_mods:
|
||||
- ".requirements.commands := ['ps']\n.runners[.type == 'nextflow'].config.script\
|
||||
\ := 'includeConfig(\"nextflow_labels.config\")'\n.resources += {path: '/src/config/labels.config',\
|
||||
\ dest: 'nextflow_labels.config'}\n"
|
||||
- ".engines += { type: \"native\" }"
|
||||
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
|
||||
- ".engines[.type == 'docker'].target_tag := 'main'"
|
||||
keywords:
|
||||
- "bioinformatics"
|
||||
- "sequence"
|
||||
- "high-throughput"
|
||||
- "mapping"
|
||||
- "counting"
|
||||
- "pipeline"
|
||||
license: "MIT"
|
||||
organization: "vsh"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
issue_tracker: "https://github.com/viash-hub/htrnaseq/issues"
|
||||
3914
target/nextflow/parallel_map/main.nf
Normal file
3914
target/nextflow/parallel_map/main.nf
Normal file
File diff suppressed because it is too large
Load Diff
125
target/nextflow/parallel_map/nextflow.config
Normal file
125
target/nextflow/parallel_map/nextflow.config
Normal file
@@ -0,0 +1,125 @@
|
||||
manifest {
|
||||
name = 'parallel_map'
|
||||
mainScript = 'main.nf'
|
||||
nextflowVersion = '!>=20.12.1-edge'
|
||||
version = 'main'
|
||||
description = 'Map wells in batch, using STAR\nSpliced Transcripts Alignment to a Reference (C) Alexander Dobin\nhttps://github.com/alexdobin/STAR\n'
|
||||
}
|
||||
|
||||
process.container = 'nextflow/bash:latest'
|
||||
|
||||
// detect tempdir
|
||||
tempDir = java.nio.file.Paths.get(
|
||||
System.getenv('NXF_TEMP') ?:
|
||||
System.getenv('VIASH_TEMP') ?:
|
||||
System.getenv('TEMPDIR') ?:
|
||||
System.getenv('TMPDIR') ?:
|
||||
'/tmp'
|
||||
).toAbsolutePath()
|
||||
|
||||
profiles {
|
||||
no_publish {
|
||||
process {
|
||||
withName: '.*' {
|
||||
publishDir = [
|
||||
enabled: false
|
||||
]
|
||||
}
|
||||
}
|
||||
}
|
||||
mount_temp {
|
||||
docker.temp = tempDir
|
||||
podman.temp = tempDir
|
||||
charliecloud.temp = tempDir
|
||||
}
|
||||
docker {
|
||||
docker.enabled = true
|
||||
// docker.userEmulation = true
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
singularity {
|
||||
singularity.enabled = true
|
||||
singularity.autoMounts = true
|
||||
docker.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
podman {
|
||||
podman.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
shifter {
|
||||
shifter.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
charliecloud {
|
||||
charliecloud.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
}
|
||||
}
|
||||
|
||||
process{
|
||||
withLabel: mem1gb { memory = 1000000000.B }
|
||||
withLabel: mem2gb { memory = 2000000000.B }
|
||||
withLabel: mem5gb { memory = 5000000000.B }
|
||||
withLabel: mem10gb { memory = 10000000000.B }
|
||||
withLabel: mem20gb { memory = 20000000000.B }
|
||||
withLabel: mem50gb { memory = 50000000000.B }
|
||||
withLabel: mem100gb { memory = 100000000000.B }
|
||||
withLabel: mem200gb { memory = 200000000000.B }
|
||||
withLabel: mem500gb { memory = 500000000000.B }
|
||||
withLabel: mem1tb { memory = 1000000000000.B }
|
||||
withLabel: mem2tb { memory = 2000000000000.B }
|
||||
withLabel: mem5tb { memory = 5000000000000.B }
|
||||
withLabel: mem10tb { memory = 10000000000000.B }
|
||||
withLabel: mem20tb { memory = 20000000000000.B }
|
||||
withLabel: mem50tb { memory = 50000000000000.B }
|
||||
withLabel: mem100tb { memory = 100000000000000.B }
|
||||
withLabel: mem200tb { memory = 200000000000000.B }
|
||||
withLabel: mem500tb { memory = 500000000000000.B }
|
||||
withLabel: mem1gib { memory = 1073741824.B }
|
||||
withLabel: mem2gib { memory = 2147483648.B }
|
||||
withLabel: mem4gib { memory = 4294967296.B }
|
||||
withLabel: mem8gib { memory = 8589934592.B }
|
||||
withLabel: mem16gib { memory = 17179869184.B }
|
||||
withLabel: mem32gib { memory = 34359738368.B }
|
||||
withLabel: mem64gib { memory = 68719476736.B }
|
||||
withLabel: mem128gib { memory = 137438953472.B }
|
||||
withLabel: mem256gib { memory = 274877906944.B }
|
||||
withLabel: mem512gib { memory = 549755813888.B }
|
||||
withLabel: mem1tib { memory = 1099511627776.B }
|
||||
withLabel: mem2tib { memory = 2199023255552.B }
|
||||
withLabel: mem4tib { memory = 4398046511104.B }
|
||||
withLabel: mem8tib { memory = 8796093022208.B }
|
||||
withLabel: mem16tib { memory = 17592186044416.B }
|
||||
withLabel: mem32tib { memory = 35184372088832.B }
|
||||
withLabel: mem64tib { memory = 70368744177664.B }
|
||||
withLabel: mem128tib { memory = 140737488355328.B }
|
||||
withLabel: mem256tib { memory = 281474976710656.B }
|
||||
withLabel: mem512tib { memory = 562949953421312.B }
|
||||
withLabel: cpu1 { cpus = 1 }
|
||||
withLabel: cpu2 { cpus = 2 }
|
||||
withLabel: cpu5 { cpus = 5 }
|
||||
withLabel: cpu10 { cpus = 10 }
|
||||
withLabel: cpu20 { cpus = 20 }
|
||||
withLabel: cpu50 { cpus = 50 }
|
||||
withLabel: cpu100 { cpus = 100 }
|
||||
withLabel: cpu200 { cpus = 200 }
|
||||
withLabel: cpu500 { cpus = 500 }
|
||||
withLabel: cpu1000 { cpus = 1000 }
|
||||
}
|
||||
|
||||
includeConfig("nextflow_labels.config")
|
||||
43
target/nextflow/parallel_map/nextflow_labels.config
Normal file
43
target/nextflow/parallel_map/nextflow_labels.config
Normal file
@@ -0,0 +1,43 @@
|
||||
process {
|
||||
// Default resources for components that hardly do any processing
|
||||
memory = { 2.GB * task.attempt }
|
||||
cpus = 1
|
||||
|
||||
// Retry for exit codes that have something to do with memory issues
|
||||
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
|
||||
maxRetries = 3
|
||||
maxMemory = null
|
||||
|
||||
// Resource labels
|
||||
withLabel: singlecpu { cpus = 1 }
|
||||
withLabel: lowcpu { cpus = 4 }
|
||||
withLabel: midcpu { cpus = 10 }
|
||||
withLabel: highcpu { cpus = 20 }
|
||||
|
||||
withLabel: lowmem { memory = { get_memory( 4.GB * task.attempt ) } }
|
||||
withLabel: midmem { memory = { get_memory( 25.GB * task.attempt ) } }
|
||||
withLabel: highmem { memory = { get_memory( 50.GB * task.attempt ) } }
|
||||
withLabel: veryhighmem { memory = { get_memory( 75.GB * task.attempt ) } }
|
||||
|
||||
}
|
||||
|
||||
def get_memory(to_compare) {
|
||||
if (!process.containsKey("maxMemory") || !process.maxMemory) {
|
||||
return to_compare
|
||||
}
|
||||
|
||||
try {
|
||||
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
|
||||
return process.maxMemory
|
||||
}
|
||||
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
|
||||
return max_memory as nextflow.util.MemoryUnit
|
||||
}
|
||||
else {
|
||||
return to_compare
|
||||
}
|
||||
} catch (all) {
|
||||
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
|
||||
System.exit(1)
|
||||
}
|
||||
}
|
||||
206
target/nextflow/parallel_map/nextflow_schema.json
Normal file
206
target/nextflow/parallel_map/nextflow_schema.json
Normal file
@@ -0,0 +1,206 @@
|
||||
{
|
||||
"$schema": "http://json-schema.org/draft-07/schema",
|
||||
"title": "parallel_map",
|
||||
"description": "Map wells in batch, using STAR\nSpliced Transcripts Alignment to a Reference (C) Alexander Dobin\nhttps://github.com/alexdobin/STAR\n",
|
||||
"type": "object",
|
||||
"definitions": {
|
||||
|
||||
|
||||
|
||||
"input arguments" : {
|
||||
"title": "Input arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"input_r1": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, multiple_sep: `\";\"`. ",
|
||||
"help_text": "Type: List of `file`, required, multiple_sep: `\";\"`. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"input_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, multiple_sep: `\";\"`. ",
|
||||
"help_text": "Type: List of `file`, required, multiple_sep: `\";\"`. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"genomeDir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. STAR reference directory",
|
||||
"help_text": "Type: `file`, required. STAR reference directory"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"barcodes": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `string`, required, multiple_sep: `\";\"`. The barcodes/wells to process",
|
||||
"help_text": "Type: List of `string`, required, multiple_sep: `\";\"`. The barcodes/wells to process"
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"barcode arguments" : {
|
||||
"title": "Barcode arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"wellBarcodesLength": {
|
||||
"type":
|
||||
"integer",
|
||||
"description": "Type: `integer`, required. The length of the well barcodes",
|
||||
"help_text": "Type: `integer`, required. The length of the well barcodes"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"umiLength": {
|
||||
"type":
|
||||
"integer",
|
||||
"description": "Type: `integer`, required. The length of the UMIs",
|
||||
"help_text": "Type: `integer`, required. The length of the UMIs"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"limitBAMsortRAM": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, default: `10000000000`. ",
|
||||
"help_text": "Type: `string`, default: `10000000000`. "
|
||||
,
|
||||
"default": "10000000000"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"runtime arguments" : {
|
||||
"title": "Runtime arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"runThreadN": {
|
||||
"type":
|
||||
"integer",
|
||||
"description": "Type: `integer`, default: `1`. Number of threads to use for a single STAR execution",
|
||||
"help_text": "Type: `integer`, default: `1`. Number of threads to use for a single STAR execution."
|
||||
,
|
||||
"default": "1"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"output arguments" : {
|
||||
"title": "Output arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"output": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, default: `$id.$key.output_*./*`, multiple_sep: `\";\"`. Location of the output folders, 1 folder per barcode",
|
||||
"help_text": "Type: List of `file`, required, default: `$id.$key.output_*./*`, multiple_sep: `\";\"`. Location of the output folders, 1 folder per barcode. The value used\nfor this argument must contain a \u0027*\u0027, which will be replaced with the\nbarcode to form the final output location for that barcode.\n"
|
||||
,
|
||||
"default": "$id.$key.output_*./*"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"joblog": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, default: `$id.$key.joblog.txt`. Where to store the log file listing all the jobs",
|
||||
"help_text": "Type: `file`, default: `$id.$key.joblog.txt`. Where to store the log file listing all the jobs."
|
||||
,
|
||||
"default": "$id.$key.joblog.txt"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"nextflow input-output arguments" : {
|
||||
"title": "Nextflow input-output arguments",
|
||||
"type": "object",
|
||||
"description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
|
||||
"properties": {
|
||||
|
||||
|
||||
"publish_dir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required, example: `output/`. Path to an output directory",
|
||||
"help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"param_list": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
|
||||
"help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
|
||||
"hidden": true
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
}
|
||||
},
|
||||
"allOf": [
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/input arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/barcode arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/runtime arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/output arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/nextflow input-output arguments"
|
||||
}
|
||||
]
|
||||
}
|
||||
234
target/nextflow/workflows/htrnaseq/.config.vsh.yaml
Normal file
234
target/nextflow/workflows/htrnaseq/.config.vsh.yaml
Normal file
@@ -0,0 +1,234 @@
|
||||
name: "htrnaseq"
|
||||
namespace: "workflows"
|
||||
version: "main"
|
||||
argument_groups:
|
||||
- name: "Input arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--input_r1"
|
||||
description: "R1"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--input_r2"
|
||||
description: "R2"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--barcodesFasta"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--genomeDir"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- name: "Output arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--fastq_output_r1"
|
||||
description: "List of demultiplexed fastq files"
|
||||
info: null
|
||||
default:
|
||||
- "fastq/*_R1_001.fastq"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--fastq_output_r2"
|
||||
description: "List of demultiplexed fastq files"
|
||||
info: null
|
||||
default:
|
||||
- "fastq/*_R2_001.fastq"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--star_output"
|
||||
description: "Output from mapping with STAR"
|
||||
info: null
|
||||
default:
|
||||
- "$id/star/*"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
resources:
|
||||
- type: "nextflow_script"
|
||||
path: "main.nf"
|
||||
is_executable: true
|
||||
entrypoint: "run_wf"
|
||||
- type: "file"
|
||||
path: "nextflow_labels.config"
|
||||
dest: "nextflow_labels.config"
|
||||
info: null
|
||||
status: "enabled"
|
||||
requirements:
|
||||
commands:
|
||||
- "ps"
|
||||
dependencies:
|
||||
- name: "workflows/well_demultiplex"
|
||||
repository:
|
||||
type: "local"
|
||||
- name: "workflows/parallel_map_wf"
|
||||
repository:
|
||||
type: "local"
|
||||
- name: "workflows/utils/groupWells"
|
||||
repository:
|
||||
type: "local"
|
||||
- name: "concat_text"
|
||||
repository:
|
||||
type: "vsh"
|
||||
repo: "craftbox"
|
||||
tag: "concat_text"
|
||||
repositories:
|
||||
- type: "local"
|
||||
name: "local"
|
||||
- type: "vsh"
|
||||
name: "bb"
|
||||
repo: "biobox"
|
||||
tag: "v0.1.0"
|
||||
- type: "vsh"
|
||||
name: "cb"
|
||||
repo: "craftbox"
|
||||
tag: "concat_text"
|
||||
license: "MIT"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
runners:
|
||||
- type: "nextflow"
|
||||
id: "nextflow"
|
||||
directives:
|
||||
tag: "$id"
|
||||
auto:
|
||||
simplifyInput: true
|
||||
simplifyOutput: false
|
||||
transcript: false
|
||||
publish: false
|
||||
config:
|
||||
labels:
|
||||
mem1gb: "memory = 1000000000.B"
|
||||
mem2gb: "memory = 2000000000.B"
|
||||
mem5gb: "memory = 5000000000.B"
|
||||
mem10gb: "memory = 10000000000.B"
|
||||
mem20gb: "memory = 20000000000.B"
|
||||
mem50gb: "memory = 50000000000.B"
|
||||
mem100gb: "memory = 100000000000.B"
|
||||
mem200gb: "memory = 200000000000.B"
|
||||
mem500gb: "memory = 500000000000.B"
|
||||
mem1tb: "memory = 1000000000000.B"
|
||||
mem2tb: "memory = 2000000000000.B"
|
||||
mem5tb: "memory = 5000000000000.B"
|
||||
mem10tb: "memory = 10000000000000.B"
|
||||
mem20tb: "memory = 20000000000000.B"
|
||||
mem50tb: "memory = 50000000000000.B"
|
||||
mem100tb: "memory = 100000000000000.B"
|
||||
mem200tb: "memory = 200000000000000.B"
|
||||
mem500tb: "memory = 500000000000000.B"
|
||||
mem1gib: "memory = 1073741824.B"
|
||||
mem2gib: "memory = 2147483648.B"
|
||||
mem4gib: "memory = 4294967296.B"
|
||||
mem8gib: "memory = 8589934592.B"
|
||||
mem16gib: "memory = 17179869184.B"
|
||||
mem32gib: "memory = 34359738368.B"
|
||||
mem64gib: "memory = 68719476736.B"
|
||||
mem128gib: "memory = 137438953472.B"
|
||||
mem256gib: "memory = 274877906944.B"
|
||||
mem512gib: "memory = 549755813888.B"
|
||||
mem1tib: "memory = 1099511627776.B"
|
||||
mem2tib: "memory = 2199023255552.B"
|
||||
mem4tib: "memory = 4398046511104.B"
|
||||
mem8tib: "memory = 8796093022208.B"
|
||||
mem16tib: "memory = 17592186044416.B"
|
||||
mem32tib: "memory = 35184372088832.B"
|
||||
mem64tib: "memory = 70368744177664.B"
|
||||
mem128tib: "memory = 140737488355328.B"
|
||||
mem256tib: "memory = 281474976710656.B"
|
||||
mem512tib: "memory = 562949953421312.B"
|
||||
cpu1: "cpus = 1"
|
||||
cpu2: "cpus = 2"
|
||||
cpu5: "cpus = 5"
|
||||
cpu10: "cpus = 10"
|
||||
cpu20: "cpus = 20"
|
||||
cpu50: "cpus = 50"
|
||||
cpu100: "cpus = 100"
|
||||
cpu200: "cpus = 200"
|
||||
cpu500: "cpus = 500"
|
||||
cpu1000: "cpus = 1000"
|
||||
script:
|
||||
- "includeConfig(\"nextflow_labels.config\")"
|
||||
debug: false
|
||||
container: "docker"
|
||||
engines:
|
||||
- type: "native"
|
||||
id: "native"
|
||||
- type: "native"
|
||||
id: "native"
|
||||
build_info:
|
||||
config: "src/workflows/htrnaseq/config.vsh.yaml"
|
||||
runner: "nextflow"
|
||||
engine: "native|native"
|
||||
output: "target/nextflow/workflows/htrnaseq"
|
||||
executable: "target/nextflow/workflows/htrnaseq/main.nf"
|
||||
viash_version: "0.9.0-RC7"
|
||||
git_commit: "21831c2104098ecce57aa9b372e49f865296cc48"
|
||||
git_remote: "https://github.com/viash-hub/htrnaseq"
|
||||
dependencies:
|
||||
- "target/nextflow/workflows/well_demultiplex"
|
||||
- "target/nextflow/workflows/parallel_map_wf"
|
||||
- "target/nextflow/workflows/utils/groupWells"
|
||||
- "target/dependencies/vsh/vsh/craftbox/concat_text/nextflow/concat_text"
|
||||
package_config:
|
||||
name: "htrnaseq"
|
||||
version: "main"
|
||||
description: "High-throughput pipeline [WIP]\n"
|
||||
info: null
|
||||
viash_version: "0.9.0-RC7"
|
||||
source: "src"
|
||||
target: "target"
|
||||
config_mods:
|
||||
- ".requirements.commands := ['ps']\n.runners[.type == 'nextflow'].config.script\
|
||||
\ := 'includeConfig(\"nextflow_labels.config\")'\n.resources += {path: '/src/config/labels.config',\
|
||||
\ dest: 'nextflow_labels.config'}\n"
|
||||
- ".engines += { type: \"native\" }"
|
||||
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
|
||||
- ".engines[.type == 'docker'].target_tag := 'main'"
|
||||
keywords:
|
||||
- "bioinformatics"
|
||||
- "sequence"
|
||||
- "high-throughput"
|
||||
- "mapping"
|
||||
- "counting"
|
||||
- "pipeline"
|
||||
license: "MIT"
|
||||
organization: "vsh"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
issue_tracker: "https://github.com/viash-hub/htrnaseq/issues"
|
||||
3313
target/nextflow/workflows/htrnaseq/main.nf
Normal file
3313
target/nextflow/workflows/htrnaseq/main.nf
Normal file
File diff suppressed because it is too large
Load Diff
124
target/nextflow/workflows/htrnaseq/nextflow.config
Normal file
124
target/nextflow/workflows/htrnaseq/nextflow.config
Normal file
@@ -0,0 +1,124 @@
|
||||
manifest {
|
||||
name = 'workflows/htrnaseq'
|
||||
mainScript = 'main.nf'
|
||||
nextflowVersion = '!>=20.12.1-edge'
|
||||
version = 'main'
|
||||
}
|
||||
|
||||
process.container = 'nextflow/bash:latest'
|
||||
|
||||
// detect tempdir
|
||||
tempDir = java.nio.file.Paths.get(
|
||||
System.getenv('NXF_TEMP') ?:
|
||||
System.getenv('VIASH_TEMP') ?:
|
||||
System.getenv('TEMPDIR') ?:
|
||||
System.getenv('TMPDIR') ?:
|
||||
'/tmp'
|
||||
).toAbsolutePath()
|
||||
|
||||
profiles {
|
||||
no_publish {
|
||||
process {
|
||||
withName: '.*' {
|
||||
publishDir = [
|
||||
enabled: false
|
||||
]
|
||||
}
|
||||
}
|
||||
}
|
||||
mount_temp {
|
||||
docker.temp = tempDir
|
||||
podman.temp = tempDir
|
||||
charliecloud.temp = tempDir
|
||||
}
|
||||
docker {
|
||||
docker.enabled = true
|
||||
// docker.userEmulation = true
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
singularity {
|
||||
singularity.enabled = true
|
||||
singularity.autoMounts = true
|
||||
docker.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
podman {
|
||||
podman.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
shifter {
|
||||
shifter.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
charliecloud {
|
||||
charliecloud.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
}
|
||||
}
|
||||
|
||||
process{
|
||||
withLabel: mem1gb { memory = 1000000000.B }
|
||||
withLabel: mem2gb { memory = 2000000000.B }
|
||||
withLabel: mem5gb { memory = 5000000000.B }
|
||||
withLabel: mem10gb { memory = 10000000000.B }
|
||||
withLabel: mem20gb { memory = 20000000000.B }
|
||||
withLabel: mem50gb { memory = 50000000000.B }
|
||||
withLabel: mem100gb { memory = 100000000000.B }
|
||||
withLabel: mem200gb { memory = 200000000000.B }
|
||||
withLabel: mem500gb { memory = 500000000000.B }
|
||||
withLabel: mem1tb { memory = 1000000000000.B }
|
||||
withLabel: mem2tb { memory = 2000000000000.B }
|
||||
withLabel: mem5tb { memory = 5000000000000.B }
|
||||
withLabel: mem10tb { memory = 10000000000000.B }
|
||||
withLabel: mem20tb { memory = 20000000000000.B }
|
||||
withLabel: mem50tb { memory = 50000000000000.B }
|
||||
withLabel: mem100tb { memory = 100000000000000.B }
|
||||
withLabel: mem200tb { memory = 200000000000000.B }
|
||||
withLabel: mem500tb { memory = 500000000000000.B }
|
||||
withLabel: mem1gib { memory = 1073741824.B }
|
||||
withLabel: mem2gib { memory = 2147483648.B }
|
||||
withLabel: mem4gib { memory = 4294967296.B }
|
||||
withLabel: mem8gib { memory = 8589934592.B }
|
||||
withLabel: mem16gib { memory = 17179869184.B }
|
||||
withLabel: mem32gib { memory = 34359738368.B }
|
||||
withLabel: mem64gib { memory = 68719476736.B }
|
||||
withLabel: mem128gib { memory = 137438953472.B }
|
||||
withLabel: mem256gib { memory = 274877906944.B }
|
||||
withLabel: mem512gib { memory = 549755813888.B }
|
||||
withLabel: mem1tib { memory = 1099511627776.B }
|
||||
withLabel: mem2tib { memory = 2199023255552.B }
|
||||
withLabel: mem4tib { memory = 4398046511104.B }
|
||||
withLabel: mem8tib { memory = 8796093022208.B }
|
||||
withLabel: mem16tib { memory = 17592186044416.B }
|
||||
withLabel: mem32tib { memory = 35184372088832.B }
|
||||
withLabel: mem64tib { memory = 70368744177664.B }
|
||||
withLabel: mem128tib { memory = 140737488355328.B }
|
||||
withLabel: mem256tib { memory = 281474976710656.B }
|
||||
withLabel: mem512tib { memory = 562949953421312.B }
|
||||
withLabel: cpu1 { cpus = 1 }
|
||||
withLabel: cpu2 { cpus = 2 }
|
||||
withLabel: cpu5 { cpus = 5 }
|
||||
withLabel: cpu10 { cpus = 10 }
|
||||
withLabel: cpu20 { cpus = 20 }
|
||||
withLabel: cpu50 { cpus = 50 }
|
||||
withLabel: cpu100 { cpus = 100 }
|
||||
withLabel: cpu200 { cpus = 200 }
|
||||
withLabel: cpu500 { cpus = 500 }
|
||||
withLabel: cpu1000 { cpus = 1000 }
|
||||
}
|
||||
|
||||
includeConfig("nextflow_labels.config")
|
||||
43
target/nextflow/workflows/htrnaseq/nextflow_labels.config
Normal file
43
target/nextflow/workflows/htrnaseq/nextflow_labels.config
Normal file
@@ -0,0 +1,43 @@
|
||||
process {
|
||||
// Default resources for components that hardly do any processing
|
||||
memory = { 2.GB * task.attempt }
|
||||
cpus = 1
|
||||
|
||||
// Retry for exit codes that have something to do with memory issues
|
||||
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
|
||||
maxRetries = 3
|
||||
maxMemory = null
|
||||
|
||||
// Resource labels
|
||||
withLabel: singlecpu { cpus = 1 }
|
||||
withLabel: lowcpu { cpus = 4 }
|
||||
withLabel: midcpu { cpus = 10 }
|
||||
withLabel: highcpu { cpus = 20 }
|
||||
|
||||
withLabel: lowmem { memory = { get_memory( 4.GB * task.attempt ) } }
|
||||
withLabel: midmem { memory = { get_memory( 25.GB * task.attempt ) } }
|
||||
withLabel: highmem { memory = { get_memory( 50.GB * task.attempt ) } }
|
||||
withLabel: veryhighmem { memory = { get_memory( 75.GB * task.attempt ) } }
|
||||
|
||||
}
|
||||
|
||||
def get_memory(to_compare) {
|
||||
if (!process.containsKey("maxMemory") || !process.maxMemory) {
|
||||
return to_compare
|
||||
}
|
||||
|
||||
try {
|
||||
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
|
||||
return process.maxMemory
|
||||
}
|
||||
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
|
||||
return max_memory as nextflow.util.MemoryUnit
|
||||
}
|
||||
else {
|
||||
return to_compare
|
||||
}
|
||||
} catch (all) {
|
||||
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
|
||||
System.exit(1)
|
||||
}
|
||||
}
|
||||
147
target/nextflow/workflows/htrnaseq/nextflow_schema.json
Normal file
147
target/nextflow/workflows/htrnaseq/nextflow_schema.json
Normal file
@@ -0,0 +1,147 @@
|
||||
{
|
||||
"$schema": "http://json-schema.org/draft-07/schema",
|
||||
"title": "htrnaseq",
|
||||
"description": "No description",
|
||||
"type": "object",
|
||||
"definitions": {
|
||||
|
||||
|
||||
|
||||
"input arguments" : {
|
||||
"title": "Input arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"input_r1": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. R1",
|
||||
"help_text": "Type: `file`, required. R1"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"input_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. R2",
|
||||
"help_text": "Type: `file`, required. R2"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"barcodesFasta": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. ",
|
||||
"help_text": "Type: `file`, required. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"genomeDir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. ",
|
||||
"help_text": "Type: `file`, required. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"output arguments" : {
|
||||
"title": "Output arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"fastq_output_r1": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, default: `$id.$key.fastq_output_r1_*.fastq`, multiple_sep: `\";\"`. List of demultiplexed fastq files",
|
||||
"help_text": "Type: List of `file`, required, default: `$id.$key.fastq_output_r1_*.fastq`, multiple_sep: `\";\"`. List of demultiplexed fastq files"
|
||||
,
|
||||
"default": "$id.$key.fastq_output_r1_*.fastq"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"fastq_output_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, default: `$id.$key.fastq_output_r2_*.fastq`, multiple_sep: `\";\"`. List of demultiplexed fastq files",
|
||||
"help_text": "Type: List of `file`, required, default: `$id.$key.fastq_output_r2_*.fastq`, multiple_sep: `\";\"`. List of demultiplexed fastq files"
|
||||
,
|
||||
"default": "$id.$key.fastq_output_r2_*.fastq"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"star_output": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, default: `$id.$key.star_output_*.star_output_*`, multiple_sep: `\";\"`. Output from mapping with STAR",
|
||||
"help_text": "Type: List of `file`, required, default: `$id.$key.star_output_*.star_output_*`, multiple_sep: `\";\"`. Output from mapping with STAR"
|
||||
,
|
||||
"default": "$id.$key.star_output_*.star_output_*"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"nextflow input-output arguments" : {
|
||||
"title": "Nextflow input-output arguments",
|
||||
"type": "object",
|
||||
"description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
|
||||
"properties": {
|
||||
|
||||
|
||||
"publish_dir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required, example: `output/`. Path to an output directory",
|
||||
"help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"param_list": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
|
||||
"help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
|
||||
"hidden": true
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
}
|
||||
},
|
||||
"allOf": [
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/input arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/output arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/nextflow input-output arguments"
|
||||
}
|
||||
]
|
||||
}
|
||||
195
target/nextflow/workflows/parallel_map_wf/.config.vsh.yaml
Normal file
195
target/nextflow/workflows/parallel_map_wf/.config.vsh.yaml
Normal file
@@ -0,0 +1,195 @@
|
||||
name: "parallel_map_wf"
|
||||
namespace: "workflows"
|
||||
version: "main"
|
||||
argument_groups:
|
||||
- name: "Arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--input_r1"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--input_r2"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--barcode"
|
||||
info: null
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--pool"
|
||||
info: null
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--genomeDir"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--output"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
resources:
|
||||
- type: "nextflow_script"
|
||||
path: "main.nf"
|
||||
is_executable: true
|
||||
entrypoint: "run_wf"
|
||||
- type: "file"
|
||||
path: "nextflow_labels.config"
|
||||
dest: "nextflow_labels.config"
|
||||
description: "Map RNA sequencing data, provided as fastq files (paired-end) to a reference\
|
||||
\ genome using STAR Solo.\nInput data must have been demultiplexed beforehand, meaning\
|
||||
\ that a single fastq pair provides data for\none barcode (one well). Multiple wells\
|
||||
\ can be mapped in parallel by providing multiple events to the \nworkflow. Output\
|
||||
\ is provided as mapped output per pool, i.e. one output is provided per pool.xx\n"
|
||||
info: null
|
||||
status: "enabled"
|
||||
requirements:
|
||||
commands:
|
||||
- "ps"
|
||||
dependencies:
|
||||
- name: "parallel_map"
|
||||
repository:
|
||||
type: "local"
|
||||
- name: "workflows/utils/groupWells"
|
||||
repository:
|
||||
type: "local"
|
||||
repositories:
|
||||
- type: "local"
|
||||
name: "local"
|
||||
license: "MIT"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
runners:
|
||||
- type: "nextflow"
|
||||
id: "nextflow"
|
||||
directives:
|
||||
tag: "$id"
|
||||
auto:
|
||||
simplifyInput: true
|
||||
simplifyOutput: false
|
||||
transcript: false
|
||||
publish: false
|
||||
config:
|
||||
labels:
|
||||
mem1gb: "memory = 1000000000.B"
|
||||
mem2gb: "memory = 2000000000.B"
|
||||
mem5gb: "memory = 5000000000.B"
|
||||
mem10gb: "memory = 10000000000.B"
|
||||
mem20gb: "memory = 20000000000.B"
|
||||
mem50gb: "memory = 50000000000.B"
|
||||
mem100gb: "memory = 100000000000.B"
|
||||
mem200gb: "memory = 200000000000.B"
|
||||
mem500gb: "memory = 500000000000.B"
|
||||
mem1tb: "memory = 1000000000000.B"
|
||||
mem2tb: "memory = 2000000000000.B"
|
||||
mem5tb: "memory = 5000000000000.B"
|
||||
mem10tb: "memory = 10000000000000.B"
|
||||
mem20tb: "memory = 20000000000000.B"
|
||||
mem50tb: "memory = 50000000000000.B"
|
||||
mem100tb: "memory = 100000000000000.B"
|
||||
mem200tb: "memory = 200000000000000.B"
|
||||
mem500tb: "memory = 500000000000000.B"
|
||||
mem1gib: "memory = 1073741824.B"
|
||||
mem2gib: "memory = 2147483648.B"
|
||||
mem4gib: "memory = 4294967296.B"
|
||||
mem8gib: "memory = 8589934592.B"
|
||||
mem16gib: "memory = 17179869184.B"
|
||||
mem32gib: "memory = 34359738368.B"
|
||||
mem64gib: "memory = 68719476736.B"
|
||||
mem128gib: "memory = 137438953472.B"
|
||||
mem256gib: "memory = 274877906944.B"
|
||||
mem512gib: "memory = 549755813888.B"
|
||||
mem1tib: "memory = 1099511627776.B"
|
||||
mem2tib: "memory = 2199023255552.B"
|
||||
mem4tib: "memory = 4398046511104.B"
|
||||
mem8tib: "memory = 8796093022208.B"
|
||||
mem16tib: "memory = 17592186044416.B"
|
||||
mem32tib: "memory = 35184372088832.B"
|
||||
mem64tib: "memory = 70368744177664.B"
|
||||
mem128tib: "memory = 140737488355328.B"
|
||||
mem256tib: "memory = 281474976710656.B"
|
||||
mem512tib: "memory = 562949953421312.B"
|
||||
cpu1: "cpus = 1"
|
||||
cpu2: "cpus = 2"
|
||||
cpu5: "cpus = 5"
|
||||
cpu10: "cpus = 10"
|
||||
cpu20: "cpus = 20"
|
||||
cpu50: "cpus = 50"
|
||||
cpu100: "cpus = 100"
|
||||
cpu200: "cpus = 200"
|
||||
cpu500: "cpus = 500"
|
||||
cpu1000: "cpus = 1000"
|
||||
script:
|
||||
- "includeConfig(\"nextflow_labels.config\")"
|
||||
debug: false
|
||||
container: "docker"
|
||||
engines:
|
||||
- type: "native"
|
||||
id: "native"
|
||||
- type: "native"
|
||||
id: "native"
|
||||
build_info:
|
||||
config: "src/workflows/parallel_map_wf/config.vsh.yaml"
|
||||
runner: "nextflow"
|
||||
engine: "native|native"
|
||||
output: "target/nextflow/workflows/parallel_map_wf"
|
||||
executable: "target/nextflow/workflows/parallel_map_wf/main.nf"
|
||||
viash_version: "0.9.0-RC7"
|
||||
git_commit: "21831c2104098ecce57aa9b372e49f865296cc48"
|
||||
git_remote: "https://github.com/viash-hub/htrnaseq"
|
||||
dependencies:
|
||||
- "target/nextflow/parallel_map"
|
||||
- "target/nextflow/workflows/utils/groupWells"
|
||||
package_config:
|
||||
name: "htrnaseq"
|
||||
version: "main"
|
||||
description: "High-throughput pipeline [WIP]\n"
|
||||
info: null
|
||||
viash_version: "0.9.0-RC7"
|
||||
source: "src"
|
||||
target: "target"
|
||||
config_mods:
|
||||
- ".requirements.commands := ['ps']\n.runners[.type == 'nextflow'].config.script\
|
||||
\ := 'includeConfig(\"nextflow_labels.config\")'\n.resources += {path: '/src/config/labels.config',\
|
||||
\ dest: 'nextflow_labels.config'}\n"
|
||||
- ".engines += { type: \"native\" }"
|
||||
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
|
||||
- ".engines[.type == 'docker'].target_tag := 'main'"
|
||||
keywords:
|
||||
- "bioinformatics"
|
||||
- "sequence"
|
||||
- "high-throughput"
|
||||
- "mapping"
|
||||
- "counting"
|
||||
- "pipeline"
|
||||
license: "MIT"
|
||||
organization: "vsh"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
issue_tracker: "https://github.com/viash-hub/htrnaseq/issues"
|
||||
3223
target/nextflow/workflows/parallel_map_wf/main.nf
Normal file
3223
target/nextflow/workflows/parallel_map_wf/main.nf
Normal file
File diff suppressed because it is too large
Load Diff
125
target/nextflow/workflows/parallel_map_wf/nextflow.config
Normal file
125
target/nextflow/workflows/parallel_map_wf/nextflow.config
Normal file
@@ -0,0 +1,125 @@
|
||||
manifest {
|
||||
name = 'workflows/parallel_map_wf'
|
||||
mainScript = 'main.nf'
|
||||
nextflowVersion = '!>=20.12.1-edge'
|
||||
version = 'main'
|
||||
description = 'Map RNA sequencing data, provided as fastq files (paired-end) to a reference genome using STAR Solo.\nInput data must have been demultiplexed beforehand, meaning that a single fastq pair provides data for\none barcode (one well). Multiple wells can be mapped in parallel by providing multiple events to the \nworkflow. Output is provided as mapped output per pool, i.e. one output is provided per pool.xx\n'
|
||||
}
|
||||
|
||||
process.container = 'nextflow/bash:latest'
|
||||
|
||||
// detect tempdir
|
||||
tempDir = java.nio.file.Paths.get(
|
||||
System.getenv('NXF_TEMP') ?:
|
||||
System.getenv('VIASH_TEMP') ?:
|
||||
System.getenv('TEMPDIR') ?:
|
||||
System.getenv('TMPDIR') ?:
|
||||
'/tmp'
|
||||
).toAbsolutePath()
|
||||
|
||||
profiles {
|
||||
no_publish {
|
||||
process {
|
||||
withName: '.*' {
|
||||
publishDir = [
|
||||
enabled: false
|
||||
]
|
||||
}
|
||||
}
|
||||
}
|
||||
mount_temp {
|
||||
docker.temp = tempDir
|
||||
podman.temp = tempDir
|
||||
charliecloud.temp = tempDir
|
||||
}
|
||||
docker {
|
||||
docker.enabled = true
|
||||
// docker.userEmulation = true
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
singularity {
|
||||
singularity.enabled = true
|
||||
singularity.autoMounts = true
|
||||
docker.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
podman {
|
||||
podman.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
shifter {
|
||||
shifter.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
charliecloud {
|
||||
charliecloud.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
}
|
||||
}
|
||||
|
||||
process{
|
||||
withLabel: mem1gb { memory = 1000000000.B }
|
||||
withLabel: mem2gb { memory = 2000000000.B }
|
||||
withLabel: mem5gb { memory = 5000000000.B }
|
||||
withLabel: mem10gb { memory = 10000000000.B }
|
||||
withLabel: mem20gb { memory = 20000000000.B }
|
||||
withLabel: mem50gb { memory = 50000000000.B }
|
||||
withLabel: mem100gb { memory = 100000000000.B }
|
||||
withLabel: mem200gb { memory = 200000000000.B }
|
||||
withLabel: mem500gb { memory = 500000000000.B }
|
||||
withLabel: mem1tb { memory = 1000000000000.B }
|
||||
withLabel: mem2tb { memory = 2000000000000.B }
|
||||
withLabel: mem5tb { memory = 5000000000000.B }
|
||||
withLabel: mem10tb { memory = 10000000000000.B }
|
||||
withLabel: mem20tb { memory = 20000000000000.B }
|
||||
withLabel: mem50tb { memory = 50000000000000.B }
|
||||
withLabel: mem100tb { memory = 100000000000000.B }
|
||||
withLabel: mem200tb { memory = 200000000000000.B }
|
||||
withLabel: mem500tb { memory = 500000000000000.B }
|
||||
withLabel: mem1gib { memory = 1073741824.B }
|
||||
withLabel: mem2gib { memory = 2147483648.B }
|
||||
withLabel: mem4gib { memory = 4294967296.B }
|
||||
withLabel: mem8gib { memory = 8589934592.B }
|
||||
withLabel: mem16gib { memory = 17179869184.B }
|
||||
withLabel: mem32gib { memory = 34359738368.B }
|
||||
withLabel: mem64gib { memory = 68719476736.B }
|
||||
withLabel: mem128gib { memory = 137438953472.B }
|
||||
withLabel: mem256gib { memory = 274877906944.B }
|
||||
withLabel: mem512gib { memory = 549755813888.B }
|
||||
withLabel: mem1tib { memory = 1099511627776.B }
|
||||
withLabel: mem2tib { memory = 2199023255552.B }
|
||||
withLabel: mem4tib { memory = 4398046511104.B }
|
||||
withLabel: mem8tib { memory = 8796093022208.B }
|
||||
withLabel: mem16tib { memory = 17592186044416.B }
|
||||
withLabel: mem32tib { memory = 35184372088832.B }
|
||||
withLabel: mem64tib { memory = 70368744177664.B }
|
||||
withLabel: mem128tib { memory = 140737488355328.B }
|
||||
withLabel: mem256tib { memory = 281474976710656.B }
|
||||
withLabel: mem512tib { memory = 562949953421312.B }
|
||||
withLabel: cpu1 { cpus = 1 }
|
||||
withLabel: cpu2 { cpus = 2 }
|
||||
withLabel: cpu5 { cpus = 5 }
|
||||
withLabel: cpu10 { cpus = 10 }
|
||||
withLabel: cpu20 { cpus = 20 }
|
||||
withLabel: cpu50 { cpus = 50 }
|
||||
withLabel: cpu100 { cpus = 100 }
|
||||
withLabel: cpu200 { cpus = 200 }
|
||||
withLabel: cpu500 { cpus = 500 }
|
||||
withLabel: cpu1000 { cpus = 1000 }
|
||||
}
|
||||
|
||||
includeConfig("nextflow_labels.config")
|
||||
@@ -0,0 +1,43 @@
|
||||
process {
|
||||
// Default resources for components that hardly do any processing
|
||||
memory = { 2.GB * task.attempt }
|
||||
cpus = 1
|
||||
|
||||
// Retry for exit codes that have something to do with memory issues
|
||||
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
|
||||
maxRetries = 3
|
||||
maxMemory = null
|
||||
|
||||
// Resource labels
|
||||
withLabel: singlecpu { cpus = 1 }
|
||||
withLabel: lowcpu { cpus = 4 }
|
||||
withLabel: midcpu { cpus = 10 }
|
||||
withLabel: highcpu { cpus = 20 }
|
||||
|
||||
withLabel: lowmem { memory = { get_memory( 4.GB * task.attempt ) } }
|
||||
withLabel: midmem { memory = { get_memory( 25.GB * task.attempt ) } }
|
||||
withLabel: highmem { memory = { get_memory( 50.GB * task.attempt ) } }
|
||||
withLabel: veryhighmem { memory = { get_memory( 75.GB * task.attempt ) } }
|
||||
|
||||
}
|
||||
|
||||
def get_memory(to_compare) {
|
||||
if (!process.containsKey("maxMemory") || !process.maxMemory) {
|
||||
return to_compare
|
||||
}
|
||||
|
||||
try {
|
||||
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
|
||||
return process.maxMemory
|
||||
}
|
||||
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
|
||||
return max_memory as nextflow.util.MemoryUnit
|
||||
}
|
||||
else {
|
||||
return to_compare
|
||||
}
|
||||
} catch (all) {
|
||||
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
|
||||
System.exit(1)
|
||||
}
|
||||
}
|
||||
121
target/nextflow/workflows/parallel_map_wf/nextflow_schema.json
Normal file
121
target/nextflow/workflows/parallel_map_wf/nextflow_schema.json
Normal file
@@ -0,0 +1,121 @@
|
||||
{
|
||||
"$schema": "http://json-schema.org/draft-07/schema",
|
||||
"title": "parallel_map_wf",
|
||||
"description": "Map RNA sequencing data, provided as fastq files (paired-end) to a reference genome using STAR Solo.\nInput data must have been demultiplexed beforehand, meaning that a single fastq pair provides data for\none barcode (one well). Multiple wells can be mapped in parallel by providing multiple events to the \nworkflow. Output is provided as mapped output per pool, i.e. one output is provided per pool.xx\n",
|
||||
"type": "object",
|
||||
"definitions": {
|
||||
|
||||
|
||||
|
||||
"arguments" : {
|
||||
"title": "Arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"input_r1": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. ",
|
||||
"help_text": "Type: `file`, required. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"input_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. ",
|
||||
"help_text": "Type: `file`, required. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"barcode": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required. ",
|
||||
"help_text": "Type: `string`, required. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"pool": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required. ",
|
||||
"help_text": "Type: `string`, required. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"genomeDir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. ",
|
||||
"help_text": "Type: `file`, required. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"output": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, default: `$id.$key.output_*.output_*`, multiple_sep: `\";\"`. ",
|
||||
"help_text": "Type: List of `file`, required, default: `$id.$key.output_*.output_*`, multiple_sep: `\";\"`. "
|
||||
,
|
||||
"default": "$id.$key.output_*.output_*"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"nextflow input-output arguments" : {
|
||||
"title": "Nextflow input-output arguments",
|
||||
"type": "object",
|
||||
"description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
|
||||
"properties": {
|
||||
|
||||
|
||||
"publish_dir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required, example: `output/`. Path to an output directory",
|
||||
"help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"param_list": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
|
||||
"help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
|
||||
"hidden": true
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
}
|
||||
},
|
||||
"allOf": [
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/nextflow input-output arguments"
|
||||
}
|
||||
]
|
||||
}
|
||||
202
target/nextflow/workflows/utils/groupWells/.config.vsh.yaml
Normal file
202
target/nextflow/workflows/utils/groupWells/.config.vsh.yaml
Normal file
@@ -0,0 +1,202 @@
|
||||
name: "groupWells"
|
||||
namespace: "workflows/utils"
|
||||
version: "main"
|
||||
argument_groups:
|
||||
- name: "Inputs"
|
||||
arguments:
|
||||
- type: "string"
|
||||
name: "--well"
|
||||
description: "Barcode identifier for a well"
|
||||
info: null
|
||||
example:
|
||||
- "barcode_1"
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--pool"
|
||||
description: "Identifier of the pool"
|
||||
info: null
|
||||
example:
|
||||
- "pool_1"
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--input_r1"
|
||||
description: "Path to the input for R1"
|
||||
info: null
|
||||
example:
|
||||
- "input.fastq.gz"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--input_r2"
|
||||
description: "Path to the input for R1"
|
||||
info: null
|
||||
example:
|
||||
- "input.fastq.gz"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- name: "Output"
|
||||
arguments:
|
||||
- type: "string"
|
||||
name: "--wells"
|
||||
description: "List of grouped wells (by means of barcodes)"
|
||||
info: null
|
||||
example:
|
||||
- "input.fastq.gz"
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--output_r1"
|
||||
description: "Path to output for R2"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--output_r2"
|
||||
description: "Path to the output for R2"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
resources:
|
||||
- type: "nextflow_script"
|
||||
path: "main.nf"
|
||||
is_executable: true
|
||||
entrypoint: "run_wf"
|
||||
- type: "file"
|
||||
path: "nextflow_labels.config"
|
||||
dest: "nextflow_labels.config"
|
||||
description: "N/A\n"
|
||||
info: null
|
||||
status: "enabled"
|
||||
requirements:
|
||||
commands:
|
||||
- "ps"
|
||||
license: "MIT"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
runners:
|
||||
- type: "nextflow"
|
||||
id: "nextflow"
|
||||
directives:
|
||||
tag: "$id"
|
||||
auto:
|
||||
simplifyInput: true
|
||||
simplifyOutput: false
|
||||
transcript: false
|
||||
publish: false
|
||||
config:
|
||||
labels:
|
||||
mem1gb: "memory = 1000000000.B"
|
||||
mem2gb: "memory = 2000000000.B"
|
||||
mem5gb: "memory = 5000000000.B"
|
||||
mem10gb: "memory = 10000000000.B"
|
||||
mem20gb: "memory = 20000000000.B"
|
||||
mem50gb: "memory = 50000000000.B"
|
||||
mem100gb: "memory = 100000000000.B"
|
||||
mem200gb: "memory = 200000000000.B"
|
||||
mem500gb: "memory = 500000000000.B"
|
||||
mem1tb: "memory = 1000000000000.B"
|
||||
mem2tb: "memory = 2000000000000.B"
|
||||
mem5tb: "memory = 5000000000000.B"
|
||||
mem10tb: "memory = 10000000000000.B"
|
||||
mem20tb: "memory = 20000000000000.B"
|
||||
mem50tb: "memory = 50000000000000.B"
|
||||
mem100tb: "memory = 100000000000000.B"
|
||||
mem200tb: "memory = 200000000000000.B"
|
||||
mem500tb: "memory = 500000000000000.B"
|
||||
mem1gib: "memory = 1073741824.B"
|
||||
mem2gib: "memory = 2147483648.B"
|
||||
mem4gib: "memory = 4294967296.B"
|
||||
mem8gib: "memory = 8589934592.B"
|
||||
mem16gib: "memory = 17179869184.B"
|
||||
mem32gib: "memory = 34359738368.B"
|
||||
mem64gib: "memory = 68719476736.B"
|
||||
mem128gib: "memory = 137438953472.B"
|
||||
mem256gib: "memory = 274877906944.B"
|
||||
mem512gib: "memory = 549755813888.B"
|
||||
mem1tib: "memory = 1099511627776.B"
|
||||
mem2tib: "memory = 2199023255552.B"
|
||||
mem4tib: "memory = 4398046511104.B"
|
||||
mem8tib: "memory = 8796093022208.B"
|
||||
mem16tib: "memory = 17592186044416.B"
|
||||
mem32tib: "memory = 35184372088832.B"
|
||||
mem64tib: "memory = 70368744177664.B"
|
||||
mem128tib: "memory = 140737488355328.B"
|
||||
mem256tib: "memory = 281474976710656.B"
|
||||
mem512tib: "memory = 562949953421312.B"
|
||||
cpu1: "cpus = 1"
|
||||
cpu2: "cpus = 2"
|
||||
cpu5: "cpus = 5"
|
||||
cpu10: "cpus = 10"
|
||||
cpu20: "cpus = 20"
|
||||
cpu50: "cpus = 50"
|
||||
cpu100: "cpus = 100"
|
||||
cpu200: "cpus = 200"
|
||||
cpu500: "cpus = 500"
|
||||
cpu1000: "cpus = 1000"
|
||||
script:
|
||||
- "includeConfig(\"nextflow_labels.config\")"
|
||||
debug: false
|
||||
container: "docker"
|
||||
engines:
|
||||
- type: "native"
|
||||
id: "native"
|
||||
build_info:
|
||||
config: "src/workflows/utils/groupWells/config.vsh.yaml"
|
||||
runner: "nextflow"
|
||||
engine: "native"
|
||||
output: "target/nextflow/workflows/utils/groupWells"
|
||||
executable: "target/nextflow/workflows/utils/groupWells/main.nf"
|
||||
viash_version: "0.9.0-RC7"
|
||||
git_commit: "21831c2104098ecce57aa9b372e49f865296cc48"
|
||||
git_remote: "https://github.com/viash-hub/htrnaseq"
|
||||
package_config:
|
||||
name: "htrnaseq"
|
||||
version: "main"
|
||||
description: "High-throughput pipeline [WIP]\n"
|
||||
info: null
|
||||
viash_version: "0.9.0-RC7"
|
||||
source: "src"
|
||||
target: "target"
|
||||
config_mods:
|
||||
- ".requirements.commands := ['ps']\n.runners[.type == 'nextflow'].config.script\
|
||||
\ := 'includeConfig(\"nextflow_labels.config\")'\n.resources += {path: '/src/config/labels.config',\
|
||||
\ dest: 'nextflow_labels.config'}\n"
|
||||
- ".engines += { type: \"native\" }"
|
||||
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
|
||||
- ".engines[.type == 'docker'].target_tag := 'main'"
|
||||
keywords:
|
||||
- "bioinformatics"
|
||||
- "sequence"
|
||||
- "high-throughput"
|
||||
- "mapping"
|
||||
- "counting"
|
||||
- "pipeline"
|
||||
license: "MIT"
|
||||
organization: "vsh"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
issue_tracker: "https://github.com/viash-hub/htrnaseq/issues"
|
||||
3206
target/nextflow/workflows/utils/groupWells/main.nf
Normal file
3206
target/nextflow/workflows/utils/groupWells/main.nf
Normal file
File diff suppressed because it is too large
Load Diff
125
target/nextflow/workflows/utils/groupWells/nextflow.config
Normal file
125
target/nextflow/workflows/utils/groupWells/nextflow.config
Normal file
@@ -0,0 +1,125 @@
|
||||
manifest {
|
||||
name = 'workflows/utils/groupWells'
|
||||
mainScript = 'main.nf'
|
||||
nextflowVersion = '!>=20.12.1-edge'
|
||||
version = 'main'
|
||||
description = 'N/A\n'
|
||||
}
|
||||
|
||||
process.container = 'nextflow/bash:latest'
|
||||
|
||||
// detect tempdir
|
||||
tempDir = java.nio.file.Paths.get(
|
||||
System.getenv('NXF_TEMP') ?:
|
||||
System.getenv('VIASH_TEMP') ?:
|
||||
System.getenv('TEMPDIR') ?:
|
||||
System.getenv('TMPDIR') ?:
|
||||
'/tmp'
|
||||
).toAbsolutePath()
|
||||
|
||||
profiles {
|
||||
no_publish {
|
||||
process {
|
||||
withName: '.*' {
|
||||
publishDir = [
|
||||
enabled: false
|
||||
]
|
||||
}
|
||||
}
|
||||
}
|
||||
mount_temp {
|
||||
docker.temp = tempDir
|
||||
podman.temp = tempDir
|
||||
charliecloud.temp = tempDir
|
||||
}
|
||||
docker {
|
||||
docker.enabled = true
|
||||
// docker.userEmulation = true
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
singularity {
|
||||
singularity.enabled = true
|
||||
singularity.autoMounts = true
|
||||
docker.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
podman {
|
||||
podman.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
shifter {
|
||||
shifter.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
charliecloud {
|
||||
charliecloud.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
}
|
||||
}
|
||||
|
||||
process{
|
||||
withLabel: mem1gb { memory = 1000000000.B }
|
||||
withLabel: mem2gb { memory = 2000000000.B }
|
||||
withLabel: mem5gb { memory = 5000000000.B }
|
||||
withLabel: mem10gb { memory = 10000000000.B }
|
||||
withLabel: mem20gb { memory = 20000000000.B }
|
||||
withLabel: mem50gb { memory = 50000000000.B }
|
||||
withLabel: mem100gb { memory = 100000000000.B }
|
||||
withLabel: mem200gb { memory = 200000000000.B }
|
||||
withLabel: mem500gb { memory = 500000000000.B }
|
||||
withLabel: mem1tb { memory = 1000000000000.B }
|
||||
withLabel: mem2tb { memory = 2000000000000.B }
|
||||
withLabel: mem5tb { memory = 5000000000000.B }
|
||||
withLabel: mem10tb { memory = 10000000000000.B }
|
||||
withLabel: mem20tb { memory = 20000000000000.B }
|
||||
withLabel: mem50tb { memory = 50000000000000.B }
|
||||
withLabel: mem100tb { memory = 100000000000000.B }
|
||||
withLabel: mem200tb { memory = 200000000000000.B }
|
||||
withLabel: mem500tb { memory = 500000000000000.B }
|
||||
withLabel: mem1gib { memory = 1073741824.B }
|
||||
withLabel: mem2gib { memory = 2147483648.B }
|
||||
withLabel: mem4gib { memory = 4294967296.B }
|
||||
withLabel: mem8gib { memory = 8589934592.B }
|
||||
withLabel: mem16gib { memory = 17179869184.B }
|
||||
withLabel: mem32gib { memory = 34359738368.B }
|
||||
withLabel: mem64gib { memory = 68719476736.B }
|
||||
withLabel: mem128gib { memory = 137438953472.B }
|
||||
withLabel: mem256gib { memory = 274877906944.B }
|
||||
withLabel: mem512gib { memory = 549755813888.B }
|
||||
withLabel: mem1tib { memory = 1099511627776.B }
|
||||
withLabel: mem2tib { memory = 2199023255552.B }
|
||||
withLabel: mem4tib { memory = 4398046511104.B }
|
||||
withLabel: mem8tib { memory = 8796093022208.B }
|
||||
withLabel: mem16tib { memory = 17592186044416.B }
|
||||
withLabel: mem32tib { memory = 35184372088832.B }
|
||||
withLabel: mem64tib { memory = 70368744177664.B }
|
||||
withLabel: mem128tib { memory = 140737488355328.B }
|
||||
withLabel: mem256tib { memory = 281474976710656.B }
|
||||
withLabel: mem512tib { memory = 562949953421312.B }
|
||||
withLabel: cpu1 { cpus = 1 }
|
||||
withLabel: cpu2 { cpus = 2 }
|
||||
withLabel: cpu5 { cpus = 5 }
|
||||
withLabel: cpu10 { cpus = 10 }
|
||||
withLabel: cpu20 { cpus = 20 }
|
||||
withLabel: cpu50 { cpus = 50 }
|
||||
withLabel: cpu100 { cpus = 100 }
|
||||
withLabel: cpu200 { cpus = 200 }
|
||||
withLabel: cpu500 { cpus = 500 }
|
||||
withLabel: cpu1000 { cpus = 1000 }
|
||||
}
|
||||
|
||||
includeConfig("nextflow_labels.config")
|
||||
@@ -0,0 +1,43 @@
|
||||
process {
|
||||
// Default resources for components that hardly do any processing
|
||||
memory = { 2.GB * task.attempt }
|
||||
cpus = 1
|
||||
|
||||
// Retry for exit codes that have something to do with memory issues
|
||||
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
|
||||
maxRetries = 3
|
||||
maxMemory = null
|
||||
|
||||
// Resource labels
|
||||
withLabel: singlecpu { cpus = 1 }
|
||||
withLabel: lowcpu { cpus = 4 }
|
||||
withLabel: midcpu { cpus = 10 }
|
||||
withLabel: highcpu { cpus = 20 }
|
||||
|
||||
withLabel: lowmem { memory = { get_memory( 4.GB * task.attempt ) } }
|
||||
withLabel: midmem { memory = { get_memory( 25.GB * task.attempt ) } }
|
||||
withLabel: highmem { memory = { get_memory( 50.GB * task.attempt ) } }
|
||||
withLabel: veryhighmem { memory = { get_memory( 75.GB * task.attempt ) } }
|
||||
|
||||
}
|
||||
|
||||
def get_memory(to_compare) {
|
||||
if (!process.containsKey("maxMemory") || !process.maxMemory) {
|
||||
return to_compare
|
||||
}
|
||||
|
||||
try {
|
||||
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
|
||||
return process.maxMemory
|
||||
}
|
||||
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
|
||||
return max_memory as nextflow.util.MemoryUnit
|
||||
}
|
||||
else {
|
||||
return to_compare
|
||||
}
|
||||
} catch (all) {
|
||||
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
|
||||
System.exit(1)
|
||||
}
|
||||
}
|
||||
146
target/nextflow/workflows/utils/groupWells/nextflow_schema.json
Normal file
146
target/nextflow/workflows/utils/groupWells/nextflow_schema.json
Normal file
@@ -0,0 +1,146 @@
|
||||
{
|
||||
"$schema": "http://json-schema.org/draft-07/schema",
|
||||
"title": "groupWells",
|
||||
"description": "N/A\n",
|
||||
"type": "object",
|
||||
"definitions": {
|
||||
|
||||
|
||||
|
||||
"inputs" : {
|
||||
"title": "Inputs",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"well": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required, example: `barcode_1`. Barcode identifier for a well",
|
||||
"help_text": "Type: `string`, required, example: `barcode_1`. Barcode identifier for a well"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"pool": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required, example: `pool_1`. Identifier of the pool",
|
||||
"help_text": "Type: `string`, required, example: `pool_1`. Identifier of the pool"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"input_r1": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1",
|
||||
"help_text": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"input_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1",
|
||||
"help_text": "Type: `file`, required, example: `input.fastq.gz`. Path to the input for R1"
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"output" : {
|
||||
"title": "Output",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"wells": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `string`, example: `input.fastq.gz`, multiple_sep: `\";\"`. List of grouped wells (by means of barcodes)",
|
||||
"help_text": "Type: List of `string`, example: `input.fastq.gz`, multiple_sep: `\";\"`. List of grouped wells (by means of barcodes)"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"output_r1": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, default: `$id.$key.output_r1_*.output_r1_*`, multiple_sep: `\";\"`. Path to output for R2",
|
||||
"help_text": "Type: List of `file`, default: `$id.$key.output_r1_*.output_r1_*`, multiple_sep: `\";\"`. Path to output for R2"
|
||||
,
|
||||
"default": "$id.$key.output_r1_*.output_r1_*"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"output_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, default: `$id.$key.output_r2_*.output_r2_*`, multiple_sep: `\";\"`. Path to the output for R2",
|
||||
"help_text": "Type: List of `file`, default: `$id.$key.output_r2_*.output_r2_*`, multiple_sep: `\";\"`. Path to the output for R2"
|
||||
,
|
||||
"default": "$id.$key.output_r2_*.output_r2_*"
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"nextflow input-output arguments" : {
|
||||
"title": "Nextflow input-output arguments",
|
||||
"type": "object",
|
||||
"description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
|
||||
"properties": {
|
||||
|
||||
|
||||
"publish_dir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required, example: `output/`. Path to an output directory",
|
||||
"help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"param_list": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
|
||||
"help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
|
||||
"hidden": true
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
}
|
||||
},
|
||||
"allOf": [
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/inputs"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/output"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/nextflow input-output arguments"
|
||||
}
|
||||
]
|
||||
}
|
||||
230
target/nextflow/workflows/well_demultiplex/.config.vsh.yaml
Normal file
230
target/nextflow/workflows/well_demultiplex/.config.vsh.yaml
Normal file
@@ -0,0 +1,230 @@
|
||||
name: "well_demultiplex"
|
||||
namespace: "workflows"
|
||||
version: "main"
|
||||
argument_groups:
|
||||
- name: "Input arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--input_r1"
|
||||
description: "R1"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--input_r2"
|
||||
description: "R2"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--barcodesFasta"
|
||||
info: null
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "input"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- name: "Output arguments"
|
||||
arguments:
|
||||
- type: "file"
|
||||
name: "--output_r1"
|
||||
description: "List of demultiplexed fastq files"
|
||||
info: null
|
||||
default:
|
||||
- "fastq/*_R1_001.fastq"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "file"
|
||||
name: "--output_r2"
|
||||
description: "List of demultiplexed fastq files"
|
||||
info: null
|
||||
default:
|
||||
- "fastq/*_R2_001.fastq"
|
||||
must_exist: true
|
||||
create_parent: true
|
||||
required: true
|
||||
direction: "output"
|
||||
multiple: true
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--pool"
|
||||
description: "The original pool / sample name"
|
||||
info: null
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--barcode"
|
||||
info: null
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--lane"
|
||||
info: null
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
- type: "string"
|
||||
name: "--pair_end"
|
||||
info: null
|
||||
required: false
|
||||
direction: "output"
|
||||
multiple: false
|
||||
multiple_sep: ";"
|
||||
resources:
|
||||
- type: "nextflow_script"
|
||||
path: "main.nf"
|
||||
is_executable: true
|
||||
entrypoint: "run_wf"
|
||||
- type: "file"
|
||||
path: "nextflow_labels.config"
|
||||
dest: "nextflow_labels.config"
|
||||
description: "Demultiplexing on well level"
|
||||
test_resources:
|
||||
- type: "nextflow_script"
|
||||
path: "test.nf"
|
||||
is_executable: true
|
||||
entrypoint: "test_wf"
|
||||
info: null
|
||||
status: "enabled"
|
||||
requirements:
|
||||
commands:
|
||||
- "ps"
|
||||
dependencies:
|
||||
- name: "cutadapt"
|
||||
repository:
|
||||
type: "vsh"
|
||||
repo: "biobox"
|
||||
tag: "v0.1.0"
|
||||
repositories:
|
||||
- type: "vsh"
|
||||
name: "bb"
|
||||
repo: "biobox"
|
||||
tag: "v0.1.0"
|
||||
license: "MIT"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
runners:
|
||||
- type: "nextflow"
|
||||
id: "nextflow"
|
||||
directives:
|
||||
tag: "$id"
|
||||
auto:
|
||||
simplifyInput: true
|
||||
simplifyOutput: false
|
||||
transcript: false
|
||||
publish: false
|
||||
config:
|
||||
labels:
|
||||
mem1gb: "memory = 1000000000.B"
|
||||
mem2gb: "memory = 2000000000.B"
|
||||
mem5gb: "memory = 5000000000.B"
|
||||
mem10gb: "memory = 10000000000.B"
|
||||
mem20gb: "memory = 20000000000.B"
|
||||
mem50gb: "memory = 50000000000.B"
|
||||
mem100gb: "memory = 100000000000.B"
|
||||
mem200gb: "memory = 200000000000.B"
|
||||
mem500gb: "memory = 500000000000.B"
|
||||
mem1tb: "memory = 1000000000000.B"
|
||||
mem2tb: "memory = 2000000000000.B"
|
||||
mem5tb: "memory = 5000000000000.B"
|
||||
mem10tb: "memory = 10000000000000.B"
|
||||
mem20tb: "memory = 20000000000000.B"
|
||||
mem50tb: "memory = 50000000000000.B"
|
||||
mem100tb: "memory = 100000000000000.B"
|
||||
mem200tb: "memory = 200000000000000.B"
|
||||
mem500tb: "memory = 500000000000000.B"
|
||||
mem1gib: "memory = 1073741824.B"
|
||||
mem2gib: "memory = 2147483648.B"
|
||||
mem4gib: "memory = 4294967296.B"
|
||||
mem8gib: "memory = 8589934592.B"
|
||||
mem16gib: "memory = 17179869184.B"
|
||||
mem32gib: "memory = 34359738368.B"
|
||||
mem64gib: "memory = 68719476736.B"
|
||||
mem128gib: "memory = 137438953472.B"
|
||||
mem256gib: "memory = 274877906944.B"
|
||||
mem512gib: "memory = 549755813888.B"
|
||||
mem1tib: "memory = 1099511627776.B"
|
||||
mem2tib: "memory = 2199023255552.B"
|
||||
mem4tib: "memory = 4398046511104.B"
|
||||
mem8tib: "memory = 8796093022208.B"
|
||||
mem16tib: "memory = 17592186044416.B"
|
||||
mem32tib: "memory = 35184372088832.B"
|
||||
mem64tib: "memory = 70368744177664.B"
|
||||
mem128tib: "memory = 140737488355328.B"
|
||||
mem256tib: "memory = 281474976710656.B"
|
||||
mem512tib: "memory = 562949953421312.B"
|
||||
cpu1: "cpus = 1"
|
||||
cpu2: "cpus = 2"
|
||||
cpu5: "cpus = 5"
|
||||
cpu10: "cpus = 10"
|
||||
cpu20: "cpus = 20"
|
||||
cpu50: "cpus = 50"
|
||||
cpu100: "cpus = 100"
|
||||
cpu200: "cpus = 200"
|
||||
cpu500: "cpus = 500"
|
||||
cpu1000: "cpus = 1000"
|
||||
script:
|
||||
- "includeConfig(\"nextflow_labels.config\")"
|
||||
debug: false
|
||||
container: "docker"
|
||||
engines:
|
||||
- type: "native"
|
||||
id: "native"
|
||||
- type: "native"
|
||||
id: "native"
|
||||
build_info:
|
||||
config: "src/workflows/well_demultiplex/config.vsh.yaml"
|
||||
runner: "nextflow"
|
||||
engine: "native|native"
|
||||
output: "target/nextflow/workflows/well_demultiplex"
|
||||
executable: "target/nextflow/workflows/well_demultiplex/main.nf"
|
||||
viash_version: "0.9.0-RC7"
|
||||
git_commit: "21831c2104098ecce57aa9b372e49f865296cc48"
|
||||
git_remote: "https://github.com/viash-hub/htrnaseq"
|
||||
dependencies:
|
||||
- "target/dependencies/vsh/vsh/biobox/v0.1.0/nextflow/cutadapt"
|
||||
package_config:
|
||||
name: "htrnaseq"
|
||||
version: "main"
|
||||
description: "High-throughput pipeline [WIP]\n"
|
||||
info: null
|
||||
viash_version: "0.9.0-RC7"
|
||||
source: "src"
|
||||
target: "target"
|
||||
config_mods:
|
||||
- ".requirements.commands := ['ps']\n.runners[.type == 'nextflow'].config.script\
|
||||
\ := 'includeConfig(\"nextflow_labels.config\")'\n.resources += {path: '/src/config/labels.config',\
|
||||
\ dest: 'nextflow_labels.config'}\n"
|
||||
- ".engines += { type: \"native\" }"
|
||||
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
|
||||
- ".engines[.type == 'docker'].target_tag := 'main'"
|
||||
keywords:
|
||||
- "bioinformatics"
|
||||
- "sequence"
|
||||
- "high-throughput"
|
||||
- "mapping"
|
||||
- "counting"
|
||||
- "pipeline"
|
||||
license: "MIT"
|
||||
organization: "vsh"
|
||||
links:
|
||||
repository: "https://github.com/viash-hub/htrnaseq"
|
||||
issue_tracker: "https://github.com/viash-hub/htrnaseq/issues"
|
||||
3286
target/nextflow/workflows/well_demultiplex/main.nf
Normal file
3286
target/nextflow/workflows/well_demultiplex/main.nf
Normal file
File diff suppressed because it is too large
Load Diff
125
target/nextflow/workflows/well_demultiplex/nextflow.config
Normal file
125
target/nextflow/workflows/well_demultiplex/nextflow.config
Normal file
@@ -0,0 +1,125 @@
|
||||
manifest {
|
||||
name = 'workflows/well_demultiplex'
|
||||
mainScript = 'main.nf'
|
||||
nextflowVersion = '!>=20.12.1-edge'
|
||||
version = 'main'
|
||||
description = 'Demultiplexing on well level'
|
||||
}
|
||||
|
||||
process.container = 'nextflow/bash:latest'
|
||||
|
||||
// detect tempdir
|
||||
tempDir = java.nio.file.Paths.get(
|
||||
System.getenv('NXF_TEMP') ?:
|
||||
System.getenv('VIASH_TEMP') ?:
|
||||
System.getenv('TEMPDIR') ?:
|
||||
System.getenv('TMPDIR') ?:
|
||||
'/tmp'
|
||||
).toAbsolutePath()
|
||||
|
||||
profiles {
|
||||
no_publish {
|
||||
process {
|
||||
withName: '.*' {
|
||||
publishDir = [
|
||||
enabled: false
|
||||
]
|
||||
}
|
||||
}
|
||||
}
|
||||
mount_temp {
|
||||
docker.temp = tempDir
|
||||
podman.temp = tempDir
|
||||
charliecloud.temp = tempDir
|
||||
}
|
||||
docker {
|
||||
docker.enabled = true
|
||||
// docker.userEmulation = true
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
singularity {
|
||||
singularity.enabled = true
|
||||
singularity.autoMounts = true
|
||||
docker.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
podman {
|
||||
podman.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
shifter.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
shifter {
|
||||
shifter.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
charliecloud.enabled = false
|
||||
}
|
||||
charliecloud {
|
||||
charliecloud.enabled = true
|
||||
docker.enabled = false
|
||||
singularity.enabled = false
|
||||
podman.enabled = false
|
||||
shifter.enabled = false
|
||||
}
|
||||
}
|
||||
|
||||
process{
|
||||
withLabel: mem1gb { memory = 1000000000.B }
|
||||
withLabel: mem2gb { memory = 2000000000.B }
|
||||
withLabel: mem5gb { memory = 5000000000.B }
|
||||
withLabel: mem10gb { memory = 10000000000.B }
|
||||
withLabel: mem20gb { memory = 20000000000.B }
|
||||
withLabel: mem50gb { memory = 50000000000.B }
|
||||
withLabel: mem100gb { memory = 100000000000.B }
|
||||
withLabel: mem200gb { memory = 200000000000.B }
|
||||
withLabel: mem500gb { memory = 500000000000.B }
|
||||
withLabel: mem1tb { memory = 1000000000000.B }
|
||||
withLabel: mem2tb { memory = 2000000000000.B }
|
||||
withLabel: mem5tb { memory = 5000000000000.B }
|
||||
withLabel: mem10tb { memory = 10000000000000.B }
|
||||
withLabel: mem20tb { memory = 20000000000000.B }
|
||||
withLabel: mem50tb { memory = 50000000000000.B }
|
||||
withLabel: mem100tb { memory = 100000000000000.B }
|
||||
withLabel: mem200tb { memory = 200000000000000.B }
|
||||
withLabel: mem500tb { memory = 500000000000000.B }
|
||||
withLabel: mem1gib { memory = 1073741824.B }
|
||||
withLabel: mem2gib { memory = 2147483648.B }
|
||||
withLabel: mem4gib { memory = 4294967296.B }
|
||||
withLabel: mem8gib { memory = 8589934592.B }
|
||||
withLabel: mem16gib { memory = 17179869184.B }
|
||||
withLabel: mem32gib { memory = 34359738368.B }
|
||||
withLabel: mem64gib { memory = 68719476736.B }
|
||||
withLabel: mem128gib { memory = 137438953472.B }
|
||||
withLabel: mem256gib { memory = 274877906944.B }
|
||||
withLabel: mem512gib { memory = 549755813888.B }
|
||||
withLabel: mem1tib { memory = 1099511627776.B }
|
||||
withLabel: mem2tib { memory = 2199023255552.B }
|
||||
withLabel: mem4tib { memory = 4398046511104.B }
|
||||
withLabel: mem8tib { memory = 8796093022208.B }
|
||||
withLabel: mem16tib { memory = 17592186044416.B }
|
||||
withLabel: mem32tib { memory = 35184372088832.B }
|
||||
withLabel: mem64tib { memory = 70368744177664.B }
|
||||
withLabel: mem128tib { memory = 140737488355328.B }
|
||||
withLabel: mem256tib { memory = 281474976710656.B }
|
||||
withLabel: mem512tib { memory = 562949953421312.B }
|
||||
withLabel: cpu1 { cpus = 1 }
|
||||
withLabel: cpu2 { cpus = 2 }
|
||||
withLabel: cpu5 { cpus = 5 }
|
||||
withLabel: cpu10 { cpus = 10 }
|
||||
withLabel: cpu20 { cpus = 20 }
|
||||
withLabel: cpu50 { cpus = 50 }
|
||||
withLabel: cpu100 { cpus = 100 }
|
||||
withLabel: cpu200 { cpus = 200 }
|
||||
withLabel: cpu500 { cpus = 500 }
|
||||
withLabel: cpu1000 { cpus = 1000 }
|
||||
}
|
||||
|
||||
includeConfig("nextflow_labels.config")
|
||||
@@ -0,0 +1,43 @@
|
||||
process {
|
||||
// Default resources for components that hardly do any processing
|
||||
memory = { 2.GB * task.attempt }
|
||||
cpus = 1
|
||||
|
||||
// Retry for exit codes that have something to do with memory issues
|
||||
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
|
||||
maxRetries = 3
|
||||
maxMemory = null
|
||||
|
||||
// Resource labels
|
||||
withLabel: singlecpu { cpus = 1 }
|
||||
withLabel: lowcpu { cpus = 4 }
|
||||
withLabel: midcpu { cpus = 10 }
|
||||
withLabel: highcpu { cpus = 20 }
|
||||
|
||||
withLabel: lowmem { memory = { get_memory( 4.GB * task.attempt ) } }
|
||||
withLabel: midmem { memory = { get_memory( 25.GB * task.attempt ) } }
|
||||
withLabel: highmem { memory = { get_memory( 50.GB * task.attempt ) } }
|
||||
withLabel: veryhighmem { memory = { get_memory( 75.GB * task.attempt ) } }
|
||||
|
||||
}
|
||||
|
||||
def get_memory(to_compare) {
|
||||
if (!process.containsKey("maxMemory") || !process.maxMemory) {
|
||||
return to_compare
|
||||
}
|
||||
|
||||
try {
|
||||
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
|
||||
return process.maxMemory
|
||||
}
|
||||
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
|
||||
return max_memory as nextflow.util.MemoryUnit
|
||||
}
|
||||
else {
|
||||
return to_compare
|
||||
}
|
||||
} catch (all) {
|
||||
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
|
||||
System.exit(1)
|
||||
}
|
||||
}
|
||||
166
target/nextflow/workflows/well_demultiplex/nextflow_schema.json
Normal file
166
target/nextflow/workflows/well_demultiplex/nextflow_schema.json
Normal file
@@ -0,0 +1,166 @@
|
||||
{
|
||||
"$schema": "http://json-schema.org/draft-07/schema",
|
||||
"title": "well_demultiplex",
|
||||
"description": "Demultiplexing on well level",
|
||||
"type": "object",
|
||||
"definitions": {
|
||||
|
||||
|
||||
|
||||
"input arguments" : {
|
||||
"title": "Input arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"input_r1": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. R1",
|
||||
"help_text": "Type: `file`, required. R1"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"input_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. R2",
|
||||
"help_text": "Type: `file`, required. R2"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"barcodesFasta": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `file`, required. ",
|
||||
"help_text": "Type: `file`, required. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"output arguments" : {
|
||||
"title": "Output arguments",
|
||||
"type": "object",
|
||||
"description": "No description",
|
||||
"properties": {
|
||||
|
||||
|
||||
"output_r1": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, default: `$id.$key.output_r1_*.fastq`, multiple_sep: `\";\"`. List of demultiplexed fastq files",
|
||||
"help_text": "Type: List of `file`, required, default: `$id.$key.output_r1_*.fastq`, multiple_sep: `\";\"`. List of demultiplexed fastq files"
|
||||
,
|
||||
"default": "$id.$key.output_r1_*.fastq"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"output_r2": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: List of `file`, required, default: `$id.$key.output_r2_*.fastq`, multiple_sep: `\";\"`. List of demultiplexed fastq files",
|
||||
"help_text": "Type: List of `file`, required, default: `$id.$key.output_r2_*.fastq`, multiple_sep: `\";\"`. List of demultiplexed fastq files"
|
||||
,
|
||||
"default": "$id.$key.output_r2_*.fastq"
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"pool": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. The original pool / sample name",
|
||||
"help_text": "Type: `string`. The original pool / sample name"
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"barcode": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. ",
|
||||
"help_text": "Type: `string`. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"lane": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. ",
|
||||
"help_text": "Type: `string`. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"pair_end": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`. ",
|
||||
"help_text": "Type: `string`. "
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
},
|
||||
|
||||
|
||||
"nextflow input-output arguments" : {
|
||||
"title": "Nextflow input-output arguments",
|
||||
"type": "object",
|
||||
"description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
|
||||
"properties": {
|
||||
|
||||
|
||||
"publish_dir": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, required, example: `output/`. Path to an output directory",
|
||||
"help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
|
||||
|
||||
}
|
||||
|
||||
|
||||
,
|
||||
"param_list": {
|
||||
"type":
|
||||
"string",
|
||||
"description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
|
||||
"help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
|
||||
"hidden": true
|
||||
|
||||
}
|
||||
|
||||
|
||||
}
|
||||
}
|
||||
},
|
||||
"allOf": [
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/input arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/output arguments"
|
||||
},
|
||||
|
||||
{
|
||||
"$ref": "#/definitions/nextflow input-output arguments"
|
||||
}
|
||||
]
|
||||
}
|
||||
Reference in New Issue
Block a user