Build branch v0.3 with version v0.3.0 (bc7a95f)

Build pipeline: viash-hub.htrnaseq.v0.3-bxj5m

Source commit: bc7a95f98f

Source message: Bump version to v0.3.0 (2)
This commit is contained in:
CI
2025-01-17 17:02:55 +00:00
commit f1b001e1da
228 changed files with 117817 additions and 0 deletions

18
.gitignore vendored Normal file
View File

@@ -0,0 +1,18 @@
target
testData
# Nextflow related files
.nextflow
.nextflow.log*
work
# Python related files
*__pycache__*
.venv
# R related files
.Rproj.user
htrnaseq.Rproj
# vscode
.vscode

77
CHANGELOG.md Normal file
View File

@@ -0,0 +1,77 @@
# htrnaseq v0.3.0
## New functionality
* Added `umi_length` argument (PR #27).
* Added `runner` workflow (PR #26, see below)
## `runner` workflow
* Removed `wellBarcodesLength` from `parallel_map` workflow (PR #27).
## Major changes
A runner workflows has been added, providing two additional features:
1. Start from an input directory containing fastq files rather than a list of input fastq pairs.
2. Improve the output of the workflow
### Input directory
It is now possible to specify a single `--input <basedir>` directory as input and the runner will extract the fastq file pairs. An error will be raised if the filename processing leads to errors.
### Output
The runner provides a complete different approach to output. A couple of things are important here:
- Output is split up in 2 parts:
1. The well-demultiplexed fastq files (`--fastq_publish_dir`)
2. All the other results of the workflow (`--results_publish_dir`)
- The well-demultiplexed fastq file are stored under `--fastq_publish_dir` according to the following format:
```
$fastq_publish_dir/$id/<date-time>_htrnaseq_<version>/$plate_$lane/<well_id>_R1/2_001.fastq
```
- The other results are stored under `--results_publish_dir` according to the following format:
```
$results_publish_dir/$project_id/$experiment_id/<date-time>_htrnaseq_<version>/
```
This is an example listing of this directory:
```
esets
fData
nrReadsNrGenesPerChrom
pData
report.html
star_output
starLogs
```
This output structure can be circumvented by using the `--output_dir` option, which will store all output in a single directory.
1. Using the `htrnaseq` workflow directory rather than the `runner` interface
2. Using the argument `--plain_output` with the `runner`. fastq files and other results will still be published in their respective directories, but not in a directory hierarchy as described above.
## Minor changes
* Use `v0.2.0` version of cutadapt instead of `main` (PR #23).
* Use `v0.3.0` version of cutadapt
* Bump viash to 0.9.1 (PR #31).
* `create_eset`: Update base container image, `R` version and all dependencies
to newer versions (PR #28).
# htrnaseq v0.2.0
# New functionality
* Make sure that the Well ID matches the required format (PR #22 and PR #21).
# htrnaseq v0.1.0
Initial release

129
README.md Normal file
View File

@@ -0,0 +1,129 @@
# HT-RNAseq - A pipeline for processing high-throughput RNA-seq data
## Introduction
__TODO__: Add a description of the pipeline here.
## Test data
As test data, we use [a DRUGseq dataset](https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE176150) from the [NCBI Sequence Read Archive](https://www.ncbi.nlm.nih.gov/sra).
The original data has been (partly) subsampled to reduce the test runtime. We used [seqtk](https://github.com/lh3/seqtk) for this with a seed of 1, e.g.:
```bash
seqtk sample -s1 orig/SRR14730302/VH02001614_S8_R1_001.fastq.gz 10000 > 10k/SRR14730302/VH02001614_S8_R1_001.fastq.gz
```
The data is available at: `gs://viash-hub-test-data/htrnaseq/v1/`:
```
gcstree -f viash-hub-test-data/htrnaseq/v1/
viash-hub-test-data
└── htrnaseq
└── v1
├── [ 48] 2-wells.fasta
├── [465.3K] GSE176150_metadata.csv
├── 100k
│ ├── SRR14730301
│ │ ├── [8.5M] VH02001612_S9_R1_001.fastq
│ │ └── [14.9M] VH02001612_S9_R2_001.fastq
│ └── SRR14730302
│ ├── [8.5M] VH02001614_S8_R1_001.fastq.gz
│ └── [14.9M] VH02001614_S8_R2_001.fastq.gz
├── 10k
│ ├── SRR14730301
│ │ ├── [845.4K] VH02001612_S9_R1_001.fastq
│ │ └── [1.5M] VH02001612_S9_R2_001.fastq
│ └── SRR14730302
│ ├── [845.3K] VH02001614_S8_R1_001.fastq.gz
│ └── [1.5M] VH02001614_S8_R2_001.fastq.gz
└── orig
├── [20.4G] SRR14730301
│ └── [20.4G] SRR14730301
├── SRR14730301
│ ├── [9.1G] VH02001612_S9_R1_001.fastq.gz
│ └── [22.0G] VH02001612_S9_R2_001.fastq.gz
├── [16.9G] SRR14730302
│ └── [16.9G] SRR14730302
├── SRR14730302
│ ├── [7.6G] VH02001614_S8_R1_001.fastq.gz
│ └── [18.0G] VH02001614_S8_R2_001.fastq.gz
├── [18.0G] SRR14730303
│ └── [18.0G] SRR14730303
├── SRR14730303
│ ├── [8.1G] VH02001618_S7_R1_001.fastq.gz
│ └── [19.2G] VH02001618_S7_R2_001.fastq.gz
├── [16.5G] SRR14730304
│ └── [16.5G] SRR14730304
├── SRR14730304
│ ├── [7.5G] VH02001700_S6_R1_001.fastq.gz
│ └── [17.8G] VH02001700_S6_R2_001.fastq.gz
├── [19.0G] SRR14730305
│ └── [19.0G] SRR14730305
├── SRR14730305
│ ├── [8.4G] VH02001702_S5_R1_001.fastq.gz
│ └── [20.6G] VH02001702_S5_R2_001.fastq.gz
├── [14.6G] SRR14730306
│ └── [14.6G] SRR14730306
├── SRR14730306
│ ├── [6.6G] VH02001704_S4_R1_001.fastq.gz
│ └── [16.0G] VH02001704_S4_R2_001.fastq.gz
├── [21.5G] SRR14730307
│ └── [21.5G] SRR14730307
├── SRR14730307
│ ├── [9.6G] VH02001708_S3_R1_001.fastq.gz
│ └── [23.2G] VH02001708_S3_R2_001.fastq.gz
├── [20.7G] SRR14730308
│ └── [20.7G] SRR14730308
├── SRR14730308
│ ├── [9.3G] VH02001710_S2_R1_001.fastq.gz
│ └── [22.1G] VH02001710_S2_R2_001.fastq.gz
├── [15.8G] SRR14730309
│ └── [15.8G] SRR14730309
└── SRR14730309
├── [7.2G] VH02001712_S1_R1_001.fastq.gz
└── [16.9G] VH02001712_S1_R2_001.fastq.gz
18 directories, 37 files
```
The `orig` directory contains the original fastq files. The fastq files are available for 10k and 100k subsamples in the `10k` and `100k` directories, respectively.
The `2-wells.fasta` file contains the barcodes for 2 wells.
## Test run
The pipeline can be run by creating a `params.yaml` file like this:
```yaml
param_list:
- input_r1: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730301/VH02001612_S9_R1_001.fastq"
input_r2: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730301/VH02001612_S9_R2_001.fastq"
genomeDir: "gs://viash-hub-test-data/htrnaseq/v1/genomeDir/gencode.v41.star.sparse"
barcodesFasta: "gs://viash-hub-test-data/htrnaseq/v1/2-wells.fasta"
id: sample_one
- input_r1: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730302/VH02001614_S8_R1_001.fastq"
input_r2: "gs://viash-hub-test-data/htrnaseq/v1/100k/SRR14730302/VH02001614_S8_R2_001.fastq"
genomeDir: "gs://viash-hub-test-data/htrnaseq/v1/genomeDir/gencode.v41.star.sparse"
barcodesFasta: "gs://viash-hub-test-data/htrnaseq/v1/2-wells.fasta"
id: sample_two
```
and then:
```bash
viash ns build --setup cb
nextflow run . -main-script target/nextflow/workflows/htrnaseq/main.nf \
-profile docker \
-c target/nextflow/workflows/htrnaseq/nextflow.config \
-params-file params.yaml \
-resume \
--publish_dir output
```
Or, by running `src/workflows/htrnaseq/integration_test.sh`.
# Special Thanks
Developed in collaboration with Data Intuitive and Open Analytics.

21
_viash.yaml Normal file
View File

@@ -0,0 +1,21 @@
name: htrnaseq
version: v0.3.0
description: |
High-throughput pipeline [WIP]
license: MIT
keywords: [bioinformatics, sequence, high-throughput, mapping, counting, pipeline]
links:
issue_tracker: https://github.com/viash-hub/htrnaseq/issues
repository: https://github.com/viash-hub/htrnaseq
viash_version: 0.9.0
info:
test_resources:
- path: gs://viash-hub-test-data/htrnaseq/v1/
dest: resources_test
config_mods: |
.requirements.commands := ['ps']
.runners[.type == 'nextflow'].config.script := 'includeConfig("nextflow_labels.config")'
.resources += {path: '/src/config/labels.config', dest: 'nextflow_labels.config'}

3
main.nf Normal file
View File

@@ -0,0 +1,3 @@
workflow {
print("This is a dummy placeholder for pipeline execution. Please use the corresponding nf files for running pipelines.")
}

12
nextflow.config Normal file
View File

@@ -0,0 +1,12 @@
manifest {
homePage = 'https://github.com/viash-hub/htrnaseq'
description = 'HT-RNAseq pipeline'
mainScript = 'target/nextflow/workflows/htrnaseq/main.nf'
}
process {
withName: publishStatesProc {
publishDir = [ enabled: false ]
}
}

View File

@@ -0,0 +1,11 @@
name: Dries Schaumont
info:
links:
email: dries@data-intuitive.com
github: DriesSchaumont
orcid: "0000-0002-4389-0440"
linkedin: dries-schaumont
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Data Scientist

View File

@@ -0,0 +1,10 @@
name: Marijke Van Moerbeke
info:
links:
github: mvanmoerbeke
orcid: 0000-0002-3097-5621
linkedin: marijke-van-moerbeke-84303a34
organizations:
- name: OpenAnalytics
href: https://www.openanalytics.eu
role: Statistical Consultant

View File

@@ -0,0 +1,10 @@
name: Toni Verbeiren
info:
role: Core Team Member
links:
github: tverbeiren
linkedin: verbeiren
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Data Scientist and CEO

108
src/config/labels.config Normal file
View File

@@ -0,0 +1,108 @@
executor {
$k8s {
submitRateLimit = '10sec'
pollInterval = '1 sec'
}
}
process {
container = 'nextflow/bash:latest'
// default resources
memory = { 8.Gb * task.attempt }
cpus = 8
maxForks = 36
// Retry for exit codes that have something to do with memory issues
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
maxRetries = 3
maxMemory = 192.GB
// Resource labels
withLabel: verylowcpu { cpus = 2 }
withLabel: lowcpu { cpus = 8 }
withLabel: midcpu { cpus = 16 }
withLabel: highcpu { cpus = 32 }
withLabel: verylowmem { memory = { get_memory( 4.GB * task.attempt ) } }
withLabel: lowmem { memory = { get_memory( 8.GB * task.attempt ) } }
withLabel: midmem { memory = { get_memory( 16.GB * task.attempt ) } }
withLabel: highmem { memory = { get_memory( 64.GB * task.attempt ) } }
}
profiles {
// detect tempdir
tempDir = java.nio.file.Paths.get(
System.getenv('NXF_TEMP') ?:
System.getenv('VIASH_TEMP') ?:
System.getenv('TEMPDIR') ?:
System.getenv('TMPDIR') ?:
'/tmp'
).toAbsolutePath()
mount_temp {
docker.temp = tempDir
podman.temp = tempDir
charliecloud.temp = tempDir
}
no_publish {
process {
withName: '.*' {
publishDir = [
enabled: false
]
}
}
}
docker {
docker.fixOwnership = true
docker.enabled = true
// docker.userEmulation = true
singularity.enabled = false
podman.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
local {
// This config is for local processing.
process {
withName: ".*parallel_map_process" {
maxForks = 1
}
maxMemory = 25.GB
withLabel: verylowcpu { cpus = 2 }
withLabel: lowcpu { cpus = 4 }
withLabel: midcpu { cpus = 6 }
withLabel: highcpu { cpus = 8 }
withLabel: lowmem { memory = { get_memory( 8.GB * task.attempt ) } }
withLabel: midmem { memory = { get_memory( 12.GB * task.attempt ) } }
withLabel: highmem { memory = { get_memory( 20.GB * task.attempt ) } }
}
}
}
def get_memory(to_compare) {
if (!process.containsKey("maxMemory") || !process.maxMemory) {
return to_compare
}
try {
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
return process.maxMemory
}
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
return max_memory as nextflow.util.MemoryUnit
}
else {
return to_compare
}
} catch (all) {
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
System.exit(1)
}
}

View File

@@ -0,0 +1,56 @@
name: create_eset
namespace: "eset"
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ maintainer ]
- __merge__: /src/base/authors/marijke_van_moerbeke.yaml
roles: [ author ]
argument_groups:
- name: "Arguments"
arguments:
- type: file
name: "--pDataFile"
required: true
- type: file
name: "--fDataFile"
required: true
- type: file
name: "--mappingDir"
multiple: true
required: true
- type: string
name: --poolName
required: true
- name: "--output"
type: file
required: true
direction: output
default: eset.$id.rds
resources:
- type: r_script
path: script.R
test_resources:
- type: r_script
path: test.R
- path: test_data/pData.tsv
- path: test_data/fData.tsv
- path: test_data/mapping_dir
engines:
- type: docker
image: rocker/r2u:24.04
setup:
- type: r
cran:
- data.table
- nlcv
bioc:
- Seurat
test_setup:
- type: r
cran:
- testthat
runners:
- type: executable
- type: nextflow

View File

@@ -0,0 +1,432 @@
library(Biobase)
library(data.table)
library(nlcv)
library(Matrix)
library(Seurat)
### VIASH START
par <- list(
pDataFile = "src/eset/create_eset/test_data/pData.tsv",
fDataFile = "src/eset/create_eset/test_data/fData.tsv",
studyType = "Standard",
mappingDir = c("src/eset/create_eset/test_data/mapping_dir/AACAAGGTAC",
"src/eset/create_eset/test_data/mapping_dir/ACGCCTTCGT"),
output = "eset.rds",
poolName = "Foo"
)
### VIASH END
Read10X <- function(data_dir = NULL, gene_column = 2, unique_features = TRUE) {
full.data <- list()
for (i in seq_along(along.with = data_dir)) {
run <- data_dir[i]
if (!dir.exists(paths = run)) {
stop("Directory provided does not exist")
}
barcode.loc <- file.path(run, "barcodes.tsv")
gene.loc <- file.path(run, "features.tsv")
features.loc <- file.path(run, "features.tsv.gz")
matrix.loc <- file.path(run, "matrix.mtx")
pre_ver_3 <- file.exists(gene.loc)
if (!pre_ver_3) {
addgz <- function(s) {
return(paste0(s, ".gz"))
}
barcode.loc <- addgz(s = barcode.loc)
matrix.loc <- addgz(s = matrix.loc)
}
if (!file.exists(barcode.loc)) {
stop("Barcode file missing")
}
if (!pre_ver_3 && !file.exists(features.loc)) {
stop("Gene name or features file missing")
}
if (!file.exists(matrix.loc)) {
stop("Expression matrix file missing")
}
data <- readMM(file = matrix.loc)
cell.names <- readLines(barcode.loc)
if (all(grepl(pattern = "\\-1$", x = cell.names))) {
cell.names <- as.vector(x = as.character(x = sapply(X = cell.names,
FUN = ExtractField, field = 1, delim = "-")))
}
if (is.null(x = names(x = data_dir))) {
if (i < 2) {
colnames(x = data) <- cell.names
}
else {
colnames(x = data) <- paste0(i, "_", cell.names)
}
}
else {
colnames(x = data) <- paste0(names(x = data_dir)[i],
"_", cell.names)
}
feature.names <- read.delim(file = ifelse(test = pre_ver_3,
yes = gene.loc, no = features.loc), header = FALSE,
stringsAsFactors = FALSE)
if (any(is.na(x = feature.names[, gene_column]))) {
warning("Some features names are NA. Replacing NA names with ID from the opposite column requested",
call. = FALSE, immediate. = TRUE)
na.features <- which(x = is.na(x = feature.names[,
gene_column]))
replacement.column <- ifelse(test = gene_column ==
2, yes = 1, no = 2)
feature.names[na.features, gene_column] <- feature.names[na.features,
replacement.column]
}
if (unique_features) {
fcols = ncol(x = feature.names)
if (fcols < gene_column) {
stop(paste0("gene_column was set to ", gene_column,
" but feature.tsv.gz (or genes.tsv) only has ",
fcols, " columns.", " Try setting the gene_column ",
"argument to a value <= to ",
fcols, "."))
}
rownames(x = data) <- make.unique(names = feature.names[,
gene_column])
}
if (ncol(x = feature.names) > 2) {
data_types <- factor(x = feature.names$V3)
lvls <- levels(x = data_types)
if (length(x = lvls) > 1 && length(x = full.data) == 0) {
message(paste0("10X data contains more than one type and is ",
"being returned as a list containing matrices ",
"of each type."))
}
expr_name <- "Gene Expression"
if (expr_name %in% lvls) {
lvls <- c(expr_name, lvls[-which(x = lvls ==
expr_name)])
}
data <- lapply(X = lvls, FUN = function(l) {
return(data[data_types == l, , drop = FALSE])
})
names(x = data) <- lvls
} else {
data <- list(data)
}
full.data[[length(x = full.data) + 1]] <- data
}
list_of_data <- list()
for (j in 1:length(x = full.data[[1]])) {
list_of_data[[j]] <- do.call(cbind, lapply(X = full.data,
FUN = `[[`, j))
list_of_data[[j]] <- as(object = list_of_data[[j]], Class = "CsparseMatrix")
}
names(x = list_of_data) <- names(x = full.data[[1]])
if (length(x = list_of_data) == 1) {
return(list_of_data[[1]])
} else {
return(list_of_data)
}
}
match_features <- function(exprs_matrix, fdata) {
identical_features <- all(rownames(exprs_matrix) == rownames(fdata))
if (nrow(exprs_matrix) != nrow(fdata) || !identical_features) {
message(paste0("Features in 'fData' and expression matrix differ. ",
"Only matching features are returned."))
}
features <- intersect(rownames(exprs_matrix), rownames(fdata))
exprs_matrix <- exprs_matrix[which(rownames(exprs_matrix) %in% features), ]
fdata <- fdata[which(rownames(fdata) %in% features), ]
fdata[, seq_len(ncol(fdata))] <- lapply(fdata[, seq_len(ncol(fdata)), drop = FALSE], as.character)
# order features in exprs mat according to fdata
exprs_matrix <- exprs_matrix[match(rownames(fdata), rownames(exprs_matrix)), ]
list(exprs_matrix = exprs_matrix, fdata = fdata)
}
create_pdata <- function(sample_file, pool_name, barcodes) {
cols_to_remove <- c("SampleFileName", "Output", "Measure", "Strandedness")
pData <- sample_file[, !colnames(sample_file) %in% cols_to_remove,
drop = FALSE]
rownames(pData) <- lapply(sample_file$WellBC,
\(x) paste(pool_name, x, sep = "_"))
# pData[, ] <- lapply(pData, as.factor)
pData$PoolName <- pool_name
pData <- pData[match(barcodes, pData$WellBC), ]
return(pData)
}
check_sample_file <- function(mapping_dir, sample_file){
message("Checking sample annotation:")
requireNamespace("tools")
mapping_dir <- unlist(lapply(mapping_dir, function(x) {
if (!dir.exists(x)) {
stop(sprintf(paste0("Could not find directory ",
"provided in 'mappingDir' argument (%s)."), x))
}
tools::file_path_as_absolute(x)
}))
# additional check for STARsolo
check_STARsolo_output <- function(x) {
files <- c("barcodes.tsv", "features.tsv", "matrix.mtx")
test <- list.files(x) %in% c(files, paste0(files, ".gz"))
length(test) != 0 && all(test)
}
if (!"WellBC" %in% colnames(sample_file)) {
stop(paste0("STARsolo output is used. The sample annotation must ",
"contain 'WellBC' column providing cell barcodes."))
}
mapping_dir <- unique(mapping_dir)
all_STARsolo_files_present <- all(
unlist(
lapply(mapping_dir, function(x) {
check_STARsolo_output(x)
})
)
)
if (!all_STARsolo_files_present) {
stop(paste0("Could not find files: 'barcodes', 'features' and 'matrix'",
" for STARsolo output. Please check 'mappingDir' argument."))
}
message("- 'SampleFileName' column - OK")
list(sample_expression_files = mapping_dir)
}
create_exprs_matrix <- function(exprs_matrix_path, exprs_file_paths,
output, measure, col_names, cell_barcodes) {
read_matrix <- Read10X(data_dir = exprs_file_paths, gene_column = 1)
read_matrix <- read_matrix[, which(colSums(read_matrix) != 0)]
# keep index of feature names containing "_" because Seurat
#changes them to "-" and they no longer match with fdata[, "gene_id"]
idx <- grep("_", rownames(read_matrix))
requireNamespace("Seurat")
seurat_object <- Seurat::CreateSeuratObject(counts = read_matrix)
exprs_matrix <- as.matrix(seurat_object[['RNA']]$counts)
# replace "-" with "_" for features with "_"
# before converting to Seurat object
rownames(exprs_matrix)[idx] <- gsub("-", "_", rownames(exprs_matrix)[idx])
requireNamespace("stringr")
exprs_matrix <- exprs_matrix[, stringr::str_detect(colnames(exprs_matrix),
paste(cell_barcodes, collapse = "|"))]
# check if rownames are ENSEMBL and remove version suffix
isENSEMBL <- all(grepl("ENS", rownames(exprs_matrix)))
if (isENSEMBL) {
# do not use gsub("(.+)[.]\\d+", "\\1", rownames(exprs_matrix)),
# so that ENS000000.1_PAR_Y can be kept
rownames(exprs_matrix) <- gsub("\\.\\d+$", "", rownames(exprs_matrix))
}
colnames(exprs_matrix) <- col_names
exprs_matrix
}
create_eset <- function(feature_annotation_path,
sample_annotation_path,
mapping_dir,
barcodes,
output_path,
pool_name,
exprs_matrix_path = NULL,
path = NULL,
add_eset_annotation = NULL) {
if (!file.exists(feature_annotation_path)) {
stop("Could not find feature annotation at '", feature_annotation_path, "'")
}
if (!file.exists(sample_annotation_path)) {
stop("Could not find sample annotation at '", sample_annotation_path, "'")
}
if(!is.null(exprs_matrix_path)) {
if(!file.exists(exprs_matrix_path)) {
stop("Could not find expression matrix at '", exprs_matrix_path, "'")
}
}
if(!is.null(path)) {
if(!dir.exists(path)) {
stop("Provided 'path': '", path, "' does not exist.")
}
}
##### Import annotation files #####
message("Importing feature annotation")
fdata_file <- read.table(feature_annotation_path, header = TRUE,
sep = "\t", quote = "\"",
comment.char = "", stringsAsFactors = FALSE)
# for backwards compatibility
if("ENSEMBL" %in% colnames(fdata_file) && !all(grepl("ENS", fdata_file[, "ENSEMBL"])) & !"gene_id" %in% colnames(fdata_file)) {
colnames(fdata_file)[which(colnames(fdata_file) == "ENSEMBL")] <- "gene_id"
}
# Check gene annotation
if(!"gene_id" %in% colnames(fdata_file))
stop("'gene_id' column with unique feature identifiers must be present in 'feature_annotation_path'.")
# check if duplicated ids are present
if(any(duplicated(fdata_file$gene_id)))
stop("Duplicated features ids are not allowed. Please check the 'gene_id' column in 'feature_annotation_path'.")
message("Importing sample annotation")
sample_file <- read.table(sample_annotation_path, header = TRUE,
sep = "\t", quote = "\"",
comment.char = "", stringsAsFactors = FALSE)
# Check sample annotation
check_sample_file_list <- check_sample_file(mapping_dir = mapping_dir,
sample_file = sample_file)
output <- "STARsolo"
measure <- "counts"
sample_expression_files <- check_sample_file_list$sample_expression_files
##### Create phenodata #####
pdata_eset <- create_pdata(sample_file = sample_file, pool_name = pool_name,
barcodes = barcodes)
##### Create expression matrix #####
message("Creating expression matrix")
exprs_matrix_eset <- create_exprs_matrix(
exprs_matrix_path = exprs_matrix_path,
exprs_file_paths = sample_expression_files,
output = output,
measure = measure,
col_names = rownames(pdata_eset),
cell_barcodes = barcodes
)
##### Create featuredata #####
message("Creating feature data")
fdata_eset <- fdata_file
rownames(fdata_eset) <- fdata_eset[, "gene_id"]
# intersect features between exprs matrix and fdata
feature_files <- match_features(exprs_matrix = exprs_matrix_eset,
fdata = fdata_eset)
fdata_eset <- feature_files$fdata
exprs_matrix_eset <- feature_files$exprs_matrix
##### Create eSet #####
message("Creating eset")
if (nrow(pdata_eset) != ncol(exprs_matrix_eset)) {
stop("nrow(pData) and ncol(exprsMatrix) differ")
}
if (nrow(fdata_eset) != nrow(exprs_matrix_eset)) {
stop("nrow(fData) and nrow(exprsMatrix) differ")
}
if (!all(rownames(pdata_eset) == colnames(exprs_matrix_eset))) {
stop("rownames(pData) and colnames(exprsMatrix) differ")
}
if (!all(rownames(fdata_eset) == rownames(exprs_matrix_eset))) {
stop("rownames(fData) and rownames(exprsMatrix) differ")
}
if (!inherits(exprs_matrix_eset, "matrix")) {
stop("exprsMatrix must be of class 'matrix'")
}
additional_info <- paste0("Additional information about eSet \n",
" Expression matrix created from ",
output, " output. \n",
" Expression matrix contains non-transformed ",
ifelse(output %in% c("STAR", "STARsolo"),
"counts",
ifelse(measure == "expected_count",
"counts", measure)), ".")
if (isTRUE(!is.null(add_eset_annotation) &
is.character(add_eset_annotation))) {
additional_info <- paste0(additional_info, "\n", " ", add_eset_annotation)
}
fdata_eset <- new("AnnotatedDataFrame", data = fdata_eset)
pdata_eset <- new("AnnotatedDataFrame", data = pdata_eset)
requireNamespace("Biobase")
eset <- Biobase::ExpressionSet(assayData = exprs_matrix_eset,
phenoData = pdata_eset,
featureData = fdata_eset,
annotation = additional_info)
saveRDS(eset, file = output_path)
message(paste0("eset created succesfully for ", ncol(eset),
" samples and ", nrow(eset),
" genes and saved at ", output_path, "."))
eset
}
p_data_file <- par$pDataFile
f_data_file <- par$fDataFile
pool_name <- par$poolName
mapping_dir <- lapply(par$mappingDir,
\(x) file.path(x, "Solo.out", "Gene", "raw"))
get_barcode_from_mapping_dir <- function(raw_dir) {
barcodes_file <- file.path(raw_dir, "barcodes.tsv")
if (!file.exists(barcodes_file)) {
stop(paste0("Expected the 'Solo.out/Gene/raw' directory at ",
raw_dir, " to contain a 'barcodes.tsv' file."))
}
barcodes <- readLines(barcodes_file)
if (length(barcodes) != 1) {
stop(paste0("A single STAR Solo folder should only have ",
"mapped one (1) barcode, but found '",
length(barcodes), "'for mapping directory ", raw_dir))
}
return(barcodes)
}
barcodes <- lapply(mapping_dir, get_barcode_from_mapping_dir)
print(paste0("mappingDir: ", mapping_dir))
print(paste0("pDataFile: ", p_data_file))
print(paste0("fDataFile: ", f_data_file))
print(paste0("poolName: ", pool_name))
print(paste0("barcodes: ", barcodes))
# CREATE ESET WITH RAW UMI COUNTS
eset <- create_eset(feature_annotation_path = f_data_file,
sample_annotation_path = p_data_file,
mapping_dir = mapping_dir,
barcodes = barcodes,
output_path = par$output,
pool_name = pool_name,
path = NULL,
exprs_matrix_path = NULL)

View File

@@ -0,0 +1,76 @@
library(testthat)
library(Biobase)
### VIASH START
meta <- list(
resources_dir = "src/eset/create_eset/test_data",
executable = "target/executable/eset/create_eset/create_eset"
)
### VIASH END
output <- tempfile()
out <- processx::run(meta$executable, c(
"--pDataFile", file.path(meta$resources_dir, "pData.tsv"),
"--fDataFile", file.path(meta$resources_dir, "fData.tsv"),
"--mappingDir", file.path(meta$resources_dir, "mapping_dir", "AACAAGGTAC"),
"--mappingDir", file.path(meta$resources_dir, "mapping_dir", "ACGCCTTCGT"),
"--poolName", "foo",
"--output", output
))
expect_equal(out$status, 0)
expect_true(file.exists(output))
result <- readRDS(output)
stopifnot(length(sampleNames(result)) == 2)
stopifnot(all(sampleNames(result) == c("foo_AACAAGGTAC", "foo_ACGCCTTCGT")))
expected_feature_names <- c(
"ENS0001058", "ENS0000221", "ENS0001387", "ENS0000508", "ENS0001199",
"ENS0000477", "ENS0001457", "ENS0001040", "ENS0000114", "ENS0000821",
"ENS0001429", "ENS0001396", "ENS0000355", "ENS0000122", "ENS0000441",
"ENS0001223", "ENS0001431", "ENS0000042", "ENS0000443", "ENS0000389",
"ENS0001208", "ENS0001140", "ENS0000071", "ENS0001369"
)
stopifnot(length(featureNames(result)) == 24)
stopifnot(all(featureNames(result) == expected_feature_names))
expected_expressions <- matrix(
c(0, 0,
0, 40,
0, 0,
0, 0,
1, 2,
0, 0,
0, 0,
0, 0,
2, 2,
0, 0,
0, 0,
8, 2,
0, 0,
1, 0,
2, 3,
0, 0,
0, 0,
0, 0,
1, 0,
0, 0,
16, 13,
0, 0,
12, 13,
5, 2),
ncol = 2,
nrow = 24,
byrow = TRUE,
)
rownames(expected_expressions) <- expected_feature_names
colnames(expected_expressions) <- c("foo_AACAAGGTAC", "foo_ACGCCTTCGT")
stopifnot(identical(exprs(result), expected_expressions))
input_f_data <- read.table(file.path(meta$resources_dir, "fData.tsv"),
sep = "\t", quote = "\"", comment.char = "",
header = TRUE)
input_f_data <- input_f_data[input_f_data$gene_id %in% expected_feature_names, ]
row.names(input_f_data) <- input_f_data$gene_id
input_f_data[] <- lapply(input_f_data, as.character)
stopifnot(identical(input_f_data, fData(result)))

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1 @@
AACAAGGTAC
1 AACAAGGTAC

View File

@@ -0,0 +1,25 @@
ENS0001140 209E3 Gene Expression
ENS0001058 A2B9A Gene Expression
ENS0000508 CF168 Gene Expression
ENS0001457 3BA5A Gene Expression
ENS0001431 1C968 Gene Expression
ENS0000821 E5192 Gene Expression
ENS0001040 1821B Gene Expression
ENS0000443 5AD11 Gene Expression
ENS0000441 3F0FF Gene Expression
ENS0001387 265F2 Gene Expression
ENS0001223 28A43 Gene Expression
ENS0001208 58E28 Gene Expression
ENS0001396 6E614 Gene Expression
ENS0001199 EA941 Gene Expression
ENS0001369 99DDC Gene Expression
ENS0000770 AFCC0 Gene Expression
ENS0000389 B58E5 Gene Expression
ENS0000071 7A6C3 Gene Expression
ENS0000114 65424 Gene Expression
ENS0000355 077A2 Gene Expression
ENS0001429 22A4F Gene Expression
ENS0000477 981E6 Gene Expression
ENS0000042 E2D99 Gene Expression
ENS0000122 D90E9 Gene Expression
ENS0000221 97B0F Gene Expression
1 ENS0001140 209E3 Gene Expression
2 ENS0001058 A2B9A Gene Expression
3 ENS0000508 CF168 Gene Expression
4 ENS0001457 3BA5A Gene Expression
5 ENS0001431 1C968 Gene Expression
6 ENS0000821 E5192 Gene Expression
7 ENS0001040 1821B Gene Expression
8 ENS0000443 5AD11 Gene Expression
9 ENS0000441 3F0FF Gene Expression
10 ENS0001387 265F2 Gene Expression
11 ENS0001223 28A43 Gene Expression
12 ENS0001208 58E28 Gene Expression
13 ENS0001396 6E614 Gene Expression
14 ENS0001199 EA941 Gene Expression
15 ENS0001369 99DDC Gene Expression
16 ENS0000770 AFCC0 Gene Expression
17 ENS0000389 B58E5 Gene Expression
18 ENS0000071 7A6C3 Gene Expression
19 ENS0000114 65424 Gene Expression
20 ENS0000355 077A2 Gene Expression
21 ENS0001429 22A4F Gene Expression
22 ENS0000477 981E6 Gene Expression
23 ENS0000042 E2D99 Gene Expression
24 ENS0000122 D90E9 Gene Expression
25 ENS0000221 97B0F Gene Expression

View File

@@ -0,0 +1,13 @@
%%MatrixMarket matrix coordinate integer general
%
25 1 10
8 1 1
9 1 2
12 1 16
13 1 8
14 1 1
15 1 5
16 1 5
18 1 12
19 1 2
24 1 1

View File

@@ -0,0 +1 @@
ACGCCTTCGT
1 ACGCCTTCGT

View File

@@ -0,0 +1,25 @@
ENS0001140 209E3 Gene Expression
ENS0001058 A2B9A Gene Expression
ENS0000508 CF168 Gene Expression
ENS0001457 3BA5A Gene Expression
ENS0001431 1C968 Gene Expression
ENS0000821 E5192 Gene Expression
ENS0001040 1821B Gene Expression
ENS0000443 5AD11 Gene Expression
ENS0000441 3F0FF Gene Expression
ENS0001387 265F2 Gene Expression
ENS0001223 28A43 Gene Expression
ENS0001208 58E28 Gene Expression
ENS0001396 6E614 Gene Expression
ENS0001199 EA941 Gene Expression
ENS0001369 99DDC Gene Expression
ENS0000770 AFCC0 Gene Expression
ENS0000389 B58E5 Gene Expression
ENS0000071 7A6C3 Gene Expression
ENS0000114 65424 Gene Expression
ENS0000355 077A2 Gene Expression
ENS0001429 22A4F Gene Expression
ENS0000477 981E6 Gene Expression
ENS0000042 E2D99 Gene Expression
ENS0000122 D90E9 Gene Expression
ENS0000221 97B0F Gene Expression
1 ENS0001140 209E3 Gene Expression
2 ENS0001058 A2B9A Gene Expression
3 ENS0000508 CF168 Gene Expression
4 ENS0001457 3BA5A Gene Expression
5 ENS0001431 1C968 Gene Expression
6 ENS0000821 E5192 Gene Expression
7 ENS0001040 1821B Gene Expression
8 ENS0000443 5AD11 Gene Expression
9 ENS0000441 3F0FF Gene Expression
10 ENS0001387 265F2 Gene Expression
11 ENS0001223 28A43 Gene Expression
12 ENS0001208 58E28 Gene Expression
13 ENS0001396 6E614 Gene Expression
14 ENS0001199 EA941 Gene Expression
15 ENS0001369 99DDC Gene Expression
16 ENS0000770 AFCC0 Gene Expression
17 ENS0000389 B58E5 Gene Expression
18 ENS0000071 7A6C3 Gene Expression
19 ENS0000114 65424 Gene Expression
20 ENS0000355 077A2 Gene Expression
21 ENS0001429 22A4F Gene Expression
22 ENS0000477 981E6 Gene Expression
23 ENS0000042 E2D99 Gene Expression
24 ENS0000122 D90E9 Gene Expression
25 ENS0000221 97B0F Gene Expression

View File

@@ -0,0 +1,12 @@
%%MatrixMarket matrix coordinate integer general
%
25 1 9
9 1 3
12 1 13
13 1 2
14 1 2
15 1 2
16 1 3
18 1 13
19 1 2
25 1 40

View File

@@ -0,0 +1,3 @@
WellBC WellID NumberOfMTReads pctMT NumberOfERCCReads pctERCC NumberOfChromReads pctChrom NumberOfInputReads NumberOfMappedReads PctMappedReads NumberOfReadsMappedToMultipleLoci PectOfReadsMappedToMultipleLoci NumberOfReadsMappedToTooManyLoci PectOfReadsMappedToTooManyLoci NumberOfReadsUnmappedTooManyMismatches PectOfReadsUnmappedTooManyMismatches NumberOfReadsUnmappedTooShort PectOfReadsUnmappedTooShort NumberOfReadsUnmappedOther PectOfReadsUnmappedOther ReadsWithValidBarcodes SequencingSaturation Q30BasesInCB+UMI ReadsMappedToTranscriptome:Unique+MultipeGenes EstimatedNumberOfCells FractionOfReadsInCells MeanReadsPerCell NumberOfUMIs NumberOfGenes NumberOfCountedReads
AACAAGGTAC A1 0 0 0 0 8542 100 141303 23749 16.81 0 0 8458 5.99 0 0 109035 77.16 61 0.04 0.999816 0.0698056 0.979965 0.0618175 1 1 8538 7942 408 9535
ACGCCTTCGT B2 0 0 0 0 5863 100 96430 16869 17.49 0 0 6124 6.35 0 0 73375 76.09 62 0.06 0.999782 0.0665302 0.980077 0.0620969 1 1 5862 5472 377 6463
1 WellBC WellID NumberOfMTReads pctMT NumberOfERCCReads pctERCC NumberOfChromReads pctChrom NumberOfInputReads NumberOfMappedReads PctMappedReads NumberOfReadsMappedToMultipleLoci PectOfReadsMappedToMultipleLoci NumberOfReadsMappedToTooManyLoci PectOfReadsMappedToTooManyLoci NumberOfReadsUnmappedTooManyMismatches PectOfReadsUnmappedTooManyMismatches NumberOfReadsUnmappedTooShort PectOfReadsUnmappedTooShort NumberOfReadsUnmappedOther PectOfReadsUnmappedOther ReadsWithValidBarcodes SequencingSaturation Q30BasesInCB+UMI ReadsMappedToTranscriptome:Unique+MultipeGenes EstimatedNumberOfCells FractionOfReadsInCells MeanReadsPerCell NumberOfUMIs NumberOfGenes NumberOfCountedReads
2 AACAAGGTAC A1 0 0 0 0 8542 100 141303 23749 16.81 0 0 8458 5.99 0 0 109035 77.16 61 0.04 0.999816 0.0698056 0.979965 0.0618175 1 1 8538 7942 408 9535
3 ACGCCTTCGT B2 0 0 0 0 5863 100 96430 16869 17.49 0 0 6124 6.35 0 0 73375 76.09 62 0.06 0.999782 0.0665302 0.980077 0.0620969 1 1 5862 5472 377 6463

View File

@@ -0,0 +1,46 @@
name: create_fdata
namespace: eset
description: |
Create a fdata file
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ maintainer ]
- __merge__: /src/base/authors/marijke_van_moerbeke.yaml
roles: [ contributor ]
arguments:
- name: "--gtf"
type: file
description: "Genome annotation file in GTF format."
required: true
- name: "--output"
description: |
Tab-delimited text file containing information about the 'gene' or 'transcript'
entries from the input GTF file. The 'transcript' entries are used in case the source
of the GTF was 'refGene' or 'ncbiRefSeq'.
type: file
direction: output
default: fData.$id.txt
resources:
- type: python_script
path: create_fdata.py
test_resources:
- type: python_script
path: test.py
- path: test_annotation.gtf
engines:
- type: docker
image: python:3.12-slim
setup:
- type: apt
packages:
- procps
- type: python
packages:
- pandas
test_setup:
- type: python
packages:
- viashpy
runners:
- type: executable
- type: nextflow

View File

@@ -0,0 +1,130 @@
import logging
import pandas as pd
import numpy as np
from textwrap import fill
### VIASH START
meta = {
"name": "create_fdata",
}
par = {
"gtf": "src/eset/create_fdata/test_annotation.gtf",
"output": "fData.tsv"
}
### VIASH END
logger = logging.getLogger()
console_handler = logging.StreamHandler()
logger.addHandler(console_handler)
logger.setLevel(logging.DEBUG)
def read_gtf(gtf_path: str) -> pd.DataFrame:
logger.info("Reading %s", gtf_path)
result = pd.read_csv(gtf_path, sep="\t",
header=None, names=("seqname", "source",
"feature", "start", "end",
"score", "strand", "frame",
"attribute"),
dtype={
"seqname": pd.StringDtype(),
"source": pd.StringDtype(),
"feature": pd.StringDtype(),
"start": pd.Int64Dtype(),
"end": pd.Int64Dtype(),
"score": pd.StringDtype(),
"strand": pd.CategoricalDtype(categories=["+", "-"],
ordered=False),
"frame": pd.StringDtype(),
"attribute": pd.StringDtype(),
},
comment='#'
)
logger.info("Done reading %s. Found %d GTF entries ", par["gtf"], result.shape[0])
logger.info("GTF file is providing information for the following chromosomes: \n%s",
fill(", ".join(result['seqname'].unique()), width=100))
logger.info("The following sources were specified in the GTF file:\n%s",
", ".join(result["source"].unique()))
return result
def parse_attributes(attributes_series: pd.Series):
attribute_dict = dict()
attributes_list = [attr.strip().split(" ")
for attr in attributes_series["attribute"].strip(";").split(";")]
for (attr_name, attr_value) in attributes_list:
attribute_dict.setdefault(attr_name, []).append(attr_value.strip('"'))
attribute_dict = {attr_name: "|".join(attr_value)
for attr_name, attr_value in attribute_dict.items()}
return pd.Series(attribute_dict)
def main(par):
logger.info(f"{meta['name']} started.")
parameters_str = [f'\t{param}: {param_val}\n' for param, param_val in par.items()]
logger.info("Parameters:\n%s", "".join(parameters_str).rstrip())
gtf_file = read_gtf(par["gtf"])
sources = set(source for source in gtf_file["source"].unique() if source != "ERCC")
specific_gtf = False
feature = "gene"
if len(sources) == 1 and (source := sources[0]) \
and (source == "refGene" or source == "ncbiRefSeq"):
feature = "transcript"
specific_gtf = True
logger.info("Found specific GTF from %s, forcing filtering on feature type %s", source, feature)
logger.info("Filtering GTF entries for feature type '%s'.", feature)
gtf_file = gtf_file[gtf_file["feature"] == feature]
logger.info("After filtering %d entries are left.", gtf_file.shape[0])
logger.info("Parsing the GTF attributes")
annotation = gtf_file[["attribute"]].apply(parse_attributes, result_type="expand", axis=1)
logger.info("Found the following attributes in the GTF:\n%s", ", ".join(annotation.columns))
annotation = pd.concat([gtf_file.drop(["attribute"], axis=1), annotation], axis=1)
if specific_gtf:
logger.info("Because the source of the GTF is either 'ncbiRefSeq' or 'refGene', which"
"caused forced filtering based on %s, the duplicate genes still need to be dropped.",
feature)
annotation = annotation.drop_duplicates(subset=("gene_id", "gene_name"), keep=False)
logger.info("After dropping duplicates, %d entries are left", annotation.shape[0])
# detect ensembl ids
# some GTF files contain version in ENSEMBL, e.g. ENS00000000046319.1
# we remove the version, because the annotation packages don't contain the version
if "gene_id" in annotation.columns:
logger.info("'gene_id' column was detected in attributes. Performing extra parsing of ENSEMBL ids.")
annotation["ENSEMBL_with_version"] = annotation["gene_id"].where(annotation["gene_id"].str.startswith("ENS"))
annotation["ENSEMBL"] = annotation["ENSEMBL_with_version"].str.replace(r"\.\d+$", "", regex=True)
annotation["gene_id"] = annotation["gene_id"].str.replace(r"\.\d+$", "", regex=True)
possible_name_columns = ("Name", "name", "gene_name")
found_columns = list(filter(lambda col_name: col_name in annotation, possible_name_columns))
# The following code allows to select a value for the SYMBOL column based on the first non-na column
if found_columns:
logger.info("Found one the following columns: %s; which can be used to populate the SYMBOL column",
", ".join(possible_name_columns))
# For each row (gtf entry), get the name of the first column that actually holds a value.
column_to_get = annotation.loc[:,found_columns].apply(pd.Series.first_valid_index, axis=1)
counts_per_column = column_to_get.value_counts(dropna=False).to_dict()
counts_per_column_str = [f'\t{col}: {counts}\n' for col, counts in counts_per_column.items()]
logger.info("Frequencies of the origin for the entries in the SYMBOL column:\n%s",
"".join(counts_per_column_str).rstrip())
# If all columns hold NA for a certain row, first_valid_index will return None.
# Just use the name of the first column.
column_to_get = column_to_get.fillna(found_columns[0])
# We now have a list one column name per row, use it so select the values
# Loc cannot be used here because 1 value per row is required,
# and loc will select for each row all the columns in columns_to_get
idx, cols = pd.factorize(column_to_get)
symbol_values = annotation.reindex(cols, axis=1).to_numpy()[np.arange(len(annotation)), idx]
annotation["SYMBOL"] = symbol_values
logger.info("Writing to %s", par["output"])
annotation = annotation.drop(["score", "source", "frame", "feature"], axis=1)
annotation.to_csv(par["output"], sep="\t", header=True, index=False, na_rep="NA")
logger.info("%s finished", meta['name'])
if __name__ == "__main__":
main(par)

View File

@@ -0,0 +1,61 @@
import pytest
import sys
import pandas as pd
from pathlib import Path
from uuid import uuid4
### VIASH START
meta = {
"resources_dir": "./src/eset/create_fdata/",
"executable": "target/executable/eset/create_fdata/create_fdata",
"config": "src/eset/create_fdata/config.vsh.yaml"
}
### VIASH END
@pytest.fixture
def test_annotation_path():
return Path(meta["resources_dir"]) / "test_annotation.gtf"
@pytest.fixture
def random_path(tmp_path):
def wrapper(extension=None):
extension = "" if not extension else f".{extension}"
return tmp_path / f"{uuid4()}{extension}"
return wrapper
def test_create_fdata(run_component, test_annotation_path, random_path):
output_path = random_path("tsv")
run_component([
"--gtf", test_annotation_path,
"--output", output_path
])
assert output_path.is_file()
result = pd.read_csv(output_path, sep="\t", dtype=pd.StringDtype())
expected_dict = {
"seqname": ["20", "20", "20", "21"],
"start": ["87250", "142590", "157454", "297570"],
"end": ["97094", "145751", "159163", "300321"],
"strand": ["+", "+", "+", "+"],
"gene_id": ["ENSG00000178591", "ENSG00000125788",
"ENSG00000088782", "ENSG00000247315"],
"gene_version": ["7", "6", "5", "4"],
"gene_name": ["DEFB125", "DEFB126", "DEFB127", pd.NA],
"gene_source": ["ensembl_havana", "ensembl_havana",
"ensembl_havana", "havana"],
"gene_biotype": ["protein_coding", "protein_coding",
"protein_coding", "protein_coding"],
"ENSEMBL_with_version": ["ENSG00000178591.7", "ENSG00000125788",
"ENSG00000088782", "ENSG00000247315"],
"ENSEMBL": ["ENSG00000178591", "ENSG00000125788",
"ENSG00000088782", "ENSG00000247315"],
"SYMBOL": ["DEFB125", "DEFB126", "DEFB127", pd.NA]
}
expected = pd.DataFrame.from_dict(expected_dict, dtype=pd.StringDtype())
pd.testing.assert_frame_equal(expected, result, check_like=True)
if __name__ == '__main__':
sys.exit(pytest.main([__file__]))

View File

@@ -0,0 +1,45 @@
20 ensembl_havana gene 87250 97094 . + . gene_id "ENSG00000178591.7"; gene_version "7"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
20 havana transcript 87250 97094 . + . gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000608838"; transcript_version "1"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; transcript_support_level "2";
20 havana exon 87250 87359 . + . gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000608838"; transcript_version "1"; exon_number "1"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00003702629"; exon_version "1"; transcript_support_level "2";
20 havana exon 96005 97094 . + . gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000608838"; transcript_version "1"; exon_number "2"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00003705060"; exon_version "1"; transcript_support_level "2";
20 ensembl_havana transcript 87672 97094 . + . gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000382410"; transcript_version "3"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12989"; tag "basic"; transcript_support_level "1 (assigned to previous version 2)";
20 ensembl_havana exon 87672 87767 . + . gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000382410"; transcript_version "3"; exon_number "1"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12989"; exon_id "ENSE00001491993"; exon_version "2"; tag "basic"; transcript_support_level "1 (assigned to previous version 2)";
20 ensembl_havana CDS 87710 87767 . + 0 gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000382410"; transcript_version "3"; exon_number "1"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12989"; protein_id "ENSP00000371847"; protein_version "2"; tag "basic"; transcript_support_level "1 (assigned to previous version 2)";
20 ensembl_havana start_codon 87710 87712 . + 0 gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000382410"; transcript_version "3"; exon_number "1"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12989"; tag "basic"; transcript_support_level "1 (assigned to previous version 2)";
20 ensembl_havana exon 96005 97094 . + . gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000382410"; transcript_version "3"; exon_number "2"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12989"; exon_id "ENSE00001491984"; exon_version "3"; tag "basic"; transcript_support_level "1 (assigned to previous version 2)";
20 ensembl_havana CDS 96005 96414 . + 2 gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000382410"; transcript_version "3"; exon_number "2"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12989"; protein_id "ENSP00000371847"; protein_version "2"; tag "basic"; transcript_support_level "1 (assigned to previous version 2)";
20 ensembl_havana stop_codon 96415 96417 . + 0 gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000382410"; transcript_version "3"; exon_number "2"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12989"; tag "basic"; transcript_support_level "1 (assigned to previous version 2)";
20 ensembl_havana five_prime_utr 87672 87709 . + . gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000382410"; transcript_version "3"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12989"; tag "basic"; transcript_support_level "1 (assigned to previous version 2)";
20 ensembl_havana three_prime_utr 96418 97094 . + . gene_id "ENSG00000178591"; gene_version "7"; transcript_id "ENST00000382410"; transcript_version "3"; gene_name "DEFB125"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB125-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12989"; tag "basic"; transcript_support_level "1 (assigned to previous version 2)";
20 ensembl_havana gene 142590 145751 . + . gene_id "ENSG00000125788"; gene_version "6"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
20 ensembl_havana transcript 142590 145751 . + . gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000382398"; transcript_version "4"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12990"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana exon 142590 142686 . + . gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000382398"; transcript_version "4"; exon_number "1"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12990"; exon_id "ENSE00001491976"; exon_version "4"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana CDS 142629 142686 . + 0 gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000382398"; transcript_version "4"; exon_number "1"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12990"; protein_id "ENSP00000371835"; protein_version "3"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana start_codon 142629 142631 . + 0 gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000382398"; transcript_version "4"; exon_number "1"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12990"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana exon 145415 145751 . + . gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000382398"; transcript_version "4"; exon_number "2"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12990"; exon_id "ENSE00000858522"; exon_version "4"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana CDS 145415 145689 . + 2 gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000382398"; transcript_version "4"; exon_number "2"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12990"; protein_id "ENSP00000371835"; protein_version "3"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana stop_codon 145690 145692 . + 0 gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000382398"; transcript_version "4"; exon_number "2"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12990"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana five_prime_utr 142590 142628 . + . gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000382398"; transcript_version "4"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12990"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana three_prime_utr 145693 145751 . + . gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000382398"; transcript_version "4"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12990"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 havana transcript 142634 145749 . + . gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000542572"; transcript_version "1"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; tag "mRNA_start_NF"; transcript_support_level "3";
20 havana exon 142634 142686 . + . gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000542572"; transcript_version "1"; exon_number "1"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002285856"; exon_version "1"; tag "mRNA_start_NF"; transcript_support_level "3";
20 havana exon 145415 145488 . + . gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000542572"; transcript_version "1"; exon_number "2"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002303512"; exon_version "1"; tag "mRNA_start_NF"; transcript_support_level "3";
20 havana exon 145579 145749 . + . gene_id "ENSG00000125788"; gene_version "6"; transcript_id "ENST00000542572"; transcript_version "1"; exon_number "3"; gene_name "DEFB126"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB126-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002217818"; exon_version "1"; tag "mRNA_start_NF"; transcript_support_level "3";
20 ensembl_havana gene 157454 159163 . + . gene_id "ENSG00000088782"; gene_version "5"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
20 ensembl_havana transcript 157454 159163 . + . gene_id "ENSG00000088782"; gene_version "5"; transcript_id "ENST00000382388"; transcript_version "4"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB127-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12991"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana exon 157454 157593 . + . gene_id "ENSG00000088782"; gene_version "5"; transcript_id "ENST00000382388"; transcript_version "4"; exon_number "1"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB127-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12991"; exon_id "ENSE00001491947"; exon_version "4"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana CDS 157545 157593 . + 0 gene_id "ENSG00000088782"; gene_version "5"; transcript_id "ENST00000382388"; transcript_version "4"; exon_number "1"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB127-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12991"; protein_id "ENSP00000371825"; protein_version "3"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana start_codon 157545 157547 . + 0 gene_id "ENSG00000088782"; gene_version "5"; transcript_id "ENST00000382388"; transcript_version "4"; exon_number "1"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB127-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12991"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana exon 158774 159163 . + . gene_id "ENSG00000088782"; gene_version "5"; transcript_id "ENST00000382388"; transcript_version "4"; exon_number "2"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB127-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12991"; exon_id "ENSE00001166560"; exon_version "3"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana CDS 158774 159021 . + 2 gene_id "ENSG00000088782"; gene_version "5"; transcript_id "ENST00000382388"; transcript_version "4"; exon_number "2"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB127-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12991"; protein_id "ENSP00000371825"; protein_version "3"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana stop_codon 159022 159024 . + 0 gene_id "ENSG00000088782"; gene_version "5"; transcript_id "ENST00000382388"; transcript_version "4"; exon_number "2"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB127-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12991"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana five_prime_utr 157454 157544 . + . gene_id "ENSG00000088782"; gene_version "5"; transcript_id "ENST00000382388"; transcript_version "4"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB127-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12991"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
20 ensembl_havana three_prime_utr 159025 159163 . + . gene_id "ENSG00000088782"; gene_version "5"; transcript_id "ENST00000382388"; transcript_version "4"; gene_name "DEFB127"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "DEFB127-201"; transcript_source "ensembl_havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS12991"; tag "basic"; transcript_support_level "1 (assigned to previous version 3)";
21 havana gene 297570 300321 . + . gene_id "ENSG00000247315"; gene_version "4"; gene_source "havana"; gene_biotype "protein_coding";
21 havana transcript 297570 300321 . + . gene_id "ENSG00000247315"; gene_version "4"; transcript_id "ENST00000500893"; transcript_version "4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "ZCCHC3-201"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS42844"; tag "basic"; transcript_support_level "NA (assigned to previous version 3)";
21 havana exon 297570 300321 . + . gene_id "ENSG00000247315"; gene_version "4"; transcript_id "ENST00000500893"; transcript_version "4"; exon_number "1"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "ZCCHC3-201"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS42844"; exon_id "ENSE00001977652"; exon_version "4"; tag "basic"; transcript_support_level "NA (assigned to previous version 3)";
21 havana CDS 297587 298795 . + 0 gene_id "ENSG00000247315"; gene_version "4"; transcript_id "ENST00000500893"; transcript_version "4"; exon_number "1"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "ZCCHC3-201"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS42844"; protein_id "ENSP00000484056"; protein_version "1"; tag "basic"; transcript_support_level "NA (assigned to previous version 3)";
21 havana start_codon 297587 297589 . + 0 gene_id "ENSG00000247315"; gene_version "4"; transcript_id "ENST00000500893"; transcript_version "4"; exon_number "1"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "ZCCHC3-201"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS42844"; tag "basic"; transcript_support_level "NA (assigned to previous version 3)";
21 havana stop_codon 298796 298798 . + 0 gene_id "ENSG00000247315"; gene_version "4"; transcript_id "ENST00000500893"; transcript_version "4"; exon_number "1"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "ZCCHC3-201"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS42844"; tag "basic"; transcript_support_level "NA (assigned to previous version 3)";
21 havana five_prime_utr 297570 297586 . + . gene_id "ENSG00000247315"; gene_version "4"; transcript_id "ENST00000500893"; transcript_version "4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "ZCCHC3-201"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS42844"; tag "basic"; transcript_support_level "NA (assigned to previous version 3)";
21 havana three_prime_utr 298799 300321 . + . gene_id "ENSG00000247315"; gene_version "4"; transcript_id "ENST00000500893"; transcript_version "4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "ZCCHC3-201"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "CCDS"; ccds_id "CCDS42844"; tag "basic"; transcript_support_level "NA (assigned to previous version 3)";

View File

@@ -0,0 +1,55 @@
name: create_pdata
namespace: eset
description: |
Create a pdata file by combining the mapping statistics
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ maintainer ]
- __merge__: /src/base/authors/marijke_van_moerbeke.yaml
roles: [ contributor ]
arguments:
- name: "--star_stats_file"
type: file
description: |
Tab-delimited text file containing statistics (per column) that were generated
from the STAR log files (Log.final.out, Summary.csv, ReadsPerGene.out.tab).
Each entry (row) in the file describes the values for one well (barcode).
required: true
- name: "--nrReadsNrGenesPerChromPool"
type: file
description: |
Pivot table in tsv format of the combined nrReadsNrGenesPerChrom files from STAR.
Describes per chromosome (as columns) the number of reads, as well as the total number
of reads per cell barcode and the percentage of nuclear, ERCC and mitochondrial
reads.
required: true
- name: "--output"
type: file
direction: output
default: pData.$id.txt
resources:
- type: python_script
path: create_pdata.py
test_resources:
- type: python_script
path: test.py
- path: nrReadsNrGenesPerChromPool.txt
- path: starLogs.txt
engines:
- type: docker
image: python:3.12-slim
setup:
- type: apt
packages:
- procps
- type: python
packages:
- pandas
test_setup:
- type: python
packages:
- viashpy
runners:
- type: executable
- type: nextflow

View File

@@ -0,0 +1,60 @@
from itertools import batched
import pandas as pd
import logging
### VIASH START
meta = {
"name": "create_pdata",
}
par = {
"star_stats_file": "src/eset/create_pdata/starLogs.txt",
"nrReadsNrGenesPerChromPool": "src/eset/create_pdata/nrReadsNrGenesPerChromPool.txt",
"output": "pData.tsv"
}
### VIASH END
logger = logging.getLogger()
console_handler = logging.StreamHandler()
logger.addHandler(console_handler)
logger.setLevel(logging.DEBUG)
def main(par):
logger.info(f"{meta['name']} started.")
parameters_str = [f'\t{param}: {param_val}\n' for param, param_val in par.items()]
logger.info("Parameters:\n%s", "".join(parameters_str).rstrip())
logger.info("Reading %s", par["star_stats_file"])
star_log_stats = pd.read_csv(par["star_stats_file"], sep="\t", index_col=0)
logger.info("STAR log statics file contains information for the following barcodes: %s",
", ".join(star_log_stats.index))
logger.info("Reading %s", par["nrReadsNrGenesPerChromPool"])
reads_and_genes_per_chr_stats = pd.read_csv(par["nrReadsNrGenesPerChromPool"], sep="\t", index_col=0)
logger.info("Reads per gene and chromosome table contains information for the following barcodes: %s",
", ".join(reads_and_genes_per_chr_stats.index))
logger.info("Filtering mapping statistics file columns.")
cols_to_keep = ("WellID", "NumberOfMTReads", "pctMT", "NumberOfERCCReads",
"pctERCC", "NumberOfChromReads", "pctChrom")
try:
reads_and_genes_per_chr_stats = reads_and_genes_per_chr_stats.loc[:,cols_to_keep]
except KeyError as e:
raise KeyError("When trying to subset the reads per genes and chromosomes file, "
"a column was missing. Available columns in the file: "
f"{', '.join(reads_and_genes_per_chr_stats.columns)}.") from e
combined_stats = pd.concat([reads_and_genes_per_chr_stats, star_log_stats], axis=1)
if combined_stats.isna().any(axis=None): # For non-overlapping indices, the values get filled with NA
raise ValueError("Error while combining two log files. It seems that the entries (barcodes) "
f"do not fully overlap. Barcodes in '{par['star_stats_file']}: "
f"{', '.join(reads_and_genes_per_chr_stats.index)}. Barcodes in "
f"'{par['nrReadsNrGenesPerChromPool']}': "
f"{', '.join(star_log_stats.index)}")
logger.info("Summary of final output:\n%s\n",
"\n".join(repr(combined_stats.loc[:,columns].describe())
for columns in batched(combined_stats.columns, 3)))
logger.info("Writing to %s", par["output"])
combined_stats.reset_index("WellBC").to_csv(par["output"], sep="\t", header=True, index=False)
logger.info("Finished %s.", meta["name"])
if __name__ == "__main__":
main(par)

View File

@@ -0,0 +1,8 @@
WellBC WellID 20 pctChrom pctMT pctERCC SumReads NumberOfGenes NumberOfERCCReads NumberOfChromReads NumberOfMTReads
AACAAGGTAC A1 8542 100 0 0 8542 408 0 8542 0
ACGCCTTCGT A2 5863 100 0 0 5863 377 0 5863 0
CCATACTGAC A3 7396 100 0 0 7396 391 0 7396 0
GCAAGCGAAT B1 10092 100 0 0 10092 420 0 10092 0
GTCTCGAGTG C5 470 100 0 0 470 150 0 470 0
TGCGCTCATT D6 7650 100 0 0 7650 407 0 7650 0
TTGTGTTCGA E19 9422 100 0 0 9422 420 0 9422 0

View File

@@ -0,0 +1,8 @@
WellBC NumberOfInputReads NumberOfMappedReads PctMappedReads NumberOfReadsMappedToMultipleLoci PectOfReadsMappedToMultipleLoci NumberOfReadsMappedToTooManyLoci PectOfReadsMappedToTooManyLoci NumberOfReadsUnmappedTooManyMismatches PectOfReadsUnmappedTooManyMismatches NumberOfReadsUnmappedTooShort PectOfReadsUnmappedTooShort NumberOfReadsUnmappedOther PectOfReadsUnmappedOther ReadsWithValidBarcodes SequencingSaturation Q30BasesInCB+UMI ReadsMappedToTranscriptome:Unique+MultipeGenes EstimatedNumberOfCells FractionOfReadsInCells MeanReadsPerCell NumberOfUMIs NumberOfGenes NumberOfCountedReads
ACGCCTTCGT 96430 16869 17.49 0 0 6124 6.35 0 0 73375 76.09 62 0.06 0.999782 0.0665302 0.980077 0.0620969 1 1 5862 5472 377 6463
GTCTCGAGTG 10158 1902 18.72 0 0 967 9.52 0 0 7280 71.67 9 0.09 0.999803 0.0553191 0.984451 0.0476472 1 1 470 444 150 533
GCAAGCGAAT 156134 24005 15.37 0 0 7961 5.1 0 0 124096 79.48 72 0.05 0.999744 0.0680872 0.982779 0.0658665 1 1 10090 9403 420 11273
CCATACTGAC 113577 17319 15.25 0 0 5905 5.2 0 0 90292 79.5 61 0.05 0.999859 0.0717282 0.982313 0.066554 1 1 7389 6859 391 8299
TGCGCTCATT 126989 19272 15.18 0 0 7141 5.62 0 0 100515 79.15 61 0.05 0.999843 0.0667974 0.986581 0.0616668 1 1 7650 7139 407 8444
TTGTGTTCGA 142560 22129 15.52 0 0 7045 4.94 0 0 113324 79.49 62 0.04 0.999783 0.060828 0.986622 0.0676838 1 1 9420 8847 420 10383
AACAAGGTAC 141303 23749 16.81 0 0 8458 5.99 0 0 109035 77.16 61 0.04 0.999816 0.0698056 0.979965 0.0618175 1 1 8538 7942 408 9535

View File

@@ -0,0 +1,99 @@
import pytest
import sys
import pandas as pd
from pathlib import Path
from uuid import uuid4
### VIASH START
meta = {
"resources_dir": "./src/eset/create_pdata/",
"executable": "target/executable/eset/create_pdata/create_pdata",
"config": "src/eset/create_pdata/config.vsh.yaml"
}
### VIASH END
@pytest.fixture
def test_reads_and_genes_per_chr_path():
return Path(meta["resources_dir"]) / "nrReadsNrGenesPerChromPool.txt"
@pytest.fixture
def test_star_logs_summary_path():
return Path(meta["resources_dir"]) / "starLogs.txt"
@pytest.fixture
def random_path(tmp_path):
def wrapper(extension=None):
extension = "" if not extension else f".{extension}"
return tmp_path / f"{uuid4()}{extension}"
return wrapper
def test_create_fdata(run_component, test_reads_and_genes_per_chr_path,
test_star_logs_summary_path, random_path):
output_path = random_path("tsv")
run_component([
"--star_stats_file", test_star_logs_summary_path,
"--nrReadsNrGenesPerChromPool", test_reads_and_genes_per_chr_path,
"--output", output_path
])
assert output_path.is_file()
result = pd.read_csv(output_path, sep="\t", dtype=pd.StringDtype())
expected_dict = {
'WellBC': ['AACAAGGTAC', 'ACGCCTTCGT', 'CCATACTGAC', 'GCAAGCGAAT',
'GTCTCGAGTG', 'TGCGCTCATT', 'TTGTGTTCGA'],
'WellID': ['A1', 'A2', 'A3', 'B1', 'C5', 'D6', 'E19'],
'NumberOfMTReads': ['0', '0', '0', '0', '0', '0', '0'],
'pctMT': ['0', '0', '0', '0', '0', '0', '0'],
'NumberOfERCCReads': ['0', '0', '0', '0', '0', '0', '0'],
'pctERCC': ['0', '0', '0', '0', '0', '0', '0'],
'NumberOfChromReads': ['8542', '5863', '7396', '10092', '470',
'7650', '9422'],
'pctChrom': ['100', '100', '100', '100', '100', '100', '100'],
'NumberOfInputReads': ['141303', '96430', '113577', '156134', '10158',
'126989', '142560'],
'NumberOfMappedReads': ['23749', '16869', '17319', '24005', '1902',
'19272', '22129'],
'PctMappedReads': ['16.81', '17.49', '15.25', '15.37', '18.72',
'15.18', '15.52'],
'NumberOfReadsMappedToMultipleLoci': ['0', '0', '0', '0', '0', '0', '0'],
'PectOfReadsMappedToMultipleLoci': ['0', '0', '0', '0', '0', '0', '0'],
'NumberOfReadsMappedToTooManyLoci': ['8458', '6124', '5905', '7961', '967',
'7141', '7045'],
'PectOfReadsMappedToTooManyLoci': ['5.99', '6.35', '5.2', '5.1', '9.52',
'5.62', '4.94'],
'NumberOfReadsUnmappedTooManyMismatches': ['0', '0', '0', '0', '0', '0', '0'],
'PectOfReadsUnmappedTooManyMismatches': ['0', '0', '0', '0', '0', '0', '0'],
'NumberOfReadsUnmappedTooShort': ['109035', '73375', '90292', '124096',
'7280', '100515', '113324'],
'PectOfReadsUnmappedTooShort': ['77.16', '76.09', '79.5', '79.48',
'71.67', '79.15', '79.49'],
'NumberOfReadsUnmappedOther': ['61', '62', '61', '72', '9', '61', '62'],
'PectOfReadsUnmappedOther': ['0.04', '0.06', '0.05', '0.05',
'0.09', '0.05', '0.04'],
'ReadsWithValidBarcodes': ['0.999816', '0.999782', '0.999859', '0.999744',
'0.999803', '0.999843', '0.999783'],
'SequencingSaturation': ['0.0698056', '0.0665302', '0.0717282', '0.0680872',
'0.0553191', '0.0667974', '0.060828'],
'Q30BasesInCB+UMI': ['0.979965', '0.980077', '0.982313', '0.982779',
'0.984451', '0.986581', '0.986622'],
'ReadsMappedToTranscriptome:Unique+MultipeGenes': ['0.0618175', '0.0620969',
'0.066554', '0.0658665',
'0.0476472', '0.0616668',
'0.0676838'],
'EstimatedNumberOfCells': ['1', '1', '1', '1', '1', '1', '1'],
'FractionOfReadsInCells': ['1', '1', '1', '1', '1', '1', '1'],
'MeanReadsPerCell': ['8538', '5862', '7389',
'10090', '470', '7650', '9420'],
'NumberOfUMIs': ['7942', '5472', '6859', '9403',
'444', '7139', '8847'],
'NumberOfGenes': ['408', '377', '391', '420', '150', '407', '420'],
'NumberOfCountedReads': ['9535', '6463', '8299', '11273',
'533', '8444', '10383']
}
expected = pd.DataFrame.from_dict(expected_dict, dtype=pd.StringDtype())
pd.testing.assert_frame_equal(result, expected, check_like=True)
if __name__ == '__main__':
sys.exit(pytest.main([__file__]))

View File

@@ -0,0 +1,34 @@
name: "check_eset"
namespace: "integration_test_components/htrnaseq"
description: "This component test the ExpressionSet object as output by the main pipeline."
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: "--eset"
type: file
required: true
description: Path to an ExpressionSet object.
example: eset.rds
- name: "--star_output"
type: file
required: true
multiple: true
resources:
- type: r_script
path: script.R
engines:
- type: docker
image: bioconductor/bioconductor_docker:3.19
setup:
- type: r
cran:
- bit64
bioc:
- Biobase
runners:
- type: executable
- type: nextflow

View File

@@ -0,0 +1,198 @@
library(Biobase)
library(testthat)
library(Matrix)
sample_1_result <- readRDS(par$eset)
expected_sample_names <- c(
"sample_one_AACAAGGTAC", "sample_one_AACAATCAGG", "sample_one_AACACCTAGT",
"sample_one_AACAGGCAAT", "sample_one_AACATGGAGA", "sample_one_AACATTACCG",
"sample_one_AACCAGCCAG", "sample_one_AACCAGTTGA", "sample_one_AACCGCGACT",
"sample_one_AACCGGAAGG", "sample_one_AACCGGCGTA", "sample_one_AACCTAGTCC",
"sample_one_AACCTCATAG", "sample_one_AACGTAAGCT", "sample_one_AACTCTACAC",
"sample_one_AACTGTGTCA", "sample_one_AAGACGGATT", "sample_one_AAGATCGGCG",
"sample_one_AAGATGTCCA", "sample_one_AAGCATATGG", "sample_one_AAGCGATGTT",
"sample_one_AAGCGTTCAG", "sample_one_AAGCTCACCT", "sample_one_AAGGCATGCG",
"sample_one_AAGGTCTGGA", "sample_one_AAGTTAGCGC", "sample_one_AAGTTCCTTG",
"sample_one_AATACCGGTA", "sample_one_AATAGCCACA", "sample_one_AATCACGCGA",
"sample_one_AATCCATCTG", "sample_one_AATCCGCTCC", "sample_one_AATCCTACCA",
"sample_one_AATCGTCCGC", "sample_one_AATGAACACG", "sample_one_AATGACCTTC",
"sample_one_AATGAGAGCA", "sample_one_AATGTCAGTG", "sample_one_AATTAGGCCG",
"sample_one_AATTGCGATG", "sample_one_ACAACAGTCG", "sample_one_ACAACCATAC",
"sample_one_ACAACGGAGC", "sample_one_ACAAGCGCGA", "sample_one_ACACAATCTC",
"sample_one_ACACAGTGAA", "sample_one_ACACCGAATT", "sample_one_ACACGCAGTA",
"sample_one_ACACGGTCCT", "sample_one_ACACTTGCTG", "sample_one_ACAGTGCCAA",
"sample_one_ACATGTGTGC", "sample_one_ACCAGGACCA", "sample_one_ACCATAACAC",
"sample_one_ACCGAACCGT", "sample_one_ACCGAGAGTC", "sample_one_ACCGGTACAG",
"sample_one_ACCGTACTTC", "sample_one_ACCTCCGACA", "sample_one_ACCTCTCTCC",
"sample_one_ACCTGTCCGA", "sample_one_ACCTTATGTG", "sample_one_ACGAATGACA",
"sample_one_ACGCCTCAAC", "sample_one_ACGCCTTCGT", "sample_one_ACGCTGGATA",
"sample_one_ACGGTCCGTT", "sample_one_ACGTAGGCAC", "sample_one_ACGTGCTGAT",
"sample_one_ACTCCAAGCC", "sample_one_ACTGGCGCAT", "sample_one_ACTGGCTTCC",
"sample_one_ACTTAACTGC", "sample_one_ACTTCATCAC", "sample_one_ACTTCGTTGA",
"sample_one_ACTTCTCCTG", "sample_one_ACTTGAGGAA", "sample_one_ACTTGTAAGG",
"sample_one_AGAACCACGG", "sample_one_AGAAGCAATC", "sample_one_AGACCGTTAT",
"sample_one_AGACTAGCAT", "sample_one_AGAGATGCAG", "sample_one_AGAGCTTACA",
"sample_one_AGAGTGTAAC", "sample_one_AGAGTTCTGC", "sample_one_AGATAGTGCT",
"sample_one_AGCAATGCGC", "sample_one_AGCATGTCAT", "sample_one_AGCCACTAGC",
"sample_one_AGCCAGAATA", "sample_one_AGCCAGCTCT", "sample_one_AGCGATAACG",
"sample_one_AGCGTACAAT", "sample_one_AGCTATTCCA", "sample_one_AGCTCCTCAG",
"sample_one_AGGAGGCATA", "sample_one_AGGCGTCTGT", "sample_one_AGTAACTCAC",
"sample_one_AGTAAGCGTT", "sample_one_AGTCTGTACG", "sample_one_AGTGCAATGT",
"sample_one_ATAAGGTGCA", "sample_one_ATACACGACA", "sample_one_ATAGGCCATT",
"sample_one_ATATCCGCAT", "sample_one_ATCAGCACTT", "sample_one_ATCAGCGAGG",
"sample_one_ATCCAATACG", "sample_one_ATCCGCTGTG", "sample_one_ATCCGTCCAT",
"sample_one_ATCGACGGCT", "sample_one_ATCGCGATTA", "sample_one_ATCGGTAGGC",
"sample_one_ATCTAAGGAG", "sample_one_ATGACGGTAA", "sample_one_ATGACTCAGT",
"sample_one_ATGCACCGGA", "sample_one_ATGCGGACTG", "sample_one_ATGCTTCCTA",
"sample_one_ATGGACCAAC", "sample_one_ATGGTCTTAG", "sample_one_ATGGTGAGCG",
"sample_one_ATGTGGAAGC", "sample_one_ATTATCGGAC", "sample_one_ATTCGGAACA",
"sample_one_CAACAATCCA", "sample_one_CAAGAAGCAT", "sample_one_CAAGATGAGG",
"sample_one_CAAGCCAACG", "sample_one_CAAGTGGATC", "sample_one_CACAGTTCAT",
"sample_one_CACGAGTCTG", "sample_one_CACGCTCCAA", "sample_one_CACTGAGCAC",
"sample_one_CAGATCAATG", "sample_one_CAGTGCTCTT", "sample_one_CAGTTAAGCA",
"sample_one_CATAGCTATC", "sample_one_CATCACCACC", "sample_one_CATGTACGCC",
"sample_one_CATTACACTG", "sample_one_CATTCGACGA", "sample_one_CCAACTATGG",
"sample_one_CCAAGGAGTT", "sample_one_CCAATTGTTC", "sample_one_CCACAAGTGC",
"sample_one_CCAGCTTAGT", "sample_one_CCATAACTTG", "sample_one_CCATACTGAC",
"sample_one_CCATAGATCA", "sample_one_CCATGTGCTT", "sample_one_CCATTCAGCG",
"sample_one_CCGAACAAGC", "sample_one_CCGAACCTAA", "sample_one_CCGAAGACCT",
"sample_one_CCGAATAGTG", "sample_one_CCGACTTCTC", "sample_one_CCGATCCACT",
"sample_one_CCGATGATAC", "sample_one_CCGCGTTATG", "sample_one_CCGCTAGCTT",
"sample_one_CCGGAGTATC", "sample_one_CCGGCCAATT", "sample_one_CCGGTCTCTA",
"sample_one_CCGTACGATG", "sample_one_CCGTCAGAAC", "sample_one_CCTAGACACG",
"sample_one_CCTAGTTGAG", "sample_one_CCTATTCTGT", "sample_one_CCTCAACCGA",
"sample_one_CCTCCATAAG", "sample_one_CCTGATGCCA", "sample_one_CCTGCAATAC",
"sample_one_CCTTGTATTC", "sample_one_CGAGATCTCT", "sample_one_CGAGGAACAA",
"sample_one_CGATAACCGC", "sample_one_CGATCCTGTG", "sample_one_CGCCAACCAT",
"sample_one_CGCCAGTGTT", "sample_one_CGCCTTGTAC", "sample_one_CGCGGATTCA",
"sample_one_CGCTTAAGGC", "sample_one_CGCTTACTAA", "sample_one_CGCTTCTTGG",
"sample_one_CGGAAGCTGT", "sample_one_CGGAATACAC", "sample_one_CGGAGATTGG",
"sample_one_CGGAGCTCAA", "sample_one_CGGATCGGTA", "sample_one_CGGATTCTAG",
"sample_one_CGGCAACTTA", "sample_one_CGGCTCATCA", "sample_one_CGGTCGTATT",
"sample_one_CGGTGACATC", "sample_one_CGTAACGGAT", "sample_one_CGTAAGATTC",
"sample_one_CGTACTGTAA", "sample_one_CGTAGAAGAC", "sample_one_CGTCCTAGGA",
"sample_one_CGTCGGCAAT", "sample_one_CGTGAGTTAT", "sample_one_CGTGTCAAGC",
"sample_one_CTAACTTCAG", "sample_one_CTAATAGCGT", "sample_one_CTACACCAGG",
"sample_one_CTAGCACAAT", "sample_one_CTATGAACGG", "sample_one_CTCAAGGACC",
"sample_one_CTCACCTGTC", "sample_one_CTCCTATTGT", "sample_one_CTCGCAACGT",
"sample_one_CTCGTGCCTA", "sample_one_CTGGATTGAC", "sample_one_CTGTAGTCAG",
"sample_one_CTGTCGCTTC", "sample_one_CTGTCTGTGT", "sample_one_CTTCATATCG",
"sample_one_CTTGCTGACG", "sample_one_GAAGGATTAG", "sample_one_GAATCGAGCC",
"sample_one_GACCATCTAA", "sample_one_GACGACCACA", "sample_one_GAGACATCTT",
"sample_one_GAGCGAGTCA", "sample_one_GAGTAGACCA", "sample_one_GATACGCTTA",
"sample_one_GATAGACTGT", "sample_one_GATAGAGGCG", "sample_one_GATAGGTCAA",
"sample_one_GATATCAGGA", "sample_one_GATCTCATTC", "sample_one_GATCTGGTCG",
"sample_one_GATGAGTGAC", "sample_one_GATGGATACA", "sample_one_GATGTGACAG",
"sample_one_GATTAAGTCC", "sample_one_GATTGCACGC", "sample_one_GCAAGCGAAT",
"sample_one_GCAATGTAAG", "sample_one_GCACACTATA", "sample_one_GCACTCGGAA",
"sample_one_GCACTGCGTT", "sample_one_GCACTTAATC", "sample_one_GCAGGAGATG",
"sample_one_GCAGTACTGG", "sample_one_GCATATGAGT", "sample_one_GCATCCGATC",
"sample_one_GCCAAGTACA", "sample_one_GCCACGATTC", "sample_one_GCCATAGGTT",
"sample_one_GCCATATCGA", "sample_one_GCCGTCAATA", "sample_one_GCCTGGACAT",
"sample_one_GCGTAATTAC", "sample_one_GCTATTATCC", "sample_one_GCTCAGTAAT",
"sample_one_GCTGCTTATA", "sample_one_GGAATAAGCA", "sample_one_GGACGATGCT",
"sample_one_GGCATCGTGA", "sample_one_GGCATTATTG", "sample_one_GGCCGAGATT",
"sample_one_GGCGCTATAA", "sample_one_GGCGTTAAGT", "sample_one_GGCTATTGAT",
"sample_one_GGCTGCTACT", "sample_one_GGTAATGTGT", "sample_one_GGTGGTTGGA",
"sample_one_GGTGTTCACC", "sample_one_GGTTAGATCT", "sample_one_GGTTATGGCG",
"sample_one_GGTTCACTGG", "sample_one_GGTTGTGCAA", "sample_one_GTAACCAGTA",
"sample_one_GTAACCTTGG", "sample_one_GTAAGAACCT", "sample_one_GTAAGGCTCC",
"sample_one_GTAATCCACG", "sample_one_GTATTGTGGA", "sample_one_GTCCGCATCA",
"sample_one_GTCCTTCGGT", "sample_one_GTCGCTCTCT", "sample_one_GTCGGTGACA",
"sample_one_GTCTCGAGTG", "sample_one_GTCTCTTAAG", "sample_one_GTCTTCCGAG",
"sample_one_GTGACTATAC", "sample_one_GTGGTTAATG", "sample_one_GTGTGCCTGT",
"sample_one_GTGTGTGTCC", "sample_one_GTTCATTGCC", "sample_one_GTTCCGGTGA",
"sample_one_GTTCGTCGAA", "sample_one_GTTGAATTGG", "sample_one_GTTGATCCGC",
"sample_one_GTTGTATGCT", "sample_one_TAACCGTAGC", "sample_one_TAACGTCGAT",
"sample_one_TAAGGTACGG", "sample_one_TACGGACATA", "sample_one_TACTACCGCC",
"sample_one_TACTGTCAAG", "sample_one_TAGCGAACGC", "sample_one_TAGCGCCAAC",
"sample_one_TAGGACGCCT", "sample_one_TAGGTTGCAA", "sample_one_TAGTAGTCTC",
"sample_one_TAGTCCGCTG", "sample_one_TAGTGGAACT", "sample_one_TATCATGCAG",
"sample_one_TATCGTTACG", "sample_one_TCAAGTGCAG", "sample_one_TCACAGATAC",
"sample_one_TCACCGCCTA", "sample_one_TCACGCCACT", "sample_one_TCACGTTGGC",
"sample_one_TCATTGTCCA", "sample_one_TCCACACTAG", "sample_one_TCCACGGTCA",
"sample_one_TCCACTCGCT", "sample_one_TCCGACTAAC", "sample_one_TCCGTTATCT",
"sample_one_TCCTAAGAGA", "sample_one_TCCTCTAGTA", "sample_one_TCGAAGCATT",
"sample_one_TCGAGAGAGC", "sample_one_TCGCACTTGA", "sample_one_TCGCCTACTG",
"sample_one_TCGCGTAGCA", "sample_one_TCGGCGTTAA", "sample_one_TCTACATCCG",
"sample_one_TCTCCACATT", "sample_one_TCTCTCCTAT", "sample_one_TCTTGCTCGG",
"sample_one_TGAACTAACC", "sample_one_TGAAGAAGGT", "sample_one_TGAGCGTTCC",
"sample_one_TGAGTACGTA", "sample_one_TGGAATGGAG", "sample_one_TGTCATTCGC",
"sample_one_TGTGCTTCAG", "sample_one_TGTTCAGGAT", "sample_one_TTACACACGT",
"sample_one_TTACTGTGAC", "sample_one_TTATAGGAGG", "sample_one_TTATCGCGTT",
"sample_one_TTATGCCGCG", "sample_one_TTCACGGAAG", "sample_one_TTCAGGAGTA",
"sample_one_TTCCATCGAG", "sample_one_TTCGAGTGAT", "sample_one_TTCTGTACCT",
"sample_one_TTGGCAATTC", "sample_one_TTGGCTCCAC", "sample_one_TTGGTAACAG",
"sample_one_TTGGTCAGTA", "sample_one_TTGTCGGCCA", "sample_one_TTGTGTTCGA"
)
stopifnot(identical(sampleNames(sample_1_result), expected_sample_names))
expected_var_labels <- c(
"WellBC",
"WellID",
"NumberOfMTReads",
"pctMT",
"NumberOfERCCReads",
"pctERCC",
"NumberOfChromReads",
"pctChrom",
"NumberOfInputReads",
"NumberOfMappedReads",
"PctMappedReads",
"NumberOfReadsMappedToMultipleLoci",
"PectOfReadsMappedToMultipleLoci",
"NumberOfReadsMappedToTooManyLoci",
"PectOfReadsMappedToTooManyLoci",
"NumberOfReadsUnmappedTooManyMismatches",
"PectOfReadsUnmappedTooManyMismatches",
"NumberOfReadsUnmappedTooShort",
"PectOfReadsUnmappedTooShort",
"NumberOfReadsUnmappedOther",
"PectOfReadsUnmappedOther",
"ReadsWithValidBarcodes",
"SequencingSaturation",
"Q30BasesInCB.UMI",
"ReadsMappedToTranscriptome.Unique.MultipeGenes",
"EstimatedNumberOfCells",
"FractionOfReadsInCells",
"MeanReadsPerCell",
"NumberOfUMIs",
"NumberOfGenes",
"NumberOfCountedReads",
"PoolName"
)
stopifnot(identical(varLabels(sample_1_result), expected_var_labels))
read_mm <- function(mapping_dir) {
market_matrix_file <- file.path(mapping_dir, "Solo.out",
"Gene", "raw", "matrix.mtx")
result <- readMM(market_matrix_file)
feature_file <- file.path(mapping_dir, "Solo.out",
"Gene", "raw", "features.tsv")
features <- read.table(feature_file, sep = "\t", header = FALSE,
col.names = c("ID", "Name", "Type"))$ID
rownames(result) <- gsub("\\.\\d+$", "", features)
barcodes_file <- file.path(mapping_dir,
"Solo.out", "Gene", "raw", "barcodes.tsv")
if (!file.exists(barcodes_file)) {
stop(paste0("Expected the 'Solo.out/Gene/raw' directory at ",
mapping_dir, " to contain a 'barcodes.tsv' file."))
}
barcodes <- readLines(barcodes_file)
if (length(barcodes) != 1) {
stop(paste0("A single STAR Solo folder should only have ",
"mapped one (1) barcode, but found '",
length(barcodes), "'for mapping directory ", mapping_dir))
}
colnames(result) <- paste0("sample_one_", barcodes)
return(result)
}
expected_matrices <- lapply(par$star_output, read_mm)
expected_matrix <- as.matrix(do.call(cbind, expected_matrices))
result_counts <- exprs(sample_1_result)
stopifnot(length(setdiff(colnames(expected_matrix),
colnames(exprs(sample_1_result)))) == 0)
stopifnot(length(setdiff(rownames(expected_matrix),
rownames(exprs(sample_1_result)))) == 0)
expected_matrix_sorted <- expected_matrix[, colnames(exprs(sample_1_result))]
stopifnot(identical(exprs(sample_1_result), expected_matrix_sorted))

View File

@@ -0,0 +1,41 @@
name: "check_cutadapt_output"
namespace: "integration_test_components/well_demultiplexing"
description: "This component test the cutadapt output from the well_demultiplex subworkflow."
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: "--fastq_r1"
type: file
required: true
multiple: true
description: Path to the forward reads to test.
- name: "--fastq_r2"
type: file
required: true
multiple: true
description: Path to the reverse reads to test.
- name: "--ids"
type: string
description: "Well IDs for the corresponding fastq input"
required: true
multiple: true
resources:
- type: python_script
path: script.py
engines:
- type: docker
image: python:3.12-slim
setup:
- type: apt
packages:
- procps
- type: python
packages:
- dnaio
runners:
- type: executable
- type: nextflow

View File

@@ -0,0 +1,75 @@
import dnaio
from operator import itemgetter
## VIASH START
par = {
}
## VIASH END
def assert_number_of_reads(reads):
expected_number_of_reads = {
"SRR14730301__A1": 165,
"SRR14730301__B1": 194,
"SRR14730302__A1": 141,
"SRR14730302__B1": 213
}
for input_id, expected_reads in expected_number_of_reads.items():
num_reads = len(reads[input_id])
assert num_reads == expected_reads, \
f"Expected number of ouput reads for {input_id} to be {expected_reads}, was {num_reads}."
def string_difference(string1, string2):
result = 0
for char1, char2 in zip(string1, string2, strict=True):
if char1.lower() != char2.lower():
result += 1
return result
def assert_barcodes_not_removed(reads):
barcodes = {
"SRR14730301__A1": "ACACCGAATT",
"SRR14730302__A1": "ACACCGAATT",
"SRR14730301__B1": "GGCTATTGAT",
"SRR14730302__B1": "GGCTATTGAT"
}
for sample_id, barcode in barcodes.items():
sample_reads = reads[sample_id]
forward_reads = map(itemgetter(0), sample_reads)
for i, forward_read in enumerate(forward_reads):
read_sequence = forward_read.sequence
read_barcode_start = read_sequence[: len(barcode)]
# A 10% difference is allowed.
assert string_difference(read_barcode_start, barcode) <= (0.1 * len(barcode)), \
(f"Expected barcode {barcode} to be present for sample {sample_id} "
f"in read {i}. Found {read_barcode_start}")
def create_input_mapping(sample_ids, inputs_r1, inputs_r2):
return {sample_id: [input_r1, input_r2]
for sample_id, input_r1, input_r2
in zip(sample_ids, inputs_r1, inputs_r2, strict=True)}
def read_input_files(input_mapping):
expected_keys = {"SRR14730301__A1", "SRR14730301__B1",
"SRR14730302__A1", "SRR14730302__B1"}
difference = set(input_mapping.keys()) - expected_keys
assert not difference, f"Found unexpected output id(s): {difference}"
result = {}
for input_id, input_files in input_mapping.items():
input_r1, input_r2 = input_files
# This reads the files into memory,
# but they are reasonably small
with dnaio.open(input_r1) as r1_reads, dnaio.open(input_r2) as r2_reads:
for r1_read, r2_read in zip(r1_reads, r2_reads, strict=True):
result.setdefault(input_id, []).append((r1_read, r2_read))
return result
def main(par):
inputs = create_input_mapping(par["ids"], par["fastq_r1"], par["fastq_r2"])
reads = read_input_files(inputs)
assert_number_of_reads(reads)
assert_barcodes_not_removed(reads)
if __name__ == "__main__":
main(par)

20
src/io/publish_fastqs/code.sh Executable file
View File

@@ -0,0 +1,20 @@
#!/bin/bash
echo "Publishing $par_input -> $par_output"
echo
echo "Creating directory if it does not exist:"
mkdir -p "$par_output" && echo "$par_output created"
echo
echo "Copying files..."
IFS=";" read -ra input_r1 <<<$par_input_r1
IFS=";" read -ra input_r2 <<<$par_input_r2
for i in "${input_r1[@]}"; do
cp -rL "$i" "$par_output/"
done
for i in "${input_r2[@]}"; do
cp -rL "$i" "$par_output/"
done

View File

@@ -0,0 +1,39 @@
name: "publish_fastqs"
namespace: "io"
description: "Publish the fastq files per well"
argument_groups:
- name: Input arguments
arguments:
- name: --input_r1
description: Directory to write R1 fastq data to
type: file
multiple: true
required: true
- name: --input_r2
description: Directory to write R2 fastq data to
type: file
multiple: true
required: true
- name: Output arguments
arguments:
- name: --output
type: file
direction: output
# ID is the well barcode
default: "$id/"
resources:
- type: bash_script
path: ./code.sh
engines:
- type: docker
image: debian:stable-slim
setup:
- type: apt
packages:
- procps
runners:
- type: executable
- type: nextflow

42
src/io/publish_results/code.sh Executable file
View File

@@ -0,0 +1,42 @@
#!/bin/bash
echo "Publishing $par_input -> $par_output"
echo
echo "Creating directory if it does not exist:"
mkdir -p "$par_output" && echo "$par_output created"
echo
echo "Copying files..."
IFS=";" read -ra star_output <<<$par_star_output
IFS=";" read -ra nrReadsNrGenesPerChrom <<<$par_nrReadsNrGenesPerChrom
IFS=";" read -ra star_qc_metrics <<<$par_star_qc_metrics
IFS=";" read -ra eset <<<$par_eset
IFS=";" read -ra f_data <<<$par_f_data
IFS=";" read -ra p_data <<<$par_p_data
for i in "${star_output[@]}"; do
cp -rL "$i" "$par_output/"
done
for i in "${nrReadsNrGenesPerChrom[@]}"; do
cp -rL "$i" "$par_output/"
done
for i in "${star_qc_metrics[@]}"; do
cp -rL "$i" "$par_output/"
done
for i in "${eset[@]}"; do
cp -rL "$i" "$par_output/"
done
for i in "${f_data[@]}"; do
cp -rL "$i" "$par_output/"
done
for i in "${p_data[@]}"; do
cp -rL "$i" "$par_output/"
done
cp -rL "$par_html_report" "$par_output/"

View File

@@ -0,0 +1,57 @@
name: "publish_results"
namespace: "io"
description: "Publish the results"
argument_groups:
- name: Input arguments
arguments:
- name: --star_output
description: Output from mapping with STAR
type: file
multiple: true
required: true
- name: "--nrReadsNrGenesPerChrom"
type: file
multiple: true
required: true
- name: "--star_qc_metrics"
type: file
multiple: true
required: true
- name: "--eset"
type: file
multiple: true
required: true
- name: "--f_data"
type: file
multiple: true
required: true
- name: "--p_data"
type: file
multiple: true
required: true
- name: "--html_report"
type: file
required: true
- name: Output arguments
arguments:
- name: --output
type: file
direction: output
# ID is the well barcode
default: "$id/"
resources:
- type: bash_script
path: ./code.sh
engines:
- type: docker
image: debian:stable-slim
setup:
- type: apt
packages:
- procps
runners:
- type: executable
- type: nextflow

BIN
src/parallel_map/STAR Executable file

Binary file not shown.

View File

@@ -0,0 +1,106 @@
name: parallel_map
description: |
Map wells in batch, using STAR
Spliced Transcripts Alignment to a Reference (C) Alexander Dobin
https://github.com/alexdobin/STAR
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ maintainer ]
- __merge__: /src/base/authors/toni_verbeiren.yaml
roles: [ author, maintainer ]
requirements:
commands:
- STAR
- file
- parallel
argument_groups:
- name: Input arguments
arguments:
- name: "--input_r1"
type: file
required: true
multiple: true
- name: "--input_r2"
type: file
required: true
multiple: true
- name: "--genomeDir"
type: file
required: true
description: STAR reference directory
- name: "--barcodes"
type: string
multiple: true
required: true
description: The barcodes/wells to process
- name: Barcode arguments
arguments:
- name: "--umiLength"
type: integer
required: true
description: The length of the UMIs
- name: "--limitBAMsortRAM"
type: string
default: "10000000000"
- name: Runtime arguments
arguments:
- name: "--runThreadN"
description: "Number of threads to use for a single STAR execution."
type: integer
default: 1
- name: Output arguments
arguments:
- name: "--output"
type: file
description: |
Location of the output folders, 1 folder per barcode. The value used
for this argument must contain a '*', which will be replaced with the
barcode to form the final output location for that barcode.
required: true
multiple: true
direction: output
default: './*'
- name: "--joblog"
type: file
description: Where to store the log file listing all the jobs.
required: false
direction: output
default: "execution_log.txt"
resources:
- type: bash_script
path: script.sh
- path: STAR
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: debian:stable-slim
setup:
- type: apt
packages:
- procps
- wget
- automake
- make
- gcc
- g++
- zlib1g-dev
- parallel
- file
- type: docker
build_args:
- STAR_V=2.7.6a
env:
- STAR_SOURCE="https://github.com/alexdobin/STAR/archive/refs/tags/$STAR_V.tar.gz"
- STAR_TARGET="/app/star-$STAR_V.tar.gz"
- STAR_INSTALL_DIR="/app/STAR-$STAR_V"
- STAR_BINARY=STAR
copy:
- STAR /usr/local/bin/$STAR_BINARY
runners:
- type: executable
- type: nextflow

292
src/parallel_map/script.sh Executable file
View File

@@ -0,0 +1,292 @@
#!/bin/bash
## VIASH START
par_input_r1="work/2c/5b8b3a2dd4a988b8838e3f72d38a37/_viash_par/input_r1_1/two__ACACCGAATT.concat_text_r1.output.txt"
par_input_r2="work/2c/5b8b3a2dd4a988b8838e3f72d38a37/_viash_par/input_r2_1/two__ACACCGAATT.concat_text_r2.output.txt"
par_barcodes="ACACCGAATT;GGCTATTGAT"
par_output="./*"
par_genomeDir="star"
par_umiLength=10
par_limitBAMsortRAM="10000000000"
meta_cpus=2
par_runThreadN=1
## VIASH END
set -eo pipefail
# Check if wildcard character is present in output folder template
printf "Checking if output folder template ($par_output) contains a single wildcard character '*'. "
output_glob_character="${par_output//[^\*]}"
if [[ "${#output_glob_character}" -ne "1" ]]; then
echo "The value for --output must contain exactly one '*' character. Exiting..."
exit 1
else
echo "Done, wildcard character found!"
fi
# Split the delimited strings into arrays
IFS=';' read -r -a barcodes <<< "$par_barcodes"
IFS=';' read -r -a input_r1 <<< "$par_input_r1"
IFS=';' read -r -a input_r2 <<< "$par_input_r2"
# Check that the number of values provided for the barcodes and the fastq files are the same.
num_barcodes="${#barcodes[@]}"
num_r1_inputs="${#input_r1[@]}"
num_r2_inputs="${#input_r2[@]}"
if [ ! "$num_barcodes" -eq "$num_r1_inputs" ] || [ ! "$num_r1_inputs" -eq "$num_r2_inputs" ]; then
echo "The number of values for arguments 'barcodes' ($num_barcodes), "\
"'input_r1' ($num_r1_inputs) and 'input_r2' ($num_r2_inputs) "\
"should be the same, and their order should match."
exit 1
else
echo "Checked if length of barcodes input ($num_barcodes) is "\
"the same as R1 reads ($num_r1_inputs) and R2 reads "\
"($num_r2_inputs). Seems OK!"
fi
# Function to test for unique values in array
function arrayContainsUniqueValues {
# Pass the argument by reference
local -n arr=$1
# Create a temporary associative array
# in order to use its uniqueness of keys
# 'declare' in a function is automatically local
declare -A uniq_tmp
for item in "${arr[@]}"; do
uniq_tmp[$item]=0 # assigning a placeholder
done
local unique_array_values=(${!uniq_tmp[@]})
if [ "${#unique_array_values[@]}" -eq "${#arr[@]}" ]; then
return
fi
false
}
arrayContainsUniqueValues barcodes
is_array_unique_exit_code=$?
if ! (exit $is_array_unique_exit_code); then
echo "The provided barcodes should be unique!"
echo "Values: $par_barcodes"
exit 1
fi
# Define the function that will be used to run a single job
function _run() {
local par_UMIlength="$1"
local par_output="$2"
local par_genomeDir="$3"
local par_limitBAMsortRAM="$4"
local par_runThreadN="$5"
local barcode="$6"
local input_R1="$7"
local input_R2="$8"
local barcode_length="${#barcode}"
local umi_start="$(($barcode_length + 1))"
set -eo pipefail
echo <<-EOF
Processing $barcode
For the following inputs (lanes):
"$star_readFilesIn
EOF
echo "Writing barcode '$barcode' to $barcode.txt and using it as input".
# Note that there is no possible conflict between jobs here
# because the barcodes are unique (and the barcode is part of the name
# of the file).
echo "$barcode" > "$barcode.txt"
local dir="${par_output//\*/$barcode}/"
echo "Setting output for barcode '$barcode' to '$dir'."
mkdir -p "$dir"
# check if files are compressed
local TMPDIR=$(mktemp -d "$meta_temp_dir/parallel_map-$barcode-XXXXXX")
function clean_up {
[[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
}
trap clean_up RETURN
# Decompress the input files when needed
# NOTE: for some reason, using STAR's --readFilesCommand does not always work
# This might be because STAR creates fifo files (see https://man7.org/linux/man-pages/man7/fifo.7.html)
# and this requires a filesystem that supports this. Another cause might be that the input files
# are symlinks. When testing this, using '--readFilesCommand "zcat"'
# always produced empty BAM files, but also a succesfull exit code (0) so the problem is not reported.
# However, the logs showed the following error: "gzip -: unexpected end of file".
function is_gzipped {
printf "Checking if input '$1' (barcode '$barcode') is gzipped... "
if file "$1" | grep -q 'gzip'; then
echo "Done, detected compressed file."
return
fi
echo "Done, file does not need decompression."
false
}
# Resolve symbolic links to actual file paths
input_R1=$(realpath $input_R1)
input_R2=$(realpath $input_R2)
if is_gzipped $input_R1; then
local compressed_file_name_r1="$(basename -- $input_R1)"
local uncompressed_file_r1="$TMPDIR/${compressed_file_name_r1%.gz}"
printf "Unpacking input to $uncompressed_file_r1... "
zcat "$input_R1" > "$uncompressed_file_r1"
echo "Decompression done."
else
local uncompressed_file_r1="$input_R1"
fi
if is_gzipped $input_R2; then
local compressed_file_name_r2="$(basename -- $input_R2)"
local uncompressed_file_r2="$TMPDIR/${compressed_file_name_r2%.gz}"
printf "Unpacking input to $uncompressed_file_r2... "
zcat "$input_R2" > "$uncompressed_file_r2"
echo "Decompression done."
else
local uncompressed_file_r2="$input_R2"
fi
local n_input_lines_r1=$(wc -l < "$uncompressed_file_r1")
local n_input_lines_r2=$(wc -l < "$uncompressed_file_r2")
printf "Checking if length of input file mates match. "
if (( $n_input_lines_r1 != n_input_lines_r2 )); then
echo "The length of file $input_R1 ($n_input_lines_r1) does not match with $input_R2 ($n_input_lines_r2)"
return 1
else
echo "Seems OK, $n_input_lines_r1 input lines."
fi
echo "Starting STAR for barcode '$barcode'"
# soloType 'Droplet' is the same as 'CB_UMI_Simple': one UMI and one cell barcode of fixed length.
# By default in this mode, STAR will look for the cell barcode and the UMI int the last files specified with --readFilesIn
# So we need to specify R2 first and R1 second, because R1 contains the barcode and UMI.
# Also, you might be tempted to use '--soloBarcodeMate 1' to alter this behavior, but this requires the clipping
# the barcode from this mate by specifying --clip5pNbases and/or --clip3pNbases, which we do not want to do.
STAR \
--readFilesIn "$uncompressed_file_r2" "$uncompressed_file_r1" \
--soloType Droplet \
--quantMode GeneCounts \
--genomeLoad LoadAndKeep \
--limitBAMsortRAM "$par_limitBAMsortRAM" \
--runThreadN "$par_runThreadN" \
--outFilterMultimapNmax 1 \
--outSAMtype BAM SortedByCoordinate \
--soloCBstart 1 \
--readFilesType "Fastx" \
--soloCBlen "$barcode_length" \
--soloUMIstart "$umi_start" \
--soloUMIlen "$par_UMIlength" \
--soloBarcodeReadLength 0 \
--soloStrand Unstranded \
--soloFeatures Gene \
--genomeDir "$par_genomeDir" \
--outReadsUnmapped Fastx \
--outSAMunmapped Within \
--outSAMattributes NH HI nM AS CR UR CB UB GX GN \
--soloCBwhitelist "$barcode.txt" \
--outFileNamePrefix "$dir" \
--outTmpDir "$TMPDIR/STARtemp/"
printf "Done running STAR. "
# Check if the number of processed reads is equal to the number of input reads
local n_input_reads=$(($n_input_lines_r1 / 4))
local nr_output_reads=$(grep -Po "Number\ of\ input\ reads \\|\W*\K\d+" "$dir/Log.final.out")
if (( $nr_output_reads != $n_input_reads )); then
echo "Not all input reads were processed for barcode $barcode."
return 1
else
echo "Processed $nr_output_reads reads for barcode $barcode".
fi
printf "Making sure that the output has the proper permissions."
find "$dir" -type d -exec chmod o+x {} \;
chmod -R o+r "$dir"
echo "Done"
}
# Export the function - requires bash
export -f _run
# Load reference genome
echo "Loading reference genome"
STAR --genomeLoad LoadAndExit --genomeDir "$par_genomeDir"
# Run the concurrent jobs using GNU parallel
# Make sure that parallel uses the correct shell
export PARALLEL_SHELL="/bin/bash"
# Some notes:
# --halt now,fail=1: instruct parallel to exit when a job has failed and kill remaining running jobs.
#
# ::: is a special syntax for GNU parallel to delineate inputs
# If multiple ::: are given, each group will be treated as an input source, and all combinations of input
# sources will be generated. E.g. ::: 1 2 ::: a b c will result in the combinations (1,a) (1,b) (1,c) (2,a) (2,b) (2,c)
# The delimiter :::+ (note the extra '+') links the argument to the previous argument, and one argument from each of the input
# sources will be read.
parallel_cmd=("parallel" "--jobs" "80%" "--verbose" "--memfree" "2G"
"--tmpdir" "$meta_temp_dir"
"--retry-failed" "--retries" "4" "--halt" "soon,fail=1"
"--joblog" "$par_joblog" "_run" "{}")
# Arguments for which there is one value, so these will not create extra jobs
parallel_cmd+=(":::" "$par_umiLength" ":::" "$par_output" ":::" "$par_genomeDir" ":::" "$par_limitBAMsortRAM" ":::" "$par_runThreadN")
# Argument which in fact will cause extra jobs to be spawned, per job one item from each argument will be selected
# Thus, these argument lists should have the same length.
parallel_cmd+=(":::" "${barcodes[@]}" ":::+" "${input_r1[@]}" ":::+" "${input_r2[@]}")
set +eo pipefail
"${parallel_cmd[@]}"
exit_code=$?
set -eo pipefail
echo "GNU parallel finished!"
# Unload reference
printf "Unloading reference genome. "
STAR --genomeLoad Remove --genomeDir "$par_genomeDir"
echo "Done!"
# Exit code from GNU parallel:
# If fail=1 is used, the exit status will be the exit status of the failing job.
echo "Checking exit code"
if ((exit_code>0)); then
# Note that the ending HERE must be indented with TAB characters (not spaces)
# in order to remove leading indentation
MESSAGE=$(
cat <<-HERE
==================================================================
!!! An error occurred for one of the jobs.
Exit code of the failing job: $exit_code.
%s
==================================================================
HERE
)
printf "$MESSAGE" "$(<$par_joblog)"
exit 1
else
cat <<-HERE
==================================================================
Mapping went fine (exit code '$exit_code'), zero errors occurred
==================================================================
HERE
fi

350
src/parallel_map/test.sh Executable file
View File

@@ -0,0 +1,350 @@
set -eo pipefail
## VIASH START
meta_executable=$(realpath "target/executable/parallel_map/parallel_map")
## VIASH END
# Some helper functions
assert_directory_exists() {
[ -d "$1" ] || { echo "File '$1' does not exist" && exit 1; }
}
assert_file_exists() {
[ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
}
assert_file_contains() {
grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
}
assert_file_contains_regex() {
grep -q -E "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
}
echo "> Prepare test data in $meta_temp_dir"
TMPDIR=$(mktemp -d --tmpdir="$meta_temp_dir")
function clean_up {
[[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
}
trap clean_up EXIT
# Sample 1, barcode ACAGTCACAG, UMI CTACGGATGA
cat > "$TMPDIR/sample1_R1.fastq" <<'EOF'
@SAMPLE_1_SEQ_ID1
ACAGTCACAGCTACGGATGAGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@SAMPLE_1_SEQ_ID2
ACAGTCACAGCTACGGATGAGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAG
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
EOF
cat > "$TMPDIR/sample1_R2.fastq" <<'EOF'
@SAMPLE_1_SEQ_ID1
CTCACAGAGAGTCACAACATAGGCGCGGATGTGTGAGGCTTATGAGGC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@SAMPLE_1_SEQ_ID2
CTCACAGAGAGTCACAACATAGGCGCGGATGTGTGAGGCTTATGAGGC
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
EOF
# Sample 2, barcode CGGGTTTACC, UMI GCTAGCTAGC
cat > "$TMPDIR/sample2_R1.fastq" << 'EOF'
@SAMPLE_2_SEQ_ID1
CGGGTTTACCGCTAGCTAGCCACCACTATGGTTGGCCGGTTAGTAGTGT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@SAMPLE_2_SEQ_ID2
CGGGTTTACCGCTAGCTAGCCACCACTATGGTTGGCCGGTTAGTAGTGT
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
EOF
cat > "$TMPDIR/sample2_R2.fastq" <<'EOF'
@SAMPLE_2_SEQ_ID1
ACACTACTAACCGGCCAACCATAGTGGTG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIII
@SAMPLE_2_SEQ_ID2
ACACTACTAACCGGCCAACCATAGTGGTG
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
EOF
# Note that there is a sjdbGTFchrPrefix argument for STAR:
# prefix for chromosome names in a GTF file (default: '-')
cat > "$TMPDIR/genome.fasta" <<'EOF'
>1
TGGCATGAGCCAACGAACGCTGCCTCATAAGCCTCACACATCCGCGCCTATGTTGTGACTCTCTGTGAGCGTTCGTGGG
GCTCGTCACCACTATGGTTGGCCGGTTAGTAGTGTGACTCCTGGTTTTCTGGAGCTTCTTTAAACCGTAGTCCAGTCAA
TGCGAATGGCACTTCACGACGGACTGTCCTTAGCTCAGGGGA
EOF
cat > "$TMPDIR/genes.gtf" <<'EOF'
1 example_source gene 0 72 . + . gene_id "gene1"; gene_name: "GENE1;
1 example_source exon 20 71 . + . gene_id "gene1"; gene_name: "GENE1"; exon_id: gene1_exon1;
1 example_source gene 80 160 . + . gene_id "gene2"; gene_name: "GENE2;
1 example_source exon 80 159 . + . gene_id "gene2"; gene_name: "GENE2"; exon_id: gene2_exon1;
EOF
echo "> Generate index"
STAR \
${meta_cpus:+--runThreadN $meta_cpus} \
--runMode genomeGenerate \
--genomeDir "$TMPDIR/index/" \
--genomeFastaFiles "$TMPDIR/genome.fasta" \
--sjdbGTFfile "$TMPDIR/genes.gtf" \
--genomeSAindexNbases 2 > /dev/null 2>&1
echo "> Run test 1"
run_1_dir="$TMPDIR/run_1"
mkdir -p "$run_1_dir"
pushd "$run_1_dir" > /dev/null
"$meta_executable" \
--input_r1 "$TMPDIR/sample1_R1.fastq;$TMPDIR/sample2_R1.fastq" \
--input_r2 "$TMPDIR/sample1_R2.fastq;$TMPDIR/sample2_R2.fastq" \
--genomeDir "$TMPDIR/index/" \
--barcodes "ACAGTCACAG;CGGGTTTACC" \
--umiLength 10 \
--runThreadN 2 \
--output "$TMPDIR/output_*" > /dev/null 2>&1
popd
echo ">> Check if output directories exists"
sample1_out="$TMPDIR/output_ACAGTCACAG"
sample2_out="$TMPDIR/output_CGGGTTTACC"
assert_directory_exists "$sample1_out"
assert_directory_exists "$sample2_out"
echo ">> Check if output files have been created"
for sample in "$sample1_out" "$sample2_out"; do
assert_file_exists "$sample/Aligned.sortedByCoord.out.bam"
assert_file_exists "$sample/Unmapped.out.mate1"
assert_file_exists "$sample/Unmapped.out.mate2"
assert_file_exists "$sample/Log.out"
assert_file_exists "$sample/Log.final.out"
assert_file_exists "$sample/ReadsPerGene.out.tab"
done
echo ">> Check if Solo output is present"
for sample in "$sample1_out" "$sample2_out"; do
assert_directory_exists "$sample1_out/Solo.out"
assert_directory_exists "$sample1_out/Solo.out/Gene"
assert_file_exists "$sample1_out/Solo.out/Barcodes.stats"
assert_file_exists "$sample1_out/Solo.out/Gene/raw/barcodes.tsv"
assert_file_exists "$sample1_out/Solo.out/Gene/raw/features.tsv"
assert_file_exists "$sample1_out/Solo.out/Gene/raw/matrix.mtx"
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv"
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/features.tsv"
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/matrix.mtx"
done
echo ">> Check contents of output"
echo ">>> Sample 1"
assert_file_contains "$sample1_out/Solo.out/Barcodes.stats" "nExactMatch 2"
assert_file_contains "$sample1_out/Log.final.out" "Uniquely mapped reads number | 2"
assert_file_contains "$sample1_out/Log.final.out" "Number of input reads | 2"
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; }
ACAGTCACAG
EOF
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; }
gene1 gene1 Gene Expression
gene2 gene2 Gene Expression
EOF
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; }
%%MatrixMarket matrix coordinate integer general
%
2 1 1
1 1 1
EOF
echo ">>> Sample 2"
assert_file_contains "$sample2_out/Solo.out/Barcodes.stats" "nExactMatch 2"
assert_file_contains "$sample2_out/Log.final.out" "Uniquely mapped reads number | 2"
assert_file_contains "$sample2_out/Log.final.out" "Number of input reads | 2"
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; }
CGGGTTTACC
EOF
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; }
gene1 gene1 Gene Expression
gene2 gene2 Gene Expression
EOF
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; }
%%MatrixMarket matrix coordinate integer general
%
2 1 1
2 1 1
EOF
echo "> Run test 2 (compressed input)"
gzip -c "$TMPDIR/sample1_R1.fastq" > "$TMPDIR/sample1_R1.fastq.gz"
gzip -c "$TMPDIR/sample2_R1.fastq" > "$TMPDIR/sample2_R1.fastq.gz"
gzip -c "$TMPDIR/sample1_R2.fastq" > "$TMPDIR/sample1_R2.fastq.gz"
gzip -c "$TMPDIR/sample2_R2.fastq" > "$TMPDIR/sample2_R2.fastq.gz"
run_2_dir="$TMPDIR/run_2"
mkdir -p "$run_2_dir"
pushd "$run_2_dir" > /dev/null
"$meta_executable" \
--input_r1 "$TMPDIR/sample1_R1.fastq.gz;$TMPDIR/sample2_R1.fastq.gz" \
--input_r2 "$TMPDIR/sample1_R2.fastq.gz;$TMPDIR/sample2_R2.fastq.gz" \
--genomeDir "$TMPDIR/index/" \
--barcodes "ACAGTCACAG;CGGGTTTACC" \
--umiLength 10 \
--runThreadN 2 \
--output "$TMPDIR/output_gz_*" > /dev/null 2>&1
popd > /dev/null
echo ">> Check if output directories exists"
sample1_out="$TMPDIR/output_gz_ACAGTCACAG"
sample2_out="$TMPDIR/output_gz_CGGGTTTACC"
assert_directory_exists "$sample1_out"
assert_directory_exists "$sample2_out"
echo ">> Check if output files have been created"
for sample in "$sample1_out" "$sample2_out"; do
assert_file_exists "$sample/Aligned.sortedByCoord.out.bam"
assert_file_exists "$sample/Unmapped.out.mate1"
assert_file_exists "$sample/Unmapped.out.mate2"
assert_file_exists "$sample/Log.out"
assert_file_exists "$sample/Log.final.out"
assert_file_exists "$sample/ReadsPerGene.out.tab"
done
echo ">> Check if Solo output is present"
for sample in "$sample1_out" "$sample2_out"; do
assert_directory_exists "$sample1_out/Solo.out"
assert_directory_exists "$sample1_out/Solo.out/Gene"
assert_file_exists "$sample1_out/Solo.out/Barcodes.stats"
assert_file_exists "$sample1_out/Solo.out/Gene/raw/barcodes.tsv"
assert_file_exists "$sample1_out/Solo.out/Gene/raw/features.tsv"
assert_file_exists "$sample1_out/Solo.out/Gene/raw/matrix.mtx"
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv"
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/features.tsv"
assert_file_exists "$sample1_out/Solo.out/Gene/filtered/matrix.mtx"
done
echo ">> Check contents of output"
echo ">>> Sample 1"
assert_file_contains "$sample1_out/Solo.out/Barcodes.stats" "nExactMatch 2"
assert_file_contains "$sample1_out/Log.final.out" "Uniquely mapped reads number | 2"
assert_file_contains "$sample1_out/Log.final.out" "Number of input reads | 2"
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; }
ACAGTCACAG
EOF
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; }
gene1 gene1 Gene Expression
gene2 gene2 Gene Expression
EOF
cat << EOF | cmp -s "$sample1_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; }
%%MatrixMarket matrix coordinate integer general
%
2 1 1
1 1 1
EOF
echo ">>> Sample 2"
assert_file_contains "$sample2_out/Solo.out/Barcodes.stats" "nExactMatch 2"
assert_file_contains "$sample2_out/Log.final.out" "Uniquely mapped reads number | 2"
assert_file_contains "$sample2_out/Log.final.out" "Number of input reads | 2"
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/barcodes.tsv" || { echo "Barcodes file is different"; exit 1; }
CGGGTTTACC
EOF
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/features.tsv" || { echo "Features file is different"; exit 1; }
gene1 gene1 Gene Expression
gene2 gene2 Gene Expression
EOF
cat << EOF | cmp -s "$sample2_out/Solo.out/Gene/filtered/matrix.mtx" || { echo "Matrix file is different"; exit 1; }
%%MatrixMarket matrix coordinate integer general
%
2 1 1
2 1 1
EOF
echo "> Check that wrong number of barcodes are detected."
run_3_dir="$TMPDIR/run_3"
mkdir -p "$run_3_dir"
pushd "$run_3_dir" > /dev/null
set +eo pipefail
"$meta_executable" \
--input_r1 "$TMPDIR/sample1_R1.fastq.gz;$TMPDIR/sample2_R1.fastq.gz" \
--input_r2 "$TMPDIR/sample1_R2.fastq.gz;$TMPDIR/sample2_R2.fastq.gz" \
--genomeDir "$TMPDIR/index/" \
--barcodes "ACAGTCACAG" \
--umiLength 10 \
--runThreadN 2 \
--output "$TMPDIR/output_gz_*" > /dev/null 2>&1 && echo "Expected non-zero exit code " && exit 1
set -eo pipefail
popd > /dev/null
echo "> Check that missing wildcard character is detected."
run_4_dir="$TMPDIR/run_4"
mkdir -p "$run_4_dir"
pushd "$run_4_dir" > /dev/null
set +eo pipefail
"$meta_executable" \
--input_r1 "$TMPDIR/sample1_R1.fastq.gz;$TMPDIR/sample2_R1.fastq.gz" \
--input_r2 "$TMPDIR/sample1_R2.fastq.gz;$TMPDIR/sample2_R2.fastq.gz" \
--genomeDir "$TMPDIR/index/" \
--barcodes "ACAGTCACAG;CGGGTTTACC" \
--umiLength 10 \
--runThreadN 2 \
--output "$TMPDIR/output_run4" > /dev/null 2>&1 && echo "Expected non-zero exit code." && exit 1
set -eo pipefail
popd > /dev/null
echo "> Check that a mismatch in the length of the input mates is detected."
empty_input_file="$TMPDIR/empty.fastq"
touch "$empty_input_file"
run_5_dir="$TMPDIR/run_5"
mkdir -p "$run_5_dir"
pushd "$run_5_dir" > /dev/null
set +eo pipefail
"$meta_executable" \
--input_r1 "$TMPDIR/sample1_R1.fastq;$empty_input_file" \
--input_r2 "$TMPDIR/sample1_R2.fastq;$TMPDIR/sample2_R2.fastq" \
--genomeDir "$TMPDIR/index/" \
--barcodes "ACAGTCACAG;CGGGTTTACC" \
--umiLength 10 \
--runThreadN 2 \
--output "$TMPDIR/output_run5_*" > /dev/null 2>&1 && echo "Expected non-zero exit code " && exit 1
set -eo pipefail
popd > /dev/null
echo "> Check that wrong number of input files is detected."
run_6_dir="$TMPDIR/run_6"
mkdir -p "$run_6_dir"
pushd "$run_6_dir" > /dev/null
set +eo pipefail
"$meta_executable" \
--input_r1 "$TMPDIR/sample1_R1.fastq" \
--input_r2 "$TMPDIR/sample1_R2.fastq;$TMPDIR/sample2_R2.fastq" \
--genomeDir "$TMPDIR/index/" \
--barcodes "ACAGTCACAG;CGGGTTTACC" \
--umiLength 10 \
--runThreadN 2 \
--output "$TMPDIR/output_run_6_*" > /dev/null 2>&1 && echo "Expected non-zero exit code " && exit 1
set -eo pipefail
popd > /dev/null

Binary file not shown.

After

Width:  |  Height:  |  Size: 77 KiB

View File

@@ -0,0 +1,73 @@
name: create_report
namespace: "report"
description: |
Create a basic QC report in HTML format based on a number of esets.
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ maintainer ]
- __merge__: /src/base/authors/marijke_van_moerbeke.yaml
roles: [ author, maintainer ]
argument_groups:
- name: "Arguments"
arguments:
- type: file
name: "--eset"
required: true
multiple: true
- type: file
name: "--output_report"
required: true
direction: output
example: report.html
resources:
- type: r_script
path: script.R
- type: r_script
path: template.Rmd
- type: r_script
path: plateLayouts.R
- path: OutputSTARsolo.png
type: file
test_resources:
- type: r_script
path: test.R
- path: ./test_data
engines:
- type: docker
image: rocker/r2u:24.04
setup:
- type: apt
packages:
- procps
- pandoc
- type: r
bioc:
- Biobase
- ComplexHeatmap
cran:
- ggplot2
- knitr
- gridExtra
- RColorBrewer
- processx
- whisker
- rmarkdown
- bookdown
- data.table
- platetools
- htmltools
- DT
- logger
- bit64
script:
- install.packages("oaStyle", repos = c(rdepot = "https://repos.openanalytics.eu/repo/public", getOption("repos")))
test_setup:
- type: r
packages:
- testthat
- R.utils
runners:
- type: executable
- type: nextflow

430
src/report/plateLayouts.R Normal file
View File

@@ -0,0 +1,430 @@
#' Displays the annotation of the wells in a plateLayout
#' @param plateData a data.table object containing the information
#' of the plate. This must contain a "WellID".
#' @param plateName The plate name
#' @param valueVariable The name of the variable in 'plateData' to
#' be visualized in a plate layout.
#' @param textVariable The name of the variable in 'plateData' to be
#' shown in the wells of the plate layout. If NULL, the valueVariable
#' is shown.
#' @param colours A named character vector containing the colours
#' for the different levels of the valuevariable. The names should
#' correspond to the dose levels. if not specified, a scheme of blues
#' will be provided.
#' @param breaks Numeric vector indicating breaks for plot coloring.
#' @param colourWellText Colour to display the text in the wells.
#' @param layout Integer vector of length two with number of rows and
#' colums in a plate, e.g. \code{c(16,24)}
#' @param legend.title A title for the legend
#' @param plot.title A title for the plot, will be contracted
#' with the plate name
#' @param ... additional arguments for \code{plateLayout.default} function
#' @import data.table
#' @importFrom platetools fill_plate
#' @export
plateLayout.annotation <- function(
plateData,
plateName = character(),
valueVariable = "Dose",
textVariable = NULL,
breaks = NULL, colours = NULL,
colourWellText = "black",
layout = c(16, 24),
legend.title = "Dose",
plot.title = "Plate Annotation - ",
textFontSize = 9, ...
) {
WellID <- Label <- NULL
if (!(all(c("WellID", "SampleName") %in% colnames(plateData)))) {
stop(" 'WellID' and 'SampleName' column required in plateData object")
}
#Check WellID Format
checkWellID <- grepl("^[[:upper:]]{1,2}[[:digit:]]{1,2}$", plateData$WellID)
if(!all(checkWellID)){
stop("WellID does not have the correct format")
}
plateData[, WellID := paste0(
sub(".*([[:alpha:]]).+", "\\1", plateData$WellID),
sprintf(
"%02d", as.numeric(sub(".*[[:alpha:]](.+)", "\\1", plateData$WellID))
)
)]
plateData <- platetools::fill_plate(plateData, "WellID", plate = layout[1]*layout[2])
plateData$column <- factor(
sprintf(
"%02d",
as.numeric(sub(".*[[:alpha:]](.+)", "\\1", plateData$WellID))
),
levels = sprintf("%02d", seq(1, layout[2]))
)
plateData$row <- factor(sub(".*([[:alpha:]]).+", "\\1", plateData$WellID),
levels = LETTERS[seq(1, layout[1])])
if (!is.null(valueVariable)){
plateData[, values := as.character(plateData[, ..valueVariable][[1]])]
valueVar <- "values"
}else{
plateData[, values := "grey"]
valueVar <- "values"
colours <- setNames("grey", "grey")
}
if (is.null(colours)) {
blues <- colorRampPalette(c("#d6e0ff", "#2171B5"))
greens <- colorRampPalette(c("light green", "dark green"))
numLevels <- sort(as.numeric(as.character(unique(plateData[, values])[
grepl(
"^[[:digit:]]+([.][[:digit:]]+)?$",
trimws(unique(plateData[, values]))
)
])))
otherLevels <- sort(as.character(unique(plateData[, values])[
!grepl(
"^[[:digit:]]+([.][[:digit:]]+)?$",
trimws(unique(plateData[,values]))
)
]))
colours <- c(blues(length(numLevels)), greens(length(otherLevels)), "red")
names(colours) <- c(numLevels, otherLevels, "failed")
}
if (!is.null(textVariable)) {
plateData[,
Label := do.call(paste, c(.SD, sep = "\n ")),
.SDcols = textVariable
]
plateData[, Label := gsub("-", "-\n", Label)]
plateData[, Label := gsub("_", "_\n", Label)]
textVar <- "Label"
} else {
textVar <- NULL
}
if (is.null(breaks)){
breaks <- seq_len(length(colours))
}
plateLayout(
plateData = plateData, valueVariable = valueVar,
textVariable = textVar, plateName = plateName,
breaks = breaks, colourWellText = colourWellText,
legend.title = legend.title, layout = layout,
colours = colours, plot.title = plot.title,
textFontSize = textFontSize, ...
)
}
#' Create a heatmap of values in a plateLayout view. The values can be
#' library sizes, number of genes, qcScore (0/1) or a factor.
#' @param plateData A data.table of the values to be visualized with
#' at least the column of interest (specified in 'varOfInterest')
#' and a 'WellID' column indicating the wells in the plate. The WellID
#' is a combination of a letter (row in the plate) and an integer
#' (column in the plate).
#' @param valueVariable The name of the variable in 'plateData'
#' to be visualized in a plate layout
#' @param textVariable The name of the variable in 'plateData'
#' to be shown in the wells of the plate layout. Defaults to the
#' valueVariable and if NULL, no text will be displayed.
#' @param breaks Numeric vector indicating breaks for plot coloring.
#' @param colours Colours to be used for levels specified by
#' the breaks. If NULL, a colour scheme of purples is shown.
#' @param colourWellText Colour to display the text in the wells.
#' @param layout Integer vector of length two with number of rows
#' and colums in a plate, e.g. \code{c(16,24)}
#' @param makeContourColours Logical, whether or not the plate
#' layout will contain a contour colours for the wells based on the
#' parameters in 'contourColours' and 'categories'
#' @param contourVariable The variable used for the contour colouring
#' @param contourColours Character vector specifying a colour for
#' each range in 'categories'
#' @param labelsCategories Character vector specifying the names
#' (labels) for each range in 'categories'
#' @param categories if contour Variable is not a factor, a numeric
#' vector specifying the categories to divide the 'varOfInterest',
#' including the lower and upper limits.
#' @param plateName The plate name
#' @param plot.title A title for the plot, will be contracted with
#' the plate name
#' @param legend.title A title for the legend
#' @param displayHeatmap Logical, whether to display the plateLayout heatmap
#' @param saveHeatmap Logical, whether to save the plateLayout heatmap
#' @param outputDir The directory where the plateLayout heatmap should be saved
#' @param prefix The prefix to the file name of the saved plateLayout heatmap
#' @param ... additional arguments for \code{ComplexHeatmap::Heatmap} function
#' @importFrom platetools fill_plate
#' @importFrom RColorBrewer brewer.pal
#' @importFrom ComplexHeatmap Heatmap
#' @importFrom circlize colorRamp2
#' @importFrom grid grid.text grid.rect gpar legendGrob gpar
#' @importFrom grDevices dev.off png
#' @importFrom graphics title
#' @export
plateLayout <- function(
plateData, valueVariable, textVariable = valueVariable,
breaks = NULL, colours = NULL, colourWellText = "white", textFontSize = 6,
layout = c(16, 24), makeContourColours = FALSE, contourVariable = character(),
contourColours = c("red", "orange", "seagreen3"),lwdContours = c(1, 1, 1),
labelsCategories = c('1', '2', '3'), categories = NULL, plateName = character(),
plot.title = character(), legend.title = NULL, legendFontSize = 15,
row_split = rep("A", 16), col_split = rep("A", 24), legendFontSizeTitle = 15,
displayHeatmap = TRUE, saveHeatmap = FALSE, outputDir = ".", prefix = ""
) {
WellID <- NULL
if (!(all(c("WellID", "SampleName") %in% colnames(plateData)))) {
stop(" 'WellID' and 'SampleName' column required in plateData object")
}
plateData[, WellID := paste0(
sub(".*([[:alpha:]]).+", "\\1", plateData$WellID),
sprintf(
"%02d",
as.numeric(sub(".*[[:alpha:]](.+)", "\\1", plateData$WellID))
)
)]
plateData <- platetools::fill_plate(plateData, "WellID", plate = 384)
plateData$column <- factor(
sprintf("%02d", as.numeric(
sub(".*[[:alpha:]](.+)", "\\1", plateData$WellID)
)),
levels = sprintf("%02d", seq(1, layout[2]))
)
plateData$row <- factor(sub(".*([[:alpha:]]).+", "\\1", plateData$WellID),
levels = LETTERS[seq(1, layout[1])])
plateValues <- plateLayoutFormat(
plateData,
varOfInterest = valueVariable,
rows = layout[1],
cols = layout[2]
)
if (!is.null(textVariable)) {
plateText <- plateLayoutFormat(
plateData, varOfInterest = textVariable,
rows = layout[1],
cols = layout[2]
)
}
plot.title <- gsub(
"^([a-z])", "\\U\\1",
gsub("([A-Z])", " \\1",
plot.title, perl = TRUE), perl = TRUE
)
mainTitle <- paste0(plot.title, plateName)
plateContourColours <- matrix("", nrow = layout[1], ncol = layout[2])
if (makeContourColours) {
contourData <- plateData[WellType %in% c("nonEmpty", "Treated Wells"), ]
if (is.numeric(contourData[, ..contourVariable][[1]])) {
contourData$contours <- cut(
contourData[, ..contourVariable][[1]],
categories, left = TRUE,
right = TRUE,
labels = labelsCategories)
}
else {
contourData$contours <- contourData[, ..contourVariable][[1]]
}
names(contourColours) <- labelsCategories
names(lwdContours) <- labelsCategories
for (i in seq_len(layout[1])) {
for (j in seq_len(layout[2])) {
tryCatch({
sampleHit <- which(
as.character(contourData$WellID) == paste0(
LETTERS[i], sprintf("%02d", j)
)
)
if (length(sampleHit) == 1) {
plateContourColours[i, j] <- as.character(
contourData[sampleHit,'contours'][[1]]
)
}
},
error = function(e) {
print(paste0(LETTERS[i], sprintf("%02d", j), " is missing."))
}
)
}
}
}
plateValues$contours <- plateContourColours
colnames(plateValues$values) <- seq_len(ncol(plateValues$values))
if (is.null(breaks)) {
breakValues <- plateValues$values
breakValues[which(is.na(breakValues))] <- 0
if (all(breakValues >= 0)) {
breaks <- computeBreaks(7, max(plateValues$values, na.rm = TRUE))
} else {
breaks <- quantile(plateValues$values, probs = seq(0, 1, 0.125))
}
}
if (is.null(colours)) {
colours <- tryCatch({
colorRamp2(
breaks = breaks,
colors = brewer.pal(length(breaks), "Purples")
)
},
error = function(cond) {
return(c("#9370DB", "white"))
})
}
ht <- Heatmap(
plateValues$values,
column_title = mainTitle, column_title_side = "top",
rect_gp = gpar(lwd = 0.4),
cluster_rows = FALSE, cluster_columns = FALSE,
col = colours, row_title = NULL,
row_split = row_split, column_split = col_split,
row_names_side = "left",
cluster_row_slices = FALSE,
cluster_column_slices = FALSE,
show_heatmap_legend = TRUE,
heatmap_legend_param = list(
title = ifelse(
is.null(legend.title),
paste0(valueVariable, "\n"),
paste0(legend.title, "\n")
),
grid_height = unit(9, "mm"), border = "black",
labels_gp = gpar(fontsize = legendFontSize),
title_gp = gpar(fontsize = legendFontSizeTitle)
),
cell_fun = function(j, i, x, y, width, height, fill) {
if (is.na(plateValues$values[i, j])) {
grid.rect(
x, y, width, height,
gp = gpar(fill = "white", alpha = 0.7, lwd = 0.7, col = "white")
)
}
else if (!is.null(textVariable)) {
grid.text(
plateText$values[i, j], x, y,
just = "centre",
gp = gpar(fontsize = textFontSize, col = colourWellText)
)
}
if (makeContourColours) {
if (!is.na(plateValues$contours[i, j])) {
grid.rect(
x, y, width, height,
gp = gpar(
col = contourColours[as.character(plateValues$contours[i, j])],
fill = NA,
lwd = lwdContours[as.character(plateValues$contours[i, j])]
)
)
}
}
}
)
if (displayHeatmap) {
print(ht)
}
if (saveHeatmap) {
png(
file.path(
outputDir,
paste0(prefix,gsub(" |-", "",plot.title), "_", plateName, ".png")
),
width = 30, height = 10, units = "cm", res = 1200
)
print(ht)
dev.off()
}
return(ht)
}
#' Return numerical matrix with number of reads that corresponds to the
#' plate layout
#' @param data A data.frame of the values to be visualized with at least
#' the columnof interest (specified in 'varOfInterest') and a 'WellID' column
#' indicating the wells in the plate. The WellID is a combination of a
#' letter (row in the plate) and an integer (column in the plate).
#' @param varOfInterest The name of the variable in 'data' to be visualized
#' in a plate layout
#' @param rows number of rows in a plate layout
#' @param cols number of columns in a plate layout
#' @param verbose if \code{TRUE}, samples missing from the plate
#' will be reported
#' @export
plateLayoutFormat <- function(
data, varOfInterest,
rows = 16, cols = 24,
verbose = FALSE
) {
plateValues <- matrix(NA, nrow = rows, ncol = cols)
for (i in seq_len(rows)) {
for (j in seq_len(cols)) {
tryCatch({
sampleHit <- which(
as.character(data$WellID) == paste0(LETTERS[i], sprintf("%02d", j))
)
if(length(sampleHit) == 1){
plateValues[i, j] <- data[sampleHit, ..varOfInterest][[1]]
}
},
error = function(e) {
if (verbose == TRUE) {
print(paste0(LETTERS[i], sprintf("%02d", j), " is missing."))
}
}
)
}
}
row.names(plateValues) <- LETTERS[1:rows]
return(list("values" = plateValues))
}
#' Helper function to automate break selection for raw count data
#'
#' This function creates an exponentially increasing vector for given number
#' breaks between zero and some element of choice. It is particularly useful for
#' raw counts or raw counts per million.
#'
#' @param nBreaks Number of breaks to be generated
#' @param maxElement Maximum value of data entries
#' @export
computeBreaks <- function(nBreaks, variable) {
maxElement <- max(variable, na.rm = TRUE)
if (length(unique(variable)) == 1) {
breaks <- c(0, 0.5, ifelse(maxElement < 1, 1, maxElement))
} else {
coefSystem <- solve(
rbind(c(1, 1), c(1, (nBreaks - 1)))) %*% c(0, log(maxElement)
)
coefExp <- c(exp(coefSystem[1]), coefSystem[2])
breaks <- coefExp[1] * exp((1:(nBreaks - 1)) * coefExp[2])
}
return(c(0, breaks))
}

33
src/report/script.R Normal file
View File

@@ -0,0 +1,33 @@
library(whisker)
library(logger)
log_info("Setting temporary directory to: {meta$temp_dir}")
Sys.setenv(TMP = meta$temp_dir)
temp_folder <- tempdir(check = TRUE)
log_info("Created temporary directory {temp_folder}")
template <- file.path(meta$resources_dir, "template.Rmd")
esets_normalized <- lapply(par$eset, function(eset_path) {
return(file.path(normalizePath(dirname(eset_path)), basename(eset_path)))
})
log_info(paste0(
"Rendering markdown {template} to HTML ",
"{par$output_report} with esets {paste(esets_normalized, collapse = ', ')}"
))
rmarkdown::render(
normalizePath(template),
output_file = basename(par$output_report),
output_dir = dirname(par$output_report),
runtime = "static",
intermediates_dir = par$report_dir,
clean = TRUE,
params = list(
esets = esets_normalized,
outputDir = par$report_dir
)
)
log_info("Done")

977
src/report/template.Rmd Normal file
View File

@@ -0,0 +1,977 @@
---
title: "Exploratory Data Report"
date: "`r format(Sys.time(), '%d %B, %Y')`"
editor_options:
chunk_output_type: console
output:
oaStyle::html_report
# parameters which are overwritten by the script
params:
outputDir: 'output/'
esets:
- sample1.rds
- sample2.rds
---
<!---
Copy this template in your working directory (where you want to run the report).
This template can be used as a starting document to run a preliminary DRUGseq report
-->
<!---
Use full page width
-->
<style type="text/css">
div.main-container {
max-width: 1600px !important;
margin-left: auto;
margin-right: auto;
}
</style>
```{r params, eval = TRUE, include = FALSE}
outputDir <- params$outputDir
esets <- params$esets
```
```{r outputDir, echo = FALSE}
## Required: ABSOLUTE outputDir
outputDir <- file.path(outputDir)
# When working on a windows computer it should be
# "/Users/..." instead of "C:/Users/..."
if (.Platform$OS.type == "windows") {
outputDir <- paste0(
"/",
paste(
unlist(strsplit(outputDir, split = "/"))[-1], collapse = "/"
),
"/"
)
}
```
```{r optionsChunkDoNotModify, echo = FALSE, message = FALSE, warning=FALSE}
## Chunk with options for knitr. This chunk should not be modified.
knitr::opts_chunk$set(
eval = TRUE,
echo = FALSE,
message = FALSE,
cache = FALSE,
warning = FALSE,
error = FALSE,
comment = NA, #"#",
tidy = FALSE,
collapse = TRUE,
out.width = "100%",
fig.width = 20,
fig.height = 10,
results = "asis")
knitr::opts_knit$set(root.dir = getwd())
options(warn = 1, width = 200)
```
```{r libraries_and_functions}
source("plateLayouts.R")
library(ComplexHeatmap)
library(data.table)
library(ggplot2)
library(knitr)
library(Biobase)
library(gridExtra)
library(RColorBrewer)
```
```{r dataImport}
# Create esetList
esetList <- sapply(
esets, simplify = FALSE,
USE.NAMES = TRUE,
function(eset_raw) {
if (!file.exists(eset_raw)) {
stop(paste0("Provided path '", eset_raw, "' is not a file."))
}
eset <- readRDS(eset_raw)
}
)
pools <- sapply(esetList, function(eset) {
unique(eset$PoolName)
})
names(esetList) <- unlist(pools)
# Create qcData
pDataList <- lapply(esetList, function(eset) data.table(pData(eset)))
qcData <- rbindlist(pDataList, fill = TRUE)
textVars <- "SampleName"
annotationVar <- "PoolName"
if (!"SampleName" %in% names(qcData)) {
qcData[, SampleName := paste0(PoolName, "_", WellBC)]
}
qcData[, log10LibSize := round(log10(NumberOfInputReads))]
qcData[, (annotationVar) := lapply(.SD, as.factor), .SDcols = annotationVar]
colourList <- list()
Design_levels <- sort(
as.character(unique(qcData[, ..annotationVar][[1]])),
decreasing = TRUE
)
if (length(Design_levels) == 1) {
colours <- c("#d6e0ff", "lightgrey")
names(colours) <- c(Design_levels, "Empty")
colourList[[annotationVar]] <- list(
"colours" = colours,
"annotVar" = annotationVar,
"text" = textVars
)
}else if (length(Design_levels) == 2) {
colours <- c("#d6e0ff", "#FF9999")
names(colours) <- c(Design_levels)
colourList[[annotationVar]] <- list(
"colours" = colours,
"annotVar" = annotationVar,
"text" = textVars
)
} else if (length(Design_levels) <= 20) {
if (length(Design_levels) > 12) {
colours <- c(
brewer.pal(12, "Set3"),
brewer.pal((length(Design_levels) - 12),
"Pastel2")
)
} else {
colours <- c(brewer.pal(length(Design_levels), "Set3"))
}
names(colours) <- c(Design_levels)
colourList[[annotationVar]] <- list(
"colours" = colours,
"annotVar" = annotationVar,
"text" = textVars
)
} else {
colours <- c("#d6e0ff")
names(colours) <- c("nonEmpty")
colourList[[annotVar]] <- list(
"colours" = colours,
"annotVar" = annotVar,
"text" = annotVar
)
}
```
# Pool Description
Per pool within this study, there are several pool layout plots shown, based on the
* number of STAR input reads (= library size)
* log10 transformed number of STAR input reads
* number of detected UMIs
* number of detected genes
* number of chromosomal reads
* percentage of ERCC
* percentage of mitochondria
> The values for the different samples within each pool is expected to be comparable if the content of the different pools is equally diverse.
```{r plateAnnotation, out.width = "100%",fig.width = 20, fig.height= 10}
plateVars <- c("NumberOfInputReads", "log10LibSize", "NumberOfMappedReads",
"NumberOfChromReads", "NumberOfUMIs", "NumberOfGenes",
"pctMT", "pctERCC")
breaksVars <- lapply(
plateVars,
function(var) {
computeBreaks(7, qcData[, ..var])
}
)
names(breaksVars) <- plateVars
for (pool in pools){
cat("\n\n")
cat(paste0("## ", pool, " {.tabset} \n\n"))
poolData <- qcData[PoolName == pool]
lapply(plateVars, function(plateVar) {
cat("\n\n")
cat(sprintf("### %s {.unnumbered}", plateVar))
cat("\n\n")
plateLayout(
poolData, valueVariable = plateVar,
textFontSize = 10, legendFontSize = 12,
plateName = pool, plot.title = "libSize - ",
legend.title = "libSize", breaks = breaksVars[[plateVar]]
)
cat("\n\n")
})
cat("\n\n")
}
```
<br>
# Data Distributions
## Reads Distributions {.tabset}
The 4 box plots below represent the distributions per pool of the different samples based on:
* the number of STAR input reads
* the number of STAR mapped reads
* the percentage of STAR mapped reads
* the number of detected genes
> The distributions contribute to the QC metrics mentioned in Par 3. The higher these values, the better.
> The data range for the different plates is expected to be comparable if the content of the different plates is equally diverse.
### Number of Input Reads {.tabset .unnumbered}
```{r settings_1}
nColPlots = 1
figHeight = 7
```
#### Distribution {.tabset .unnumbered}
```{r boxplots_input_plate, fig.height = figHeight}
ggplot(
qcData,
aes(
x = PoolName,
y = NumberOfInputReads, colour = PoolName
)
) + geom_boxplot() + ylab("Number of Input Reads") +
ggtitle("Number of Input Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
### Number of Mapped Reads {.tabset .unnumbered}
#### Distribution {.unnumbered}
```{r boxplots_mapped_plate, fig.height = figHeight}
ggplot(
qcData,
aes(x = PoolName, y = NumberOfMappedReads, colour = PoolName)
) + geom_boxplot() + ylab("Number of Mapped Reads") +
ggtitle("Number of Mapped Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title.y = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
#### pct Mapped Reads {.unnumbered}
```{r boxplots_pctMapped_plate, fig.height = figHeight}
ggplot(
qcData,
aes(x = PoolName, y = PctMappedReads, colour = PoolName)
) +
geom_boxplot() +
ylab("pct Mapped Reads") +
ggtitle("pct Mapped Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title.y = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
### Number of Chromosomal Reads {.tabset .unnumbered}
#### Distribution {.unnumbered}
```{r boxplots_chrom_plate, fig.height = figHeight}
ggplot(
qcData,
aes(x = PoolName, y = NumberOfChromReads, colour = PoolName)
) + geom_boxplot() + ylab("Number of Chromosomal Reads") +
ggtitle("Number of Chromosomal Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title.y = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
#### pct Chromosomal Reads {.unnumbered}
```{r boxplots_pctChrom_plate, fig.height = figHeight}
ggplot(
qcData,
aes(x = PoolName, y = pctChrom, colour = PoolName)
) + geom_boxplot() + ylab("pct Chromosomal Reads") +
ggtitle("pct Chromosomal Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title.y = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
### Number of UMIs {.tabset .unnumbered}
#### Distribution {.tabset .unnumbered}
```{r boxplots_umi_plate, fig.height = figHeight}
ggplot(
qcData,
aes(x = PoolName, y = NumberOfUMIs, colour = PoolName)
) + geom_boxplot() + ylab("Number of UMIs") +
ggtitle('Number of UMIs') +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
#### Density distribution {.unnumbered}
```{r density_numberOfUMIs}
## Pre-filtering data exploration
dt_plot <- melt(
qcData,
id.vars = c("SampleName", "PoolName", "WellID"),
measure.vars = c("NumberOfInputReads", "NumberOfMappedReads", "NumberOfUMIs")
)
readsDensity_plot <- ggplot(dt_plot, aes(value))
readsDensity_plot <- readsDensity_plot +
geom_density(aes(fill = variable), alpha=0.8) +
facet_grid(~ PoolName, scales = "free_x", space = "fixed", drop = TRUE) +
geom_vline(
xintercept = 5e5,
linetype = "dashed",
color = "steelblue3", size = 2
) +
annotate(
"text",
x = 3.5e5, y = 2e-6, label = "500k",
angle = 90, color = "steelblue3", size = 10
) +
geom_vline(
xintercept = 1.5e6, linetype = "dashed",
color = "forestgreen", size = 2
) +
annotate(
"text", x = 1.35e6, y = 2e-6, label = "1.5M",
angle = 90, color = "forestgreen", size = 10
) +
labs(
title = "Density plot",
subtitle = paste0(
"# Samples with NumberOfMappedReads > 1.5M: ",
length(which(qcData$NumberOfMappedReads > 1.5e6)),
"\n# Samples with NumberOfUMIs > 500k: ",
length(which(qcData$NumberOfUMIs > 5e5))
),
caption = paste0("# Total samples (after removing empty): ", nrow(qcData)),
x = "Count",
fill = "Variable"
) +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 5),
axis.text.x = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
plot.subtitle = element_text(size = 17),
plot.caption = element_text(size = 15),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15),
axis.text.y = element_blank(),
axis.ticks.y = element_blank(),
axis.title.y = element_blank()
)
readsDensity_plot
```
### Number of Genes {.tabset .unnumbered}
#### Distribution {.unnumbered}
```{r boxplots_genes_plate, fig.height = figHeight}
ggplot(
qcData,
aes(x = PoolName, y = NumberOfGenes, colour = PoolName)
) +
geom_boxplot() + ylab("Number of Genes") +
ggtitle("Number of Genes") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title.y = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
## {.tabset .toc-ignore .unnumbered}
In addition, several plots are shown visualizing the efficiency of the reads-to-genes translation:
* the number of input reads vs the number of mapped reads
* the number of chromosomal reads vs the number of mapped reads
* the number of mapped reads per UMI vs the number of mapped reads
* the number of UNI vs the number of mapped reads
* the number of mapped reads vs the number of genes
* the number of chromosomal reads vs the number of genes
* the number of mapped reads per UMI vs the number of genes
### Mapping Efficiency {.tabset .unnumbered}
#### Number of Input Reads {.unnumbered}
```{r mapping_efficiency_1_plate, fig.height = 7}
ggplot(
qcData,
aes(x = NumberOfInputReads, y = NumberOfMappedReads, colour = PoolName)
) +
geom_point() +
xlab("Number of Input Reads") +
ylab("Number of Mapped Reads") +
ggtitle("Number of Mapped Reads vs Number of Input Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text = element_text(angle = 90, size = 15),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15)
)
```
#### Number of Chromosomal Reads {.unnumbered}
```{r mapping_efficiency_2_plate, fig.height = 7}
ggplot(
qcData,
aes(x = NumberOfChromReads, y = NumberOfMappedReads, colour = PoolName)
) + geom_point() +
xlab("Number of Chromosomal Reads") + ylab("Number of Mapped Reads") +
ggtitle("Number of Chromosomal Reads vs Number of Mapped Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text = element_text(angle = 90, size = 15),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15)
)
```
#### Number of UMI {.unnumbered}
```{r mapping_efficiency_4_plate, fig.height = 7}
ggplot(
qcData,
aes(x =NumberOfUMIs, y = NumberOfMappedReads, colour = PoolName)
) + geom_point() +
ylab("Number of Mapped Reads") + xlab("Number of UMIs ") +
ggtitle("Number of UMIs vs Number of Mapped Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text = element_text(angle = 90, size = 15),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15)
)
```
### Counting Efficiency {.tabset .unnumbered}
#### Number of Mapped Reads {.unnumbered}
```{r gene_efficiency_1_plate, fig.height = 7}
ggplot(
qcData,
aes(x = NumberOfMappedReads, y = NumberOfGenes, colour = PoolName)
) + geom_point() +
ylab("Number of Genes") + xlab("Number of Mapped Reads") +
ggtitle("Number of Genes vs Number of Mapped Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text = element_text(angle = 90, size = 15),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15)
)
```
#### Number of Chromosomal Reads {.unnumbered}
```{r gene_efficiency_2_plate, fig.height = 7}
ggplot(
qcData,
aes(x = NumberOfChromReads, y = NumberOfGenes, colour = PoolName)
) + geom_point() +
ylab("Number of Genes") + xlab("Number of Chromosomal Reads") +
ggtitle("Number of Genes vs Number of Chromosomal Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text = element_text(angle = 90, size = 15),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15)
)
```
## Sequencing Saturation {.tabset}
The barplots below represent the sequencing saturation per sample as determined by STAR, split per pool.
The HT-RNAseq platform aims for shallow sequencing resulting in relatively low sequencing saturations of 10-20%.
In addition, the sequencing saturation vs the number of input reads is shown.
### Sequencing Saturation {.unnumbered}
```{r sequencingSaturation, fig.height = figHeight}
ggplot(
qcData,
aes(x = WellID, y = SequencingSaturation, fill = PoolName)
) + geom_bar(stat = "identity", position = "dodge") +
xlab("Samples") + ggtitle("Sequencing Saturation per Sample") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(1, "lines"),
text = element_text(size = 10),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15),
axis.text.x = element_blank(),
axis.text.y = element_text(size = 15),
axis.ticks.x = element_blank()
)
```
### Sequencing Saturation - Input Reads {.unnumbered}
```{r sequencingSaturation_inputReads, fig.height = figHeight}
ggplot(
qcData,
aes(x = NumberOfInputReads, y = SequencingSaturation, colour = PoolName)
) + geom_point() +
ggtitle("Sequencing Saturation vs Number of Input Reads") +
theme(strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text = element_text(angle = 90, size = 15),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15)
)
```
### Sequencing Saturation - Mapped Reads {.unnumbered}
```{r sequencingSaturation_mappedReads, fig.height = figHeight}
ggplot(
qcData,
aes(x = NumberOfChromReads, y = SequencingSaturation, colour = PoolName)
) + geom_point() +
ggtitle("Sequencing Saturation vs Number of Chromosomal Reads") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size=10),
axis.text = element_text(angle = 90, size = 15),
plot.title = element_text(size=18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15)
)
```
<br>
## Genomic Origin {.tabset}
The 3 boxplots below represent, per pool, the distributions of the percentage of reads mapping to:
* chromosomal regions
* mitochondrial regions
* ERCC spike-ins
The 4th plot summarises the above results across samples per pool.
The 5th plot shows the percentage of reads mapped to the transcriptome (as counted by STAR). This measurement serves as a proxy for the percentage of reads mapped to exons.
> The percentage ERCC contributes to the QC metrics mentioned in Par 3. This value is ideally as low as possible (but non-zero to ensure the they have been spiked in) and comparable for the different pools.
### pctChrom {.tabset .unnumbered}
```{r genomicOrigin_chrom_plate, fig.height = figHeight}
ggplot(
qcData, aes(x = PoolName, y = pctChrom, colour = PoolName)
) +
geom_boxplot() +
ggtitle("pctChrom") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title.y = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
### pctMT {.tabset .unnumbered}
```{r genomicOrigin_mt_plate, fig.height = figHeight}
ggplot(
qcData,
aes(x = PoolName, y = pctMT, colour = PoolName)
) +
geom_boxplot() + ggtitle("pctMT") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title.y = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
### pctERCC {.tabset .unnumbered}
```{r genomicOrigin_ercc_plate, fig.height = figHeight}
ggplot(qcData, aes(x = PoolName, y = pctERCC, colour = PoolName)) +
geom_boxplot() +
ggtitle("pctERCC") +
theme(
strip.text.x = element_text(size = 20),
panel.spacing = unit(2, "lines"),
text = element_text(size = 10),
axis.text.y = element_text(angle = 90, size = 14),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title.y = element_text(size = 15),
axis.text.x = element_blank(),
axis.ticks.x = element_blank()
)
```
### Genomic Summary {.tabset .unnumbered}
```{r genomicOrigin_summary_plate}
meanPctChromMTData <- qcData[, .(
"pctChrom" = median(pctChrom),
"pctMT" = median(pctMT),
"pctERCC" = median(pctERCC)
), by = PoolName]
meanPctChromMTDataLong <- melt(
meanPctChromMTData,
id.vars = "PoolName",
measure.vars = c("pctChrom", "pctMT", "pctERCC"),
variable.name = "Origin", value.name = "pct"
)
ggplot(
meanPctChromMTDataLong,
aes(fill = Origin, y = pct, x = PoolName)) +
geom_bar(position = "stack", stat = "identity") +
ggtitle("Genomic Origin") +
theme(
text = element_text(size = 10),
axis.text = element_text(angle = 90, size = 15),
plot.title = element_text(size = 18),
legend.text = element_text(size = 15),
legend.title = element_text(size = 17),
axis.title = element_text(size = 15)
)
```
# Depletion {.tabset}
<div align="center">
```{r depletion}
for (eset_name in pools) {
cat("\n\n")
cat(paste0("## ", eset_name, " {.unnumbered}"))
cat("\n\n")
eset <- esetList[[eset_name]]
average_reads <- sort(apply(exprs(eset), 1, mean), decreasing = TRUE)
plotData <- data.table(
ENSGID = names(average_reads),
av_count = average_reads
)
gen_descript <- data.table(
ENSGID = eset@featureData@data$gene_id,
Description = eset@featureData@data$GENENAME
)
order_gen_descript <- gen_descript[
match(plotData$ENSGID, gen_descript$ENSGID),
]
g <- ggplot(
plotData[c(1:100)],
aes(x = reorder(ENSGID, -av_count), y = av_count)
) + geom_bar(stat = "identity") +
theme(
axis.text.x = element_text(angle = 90, vjust = 0.5, hjust = 1, size = 12),
axis.text.y = element_text(size = 12),
legend.text = element_text(size = 15),
legend.title = element_text(size = 15),
axis.title = element_text(size = 18),
plot.title = element_text(size = 20)
) + ylab("Average Counts") + xlab("Genes")
print(g)
cat("\n\n")
cat("<br>")
cat("<br>")
print(htmltools::tagList((DT::datatable(order_gen_descript[1:100, ]))))
}
```
</div>
<br>
<br>
<br>
<br>
# Glossary {.unnumbered}
## Read {.unlisted .unnumbered}
A read is a oligonucleotide (a short RNA fragment) that has been sequenced. It consists of a fixed number of base pairs (bp) and therefore has a specific read length.
## Input Read {.unlisted .unnumbered}
Each read of the fastq file used as input to the STAR aligner is considered an input read.
## Read With Valid Barcode {.unlisted .unnumbered}
A read with a valid barcode is a read for which the barcode matches the white list of barcodes under the given restriction of the number of allowed mismatches. The number of reads with a valid barcode is lower or equal to the number of input reads.
## Mapped Read {.unlisted .unnumbered}
A read that has been aligned against the reference genome and for which one or more suitable matching locations have been found is a mapped read. Depending on the number of allowed mismatches this might or might not be be an exact match. The number of mapped reads is lower or equal to the number of reads with a valid barcode.
## Uniquely Mapped Read {.unlisted .unnumbered}
A read for which one and only one suitable matching location in the reference genome was found is an uniquely mapped read. The number of uniquely mapped reads is lower or equal to the number of mapped reads.
## Counted Read {.unlisted .unnumbered}
A mapped read will only be counted if it overlaps (1 nucleotide or more) with one and only one gene. The number of counted reads is lower or equal to the number of (uniquely) mapped reads.
## UMIs {.unlisted .unnumbered}
Unique molecular identifiers (UMI) are short sequences in order to uniquely tag each molecule in a sample library. Sequencing with UMIs allows bioinformatics software to filter out duplicate reads and PCR errors with a high level of accuracy and report unique reads.
The reported UMIs is the number of UMIs among the set of reads that map to an unique gene, i.e the number of reads is deduplicated.
## pctERCC {.unlisted .unnumbered}
The percentage of reads mapping to the ERCC genes among the total number of **mapped** reads.
## pctMT {.unlisted .unnumbered}
The percentage of reads mapping to the MT genes among the total number of **mapped** reads.
## Sequencing Saturation {.unlisted .unnumbered}
The sequencing saturation is a measure of the fraction of library complexity. The inverse of one minus the sequencing saturation can be interpreted as the number of additional reads it would take to detect a new transcript. Consequently, a low sequencing saturation indicates a shallow sequencing in which a new transcript could be discovered with a few reads.
<br>
<br>
<br>
<br>
<center>
![](OutputSTARsolo.png)
</center>
<br>
<br>

41
src/report/test.R Normal file
View File

@@ -0,0 +1,41 @@
library(whisker)
library(testthat)
library(R.utils)
cat(">> Creating temporary directory \n")
Sys.setenv(TMP = meta$temp_dir)
temp_folder <- tempdir(check = TRUE)
cat(">> Running component create_report for test case \n")
input_dir <- file.path(meta$resources_dir, "test_data")
stopifnot(file.exists(input_dir))
out <- processx::run(meta$executable, c(
"--eset", file.path(meta$resources_dir, "test_data", "eset.sample_one.rds"),
"--eset", file.path(meta$resources_dir, "test_data", "eset.sample_two.rds"),
"--output_report", "report.html"
))
expect_equal(out$status, 0)
expect_true(file.exists("report.html"))
cat(">> Test succesful \n")
cat(">> Running component create_report with symbolic links \n")
link_sample_1 <- file.path(temp_folder, "eset.sample_one.rds")
link_sample_2 <- file.path(temp_folder, "eset.sample_two.rds")
createLink(link = link_sample_1,
target = file.path(meta$resources_dir, "test_data", "eset.sample_one.rds"))
createLink(link = link_sample_2,
target = file.path(meta$resources_dir, "test_data", "eset.sample_two.rds"))
out <- processx::run(meta$executable, c(
"--eset", link_sample_1,
"--eset", link_sample_2,
"--output_report", "report2.html"
))
expect_true(file.exists("report2.html"))

Binary file not shown.

Binary file not shown.

View File

@@ -0,0 +1,72 @@
name: combine_star_logs
namespace: "stats"
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ author, maintainer ]
argument_groups:
- name: "Arguments"
arguments:
- name: "--barcodes"
type: string
multiple: true
required: true
description: |
Barcodes responding to the respective log files.
- name: "--star_logs"
type: file
multiple: true
required: true
description: |
Paths to the STAR log files (most frequently called Log.final.out)
direction: input
example: "Log.final.out"
- name: "--gene_summary_logs"
direction: input
type: file
multiple: true
required: true
description: |
Paths to the Summary.csv files from the STAR Solo output. Can be found in
the 'Solo.out/Gene' folder relative to the root of the STAR output directory.
example: "Summary.txt"
- name: "--reads_per_gene_logs"
direction: input
type: file
multiple: true
required: true
description: |
Paths to the 'ReadsPerGene.out.tab' files as output by STAR.
- name: "--output"
type: file
direction: output
default: "starLogs.txt"
description: |
Tab-delimited file describing for each barcode (as the rows), the metrics (as columns)
gathered from the different input files.
resources:
- type: python_script
path: script.py
test_resources:
- type: python_script
path: test.py
- path: test_data
engines:
- type: docker
image: python:3.12-slim
setup:
- type: apt
packages:
- procps
- type: python
packages:
- pandas
test_setup:
- type: python
packages:
- viashpy
runners:
- type: executable
- type: nextflow

View File

@@ -0,0 +1,228 @@
import logging
import pandas as pd
from itertools import batched, starmap
### VIASH START
meta = {
"name": "combine_star_logs",
}
par = {
"star_logs": ["src/stats/combine_star_logs/test_data/barcode_1/Log.final.out",
"src/stats/combine_star_logs/test_data/barcode_2/Log.final.out"],
"gene_summary_logs": ["src/stats/combine_star_logs/test_data/barcode_1/summary.csv",
"src/stats/combine_star_logs/test_data/barcode_2/summary.csv"],
"reads_per_gene_logs": ["src/stats/combine_star_logs/test_data/barcode_1/ReadsPerGene.out.tab",
"src/stats/combine_star_logs/test_data/barcode_2/ReadsPerGene.out.tab"],
"output": "output.txt",
"barcodes": ["ACGG", "TTTT"],
}
### VIASH END
logger = logging.getLogger()
console_handler = logging.StreamHandler()
logger.addHandler(console_handler)
logger.setLevel(logging.DEBUG)
def handle_percentages(column_value):
# TODO: handle this more gracefully
if column_value:
return column_value.strip('%')
return column_value
def star_log_to_dataframe(barcode: str, log_path) -> pd.DataFrame:
logger.info("Reading STAR log %s for barcode '%s'", log_path, barcode)
result = pd.read_table(log_path, sep=r"\|\t+", converters={"Value": handle_percentages},
engine="python", header=None, skip_blank_lines=True,
skipinitialspace=True, names=["Category", "Value"], index_col=0,
skiprows=[0, 1, 2])
logger.info("Read %d row(s) and %d column(s) from STAR logs at %s",
*result.shape, log_path)
return result
def summary_to_dataframe(barcode: str, summary_path) -> pd.DataFrame:
logger.info("Reading summary log %s for barcode %s", summary_path, barcode)
result = pd.read_table(summary_path, sep=",",
header=None, names=["Category", "Value"],
index_col=0, dtype=pd.StringDtype())
logger.info("Read %d row(s) and %d column(s) from summary file at %s",
*result.shape, summary_path)
return result
def reads_per_gene_to_dataframe(barcode, read_per_gene_path) -> pd.DataFrame:
logger.info("Reading reads per gene file %s for barcode %s", read_per_gene_path, barcode)
result = pd.read_table(read_per_gene_path, skiprows=[0, 1, 2, 3], header=None, sep="\t",
dtype={"geneID": pd.StringDtype(),
"Unstranded": pd.Int64Dtype(),
"posStrand": pd.Int64Dtype(),
"negStrand": pd.Int64Dtype()},
index_col=0, names=["geneID", "Unstranded", "posStrand", "negStrand"])
result = result[["Unstranded"]] # Do not use .loc here because we need a DataFrame, not a Series
df = pd.DataFrame({"Value": result.sum()})
df = df.rename({"Unstranded": "NumberOfCountedReads"}, errors="raise")
df.index.name = "Category"
logger.info("Read %d row(s) and %d column(s) from reads per gene file at %s",
*df.shape, read_per_gene_path)
return df
def star_log_remove_unwanted_entries_and_adjust_format(barcode, df: pd.DataFrame) -> pd.DataFrame:
"""
For a single star log (Log.final.out) in dataframe format, filter out the
entries that are not needed and format the labels for some metrics:
- Replace '%' with 'pect' in the labels.
- Remove labels ending with ':'
(mostly the section separators like 'MULTI-MAPPING READS:' and 'UNMAPPED READS:')
- Remove the metrics we do no need based on the following keywords:
Mapping speed, Average, Number of splices, per base, chimeric reads, average
The dataframe provided as input must have an index with 1 level with the metric names.
"""
# Remove index values ending with ':' (rows like 'MULTI-MAPPING READS:','UNIQUE READS:')
logger.info("Filtering STAR logs for barcode %s. Starting with %d row(s) and %d column(s)", barcode, *df.shape)
to_keep = ~df.index.to_series().str.endswith(":")
# Remove index values where the values contain any of these substrings
regex_columns_to_remove = "Mapping speed|Average|Number of splices|per base|chimeric reads|average"
to_keep = to_keep & ~df.index.to_series().str.contains(regex_columns_to_remove, regex=True)
logger.info("Removed the following log entries for barcode '%s':\n\t%s",
barcode,
"\n\t".join(to_keep[~to_keep].index.to_list()))
result = df.loc[to_keep]
# Replace % by pect, remove columns, use camel case and remove spaces
# You might be tempted to use .title() to make everything uppercase,
# but characters which are already uppercase should stay that way.
# (example: NumberOfUMIs and not NumberOfUmis)
result.index = result.index.str.replace("%", "pect")\
.str.replace(":", "")\
.str.replace(r"(?:^|\s).", lambda m:m.group(0).upper(), regex=True)\
.str.replace(" ", "")
result = result.rename({"UniquelyMappedReadsNumber": "NumberOfMappedReads",
"UniquelyMappedReadsPect": "PctMappedReads"}, errors="raise")
logger.info("Done filtering STAR logs for barcode %s. Result has %d row(s) and %d column(s). "
"Found entries:\n\t%s",
barcode, *result.shape, "\n\t".join(result.index.to_list()))
return result
def summary_remove_unwanted_entries_and_adjust_format(barcode, df: pd.DataFrame) -> pd.DataFrame:
logger.info("Filtering and formatting summary logs for barcode %s. "
"Starting with %d row(s) and %d column(s)", barcode, *df.shape)
columns_to_remove = (
"Number of Reads",
"Q30 Bases in RNA read",
"Reads Mapped to Genome: Unique",
"Reads Mapped to Transcriptome: Unique Genes",
"Reads in Cells Mapped to Unique Genes",
"Median UMI per Cell",
"Median Genes per Cell",
"Reads Mapped to Genome: Unique+Multiple",
"Median Reads per Cell",
"Mean UMI per Cell",
"Mean Genes per Cell",
)
to_keep = ~df.index.isin(columns_to_remove)
logger.info("Removed the following summary entries for barcode '%s':\n\t%s",
barcode,
"\n\t".join(df.loc[~to_keep].index.to_list()))
result = df.loc[to_keep]
result.index = result.index.str.replace(r"(?:^|\s).", lambda m:m.group(0).upper(),
regex=True).str.replace(" ", "")
to_rename = {"UMIsInCells": "NumberOfUMIs",
"TotalGenesDetected": "NumberOfGenes"}
try:
result = result.rename(to_rename, errors="raise")
except KeyError as e:
raise KeyError(f"Tried to rename log entries ({','.join(to_rename)}) in the summary "
f"log for barcode {barcode}, but an entry was not found in the file. "
"Make sure that you are using the correct version of STAR."
f"Available entries: {", ".join(result.index.to_list())}") from e
logger.info("Done filtering summary logs for barcode %s. Result has %d row(s) and %d column(s). "
"Found entries:\n\t%s",
barcode, *result.shape, "\n\t".join(result.index.to_list()))
return result
def join_dfs(df_list, barcodes) -> pd.DataFrame:
# Combine the dataframes together and add the barcodes as a level to the dataframe
# in order to make a 2-level index (first level the barcodes and second level the metrics).
result = pd.concat(dict(zip(barcodes, df_list)), names=["WellBC"])
# Pivot the table by moving the metrics to the columns. Its added as an extra level,
# so we can just frop the 'Values' level that was already there
result = result.unstack(level="Category").droplevel(0, axis="columns")
return result
def main(par):
logger.info("Component started.")
# Provide an overview of the parameters in the logs
parameters_str = [f'\t{param}: {param_val}\n' for param, param_val in par.items()]
logger.info("Parameters:\n%s", "".join(parameters_str).rstrip())
star_logs, gene_summary_logs, reads_per_gene_logs, barcodes = par["star_logs"], \
par["gene_summary_logs"], par["reads_per_gene_logs"], par["barcodes"]
number_of_inputs = tuple(len(i) for i in (star_logs, gene_summary_logs,
reads_per_gene_logs, barcodes))
if len(set(number_of_inputs)) != 1:
raise ValueError("Expected the same number of inputs for 'star_logs' (%d), "
"'gene_summary_logs' (%d), 'reads_per_gene_logs' (%d) "
"and 'barcodes' (%d)." % number_of_inputs)
logs_to_process = [
(star_log_to_dataframe, star_log_remove_unwanted_entries_and_adjust_format, star_logs),
(summary_to_dataframe, summary_remove_unwanted_entries_and_adjust_format, gene_summary_logs),
(reads_per_gene_to_dataframe, None, reads_per_gene_logs),
]
logger.info("Formatting the contents of the log files.")
all_logs_data = []
for df_generator, formatter, data in logs_to_process:
data_as_df = list(starmap(df_generator, zip(barcodes, data)))
data_formatted = data_as_df
if formatter:
data_formatted = list(starmap(formatter, zip(barcodes, data_as_df)))
data_joined = join_dfs(data_formatted, barcodes)
all_logs_data.append(data_joined)
logger.info("Joining entries across the different logs together.")
all_stats = pd.concat(all_logs_data, axis=1)
logger.info("Log statistics were gathered for the following barcodes: %s",
", ".join(all_stats.index.to_list()))
dtypes = {
'NumberOfInputReads': pd.UInt64Dtype(),
'NumberOfMappedReads': pd.UInt64Dtype(),
'PctMappedReads': pd.Float64Dtype(),
'NumberOfReadsMappedToMultipleLoci': pd.UInt64Dtype(),
'PectOfReadsMappedToMultipleLoci': pd.Float64Dtype(),
'NumberOfReadsMappedToTooManyLoci': pd.UInt64Dtype(),
'PectOfReadsMappedToTooManyLoci': pd.Float64Dtype(),
'NumberOfReadsUnmappedTooManyMismatches': pd.UInt64Dtype(),
'PectOfReadsUnmappedTooManyMismatches': pd.Float64Dtype(),
'NumberOfReadsUnmappedTooShort': pd.UInt64Dtype(),
'PectOfReadsUnmappedTooShort': pd.Float64Dtype(),
'NumberOfReadsUnmappedOther': pd.UInt64Dtype(),
'PectOfReadsUnmappedOther': pd.Float64Dtype(),
'ReadsWithValidBarcodes': pd.Float64Dtype(),
'SequencingSaturation': pd.Float64Dtype(),
'Q30BasesInCB+UMI': pd.Float64Dtype(),
'ReadsMappedToTranscriptome:Unique+MultipeGenes': pd.Float64Dtype(),
'EstimatedNumberOfCells': pd.UInt64Dtype(),
'FractionOfReadsInCells': pd.Float64Dtype(),
'MeanReadsPerCell': pd.UInt64Dtype(),
'NumberOfUMIs': pd.UInt64Dtype(),
'NumberOfGenes': pd.UInt64Dtype(),
'NumberOfCountedReads': pd.UInt64Dtype(),
}
all_stats = all_stats.astype(dtypes)
# batched() is used here to print a limited amount of columnns at a time
# to make sure that they are all displayed (pandas might limit the view for readability)
logger.info("Summary of final output:\n%s\n",
"\n".join(repr(all_stats.loc[:,columns].describe())
for columns in batched(all_stats.columns, 3)))
logger.info("Writing output to %s", par["output"])
all_stats.reset_index("WellBC").to_csv(par["output"], sep="\t", header=True,
index=False, float_format='%g')
logger.info("Finished %s.", meta["name"])
if __name__ == "__main__":
main(par)

View File

@@ -0,0 +1,125 @@
import pytest
import sys
import re
import pandas as pd
from pathlib import Path
from uuid import uuid4
from subprocess import CalledProcessError
### VIASH START
meta = {
"resources_dir": "./src/stats/combine_star_logs/",
"executable": "target/executable/stats/combine_star_logs/combine_star_logs",
"config": "src/stats/combine_star_logs/config.vsh.yaml"
}
### VIASH END
@pytest.fixture
def test_resources_path():
return Path(meta["resources_dir"]) / "test_data"
@pytest.fixture
def barcode_1_star_log(test_resources_path):
return test_resources_path / "barcode_1" / "Log.final.out"
@pytest.fixture
def barcode_1_reads_per_gene_file(test_resources_path):
return test_resources_path / "barcode_1" / "ReadsPerGene.out.tab"
@pytest.fixture
def barcode_1_summary(test_resources_path):
return test_resources_path / "barcode_1" / "summary.csv"
@pytest.fixture
def barcode_2_star_log(test_resources_path):
return test_resources_path / "barcode_2" / "Log.final.out"
@pytest.fixture
def barcode_2_reads_per_gene_file(test_resources_path):
return test_resources_path / "barcode_2" / "ReadsPerGene.out.tab"
@pytest.fixture
def barcode_2_summary(test_resources_path):
return test_resources_path / "barcode_2" / "summary.csv"
@pytest.fixture
def random_path(tmp_path):
def wrapper(extension=None):
extension = "" if not extension else f".{extension}"
return tmp_path / f"{uuid4()}{extension}"
return wrapper
def test_incorrect_number_of_inputs_raises(run_component,
barcode_1_star_log, barcode_2_star_log,
barcode_1_reads_per_gene_file, barcode_2_reads_per_gene_file,
barcode_1_summary, barcode_2_summary,
random_path):
output_path = random_path("txt")
with pytest.raises(CalledProcessError) as err:
run_component([
"--barcodes", "foo;bar",
"--star_logs", f"{barcode_1_star_log}",
"--reads_per_gene_logs", f"{barcode_1_reads_per_gene_file};{barcode_2_reads_per_gene_file}",
"--gene_summary_logs", f"{barcode_1_summary};{barcode_2_summary}",
"--output", output_path,
])
assert re.search(r"ValueError: Expected the same number of inputs for 'star_logs' \(1\), "
r"'gene_summary_logs' \(2\), 'reads_per_gene_logs' \(2\) and 'barcodes' \(2\)\.",
err.value.stdout.decode('utf-8'))
def test_equal_number_of_argument(run_component,
barcode_1_star_log, barcode_2_star_log,
barcode_1_reads_per_gene_file, barcode_2_reads_per_gene_file,
barcode_1_summary, barcode_2_summary,
random_path):
output_path = random_path("txt")
run_component([
"--barcodes", "foo;bar",
"--star_logs", f"{barcode_1_star_log};{barcode_2_star_log}",
"--reads_per_gene_logs", f"{barcode_1_reads_per_gene_file};{barcode_2_reads_per_gene_file}",
"--gene_summary_logs", f"{barcode_1_summary};{barcode_2_summary}",
"--output", output_path,
])
# We use strings here to make a comparison of the file contents without
# doing any inferences of the numerical data type (i.e. exact file contents).
expected_dict = {
'NumberOfInputReads': ["96398", "10155"],
'NumberOfMappedReads': ["70824", "7179"],
'PctMappedReads': ["73.47", "70.69"],
'NumberOfReadsMappedToMultipleLoci': ["0", "0"],
'PectOfReadsMappedToMultipleLoci': ["0", "0"],
'NumberOfReadsMappedToTooManyLoci': ["22281", "2248"],
'PectOfReadsMappedToTooManyLoci': ["23.11", "22.14"],
'NumberOfReadsUnmappedTooManyMismatches': ["0", "0"],
'PectOfReadsUnmappedTooManyMismatches': ["0", "0"],
'NumberOfReadsUnmappedTooShort': ["2697", "553"],
'PectOfReadsUnmappedTooShort': ["2.8", "5.45"],
'NumberOfReadsUnmappedOther': ["596", "175"],
'PectOfReadsUnmappedOther': ["0.62", "1.72"],
'ReadsWithValidBarcodes': ["0.999782", "0.999803"],
'SequencingSaturation': ["0.0602963", "0.0539344"],
'Q30BasesInCB+UMI': ["0.980096", "0.984461"],
'ReadsMappedToTranscriptome:Unique+MultipeGenes': ["0.60411", "0.530871"],
'EstimatedNumberOfCells': ["1", "1"],
'FractionOfReadsInCells': ["1", "1"],
'MeanReadsPerCell': ["53602", "4969"],
'NumberOfUMIs': ["50370", "4701"],
'NumberOfGenes': ["8767", "2397"],
'NumberOfCountedReads': ["17", "15"],
}
expected = pd.DataFrame.from_dict(expected_dict, dtype=pd.StringDtype())
expected.index = pd.Index(["foo", "bar"], name="WellBC", dtype=pd.StringDtype())
assert output_path.is_file()
contents = pd.read_csv(output_path, sep="\t", index_col=0, dtype=pd.StringDtype())
assert set(("NumberOfInputReads", "SequencingSaturation",
"NumberOfGenes", "NumberOfUMIs", "NumberOfCountedReads",
"PctMappedReads")).issubset(set(contents.columns))
pd.testing.assert_frame_equal(contents, expected)
if __name__ == '__main__':
sys.exit(pytest.main([__file__]))

View File

@@ -0,0 +1,37 @@
Started job on | Jun 26 09:38:11
Started mapping on | Jun 26 09:38:14
Finished on | Jun 26 09:38:23
Mapping speed, Million of reads per hour | 38.56
Number of input reads | 96398
Average input read length | 57
UNIQUE READS:
Uniquely mapped reads number | 70824
Uniquely mapped reads % | 73.47%
Average mapped length | 56.93
Number of splices: Total | 6432
Number of splices: Annotated (sjdb) | 6285
Number of splices: GT/AG | 6331
Number of splices: GC/AG | 33
Number of splices: AT/AC | 2
Number of splices: Non-canonical | 66
Mismatch rate per base, % | 0.61%
Deletion rate per base | 0.01%
Deletion average length | 1.38
Insertion rate per base | 0.00%
Insertion average length | 1.24
MULTI-MAPPING READS:
Number of reads mapped to multiple loci | 0
% of reads mapped to multiple loci | 0.00%
Number of reads mapped to too many loci | 22281
% of reads mapped to too many loci | 23.11%
UNMAPPED READS:
Number of reads unmapped: too many mismatches | 0
% of reads unmapped: too many mismatches | 0.00%
Number of reads unmapped: too short | 2697
% of reads unmapped: too short | 2.80%
Number of reads unmapped: other | 596
% of reads unmapped: other | 0.62%
CHIMERIC READS:
Number of chimeric reads | 0
% of chimeric reads | 0.00%

View File

@@ -0,0 +1,8 @@
N_unmapped 11111 22222 33333
N_multimapping 0 0 0
N_noFeature 44444 55555 66666
N_ambiguous 77777 88888 99999
gene1 2 0 0
gene2 0 0 0
gene3 6 0 6
gene5 9 6 3

View File

@@ -0,0 +1,20 @@
Number of Reads,96398
Reads With Valid Barcodes,0.999782
Sequencing Saturation,0.0602963
Q30 Bases in CB+UMI,0.980096
Q30 Bases in RNA read,0.799904
Reads Mapped to Genome: Unique+Multiple,0.734704
Reads Mapped to Genome: Unique,0.734704
Reads Mapped to Transcriptome: Unique+Multipe Genes,0.60411
Reads Mapped to Transcriptome: Unique Genes,0.556049
Estimated Number of Cells,1
Reads in Cells Mapped to Unique Genes,53602
Fraction of Reads in Cells,1
Mean Reads per Cell,53602
Median Reads per Cell,53602
UMIs in Cells,50370
Mean UMI per Cell,50370
Median UMI per Cell,50370
Mean Genes per Cell,8767
Median Genes per Cell,8767
Total Genes Detected,8767
1 Number of Reads 96398
2 Reads With Valid Barcodes 0.999782
3 Sequencing Saturation 0.0602963
4 Q30 Bases in CB+UMI 0.980096
5 Q30 Bases in RNA read 0.799904
6 Reads Mapped to Genome: Unique+Multiple 0.734704
7 Reads Mapped to Genome: Unique 0.734704
8 Reads Mapped to Transcriptome: Unique+Multipe Genes 0.60411
9 Reads Mapped to Transcriptome: Unique Genes 0.556049
10 Estimated Number of Cells 1
11 Reads in Cells Mapped to Unique Genes 53602
12 Fraction of Reads in Cells 1
13 Mean Reads per Cell 53602
14 Median Reads per Cell 53602
15 UMIs in Cells 50370
16 Mean UMI per Cell 50370
17 Median UMI per Cell 50370
18 Mean Genes per Cell 8767
19 Median Genes per Cell 8767
20 Total Genes Detected 8767

View File

@@ -0,0 +1,37 @@
Started job on | Jun 26 09:38:56
Started mapping on | Jun 26 09:39:00
Finished on | Jun 26 09:39:02
Mapping speed, Million of reads per hour | 18.28
Number of input reads | 10155
Average input read length | 57
UNIQUE READS:
Uniquely mapped reads number | 7179
Uniquely mapped reads % | 70.69%
Average mapped length | 56.36
Number of splices: Total | 526
Number of splices: Annotated (sjdb) | 495
Number of splices: GT/AG | 502
Number of splices: GC/AG | 4
Number of splices: AT/AC | 1
Number of splices: Non-canonical | 19
Mismatch rate per base, % | 0.85%
Deletion rate per base | 0.00%
Deletion average length | 1.09
Insertion rate per base | 0.00%
Insertion average length | 1.07
MULTI-MAPPING READS:
Number of reads mapped to multiple loci | 0
% of reads mapped to multiple loci | 0.00%
Number of reads mapped to too many loci | 2248
% of reads mapped to too many loci | 22.14%
UNMAPPED READS:
Number of reads unmapped: too many mismatches | 0
% of reads unmapped: too many mismatches | 0.00%
Number of reads unmapped: too short | 553
% of reads unmapped: too short | 5.45%
Number of reads unmapped: other | 175
% of reads unmapped: other | 1.72%
CHIMERIC READS:
Number of chimeric reads | 0
% of chimeric reads | 0.00%

View File

@@ -0,0 +1,8 @@
N_unmapped 101010 202020 303030
N_multimapping 0 0 0
N_noFeature 404040 505050 606060
N_ambiguous 707070 808080 909090
gene1 0 0 0
gene2 0 0 0
gene6 5 5 0
gene4 10 2 8

View File

@@ -0,0 +1,20 @@
Number of Reads,10155
Reads With Valid Barcodes,0.999803
Sequencing Saturation,0.0539344
Q30 Bases in CB+UMI,0.984461
Q30 Bases in RNA read,0.786064
Reads Mapped to Genome: Unique+Multiple,0.706942
Reads Mapped to Genome: Unique,0.706942
Reads Mapped to Transcriptome: Unique+Multipe Genes,0.530871
Reads Mapped to Transcriptome: Unique Genes,0.489316
Estimated Number of Cells,1
Reads in Cells Mapped to Unique Genes,4969
Fraction of Reads in Cells,1
Mean Reads per Cell,4969
Median Reads per Cell,4969
UMIs in Cells,4701
Mean UMI per Cell,4701
Median UMI per Cell,4701
Mean Genes per Cell,2397
Median Genes per Cell,2397
Total Genes Detected,2397
1 Number of Reads 10155
2 Reads With Valid Barcodes 0.999803
3 Sequencing Saturation 0.0539344
4 Q30 Bases in CB+UMI 0.984461
5 Q30 Bases in RNA read 0.786064
6 Reads Mapped to Genome: Unique+Multiple 0.706942
7 Reads Mapped to Genome: Unique 0.706942
8 Reads Mapped to Transcriptome: Unique+Multipe Genes 0.530871
9 Reads Mapped to Transcriptome: Unique Genes 0.489316
10 Estimated Number of Cells 1
11 Reads in Cells Mapped to Unique Genes 4969
12 Fraction of Reads in Cells 1
13 Mean Reads per Cell 4969
14 Median Reads per Cell 4969
15 UMIs in Cells 4701
16 Mean UMI per Cell 4701
17 Median UMI per Cell 4701
18 Mean Genes per Cell 2397
19 Median Genes per Cell 2397
20 Total Genes Detected 2397

View File

@@ -0,0 +1,56 @@
name: generate_pool_statistics
namespace: "stats"
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ author, maintainer ]
- __merge__: /src/base/authors/marijke_van_moerbeke.yaml
roles: [ contributor ]
argument_groups:
- name: "Arguments"
arguments:
- name: "--nrReadsNrGenesPerChrom"
type: file
multiple: true
description: |
Path to an output file that contains a .tsv formatted table describing
per chromosome the number of reads that were mapped to that chromosome (NumberOfReads
column) and the number of genes on that chromosome that had at least one
read mapped to it (NumberOfGenes).
direction: input
default: [processedBamFile_well1.tsv, processedBamfile_well2.tsv]
- name: "--nrReadsNrGenesPerChromPool"
direction: output
type: file
multiple: false
description: |
Pivot table in tsv format of the combined input nrReadsNrGenesPerChrom files. Describes
per chromosome (as columns) the number of reads, as well as the total number
of reads per cell barcode and the percentage of nuclear, ERCC and mitochondrial
reads.
example: "nrReadsNrGenesPerChrom.txt"
resources:
- type: python_script
path: script.py
test_resources:
- type: python_script
path: test.py
engines:
- type: docker
image: python:3.12-slim
setup:
- type: apt
packages:
- procps
- type: python
packages:
- pandas
test_setup:
- type: python
packages:
- viashpy
runners:
- type: executable
- type: nextflow

View File

@@ -0,0 +1,88 @@
import pandas as pd
import re
### VIASH START
par = {
"nrReadsNrGenesPerChrom": ["src/stats/generate_pool_statistics/test1.tsv", "src/stats/generate_pool_statistics/test2.tsv"],
"nrReadsNrGenesPerChromPool": "nrReadsNrGenesPerChrom_pool.txt"
}
### VIASH END
INDEX_COL = ["WellBC", "WellID"]
if __name__ == "__main__":
#########
# nrReadsNrGenesPerChrom file
#########
nr_reads_nr_genes_wells = []
for nr_reads_nr_genes_file in par["nrReadsNrGenesPerChrom"]:
nr_reads_nr_genes_wells.append(pd.read_csv(nr_reads_nr_genes_file,
header=0, delimiter="\t",
dtype={"WellBC": pd.StringDtype(),
"WellID": pd.StringDtype(),
"Chr": pd.StringDtype(),
"NumberOfReads": pd.UInt64Dtype(),
"NumberOfGenes": pd.UInt64Dtype()}))
nr_reads_nr_genes_pool = pd.concat(nr_reads_nr_genes_wells, ignore_index=True,)
total_nr_reads_per_chromosome = nr_reads_nr_genes_pool.pivot_table(index=INDEX_COL, columns="Chr",
values=["NumberOfReads"], fill_value=0,
aggfunc="sum").droplevel(0, axis=1)
total_nr_reads_per_chromosome.columns.name = None
##### Total number of genes from all chromosomes
total_nr_genes = nr_reads_nr_genes_pool.loc[:, INDEX_COL + ['NumberOfGenes']].groupby(["WellBC", "WellID"]).sum()
##### Total counts across (irrespective of chromosome)
total_sum_of_reads = total_nr_reads_per_chromosome.sum(numeric_only=True, axis=1)
##### Logic to split up chromosome per type
chromosome_names = total_nr_reads_per_chromosome.columns.to_list()
chr_regex = re.compile(r"^(chr)?\d+")
matching_chromosomes = [chr_name for chr_name
in chromosome_names
if chr_regex.match(chr_name)]
sex_chromosome_names = ["X", "Y"]
mitochondrial_chr_name = "MT"
# This is logic from the original HT pipeline,
# only when all of the matched chromosomes start with "chr", the mitochonrial, X and Y
# chromosomes should also start with 'chr'
if all(chr_name.startswith("chr") for chr_name in matching_chromosomes):
sex_chromosome_names += ["chrX", "chrY"]
mitochondrial_chr_name = "chrM"
###### Counts for mitochondrial reads
try:
mitochondrial_reads = total_nr_reads_per_chromosome.loc[:,mitochondrial_chr_name]
except KeyError:
mitochondrial_reads = 0
percentage_mitochondrial_reads = round(mitochondrial_reads / total_sum_of_reads * 100, 2)
###### Counts for ERCC reads
total_ercc_reads = total_nr_reads_per_chromosome.filter(regex=r"^ERCC").sum(axis=1)
percentage_ercc_reads = round(total_ercc_reads / total_sum_of_reads * 100, 2)
###### Counts for nuclear chromosomes
total_chromosomal_reads = total_nr_reads_per_chromosome.loc[:,matching_chromosomes].sum(axis=1)
percentage_chromosomal_reads = round(total_chromosomal_reads / total_sum_of_reads * 100, 2)
cols_to_add = {
"pctChrom": percentage_chromosomal_reads,
"pctMT": percentage_mitochondrial_reads,
"pctERCC": percentage_ercc_reads,
"SumReads": total_sum_of_reads,
"NumberOfGenes": total_nr_genes,
"NumberOfERCCReads": total_ercc_reads,
"NumberOfChromReads": total_chromosomal_reads,
"NumberOfMTReads": mitochondrial_reads,
}
total_nr_reads_per_chromosome = total_nr_reads_per_chromosome.assign(
**cols_to_add
)
total_nr_reads_per_chromosome.reset_index(names=INDEX_COL)\
.to_csv(par["nrReadsNrGenesPerChromPool"], sep="\t",
header=True, index=False, float_format="%g",
columns=tuple(INDEX_COL) + tuple(chromosome_names) + tuple(cols_to_add.keys())
)

View File

@@ -0,0 +1,174 @@
from uuid import uuid4
from textwrap import dedent
import pandas as pd
import pytest
import sys
### VIASH START
meta = {
"resources_dir": "./src/stats/generate_pool_statistics/",
"executable": "target/executable/stats/generate_pool_statistics/generate_pool_statistics",
"config": "src/stats/generate_pool_statistics/config.vsh.yaml"
}
### VIASH END
@pytest.fixture
def random_path(tmp_path):
def wrapper(extension=None):
extension = "" if not extension else f".{extension}"
return tmp_path / f"{uuid4()}{extension}"
return wrapper
@pytest.fixture
def random_tsv_path(random_path):
def wrapper():
return random_path(".tsv")
return wrapper
@pytest.fixture
def simple_input_file_one(random_tsv_path, request):
prefix = request.param
mito_name = f"{prefix}M{'T' if not prefix else ''}"
contents = dedent(
f"""\
WellBC WellID Chr NumberOfReads NumberOfGenes
AGG A1 {prefix}1 2 1
AGG A1 {prefix}2 3 2
AGG A1 {prefix}3 4 2
AGG A1 {mito_name} 4 2
AGG A1 {prefix}X 2 3
AGG A1 ERCC-1 1 1
AGG A1 ERCC-2 1 1
""")
output_file = random_tsv_path()
with output_file.open("w") as open_file:
open_file.write(contents)
return output_file
@pytest.fixture
def simple_input_file_two(random_tsv_path, request):
prefix = request.param
contents = dedent(
f"""\
WellBC WellID Chr NumberOfReads NumberOfGenes
CCC B2 {prefix}2 2 1
CCC B2 {prefix}3 3 2
CCC B2 {prefix}5 4 2
CCC B2 {prefix}1 4 2
CCC B2 {prefix}Y 2 3
CCC B2 {prefix}X 2 3
CCC B2 ERCC-3 1 1
CCC B2 ERCC-2 1 1
""")
output_file = random_tsv_path()
with output_file.open("w") as open_file:
open_file.write(contents)
return output_file
@pytest.mark.parametrize("simple_input_file_one,simple_input_file_two,expected", [("chr", "chr", "chr"), ("", "", "")],
indirect=["simple_input_file_one", "simple_input_file_two"])
def test_generate_pool_statistics_simple(run_component, simple_input_file_one,
simple_input_file_two, random_tsv_path, expected):
output_path = random_tsv_path()
run_component([
"--nrReadsNrGenesPerChrom", simple_input_file_one,
"--nrReadsNrGenesPerChrom", simple_input_file_two,
"--nrReadsNrGenesPerChromPool", output_path
])
mito_name = f"{expected}M{'T' if not expected else ''}"
expected_dict = {
"WellBC": ["AGG", "CCC"],
"WellID": ["A1", "B2"],
"ERCC-1": ["1", "0"],
"ERCC-2": ["1", "1"],
"ERCC-3": ["0", "1"],
f"{expected}1": ["2", "4"],
f"{expected}2": ["3", "2"],
f"{expected}3": ["4", "3"],
f"{expected}5": ["0", "4"],
f"{mito_name}": ["4", "0"],
f"{expected}X": ["2", "2"],
f"{expected}Y": ["0", "2"],
"SumReads": ["17", "19"],
"pctMT": ["23.53", "0"],
"pctERCC": ["11.76", "10.53"],
"pctChrom": ["52.94", "68.42"],
"NumberOfGenes": ["12", "15"],
"NumberOfMTReads": ["4", "0"],
"NumberOfChromReads": ["9", "13"],
"NumberOfERCCReads": ["2", "2"],
}
expected_frame = pd.DataFrame.from_dict(expected_dict, dtype=pd.StringDtype())
assert output_path.is_file()
contents = pd.read_csv(output_path, sep="\t", dtype=pd.StringDtype())
pd.testing.assert_frame_equal(contents, expected_frame, check_like=True)
def test_only_numerical_chromosomes(run_component, random_tsv_path):
"""
The chromosome column might be read as an integer instead of a string,
make sure that a numerical column only works.
"""
output_path = random_tsv_path()
contents1 = dedent(
f"""\
WellBC WellID Chr NumberOfReads NumberOfGenes
CCC B2 2 2 1
CCC B2 3 3 2
CCC B2 5 4 2
CCC B2 1 4 2
""")
input_file_1 = random_tsv_path()
with input_file_1.open("w") as open_file:
open_file.write(contents1)
contents2 = dedent(
f"""\
WellBC WellID Chr NumberOfReads NumberOfGenes
AGG A1 2 2 1
AGG A1 3 3 2
AGG A1 5 4 2
AGG A1 1 4 2
""")
input_file_2 = random_tsv_path()
with input_file_2.open("w") as open_file:
open_file.write(contents2)
output_path = random_tsv_path()
run_component([
"--nrReadsNrGenesPerChrom", input_file_1,
"--nrReadsNrGenesPerChrom", input_file_2,
"--nrReadsNrGenesPerChromPool", output_path
])
expected_dict = {
"WellBC": ["AGG", "CCC"],
"WellID": ["A1", "B2"],
"1": ["4", "4"],
"2": ["2", "2"],
"3": ["3", "3"],
"5": ["4", "4"],
"pctChrom": ["100", "100"],
"pctMT": ["0", "0"],
"pctERCC": ["0", "0"],
"SumReads": ["13", "13"],
"NumberOfGenes": ["7", "7"],
"NumberOfERCCReads": ["0", "0"],
"NumberOfChromReads": ["13", "13"],
"NumberOfMTReads": ["0", "0"],
}
expected_frame = pd.DataFrame.from_dict(expected_dict,
dtype=pd.StringDtype())
assert output_path.is_file()
contents = pd.read_csv(output_path, sep="\t", dtype=pd.StringDtype())
pd.testing.assert_frame_equal(contents, expected_frame, check_like=True)
if __name__ == '__main__':
sys.exit(pytest.main([__file__]))

View File

@@ -0,0 +1,102 @@
name: generate_well_statistics
namespace: "stats"
description: Generate summary statistics from BAM files generated by STAR solo.
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ author, maintainer ]
- __merge__: /src/base/authors/marijke_van_moerbeke.yaml
roles: [ contributor ]
argument_groups:
- name: "Arguments"
arguments:
- name: "--input"
type: file
description: "The .bam file as returned by the mapping tool STAR."
direction: input
example: "input.bam"
- name: "--barcode"
type: string
description: |
The barcode for the well that is being processed. Is only used to add a metadata
column to all output files.
required: true
- name: "--well_id"
type: string
description: |
ID of this well. Only used to add a metadata column to the output files.
required: true
- name: "--processedBAMFile"
type: file
description: |
Path to a .tsv file listing, per read in the BAM file,
the value for the "CB", "UX", "GX" and "GN" tag, together with the
chromsome to which the read was mapped to.
direction: output
default: processedBamFile.txt
- name: "--nrReadsNrGenesPerChrom"
type: file
description: |
Path to an output file that contains a .tsv formatted table describing
per chromosome the number of reads that were mapped to that chromosome (NumberOfReads
column) and the number of genes on that chromosome that had at least one
read mapped to it (NumberOfGenes).
default: nrReadsNrGenesPerChrom.txt
direction: output
- name: "--nrReadsNrUMIsPerCB"
type: file
description: |
Path to an output file that contains a .tsv formatted table describing
per barcode the number of UMI's (nrUMIs) and the total number of reads (NumberOfReads).
direction: output
default: nrReadsNrUMIsPerCB.txt
- name: "--umiFreqTop"
type: file
description: |
Path to an output file that contains a .tsv formatted table describing
per UMI (column UB) the frequency at which they occur in the reads (column
N). Only the top 100 UMIs are included.
default: umiFreqTop100.txt
direction: output
- name: "--threads"
type: integer
description: |
Number of threads to use for decompressing BAM files.
min: 1
default: 1
resources:
- type: python_script
path: script.py
test_resources:
- type: python_script
path: test.py
- path: test.sam
engines:
- type: docker
image: debian:stable-slim
setup:
- type: docker
env:
- PIP_BREAK_SYSTEM_PACKAGES=1
- HTSLIB_LIBRARY_DIR=/usr/lib/
- HTSLIB_INCLUDE_DIR=/usr/include/
- type: apt
packages:
- python3
- python3-pip
- python3-venv
- python-is-python3
- libhts-dev
- procps
- type: python
packages:
- pysam
- pandas
test_setup:
- type: python
packages:
- viashpy
runners:
- type: executable
- type: nextflow

View File

@@ -0,0 +1,77 @@
import pysam
import pandas as pd
import logging
### VIASH START
par = {
"input": "src/stats/generate_well_statistics/test.sam",
"processedBAMFile": "processedBamFile.txt",
"nrReadsNrGenesPerChrom": "nrReadsNrGenesPerChrom.txt",
"nrReadsNrUMIsPerCB": "nrReadsNrUMIsPerCB.txt",
"umiFreqTop": "umiFreqTop.txt",
"threads": 1,
"barcode": "ACGT"
}
### VIASH END
logger = logging.getLogger()
console_handler = logging.StreamHandler()
logger.addHandler(console_handler)
logger.setLevel(logging.DEBUG)
if __name__ == "__main__":
logger.info("Component started.")
parameters_str = [f'\t{param}: {param_val}\n' for param, param_val in par.items()]
logger.info("Parameters:\n%s", "".join(parameters_str).rstrip())
logger.info("Opening '%s'", par["input"])
samfile = pysam.AlignmentFile(par["input"], "rb", threads=par["threads"])
all_tags = []
index = []
tags_selection = ("CB", "UB", "GX", "GN")
for aligned_segment in samfile:
tags = dict(aligned_segment.get_tags())
all_tags.append(tags)
reference_name = aligned_segment.reference_name
index.append("*" if not reference_name else reference_name)
tag_dataframe = pd.DataFrame.from_records(all_tags, index=index,
columns=tags_selection)
tag_dataframe_to_write = tag_dataframe.copy()
logger.info("Done reading BAM file. Found %i entries", tag_dataframe.shape[0])
tag_dataframe.assign(WellBC=par["barcode"], WellID=par["well_id"])\
.reset_index(names="Chr")\
.to_csv(par["processedBAMFile"], sep="\t", na_rep="",
header=True, index=False,
columns=("WellBC", "WellID", "Chr") + tags_selection)
logger.info("Constructing of dataframe done.")
# Number of genes that had a read mapped to them per chromosome,
# and the number of reads mapped to those genes per chromosome.
nr_reads_nr_genes = tag_dataframe.dropna(subset=["GX"]).groupby(level=0).agg(
NumberOfReads=pd.NamedAgg("GX", aggfunc="size"),
NumberOfGenes=pd.NamedAgg(column="GX", aggfunc="nunique")
)
logger.info("Done calculating number of reads per gene and per chromesome. Writing to %s",
par['nrReadsNrGenesPerChrom'])
nr_reads_nr_genes.reset_index(names="Chr").assign(WellBC=par["barcode"], WellID=par["well_id"])\
.to_csv(par["nrReadsNrGenesPerChrom"], sep="\t",
header=True, index=False,
columns=("WellBC", "WellID", "Chr", "NumberOfReads", "NumberOfGenes"))
# Number of reads mapped to the reference, grouped by UMI
nr_read_per_umi = tag_dataframe.groupby('UB').size()\
.drop("", errors="ignore").sort_values(ascending=False).head(100)
nr_read_per_umi_df = nr_read_per_umi.to_frame(name="N")
logger.info("Done calculating number of mapped reads per UMI, writing to %s", par["umiFreqTop"])
nr_read_per_umi_df.assign(WellBC=par["barcode"], WellID=par["well_id"]).reset_index(names="UB")\
.to_csv(par["umiFreqTop"], header=True, sep="\t",
index=False, columns=("WellBC", "WellID", "UB", "N"))
# Total number of mapped reads and total number of UMIs (not grouped per chromosome)
nr_reads_and_umi_per_barcode = tag_dataframe.groupby(by="CB").agg(
NumberOfReads=pd.NamedAgg("CB", "size"),
nrUMIs=pd.NamedAgg("UB", "nunique")
)
logger.info("Done calculating number of mapped reads and number of UMIs per Cell Barcode, writing to %s",
par["nrReadsNrUMIsPerCB"])
nr_reads_and_umi_per_barcode.assign(WellBC=par["barcode"], WellID=par["well_id"]).reset_index(names="CB")\
.to_csv(par["nrReadsNrUMIsPerCB"], sep="\t", header=True,
index=False, columns=("WellBC", "WellID", "CB", "NumberOfReads", "nrUMIs"))
logger.info("Finished!")

View File

@@ -0,0 +1,111 @@
import sys
import pytest
import pysam
from uuid import uuid4
from pathlib import Path
from textwrap import dedent
### VIASH START
meta = {
"resources_dir": "./src/stats/generate_well_statistics/",
"executable": "target/executable/stats/generate_well_statistics/generate_well_statistics",
"config": "src/stats/generate_well_statistics/config.vsh.yaml"
}
### VIASH END
def assert_file_content_equals(file_to_check, expected):
with file_to_check.open('r') as open_file:
contents = open_file.read()
assert contents == expected
@pytest.fixture
def input_sam_path():
return Path(meta["resources_dir"]) / "test.sam"
@pytest.fixture
def random_path(tmp_path):
def wrapper(extension=None):
extension = "" if not extension else f".{extension}"
return tmp_path / f"{uuid4()}{extension}"
return wrapper
@pytest.fixture
def random_bam_path(random_path):
def wrapper():
return random_path(".bam")
return wrapper
@pytest.fixture
def sam_to_bam(random_bam_path):
def wrapper(sam_file):
out_path = random_bam_path()
with pysam.AlignmentFile(sam_file, "r") as infile, \
pysam.AlignmentFile(out_path, "wb", template=infile) as outfile:
for s in infile:
outfile.write(s)
infile.close()
return out_path
return wrapper
def test_generate_well_statistics_simple_bam(run_component, input_sam_path, sam_to_bam, random_path):
bam_file = sam_to_bam(input_sam_path)
processed_bam = random_path("tsv")
reads_per_chromosome = random_path("tsv")
nr_reads_nr_umis_per_cb = random_path("tsv")
top_onehundred_umis = random_path("tsv")
run_component([
"--input", bam_file,
"--processedBAMFile", processed_bam,
"--nrReadsNrGenesPerChrom", reads_per_chromosome,
"--nrReadsNrUMIsPerCB", nr_reads_nr_umis_per_cb,
"--umiFreqTop", top_onehundred_umis,
"--barcode", "ACGT",
"--well_id", "A1",
])
for file_path in (processed_bam, reads_per_chromosome,
nr_reads_nr_umis_per_cb, top_onehundred_umis):
assert file_path.is_file()
expected_processed_bam = \
dedent("""\
WellBC WellID Chr CB UB GX GN
ACGT A1 1 ACA CGG gene1 gene1
ACGT A1 1 ACA CGG gene1 gene1
ACGT A1 2 GGG GTT gene2 gene2
ACGT A1 2 GGG GTC gene3 gene3
""")
expected_reads_per_chromosome = \
dedent("""\
WellBC WellID Chr NumberOfReads NumberOfGenes
ACGT A1 1 2 1
ACGT A1 2 2 2
""")
expected_nr_reads_nr_umis_per_cb = \
dedent("""\
WellBC WellID CB NumberOfReads nrUMIs
ACGT A1 ACA 2 1
ACGT A1 GGG 2 2
""")
expected_top_onehundred_umis = \
dedent("""\
WellBC WellID UB N
ACGT A1 CGG 2
ACGT A1 GTC 1
ACGT A1 GTT 1
""")
assert_file_content_equals(processed_bam, expected_processed_bam)
assert_file_content_equals(reads_per_chromosome, expected_reads_per_chromosome)
assert_file_content_equals(nr_reads_nr_umis_per_cb, expected_nr_reads_nr_umis_per_cb)
assert_file_content_equals(top_onehundred_umis, expected_top_onehundred_umis)
if __name__ == '__main__':
sys.exit(pytest.main([__file__]))

View File

@@ -0,0 +1,7 @@
@HD VN:1.4 SO:coordinate
@SQ SN:1 LN:200
@SQ SN:2 LN:50
test_1 16 1 22 255 1M * 0 0 C I NH:i:1 HI:i:1 nM:i:0 AS:i:47 CR:Z:ACA UR:Z:CGG GX:Z:gene1 GN:Z:gene1 CB:Z:ACA UB:Z:CGG
test_2 16 1 22 255 1M * 0 0 G ! NH:i:1 HI:i:1 nM:i:0 AS:i:47 CR:Z:ACA UR:Z:CGG GX:Z:gene1 GN:Z:gene1 CB:Z:ACA UB:Z:CGG
test_3 0 2 40 255 1M * 0 0 T ! NH:i:1 HI:i:1 nM:i:0 AS:i:47 CR:Z:GGG UR:Z:GTT GX:Z:gene2 GN:Z:gene2 CB:Z:GGG UB:Z:GTT
test_4 0 2 60 255 1M * 0 0 C ! NH:i:1 HI:i:1 nM:i:0 AS:i:47 CR:Z:GGG UR:Z:GTC GX:Z:gene3 GN:Z:gene3 CB:Z:GGG UB:Z:GTC

View File

@@ -0,0 +1,37 @@
name: listInputDir
namespace: utils
description: List the contents of a directory and parse contained fastq files
arguments:
- name: "--input"
alternatives: [-i]
type: file
description: Path to the sample
required: true
example: input.fastq.gz
- name: "--r1"
type: file
description: Path to read 1 fastq/fasta file
direction: output
- name: "--r2"
type: file
description: Path to read 2 fastq/fasta file
direction: output
- name: "--lane"
type: string
description: Lane nr
direction: output
- name: "--sample"
type: string
description: Sample nr
direction: output
resources:
- type: nextflow_script
path: main.nf
entrypoint: run_wf
runners:
- type: nextflow
engines:
- type: native

View File

@@ -0,0 +1,56 @@
workflow run_wf {
take: in_
main:
out_ = in_
| flatMap{ id, state ->
println "Looking for fastq files in ${state.input}"
def allFastqs = state.input
.listFiles()
.findAll{
it.isFile() &&
it.name ==~ /^.+\.fastq.gz$|^.+\.fastq$|^.+\.fasta$/
}
println "Found ${allFastqs.size()} fastq/fasta files in ${state.input}"
assert allFastqs.size() > 0: "No fastq/fasta files found"
println("Extracting information from fastq/fasta filenames")
def processed_fastqs = allFastqs.collect { f ->
def regex = ~/^(\w+)_S(\d+)_(L(\d+)_)?R(\d)_(\d+)\.fast[qa](\.gz)?$/
def validFastq = f.name ==~ regex
assert validFastq: "${f} does not match the regex ${regex}"
def parsedFastq = f.name =~ regex
return [
fastq: f,
sample_id: parsedFastq[0][1],
sample: parsedFastq[0][2],
lane: parsedFastq[0][3],
read: parsedFastq[0][5],
]
}
println("Group paired fastq/fasta files")
def grouped = processed_fastqs
.groupBy({it.sample_id})
.collect{ k, vs ->
def r1 = vs.find{it.read == "1"}
def r2 = vs.find{it.read == "2"}
def newState = [
r1: r1.fastq,
r2: r2.fastq
]
[ k, newState + vs[0].findAll{ it.key in ["sample", "lane"] } ]
}
grouped
.collect{ [ it[0], it[1] + [ _meta: [ join_id: id ] ] ] }
}
emit: out_
}

View File

@@ -0,0 +1,132 @@
name: htrnaseq
namespace: workflows
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ maintainer ]
argument_groups:
- name: Input arguments
arguments:
- name: --input_r1
description: |
Forward reads in FASTQ format. Multiple files can be provided which will
be demultiplexed separately before joining the results for each individual well.
type: file
required: true
multiple: true
- name: --input_r2
description: |
Reverse reads in FASTQ format. Multiple files can be provided which will
be demultiplexed separately before joining the results for each individual well.
type: file
required: true
multiple: true
- name: --barcodesFasta
type: file
required: true
- name: "--umi_length"
description: |
Length of the UMI sequences
type: integer
min: 1
default: 10
- name: --genomeDir
type: file
required: true
- name: --annotation
type: file
required: true
- name: Output arguments
arguments:
- name: --fastq_output_r1
description: List of demultiplexed fastq files
type: file
direction: output
multiple: true
required: true
default: "fastq/*_R1_001.fastq"
- name: --fastq_output_r2
description: List of demultiplexed fastq files
type: file
direction: output
multiple: true
required: true
default: "fastq/*_R2_001.fastq"
- name: --star_output
description: Output from mapping with STAR
type: file
direction: output
multiple: true
required: true
default: star.$id/*
- name: "--nrReadsNrGenesPerChrom"
type: file
direction: output
required: true
default: "nrReadsNrGenesPerChrom.$id.txt"
- name: "--star_qc_metrics"
type: file
direction: output
required: true
default: "starLogs.$id.txt"
- name: "--eset"
type: file
direction: output
required: true
default: eset.$id.rds
- name: "--f_data"
type: file
direction: output
required: true
default: fData.$id.tsv
- name: "--p_data"
type: file
direction: output
required: true
default: pData.$id.tsv
- name: "--html_report"
type: file
direction: output
required: true
default: report.$id.html
resources:
- type: nextflow_script
path: main.nf
entrypoint: run_wf
test_resources:
- type: nextflow_script
path: test.nf
entrypoint: test_wf
dependencies:
- name: stats/combine_star_logs
repository: local
- name: stats/generate_pool_statistics
repository: local
- name: stats/generate_well_statistics
repository: local
- name: workflows/well_demultiplex
repository: local
- name: workflows/parallel_map_wf
repository: local
- name: workflows/utils/groupWells
repository: local
- name: eset/create_eset
repository: local
- name: eset/create_fdata
repository: local
- name: eset/create_pdata
repository: local
- name: report/create_report
repository: local
repositories:
- name: local
type: local
- name: bb
type: vsh
repo: biobox
tag: v0.1.0
runners:
- type: nextflow
engines:
- type: native

View File

@@ -0,0 +1,21 @@
#!/bin/bash
# get the root of the directory
REPO_ROOT=$(git rev-parse --show-toplevel)
# ensure that the command below is run from the root of the repository
cd "$REPO_ROOT"
# Make sure the workflow is built
viash ns build --setup cb --parallel
export NXF_VER=24.04.4
nextflow \
run . \
-main-script src/workflows/htrnaseq/test.nf \
-config ./src/config/labels.config \
-entry test_wf \
-resume \
-profile docker,local \
--publish_dir output

View File

@@ -0,0 +1,234 @@
workflow run_wf {
take:
input_ch
main:
// The featureData only has one requirement: the genome annotation.
// It can be generated straight away.
f_data_ch = input_ch
| create_fdata.run(
directives: [label: ["lowmem", "lowcpu"]],
fromState: [
"gtf": "annotation",
"output": "f_data"
],
toState: {id, result, state -> ["f_data": result.output]}
)
// Perform mapping of each well. The input here are events per pool,
// the output channel is one event per well.
mapping_ch = input_ch
| well_demultiplex.run(
fromState: [
"input_r1": "input_r1",
"input_r2": "input_r2",
"barcodesFasta": "barcodesFasta",
],
toState: { id, result, state ->
def filtered_input = state.findAll{!["input_r1", "input_r2"].contains(it.key)}
def filtered_results = result.findAll{!["output_r1", "output_r2"].contains(it.key)}
def new_state = filtered_input + filtered_results + [
"fastq_output_r1": result.output_r1,
"fastq_output_r2": result.output_r2,
]
return new_state
}
)
| parallel_map_wf.run(
fromState: {id, state ->
[
"input_r1": state.fastq_output_r1[0],
"input_r2": state.fastq_output_r2[0],
"barcode": state.barcode,
"umi_length": state.umi_length,
"pool": state.pool,
"output": state.star_output[0],
"genomeDir": state.genomeDir,
]
},
toState: ["star_output": "output"]
)
// From the mapped wells, create statistics based on the BAM file
// and join the events back to pool level.
pool_ch = mapping_ch
| generate_well_statistics.run(
directives: [label: ["verylowmem", "verylowcpu"]],
fromState: { id, state ->
[
"input": state.star_output.resolve('Aligned.sortedByCoord.out.bam'),
"barcode": state.barcode,
"well_id": state.well_id,
]
},
toState: [
"nrReadsNrGenesPerChromWell": "nrReadsNrGenesPerChrom",
]
)
| map {id, state ->
// Create a special groupKey, such that groupTuple
// knows when all the barcodes have been grouped into 1 event.
// This way the processing is as distributed as possible.
def key = groupKey(state.pool, state.n_wells)
def newEvent = [key, state]
return newEvent
}
// Use a custom sorting function because sort: 'hash'
// requires a hash to be calculated on every entry of the state
// This is inefficient when the number of events is large
// (i.e large number or barcodes).
// Sorting on lexographical order of the barcode is sufficient here.
| groupTuple(sort: {a, b -> a.barcode <=> b.barcode})
| map {id, states ->
// Gather the keys from all states. for some state items,
// we need gather all the different items from across the states
def barcodes = states.collect{it.barcode}
assert barcodes.clone().unique().size() == barcodes.size(), \
"Error when gathering information for pool ${id}, barcodes are not unique!"
def well_ids = states.collect{it.well_id}
assert well_ids.clone().unique().size() == well_ids.size(), \
"Error when gathering information for pool ${id}, well IDs are not unique!"
def custom_state = [
"fastq_output_r1": states.collect{it.fastq_output_r1[0]},
"fastq_output_r2": states.collect{it.fastq_output_r2[0]},
"barcode": barcodes,
"well_id": well_ids,
"star_output": states.collect{it.star_output},
// Well and pool stats should be carefully kept separate.
// The workflow argument points to the name for the pool statistics:
"nrReadsNrGenesPerChromWell": states.collect{it.nrReadsNrGenesPerChromWell},
"nrReadsNrGenesPerChromPool": states[0].nrReadsNrGenesPerChrom
]
//For many state items, the value is the same across states.
def other_state_keys = states.inject([].toSet()){ current_keys, state ->
def new_keys = current_keys + state.keySet()
return new_keys
}.minus(custom_state.keySet())
// All other state should have a unique value
def old_state_items = other_state_keys.inject([:]){ old_state, argument_name ->
argument_values = states.collect{it.get(argument_name)}.unique()
assert argument_values.size() == 1, "Arguments should be the same across modalities. Please report this \
as a bug. Argument name: $argument_name, \
argument value: $argument_values"
def argument_value
argument_values.each { argument_value = it }
def current_state = old_state + [(argument_name): argument_value]
return current_state
}
def new_state = custom_state + old_state_items
[id.getGroupTarget(), new_state]
}
// The well statistics are merged on pool level.
pool_statistics_ch = pool_ch
| generate_pool_statistics.run(
directives: ["label": ["lowmem", "verylowcpu"]],
fromState: [
"nrReadsNrGenesPerChrom": "nrReadsNrGenesPerChromWell",
"nrReadsNrGenesPerChromPool": "nrReadsNrGenesPerChromPool"
],
toState: [
"nrReadsNrGenesPerChromPool": "nrReadsNrGenesPerChromPool"
]
)
// The statistics from the STAR logs of different wells are joined
// on pool level
star_logs_ch = pool_ch
| combine_star_logs.run(
directives: ["label": ["lowmem", "verylowcpu"]],
fromState: {id, state -> [
"star_logs": state.star_output.collect{it.resolve("Log.final.out")},
"gene_summary_logs": state.star_output.collect{it.resolve("Solo.out/Gene/Summary.csv")},
"reads_per_gene_logs": state.star_output.collect{it.resolve("ReadsPerGene.out.tab")},
"barcodes": state.barcode,
"output": state.star_qc_metrics
]
},
toState: [
"star_qc_metrics": "output",
]
)
p_data_ch = star_logs_ch.join(pool_statistics_ch, remainder: true)
| map {id, star_logs_state, pool_statistics_state ->
def newState = star_logs_state + ["nrReadsNrGenesPerChromPool": pool_statistics_state.nrReadsNrGenesPerChromPool]
return [id, newState]
}
| create_pdata.run(
directives: [label: ["lowmem", "lowcpu"]],
fromState: [
"star_stats_file": "star_qc_metrics",
"nrReadsNrGenesPerChromPool": "nrReadsNrGenesPerChromPool",
"output": "p_data"
],
toState: ["p_data": "output"],
)
eset_ch = p_data_ch.join(f_data_ch, remainder: true)
| map {id, p_data_state, f_data_state ->
def newState = p_data_state + ["f_data": f_data_state["f_data"]]
[id, newState]
}
| create_eset.run(
directives: [label: ["lowmem", "lowcpu"]],
fromState: [
"pDataFile": "p_data",
"fDataFile": "f_data",
"mappingDir": "star_output",
"output": "eset",
"barcodes": "barcode",
"poolName": "pool",
],
toState: [
"eset": "output",
]
)
report_channel = eset_ch
| toSortedList()
| map {ids_and_states ->
def states = ids_and_states.collect{it[1]}
def html_report = states[0].html_report
def ids = ids_and_states.collect{it[0]}
def esets = states.collect{it.eset}
["report", ["esets": esets, "html_report": html_report, "original_ids": ids]]
}
| create_report.run(
fromState: [
"eset": "esets",
"output_report": "html_report",
],
toState: [
"html_report": "output_report"
]
)
| flatMap {id, state ->
state.original_ids.collect{original_id ->
[original_id, ["html_report": state.html_report]]
}
}
output_ch = eset_ch.join(report_channel)
| map {id, state_eset, state_report ->
def new_state = state_eset + ["html_report": state_report.html_report]
[id, new_state]
}
| setState([
"star_output": "star_output",
"fastq_output_r1": "fastq_output_r1",
"fastq_output_r2": "fastq_output_r2",
"star_output": "star_output",
"nrReadsNrGenesPerChrom": "nrReadsNrGenesPerChromPool",
"star_qc_metrics": "star_qc_metrics",
"eset": "eset",
"f_data": "f_data",
"p_data": "p_data",
"html_report": "html_report",
])
emit:
output_ch
}

View File

@@ -0,0 +1,8 @@
params {
rootDir = java.nio.file.Paths.get("$projectDir/../../../").toAbsolutePath().normalize().toString()
}
// include common settings
includeConfig("${params.rootDir}/src/config/labels.config")

View File

@@ -0,0 +1,45 @@
nextflow.enable.dsl=2
targetDir = params.rootDir + "/target/nextflow"
include { htrnaseq } from targetDir + "/workflows/htrnaseq/main.nf"
include { check_eset } from targetDir + "/integration_test_components/htrnaseq/check_eset/main.nf"
params.resources_test = "gs://viash-hub-test-data/htrnaseq/v1/"
workflow test_wf {
resources_test_file = file(params.resources_test)
input_ch = Channel.fromList([
[
id: "sample_one",
input_r1: resources_test_file.resolve("100k/SRR14730301/VH02001612_S9_R1_001.fastq"),
input_r2: resources_test_file.resolve("100k/SRR14730301/VH02001612_S9_R2_001.fastq"),
genomeDir: resources_test_file.resolve("genomeDir/gencode.v41.star.sparse"),
barcodesFasta: resources_test_file.resolve("360-wells-with-ids.fasta"),
annotation: resources_test_file.resolve("genomeDir/gencode.v41.annotation.gtf.gz")
],
[
id: "sample_two",
input_r1: resources_test_file.resolve("100k/SRR14730302/VH02001614_S8_R1_001.fastq"),
input_r2: resources_test_file.resolve("100k/SRR14730302/VH02001614_S8_R2_001.fastq"),
genomeDir: resources_test_file.resolve("genomeDir/gencode.v41.star.sparse"),
barcodesFasta: resources_test_file.resolve("360-wells-with-ids.fasta"),
annotation: resources_test_file.resolve("genomeDir/gencode.v41.annotation.gtf.gz")
]
])
| map{ state -> [state.id, state] }
| view { "Input: $it" }
| htrnaseq.run(
toState: [
"eset": "eset",
"star_output": "star_output",
]
)
| check_eset.run(
runIf: {id, state -> id == "sample_one"},
toState: [
"eset": "eset",
"star_output": "star_output"
]
)
}

View File

@@ -0,0 +1,63 @@
name: parallel_map_wf
namespace: workflows
description: |
Map RNA sequencing data, provided as fastq files (paired-end) to a reference genome using STAR Solo.
Input data must have been demultiplexed beforehand, meaning that a single fastq pair provides data for
one barcode (one well). Multiple wells can be mapped in parallel by providing multiple events to the
workflow. Output is provided as mapped output per pool, i.e. one output is provided per pool.
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ maintainer ]
argument_groups:
- name: "Arguments"
arguments:
- name: "--input_r1"
type: file
direction: input
required: true
- name: "--input_r2"
type: file
direction: input
required: true
- name: "--barcode"
type: string
required: true
- name: "--umi_length"
type: integer
min: 1
- name: "--pool"
type: string
required: true
- name: "--genomeDir"
type: file
required: true
direction: input
- name: "--output"
type: file
direction: output
required: true
resources:
- type: nextflow_script
path: main.nf
entrypoint: run_wf
# test_resources:
# - type: nextflow_script
# path: test.nf
# entrypoint: test_wf
dependencies:
- name: parallel_map
repository: local
- name: workflows/utils/groupWells
repository: local
repositories:
- name: local
type: local
runners:
- type: nextflow
engines:
- type: native

View File

@@ -0,0 +1,73 @@
workflow run_wf {
take:
input_ch
main:
pool_ch = input_ch
| groupWells.run(
fromState: [
"input_r1": "input_r1",
"input_r2": "input_r2",
"well": "barcode",
"pool": "pool",
],
toState: [
"wells": "wells",
"input_r1": "output_r1",
"input_r2": "output_r2",
]
)
| parallel_map.run(
fromState: { id, state ->
[
"input_r1": state.input_r1,
"input_r2": state.input_r2,
"genomeDir": state.genomeDir,
"barcodes": state.wells,
"pool": state.pool,
"umiLength": state.umi_length,
"output": state.output,
]
},
toState: ["output": "output"],
directives: ["label": ["highmem", "lowcpu"]],
)
| setState(["output", "pool"])
// input_ch is on pool level, while parallel_map
// outputs multiple events per pool.
// Join the results back to pool level
input_join_ch = input_ch
| map {id, state ->
def newEvent = [state.pool, id, state]
return newEvent
}
output_ch = input_join_ch.combine(pool_ch, by: 0)
| map {pool, well_id, state_well, state_pool ->
def well_output = state_pool.output.findAll{star_output_dir ->
def barcodes_list = []
// Get the barcode from the STAR file.
// One STAR output contains the results for one
// well barcode. We can look for the barcode in
// the 'Solo.out/Gene/raw/barcode.tsv' file.
def barcodes_files = files("${star_output_dir}/Solo.out/Gene/raw/barcodes.tsv")
assert barcodes_files.size() == 1, \
"Exactly one file should have matched the barcodes files (found: $barcodes_files)."
def barcode
barcodes_files.each{ it ->
assert it.countLines() == 1,
"Expected only one barcode in a single STAR output."
barcode = it.text.trim()
}
return barcode == state_well.barcode
}
assert well_output.size() == 1, \
"Two or more outputs from the mapping seemed to have processed barcode '$barcode'."
[well_id, ["output": well_output[0]]]
}
emit:
output_ch
}

View File

@@ -0,0 +1,68 @@
name: runner
namespace: workflows
description: Runner for HT RNA-seq pipeline
argument_groups:
- name: Input arguments
arguments:
- name: --input
description: Base directory of the form `s3:/<bucket>/Sequencing/<Sequencer>/<RunID>/<demultiplex_dir>`
type: file
required: true
- name: --barcodesFasta
type: file
required: true
- name: --genomeDir
type: file
required: true
- name: --annotation
type: file
required: true
- name: Metadata arguments
arguments:
- name: --id
description: Unique identifier for the run
type: string
- name: --project_id
description: Project ID
type: string
required: true
- name: --experiment_id
description: Experiment ID
type: string
required: true
- name: Annotation flags
arguments:
- name: --plain_output
description: |
Flag to indicate that the output should be stored directly under $publish_dir rather than
under a subdirectory structure runID/<date_time>_demultiplex_<version>/.
type: boolean_true
- name: Publish arguments
arguments:
- name: --fastq_publish_dir
type: string
required: true
- name: --results_publish_dir
type: string
required: true
resources:
- type: nextflow_script
path: main.nf
entrypoint: run_wf
dependencies:
- name: utils/listInputDir
repository: local
- name: workflows/htrnaseq
repository: local
- name: io/publish_fastqs
repository: local
- name: io/publish_results
repository: local
runners:
- type: nextflow
engines:
- type: native

View File

@@ -0,0 +1,187 @@
def date = new Date().format('yyyyMMdd_hhmmss')
def viash_config = java.nio.file.Paths.get("$projectDir/../../../../").toAbsolutePath().normalize().toString() + "/_viash.yaml"
def version = get_version(viash_config)
workflow run_wf {
take:
input_ch
main:
output_ch = input_ch
// Pass the original ID in the state to pick it up later
| map{ id, state -> [ id, state + [ run_id: id ] ] }
| listInputDir.run(
fromState: [ input: "input" ],
toState: { id, state, result ->
def clean_state = state.findAll{ it.key != "input" }
clean_state + result
}
)
| htrnaseq.run(
args: [
f_data: 'fData/$id.txt',
p_data: 'pData/$id.txt',
star_output: 'star_output/$id/*',
fastq_output_r1: 'fastq/*_R1_001.fastq',
fastq_output_r2: 'fastq/*_R1_001.fastq',
eset: 'esets/$id.rds',
nrReadsNrGenesPerChrom: 'nrReadsNrGenesPerChrom/$id.txt',
star_qc_metrics: 'starLogs/$id.txt',
html_report: "report.html"
],
fromState: [
input_r1: "r1",
input_r2: "r2",
barcodesFasta: "barcodesFasta",
genomeDir: "genomeDir",
annotation: "annotation",
],
toState: { id, result, state -> state + result }
)
// The HT-RNAseq workflow outputs multiple events, one per 'pool' (usually a plate)
// but for publishing the results, this is not handy because we want to use the $id
// variable as a pointer to the target data.
//
// So, we should combine everything together
//
// project_id / experiment_id / date_workflow
| toSortedList
| map{ vs ->
def all_fastqs
[
vs[0][1].run_id, // The original ID
[
star_output: reduce_paths(vs.collect{ it[1].star_output }.flatten()),
fastq_output_r1: reduce_paths(vs.collect{ it[1].fastq_output_r1 }.flatten(), 1),
fastq_output_r2: reduce_paths(vs.collect{ it[1].fastq_output_r2 }.flatten(), 1),
nrReadsNrGenesPerChrom: reduce_paths(vs.collect{ it[1].nrReadsNrGenesPerChrom }),
star_qc_metrics: reduce_paths(vs.collect{ it[1].star_qc_metrics }),
eset: reduce_paths(vs.collect{ it[1].eset }),
f_data: reduce_paths(vs.collect{ it[1].f_data }),
p_data: reduce_paths(vs.collect{ it[1].p_data }),
html_report: vs.collect{ it[1].html_report }[0], // The report is for all pools
plain_output: vs.collect{ it[1].plain_output }[0],
project_id: vs.collect{ it[1].project_id }[0],
experiment_id: vs.collect{ it[1].experiment_id }[0]
]
]
}
| publish_results.run(
fromState: { id, state ->
def project = (state.plain_output) ? id : "${state.project_id}"
def experiment = (state.plain_output) ? id : "${state.experiment_id}"
def id0 = "${project}/${experiment}"
def id1 = (state.plain_output) ? id : "${id0}/${date}"
def id2 = (state.plain_output) ? id : "${id1}_htrnaseq_${version}"
if (id == id2) {
println("Publising results to ${params.results_publish_dir}")
} else {
println("Publising results to ${params.results_publish_dir}/${id2}")
}
[
star_output: state.star_output,
star_output: state.star_output,
nrReadsNrGenesPerChrom: state.nrReadsNrGenesPerChrom,
star_qc_metrics: state.star_qc_metrics,
eset: state.eset,
f_data: state.f_data,
p_data: state.p_data,
html_report: state.html_report,
output: "${id2}"
]
},
toState: { id, result, state -> state },
directives: [
publishDir: [
path: "${params.results_publish_dir}",
overwrite: false,
mode: "copy"
]
]
)
| publish_fastqs.run(
fromState: { id, state ->
def id0 = "${id}"
def id1 = (state.plain_output) ? id : "${id0}/${date}"
def id2 = (state.plain_output) ? id : "${id1}_htrnaseq_${version}"
println(state.plain_output)
if (id == id2) {
println("Publising fastqs to ${params.fastq_publish_dir}")
} else {
println("Publising fastqs to ${params.fastq_publish_dir}/${id2}")
}
[
input_r1: state.fastq_output_r1,
input_r2: state.fastq_output_r2,
output: "${id2}",
]
},
toState: { id, result, state -> state },
directives: [
publishDir: [
path: "${params.fastq_publish_dir}",
overwrite: false,
mode: "copy"
]
]
)
emit:
output_ch
| map{ id, state -> [ id, [ _meta: [ join_id: state.run_id ] ] ] }
}
def get_version(inputFile) {
def yamlSlurper = new groovy.yaml.YamlSlurper()
def loaded_viash_config = yamlSlurper.parse(file(inputFile))
def version = (loaded_viash_config.version) ? loaded_viash_config.version : "unknown_version"
println("HT-RNAseq version to be used: ${version}")
return version
}
/*
* This function uses a heuristic to group a list of paths so that the level of nesting
* of IDs is represented in the output.
*
* We iterative of the path sections (subfolders) from the last (file) the first (root node).
* The first path segment that is common across all 'events' is the cutoff. We cutoff the paths
* at this level, select the unique elements from the list and use that as input for the next step.
*
* An optional offset allows one to shift the cutoff left or right.
*/
def reduce_paths(paths, offset = 0) {
def path_length = paths.collect{ it.getNameCount() }[0]
def unique_list = (path_length-1..0).collectEntries { i ->
[ (i): paths.collect{ it.getName(i) }.unique().size() ]
}
def cutoff = unique_list.find{ it.value == 1 }.key
def grouped_paths = paths.collect{ f -> "/" + f.subpath(0, cutoff+1+offset) }.unique()
println("")
println("Detecting the common path section to pass to the next step:")
print(" From: ")
print paths
println("")
print(" To: ")
print grouped_paths
println("")
return grouped_paths
}

View File

@@ -0,0 +1,12 @@
manifest {
nextflowVersion = '!>=20.12.1-edge'
}
process {
withName: publishStatesProc {
publishDir = [ enabled: false ]
}
}
// include common settings
includeConfig("${params.rootDir}/src/config/labels.config")

View File

@@ -0,0 +1,56 @@
name: groupWells
namespace: workflows/utils
description: |
N/A
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: "--well"
type: string
description: Barcode identifier for a well
required: true
example: barcode_1
- name: "--pool"
type: string
description: Identifier of the pool
required: true
example: pool_1
- name: "--input_r1"
type: file
description: Path to the input for R1
required: true
example: input.fastq.gz
- name: "--input_r2"
type: file
description: Path to the input for R1
required: true
example: input.fastq.gz
- name: Output
arguments:
- name: "--wells"
type: string
description: List of grouped wells (by means of barcodes)
multiple: true
direction: output
example: input.fastq.gz
- name: "--output_r1"
type: file
description: Path to output for R2
multiple: true
direction: output
- name: "--output_r2"
type: file
description: Path to the output for R2
multiple: true
direction: output
resources:
- type: nextflow_script
path: main.nf
entrypoint: run_wf
runners:
- type: nextflow

View File

@@ -0,0 +1,25 @@
workflow run_wf {
take: in_
main:
out_ = in_
| map{ id, state -> [state.pool, state, id]}
| groupTuple(sort: "hash")
| map{ new_id, inputs, original_ids ->
[
new_id,
[
output_r1: inputs.collect{it.input_r1},
output_r2: inputs.collect{it.input_r2},
wells: inputs.collect{it.well},
_meta: [ join_id: original_ids[0] ]
]
]
}
emit: out_
}

View File

@@ -0,0 +1,99 @@
name: well_demultiplex
namespace: workflows
description: Demultiplexing on well level
authors:
- __merge__: /src/base/authors/dries_schaumont.yaml
roles: [ maintainer ]
- __merge__: /src/base/authors/marijke_van_moerbeke.yaml
roles: [ contributor ]
argument_groups:
- name: Input arguments
arguments:
- name: --input_r1
description: |
Forward reads in FASTQ format. Multiple files can be provided which will
be demultiplexed separately before joining the results for each individual well.
type: file
required: true
multiple: true
- name: --input_r2
description: |
Reverse reads in FASTQ format. Multiple files can be provided which will
be demultiplexed separately before joining the results for each individual well.
type: file
required: true
multiple: true
- name: --barcodesFasta
type: file
required: true
- name: Output arguments
arguments:
- name: --output_r1
description: List of demultiplexed fastq files
type: file
direction: output
multiple: true
required: true
default: "fastq/*_R1_001.fastq"
- name: "--output_r2"
description: List of demultiplexed fastq files
type: file
direction: output
multiple: true
required: true
default: "fastq/*_R2_001.fastq"
- name: "--pool"
type: string
description: The original pool / sample name
direction: output
- name: "--well_id"
type: string
direction: output
- name: "--barcode"
type: string
direction: output
- name: "--lane"
type: string
direction: output
- name: "--pair_end"
type: string
direction: output
- name: "--n_wells"
type: integer
direction: output
description: The number of wells in the pool is well is a part of.
resources:
- type: nextflow_script
path: main.nf
entrypoint: run_wf
# Test dataset: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM5357044
test_resources:
- type: nextflow_script
path: test.nf
entrypoint: test_wf
- type: nextflow_script
path: test.nf
entrypoint: test_wf2
dependencies:
- name: cutadapt
repository: bb
- name: concat_text
repository: cb
repositories:
- name: bb
type: vsh
repo: biobox
tag: v0.3.0
- name: cb
type: vsh
repo: craftbox
tag: v0.1.0
runners:
- type: nextflow
engines:
- type: native

View File

@@ -0,0 +1,32 @@
#!/bin/bash
# get the root of the directory
REPO_ROOT=$(git rev-parse --show-toplevel)
# ensure that the command below is run from the root of the repository
cd "$REPO_ROOT"
# Make sure the workflow is built
viash ns build --setup cb --parallel
export NXF_VER=24.04.4
nextflow \
run . \
-main-script src/workflows/well_demultiplex/test.nf \
-config ./src/config/labels.config \
-entry test_wf \
-resume \
-profile docker,local \
--publish_dir output
nextflow \
run . \
-main-script src/workflows/well_demultiplex/test.nf \
-config ./src/config/labels.config \
-entry test_wf2 \
-resume \
-profile docker,local \
--publish_dir output_2 \

View File

@@ -0,0 +1,268 @@
workflow run_wf {
take:
input_ch
main:
output_ch = input_ch
/*
Parse the fasta file containing the barcodes and do the following:
- The sequence headers must not contain any whitespaces
- The headers (Well IDs) must be unique
- The barcodes must be unique
- Store the number of barcodes in the state
- Add a barcode to well ID (header) mapping to the state,
in order to be able to retreive the well ID based on the FASTQ name after well demultiplexing
*/
| map {id, state ->
def n_wells = state.barcodesFasta.countFasta() as int
// The header is the full header, the id is the part header up to the first whitespace character
// We do not allow whitespace in the header of the fasta file, so assert this.
def fasta_entries = state.barcodesFasta.splitFasta(
record: ["id": true, "header": true, "seqString": true]
)
assert fasta_entries.every{it.id == it.header}, \
"The barcodes FASTA headers must not contain any whitespace!"
// Check if the fasta headers are unique
def fasta_ids = fasta_entries.collect{it.id}
assert fasta_ids.clone().unique() == fasta_ids, \
"The barcodes FASTA entries must have a unique name!"
// Check if the sequences are unique
def fasta_sequences = fasta_entries.collect{it.seqString}
assert fasta_sequences.clone().unique() == fasta_sequences, \
"The barcodes FASTA sequences must be unique!"
def well_id_matcher = /^([A-Za-z]+)0*([1-9]?[0-9]+)$/
def entries_corrected_id = fasta_entries.collectEntries { it ->
def unformatted_id = it.header
def id_matched_to_format = unformatted_id =~ well_id_matcher
assert (id_matched_to_format && id_matched_to_format.getCount() == 1), \
"The FASTA headers must match the coordinate system of a well plate (e.g. A01, B01, ... or AA1, AB1, ...). Found: ${unformatted_id}"
def id_letters = id_matched_to_format[0][1].toUpperCase()
def id_numbers = id_matched_to_format[0][2]
["${id_letters}${id_numbers}", it.seqString]
}
def newState = state + [
"n_wells": n_wells,
"well_id_barcode_mapping": entries_corrected_id,
]
[id, newState]
}
/*
For each pool (i.e. event) in the channel, a list of R1 and R2 input
reads is provided which correspond to the lanes. If there are multiple lanes,
we can demultiplex into the wells for each lane in parallel. Therefore, cutadapt
must be started multiple times and we need an event per lane. The events are
created by taking the R1 and R2 pairs from the input lists. The index of the elements
in these lists are added to the ID in order to make them unique.
*/
| flatMap {id, state ->
assert state.input_r1.size() == state.input_r2.size(), \
"Expected equal number of inputs for R1 and R2"
// Store the number of lanes that were encountered here in order to
// group them together in an asynchronous manner later by providing
// the expected number of events to be grouped to groupTuple.
// see https://www.nextflow.io/docs/latest/reference/operator.html#grouptuple
def n_lanes = state.input_r1.size()
[state.input_r1, state.input_r2].transpose().withIndex().collect{ input_pair, index ->
def single_input_r1 = input_pair[0]
def single_input_r2 = input_pair[1]
def newState = state + ["input_r1": single_input_r1,
"input_r2": single_input_r2,
"pool": id,
"lane_sorting": index,
"n_lanes": n_lanes]
def newId = id + "_" + index
[newId, newState]
}
}
| cutadapt.run(
directives: [label: ["highmem", "midcpu"]],
fromState: { id, state ->
// Remark: the fastq path part may seem superfluous but is necessary for publising later
def new_output = ("fastq/${id}/*_001.fastq")
[
input: state.input_r1,
input_r2: state.input_r2,
no_indels: true,
action: "none",
front_fasta: state.barcodesFasta,
output: new_output,
error_rate: 0.10,
demultiplex_mode: "single",
]
},
toState: { id, result, state ->
def newState = [
"pool": state.pool,
"n_lanes": state.n_lanes,
"output": result.output,
"lane_sorting": state.lane_sorting,
"n_wells": state.n_wells,
"well_id_barcode_mapping": state.well_id_barcode_mapping,
]
return newState
}
)
// Parse the file names to obtain metadata about the output
| flatMap{ id, state ->
def pool = state.pool
state.output.collect{ p ->
def well_id_matcher = p =~ /.*\\/([A-Za-z0-9]*|unknown)_R?.*/
assert well_id_matcher, \
"Could not find Well ID in the name of FASTQ file ($p) output from cutadapt."
def well_id = well_id_matcher[0][1]
// Note: set the barcode to 'null' for reads that were put into 'unknown'
def barcode = (well_id != "unknown") ? state.well_id_barcode_mapping[well_id].replaceAll("[^ACGTacgt]", "") : null
assert (well_id == "unknown") || (barcode != null), \
"After demultiplexing, no Well ID could be retreived for barcode ${barcode}."
def pair_end_matcher = p =~ /.*_(R[12])_.*/
assert pair_end_matcher, \
"Could not find read orientation information in the name of the FASTQ file ($p) output from cutadapt."
def pair_end = pair_end_matcher[0][1]
def lane_matcher = p =~ /.*_(L\d+).*/
def lane = lane_matcher ? lane_matcher[0][1] : "NA"
def new_id = pool + "__" + well_id
[
new_id,
[
"pool": pool,
"barcode": barcode,
"well_id": well_id,
"output": p,
"lane": lane,
"n_wells": state.n_wells,
"pair_end": pair_end,
"n_lanes": state.n_lanes,
"lane_sorting": state.lane_sorting,
"_meta": [ "join_id": pool ]
]
]
}
}
/*
At this point, the events are provided on the smallest possible level,
as each event represents the reads for a certain orientation from a
particular lane and a single well. Here, we join these events back together
on well level, gathering FASTQS across the lanes and read orientations.
In order to make this joining as efficient as possible, the number of
lanes which are expected to be gathered were stored in the state earlier.
This way, the processing of a well can continue as as soon as all of
the lanes have been gathered. The number of lanes times 2 (forward
and reverse orientation) represents the total number of FASTQS (events)
to be included for a certain well.
*/
| map {id, state ->
def group_key = groupKey(id, state.n_lanes * 2)
return [group_key, state]
}
| groupTuple(sort: {a, b ->
// Make sure that the grouped states are in order,
// meaning forward and reverse FASTQs are paired and the FASTQ
// for the forward reads comes before the reverse reads FASTQ.
if (a.lane_sorting == b.lane_sorting) {
return a.pair_end <=> b.pair_end
}
return a.lane_sorting <=> b.lane_sorting
})
| map {_, states ->
// The states are in one long flat list, group them into pairs
// This assumes that the FASTQ files are already in order!
// (See the 'sort' argument of groupTuple above)
def output_pairs = states.collate(2)
// Sanity check the state
output_pairs.each{ pair ->
assert pair.size() == 2, \
"State error: expected FASTQ pairs as output from cutadapt, " +
"found output state: $pair"
def (first, second) = pair
def should_be_the_same = [
"barcode",
"well_id",
"lane",
"pool",
"lane_sorting",
]
should_be_the_same.each { attr_to_check ->
first_attr = first.get(attr_to_check)
second_attr = second.get(attr_to_check)
assert first_attr == second_attr, \
"State error: expected FASTQ pairs from cutadapt to have " +
"the same detected ${attr_to_check}. Found: " +
"$first_attr and $second_attr"
}
// Forward and reverse reads should be designated
// by 'R1' and 'R2', and sorted lexographically.
assert first.pair_end == "R1", \
"State error: expected first item from FASTQ pair to have " +
"orientation 'R1', found $first.pair_end"
assert second.pair_end == "R2", \
"State error: expected second item from FASTQ pair to have " +
"orientation 'R2', found $second.pair_end"
}
def r1_output = output_pairs.collect{it[0].output}
def r2_output = output_pairs.collect{it[1].output}
assert r1_output.size() == r2_output.size()
/* The lane sorting represents the order of the FASTQ files
as provided by the input. The order of the FASTQ files should
remain the same in the well output. This is because the result of STAR
can differ based on the order of the reads in the FASTQ file.
Even when the same reads are provided, the order of them matters.
*/
def lane_sorting = output_pairs.it[0].lane_sorting
def sorting_is_monotonically_increasing = lane_sorting.withIndex().every { i, idx ->
idx == 0 || lane_sorting[idx - 1] <= i
}
assert sorting_is_monotonically_increasing, \
"State error: expected the order of the FASTQ files after grouping " +
"the cutadapt output to be the same as the order in the input. " +
"Found sorting $lane_sorting, R1 output: $r1_output, R2 output: $r2_output."
// Here we pick the state from the first item in the list of states
// and overwrite the keys which are different across states
def first_state = states[0]
def new_id = first_state.pool + "__" + first_state.well_id
def new_state = first_state + ["output_r1": r1_output, "output_r2": r2_output]
[new_id, new_state]
}
// TODO: Expand this into matching a whitelist/blacklist of barcodes
// ... and turn into separate component
| filter{ id, state -> state.well_id != "unknown" }
| concat_text.run(
directives: [label: ["lowmem", "lowcpu"]],
key: "concat_txt_r1",
runIf: {id, state -> state.output_r1.size() > 1},
fromState: { id, state ->
[
input: state.output_r1,
gzip_output: false,
output: "${id}_R1.fastq"
]
},
toState: { id, result, state ->
def newState = state + [ output_r1: [ result.output ] ]
return newState
}
)
| concat_text.run(
directives: [label: ["lowmem", "lowcpu"]],
key: "concat_text_r2",
runIf: {id, state -> state.output_r2.size() > 1},
fromState: { id, state ->
[
input: state.output_r2,
gzip_output: false,
output: "${id}_R2.fastq",
]
},
toState: { id, result, state ->
def newState = state + [ output_r2: [ result.output ] ]
return newState
}
)
| setState(["pool", "well_id", "n_wells", "barcode", "lane", "_meta", "output_r1", "output_r2"])
emit:
output_ch
}

View File

@@ -0,0 +1,11 @@
manifest {
nextflowVersion = '!>=20.12.1-edge'
}
params {
rootDir = java.nio.file.Paths.get("$projectDir/../../../").toAbsolutePath().normalize().toString()
}
// include common settings
includeConfig("${params.rootDir}/src/config/labels.config")

View File

@@ -0,0 +1,96 @@
include { well_demultiplex } from params.rootDir + "/target/nextflow/workflows/well_demultiplex/main.nf"
include { check_cutadapt_output } from params.rootDir + "/target/nextflow/integration_test_components/well_demultiplexing/check_cutadapt_output/main.nf"
params.resources_test = "gs://viash-hub-test-data/htrnaseq/v1/"
workflow test_wf {
resources_test_file = file(params.resources_test)
output_ch = Channel.fromList([
[
id: "SRR14730301",
input_r1: resources_test_file.resolve("100k/SRR14730301/VH02001612_S9_R1_001.fastq"),
input_r2: resources_test_file.resolve("100k/SRR14730301/VH02001612_S9_R2_001.fastq"),
barcodesFasta: resources_test_file.resolve("2-wells-with-ids.fasta"),
],
[
id: "SRR14730302",
input_r1: resources_test_file.resolve("100k/SRR14730302/VH02001614_S8_R1_001.fastq"),
input_r2: resources_test_file.resolve("100k/SRR14730302/VH02001614_S8_R2_001.fastq"),
barcodesFasta: resources_test_file.resolve("2-wells-with-ids.fasta"),
],
])
| map { state -> [ state.id, state ] }
| well_demultiplex.run(
fromState: { id, state ->
[
input_r1: state.input_r1,
input_r2: state.input_r2,
barcodesFasta: state.barcodesFasta,
]
},
toState: { id, output, state ->
output }
)
| view { output ->
assert output.size() == 2 : "outputs should contain two elements; [id, file]"
"Output: $output"
}
| toSortedList()
| view { output ->
assert output.size() == 4 : "2 samples, each with 2 barcodes"
}
| map {output ->
def ids = output.collect{it[0]}
def states = output.collect{it[1]}
def new_state = [
"ids": ids,
"fastq_r1": states.collect{it.output_r1}.flatten(),
"fastq_r2": states.collect{it.output_r2}.flatten()
]
["integration_test_check", new_state]
}
| check_cutadapt_output.run(
fromState: {id, state -> state}
)
}
workflow test_wf2 {
resources_test_file = file(params.resources_test)
output_ch = Channel.fromList([
[
id: "SRR14730301",
input_r1:
[
resources_test_file.resolve("100k/SRR14730301/VH02001612_S9_R1_001.fastq"),
resources_test_file.resolve("100k/SRR14730302/VH02001614_S8_R1_001.fastq"),
],
input_r2:
[
resources_test_file.resolve("100k/SRR14730301/VH02001612_S9_R2_001.fastq"),
resources_test_file.resolve("100k/SRR14730302/VH02001614_S8_R2_001.fastq"),
],
barcodesFasta: resources_test_file.resolve("2-wells-with-ids.fasta"),
],
])
| map { state -> [ state.id, state ] }
| well_demultiplex.run(
fromState: { id, state ->
[
input_r1: state.input_r1,
input_r2: state.input_r2,
barcodesFasta: state.barcodesFasta,
]
},
toState: { id, output, state ->
output }
)
| view { output ->
assert output.size() == 2 : "outputs should contain two elements; [id, file]"
"Output: $output"
}
| toSortedList()
| view { output ->
assert output.size() == 2 : "1 samples, and two barcodes"
}
}

0
target/.build.yaml Normal file
View File

View File

@@ -0,0 +1,767 @@
name: "cutadapt"
version: "v0.3.0"
authors:
- name: "Toni Verbeiren"
roles:
- "author"
- "maintainer"
info:
links:
github: "tverbeiren"
linkedin: "verbeiren"
organizations:
- name: "Data Intuitive"
href: "https://www.data-intuitive.com"
role: "Data Scientist and CEO"
argument_groups:
- name: "Specify Adapters for R1"
arguments:
- type: "string"
name: "--adapter"
alternatives:
- "-a"
description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\
\ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\
\ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\
\ the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--front"
alternatives:
- "-g"
description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\
\ first read). The adapter and any preceding bases\nare trimmed. Partial matches\
\ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\
\ the adapter is\nonly found if it is a prefix of the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--anywhere"
alternatives:
- "-b"
description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\
\ (paired data: of the first read). Both types of\nmatches as described under\
\ -a and -g are allowed. If the\nfirst base of the read is part of the match,\
\ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\
for rescuing failed library preparations - do not use if\nyou know which end\
\ your adapter was ligated to!\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- name: "Specify Adapters using Fasta files for R1"
arguments:
- type: "file"
name: "--adapter_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 3'\
\ end (paired data:\nof the first read). The adapter and subsequent bases are\n\
trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\
\ found if it is a suffix of the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "file"
name: "--front_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 5'\
\ end (paired data:\nof the first read). The adapter and any preceding bases\n\
are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\
\ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\
\ the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--anywhere_fasta"
description: "Fasta file containing sequences of an adapter that may be ligated\
\ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\
\ as described under -a and -g are allowed. If the\nfirst base of the read is\
\ part of the match, the behavior\nis as with -g, otherwise as with -a. This\
\ option is mostly\nfor rescuing failed library preparations - do not use if\n\
you know which end your adapter was ligated to!\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Specify Adapters for R2"
arguments:
- type: "string"
name: "--adapter_r2"
alternatives:
- "-A"
description: "Sequence of an adapter ligated to the 3' end (paired data:\nof the\
\ first read). The adapter and subsequent bases are\ntrimmed. If a '$' character\
\ is appended ('anchoring'), the\nadapter is only found if it is a suffix of\
\ the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--front_r2"
alternatives:
- "-G"
description: "Sequence of an adapter ligated to the 5' end (paired data:\nof the\
\ first read). The adapter and any preceding bases\nare trimmed. Partial matches\
\ at the 5' end are allowed. If\na '^' character is prepended ('anchoring'),\
\ the adapter is\nonly found if it is a prefix of the read.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--anywhere_r2"
alternatives:
- "-B"
description: "Sequence of an adapter that may be ligated to the 5' or 3'\nend\
\ (paired data: of the first read). Both types of\nmatches as described under\
\ -a and -g are allowed. If the\nfirst base of the read is part of the match,\
\ the behavior\nis as with -g, otherwise as with -a. This option is mostly\n\
for rescuing failed library preparations - do not use if\nyou know which end\
\ your adapter was ligated to!\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- name: "Specify Adapters using Fasta files for R2"
arguments:
- type: "file"
name: "--adapter_r2_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 3'\
\ end (paired data:\nof the first read). The adapter and subsequent bases are\n\
trimmed. If a '$' character is appended ('anchoring'), the\nadapter is only\
\ found if it is a suffix of the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--front_r2_fasta"
description: "Fasta file containing sequences of an adapter ligated to the 5'\
\ end (paired data:\nof the first read). The adapter and any preceding bases\n\
are trimmed. Partial matches at the 5' end are allowed. If\na '^' character\
\ is prepended ('anchoring'), the adapter is\nonly found if it is a prefix of\
\ the read.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--anywhere_r2_fasta"
description: "Fasta file containing sequences of an adapter that may be ligated\
\ to the 5' or 3'\nend (paired data: of the first read). Both types of\nmatches\
\ as described under -a and -g are allowed. If the\nfirst base of the read is\
\ part of the match, the behavior\nis as with -g, otherwise as with -a. This\
\ option is mostly\nfor rescuing failed library preparations - do not use if\n\
you know which end your adapter was ligated to!\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Paired-end options"
arguments:
- type: "boolean_true"
name: "--pair_adapters"
description: "Treat adapters given with -a/-A etc. as pairs. Either both\nor none\
\ are removed from each read pair.\n"
info: null
direction: "input"
- type: "string"
name: "--pair_filter"
description: "Which of the reads in a paired-end read have to match the\nfiltering\
\ criterion in order for the pair to be filtered.\n"
info: null
required: false
choices:
- "any"
- "both"
- "first"
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--interleaved"
description: "Read and/or write interleaved paired-end reads.\n"
info: null
direction: "input"
- name: "Input parameters"
arguments:
- type: "file"
name: "--input"
description: "Input fastq file for single-end reads or R1 for paired-end reads.\n"
info: null
must_exist: true
create_parent: true
required: true
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--input_r2"
description: "Input fastq file for R2 in the case of paired-end reads.\n"
info: null
must_exist: true
create_parent: true
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "double"
name: "--error_rate"
alternatives:
- "-E"
- "--errors"
description: "Maximum allowed error rate (if 0 <= E < 1), or absolute\nnumber\
\ of errors for full-length adapter match (if E is an\ninteger >= 1). Error\
\ rate = no. of errors divided by\nlength of matching region. Default: 0.1 (10%).\n"
info: null
example:
- 0.1
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--no_indels"
description: "Allow only mismatches in alignments.\n"
info: null
direction: "input"
- type: "integer"
name: "--times"
alternatives:
- "-n"
description: "Remove up to COUNT adapters from each read. Default: 1.\n"
info: null
example:
- 1
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--overlap"
alternatives:
- "-O"
description: "Require MINLENGTH overlap between read and adapter for an\nadapter\
\ to be found. The default is 3.\n"
info: null
example:
- 3
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--match_read_wildcards"
description: "Interpret IUPAC wildcards in reads.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--no_match_adapter_wildcards"
description: "Do not interpret IUPAC wildcards in adapters.\n"
info: null
direction: "input"
- type: "string"
name: "--action"
description: "What to do if a match was found. trim: trim adapter and\nup- or\
\ downstream sequence; retain: trim, but retain\nadapter; mask: replace with\
\ 'N' characters; lowercase:\nconvert to lowercase; none: leave unchanged.\n\
The default is trim.\n"
info: null
example:
- "trim"
required: false
choices:
- "trim"
- "retain"
- "mask"
- "lowercase"
- "none"
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--revcomp"
alternatives:
- "--rc"
description: "Check both the read and its reverse complement for adapter\nmatches.\
\ If match is on reverse-complemented version,\noutput that one.\n"
info: null
direction: "input"
- name: "Demultiplexing options"
arguments:
- type: "string"
name: "--demultiplex_mode"
description: "Enable demultiplexing and set the mode for it.\nWith mode 'unique_dual',\
\ adapters from the first and second read are used,\nand the indexes from the\
\ reads are only used in pairs. This implies\n--pair_adapters.\nEnabling mode\
\ 'combinatorial_dual' allows all combinations of the sets of indexes\non R1\
\ and R2. It is necessary to write each read pair to an output\nfile depending\
\ on the adapters found on both R1 and R2.\nMode 'single', uses indexes or barcodes\
\ located at the 5'\nend of the R1 read (single). \n"
info: null
required: false
choices:
- "single"
- "unique_dual"
- "combinatorial_dual"
direction: "input"
multiple: false
multiple_sep: ";"
- name: "Read modifications"
arguments:
- type: "integer"
name: "--cut"
alternatives:
- "-u"
description: "Remove LEN bases from each read (or R1 if paired; use --cut_r2\n\
option for R2). If LEN is positive, remove bases from the\nbeginning. If LEN\
\ is negative, remove bases from the end.\nCan be used twice if LENs have different\
\ signs. Applied\n*before* adapter trimming.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "integer"
name: "--cut_r2"
description: "Remove LEN bases from each read (for R2). If LEN is positive, remove\
\ bases from the\nbeginning. If LEN is negative, remove bases from the end.\n\
Can be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n"
info: null
required: false
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--nextseq_trim"
description: "NextSeq-specific quality trimming (each read). Trims also\ndark\
\ cycles appearing as high-quality G bases.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--quality_cutoff"
alternatives:
- "-q"
description: "Trim low-quality bases from 5' and/or 3' ends of each read\nbefore\
\ adapter removal. Applied to both reads if data is\npaired. If one value is\
\ given, only the 3' end is trimmed.\nIf two comma-separated cutoffs are given,\
\ the 5' end is\ntrimmed with the first cutoff, the 3' end with the second.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--quality_cutoff_r2"
alternatives:
- "-Q"
description: "Quality-trimming cutoff for R2. Default: same as for R1\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "integer"
name: "--quality_base"
description: "Assume that quality values in FASTQ are encoded as\nascii(quality\
\ + N). This needs to be set to 64 for some\nold Illumina FASTQ files. The default\
\ is 33.\n"
info: null
example:
- 33
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--poly_a"
description: "Trim poly-A tails"
info: null
direction: "input"
- type: "integer"
name: "--length"
alternatives:
- "-l"
description: "Shorten reads to LENGTH. Positive values remove bases at\nthe end\
\ while negative ones remove bases at the beginning.\nThis and the following\
\ modifications are applied after\nadapter trimming.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--trim_n"
description: "Trim N's on ends of reads."
info: null
direction: "input"
- type: "string"
name: "--length_tag"
description: "Search for TAG followed by a decimal number in the\ndescription\
\ field of the read. Replace the decimal number\nwith the correct length of\
\ the trimmed read. For example,\nuse --length-tag 'length=' to correct fields\
\ like\n'length=123'.\n"
info: null
example:
- "length="
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--strip_suffix"
description: "Remove this suffix from read names if present. Can be\ngiven multiple\
\ times.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--prefix"
alternatives:
- "-x"
description: "Add this prefix to read names. Use {name} to insert the\nname of\
\ the matching adapter.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--suffix"
alternatives:
- "-y"
description: "Add this suffix to read names; can also include {name}\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--rename"
description: "Rename reads using TEMPLATE containing variables such as\n{id},\
\ {adapter_name} etc. (see documentation)\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--zero_cap"
alternatives:
- "-z"
description: "Change negative quality values to zero."
info: null
direction: "input"
- name: "Filtering of processed reads"
description: "Filters are applied after above read modifications. Paired-end reads\
\ are\nalways discarded pairwise (see also --pair_filter).\n"
arguments:
- type: "string"
name: "--minimum_length"
alternatives:
- "-m"
description: "Discard reads shorter than LEN. Default is 0.\nWhen trimming paired-end\
\ reads, the minimum lengths for R1 and R2 can be specified separately by separating\
\ them with a colon (:).\nIf the colon syntax is not used, the same minimum\
\ length applies to both reads, as discussed above.\nAlso, one of the values\
\ can be omitted to impose no restrictions.\nFor example, with -m 17:, the length\
\ of R1 must be at least 17, but the length of R2 is ignored.\n"
info: null
example:
- "0"
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--maximum_length"
alternatives:
- "-M"
description: "Discard reads longer than LEN. Default: no limit.\nFor paired reads,\
\ see the remark for --minimum_length\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "string"
name: "--max_n"
description: "Discard reads with more than COUNT 'N' bases. If COUNT is\na number\
\ between 0 and 1, it is interpreted as a fraction\nof the read length.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "long"
name: "--max_expected_errors"
alternatives:
- "--max_ee"
description: "Discard reads whose expected number of errors (computed\nfrom quality\
\ values) exceeds ERRORS.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "long"
name: "--max_average_error_rate"
alternatives:
- "--max_aer"
description: "as --max_expected_errors (see above), but divided by\nlength to\
\ account for reads of varying length.\n"
info: null
required: false
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--discard_trimmed"
alternatives:
- "--discard"
description: "Discard reads that contain an adapter. Use also -O to\navoid discarding\
\ too many randomly matching reads.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--discard_untrimmed"
alternatives:
- "--trimmed_only"
description: "Discard reads that do not contain an adapter.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--discard_casava"
description: "Discard reads that did not pass CASAVA filtering (header\nhas :Y:).\n"
info: null
direction: "input"
- name: "Output parameters"
arguments:
- type: "string"
name: "--report"
description: "Which type of report to print: 'full' (default) or 'minimal'.\n"
info: null
example:
- "full"
required: false
choices:
- "full"
- "minimal"
direction: "input"
multiple: false
multiple_sep: ";"
- type: "boolean_true"
name: "--json"
description: "Write report in JSON format to this file.\n"
info: null
direction: "input"
- type: "file"
name: "--output"
description: "Glob pattern for matching the expected output files.\nShould include\
\ `$output_dir`.\n"
info: null
example:
- "fastq/*_001.fast[a,q]"
must_exist: true
create_parent: true
required: true
direction: "output"
multiple: true
multiple_sep: ";"
- type: "boolean_true"
name: "--fasta"
description: "Output FASTA to standard output even on FASTQ input.\n"
info: null
direction: "input"
- type: "boolean_true"
name: "--info_file"
description: "Write information about each read and its adapter matches\ninto\
\ info.txt in the output directory.\nSee the documentation for the file format.\n"
info: null
direction: "input"
- name: "Debug"
arguments:
- type: "boolean_true"
name: "--debug"
description: "Print debug information"
info: null
direction: "input"
resources:
- type: "bash_script"
path: "script.sh"
is_executable: true
description: "Cutadapt removes adapter sequences from high-throughput sequencing reads.\n"
test_resources:
- type: "bash_script"
path: "test.sh"
is_executable: true
info: null
status: "enabled"
requirements:
commands:
- "ps"
keywords:
- "RNA-seq"
- "scRNA-seq"
- "high-throughput"
license: "MIT"
references:
doi:
- "10.14806/ej.17.1.200"
links:
repository: "https://github.com/marcelm/cutadapt"
homepage: "https://cutadapt.readthedocs.io"
documentation: "https://cutadapt.readthedocs.io"
runners:
- type: "executable"
id: "executable"
docker_setup_strategy: "ifneedbepullelsecachedbuild"
- type: "nextflow"
id: "nextflow"
directives:
tag: "$id"
auto:
simplifyInput: true
simplifyOutput: false
transcript: false
publish: false
config:
labels:
mem1gb: "memory = 1000000000.B"
mem2gb: "memory = 2000000000.B"
mem5gb: "memory = 5000000000.B"
mem10gb: "memory = 10000000000.B"
mem20gb: "memory = 20000000000.B"
mem50gb: "memory = 50000000000.B"
mem100gb: "memory = 100000000000.B"
mem200gb: "memory = 200000000000.B"
mem500gb: "memory = 500000000000.B"
mem1tb: "memory = 1000000000000.B"
mem2tb: "memory = 2000000000000.B"
mem5tb: "memory = 5000000000000.B"
mem10tb: "memory = 10000000000000.B"
mem20tb: "memory = 20000000000000.B"
mem50tb: "memory = 50000000000000.B"
mem100tb: "memory = 100000000000000.B"
mem200tb: "memory = 200000000000000.B"
mem500tb: "memory = 500000000000000.B"
mem1gib: "memory = 1073741824.B"
mem2gib: "memory = 2147483648.B"
mem4gib: "memory = 4294967296.B"
mem8gib: "memory = 8589934592.B"
mem16gib: "memory = 17179869184.B"
mem32gib: "memory = 34359738368.B"
mem64gib: "memory = 68719476736.B"
mem128gib: "memory = 137438953472.B"
mem256gib: "memory = 274877906944.B"
mem512gib: "memory = 549755813888.B"
mem1tib: "memory = 1099511627776.B"
mem2tib: "memory = 2199023255552.B"
mem4tib: "memory = 4398046511104.B"
mem8tib: "memory = 8796093022208.B"
mem16tib: "memory = 17592186044416.B"
mem32tib: "memory = 35184372088832.B"
mem64tib: "memory = 70368744177664.B"
mem128tib: "memory = 140737488355328.B"
mem256tib: "memory = 281474976710656.B"
mem512tib: "memory = 562949953421312.B"
cpu1: "cpus = 1"
cpu2: "cpus = 2"
cpu5: "cpus = 5"
cpu10: "cpus = 10"
cpu20: "cpus = 20"
cpu50: "cpus = 50"
cpu100: "cpus = 100"
cpu200: "cpus = 200"
cpu500: "cpus = 500"
cpu1000: "cpus = 1000"
debug: false
container: "docker"
engines:
- type: "docker"
id: "docker"
image: "python:3.12"
target_registry: "images.viash-hub.com"
target_tag: "v0.3.0"
namespace_separator: "/"
setup:
- type: "python"
user: false
pip:
- "cutadapt"
upgrade: true
- type: "docker"
run:
- "cutadapt --version | sed 's/\\(.*\\)/cutadapt: \"\\1\"/' > /var/software_versions.txt\n"
entrypoint: []
cmd: null
- type: "native"
id: "native"
build_info:
config: "src/cutadapt/config.vsh.yaml"
runner: "nextflow"
engine: "docker|native"
output: "target/nextflow/cutadapt"
executable: "target/nextflow/cutadapt/main.nf"
viash_version: "0.9.0"
git_commit: "d86bd5cf62104af02caa852aacd352b1aa97ed60"
git_remote: "https://x-access-token:ghs_EwAUAMYJ0K4VBHlAEMs4ZP2OyQYqJM0PSfEO@github.com/viash-hub/biobox"
git_tag: "v0.2.0-29-gd86bd5c"
package_config:
name: "biobox"
version: "v0.3.0"
description: "A collection of bioinformatics tools for working with sequence data.\n"
info: null
viash_version: "0.9.0"
source: "src"
target: "target"
config_mods:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.3.0'"
keywords:
- "bioinformatics"
- "modules"
- "sequencing"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/biobox"
issue_tracker: "https://github.com/viash-hub/biobox/issues"

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,126 @@
manifest {
name = 'cutadapt'
mainScript = 'main.nf'
nextflowVersion = '!>=20.12.1-edge'
version = 'v0.3.0'
description = 'Cutadapt removes adapter sequences from high-throughput sequencing reads.\n'
author = 'Toni Verbeiren'
}
process.container = 'nextflow/bash:latest'
// detect tempdir
tempDir = java.nio.file.Paths.get(
System.getenv('NXF_TEMP') ?:
System.getenv('VIASH_TEMP') ?:
System.getenv('TEMPDIR') ?:
System.getenv('TMPDIR') ?:
'/tmp'
).toAbsolutePath()
profiles {
no_publish {
process {
withName: '.*' {
publishDir = [
enabled: false
]
}
}
}
mount_temp {
docker.temp = tempDir
podman.temp = tempDir
charliecloud.temp = tempDir
}
docker {
docker.enabled = true
// docker.userEmulation = true
singularity.enabled = false
podman.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
singularity {
singularity.enabled = true
singularity.autoMounts = true
docker.enabled = false
podman.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
podman {
podman.enabled = true
docker.enabled = false
singularity.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
shifter {
shifter.enabled = true
docker.enabled = false
singularity.enabled = false
podman.enabled = false
charliecloud.enabled = false
}
charliecloud {
charliecloud.enabled = true
docker.enabled = false
singularity.enabled = false
podman.enabled = false
shifter.enabled = false
}
}
process{
withLabel: mem1gb { memory = 1000000000.B }
withLabel: mem2gb { memory = 2000000000.B }
withLabel: mem5gb { memory = 5000000000.B }
withLabel: mem10gb { memory = 10000000000.B }
withLabel: mem20gb { memory = 20000000000.B }
withLabel: mem50gb { memory = 50000000000.B }
withLabel: mem100gb { memory = 100000000000.B }
withLabel: mem200gb { memory = 200000000000.B }
withLabel: mem500gb { memory = 500000000000.B }
withLabel: mem1tb { memory = 1000000000000.B }
withLabel: mem2tb { memory = 2000000000000.B }
withLabel: mem5tb { memory = 5000000000000.B }
withLabel: mem10tb { memory = 10000000000000.B }
withLabel: mem20tb { memory = 20000000000000.B }
withLabel: mem50tb { memory = 50000000000000.B }
withLabel: mem100tb { memory = 100000000000000.B }
withLabel: mem200tb { memory = 200000000000000.B }
withLabel: mem500tb { memory = 500000000000000.B }
withLabel: mem1gib { memory = 1073741824.B }
withLabel: mem2gib { memory = 2147483648.B }
withLabel: mem4gib { memory = 4294967296.B }
withLabel: mem8gib { memory = 8589934592.B }
withLabel: mem16gib { memory = 17179869184.B }
withLabel: mem32gib { memory = 34359738368.B }
withLabel: mem64gib { memory = 68719476736.B }
withLabel: mem128gib { memory = 137438953472.B }
withLabel: mem256gib { memory = 274877906944.B }
withLabel: mem512gib { memory = 549755813888.B }
withLabel: mem1tib { memory = 1099511627776.B }
withLabel: mem2tib { memory = 2199023255552.B }
withLabel: mem4tib { memory = 4398046511104.B }
withLabel: mem8tib { memory = 8796093022208.B }
withLabel: mem16tib { memory = 17592186044416.B }
withLabel: mem32tib { memory = 35184372088832.B }
withLabel: mem64tib { memory = 70368744177664.B }
withLabel: mem128tib { memory = 140737488355328.B }
withLabel: mem256tib { memory = 281474976710656.B }
withLabel: mem512tib { memory = 562949953421312.B }
withLabel: cpu1 { cpus = 1 }
withLabel: cpu2 { cpus = 2 }
withLabel: cpu5 { cpus = 5 }
withLabel: cpu10 { cpus = 10 }
withLabel: cpu20 { cpus = 20 }
withLabel: cpu50 { cpus = 50 }
withLabel: cpu100 { cpus = 100 }
withLabel: cpu200 { cpus = 200 }
withLabel: cpu500 { cpus = 500 }
withLabel: cpu1000 { cpus = 1000 }
}

View File

@@ -0,0 +1,775 @@
{
"$schema": "http://json-schema.org/draft-07/schema",
"title": "cutadapt",
"description": "Cutadapt removes adapter sequences from high-throughput sequencing reads.\n",
"type": "object",
"definitions": {
"specify adapters for r1" : {
"title": "Specify Adapters for R1",
"type": "object",
"description": "No description",
"properties": {
"adapter": {
"type":
"string",
"description": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)",
"help_text": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n"
}
,
"front": {
"type":
"string",
"description": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)",
"help_text": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n"
}
,
"anywhere": {
"type":
"string",
"description": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)",
"help_text": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n"
}
}
},
"specify adapters using fasta files for r1" : {
"title": "Specify Adapters using Fasta files for R1",
"type": "object",
"description": "No description",
"properties": {
"adapter_fasta": {
"type":
"string",
"description": "Type: List of `file`, multiple_sep: `\";\"`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)",
"help_text": "Type: List of `file`, multiple_sep: `\";\"`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n"
}
,
"front_fasta": {
"type":
"string",
"description": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)",
"help_text": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n"
}
,
"anywhere_fasta": {
"type":
"string",
"description": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)",
"help_text": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n"
}
}
},
"specify adapters for r2" : {
"title": "Specify Adapters for R2",
"type": "object",
"description": "No description",
"properties": {
"adapter_r2": {
"type":
"string",
"description": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)",
"help_text": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n"
}
,
"front_r2": {
"type":
"string",
"description": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)",
"help_text": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n"
}
,
"anywhere_r2": {
"type":
"string",
"description": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)",
"help_text": "Type: List of `string`, multiple_sep: `\";\"`. Sequence of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n"
}
}
},
"specify adapters using fasta files for r2" : {
"title": "Specify Adapters using Fasta files for R2",
"type": "object",
"description": "No description",
"properties": {
"adapter_r2_fasta": {
"type":
"string",
"description": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read)",
"help_text": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 3\u0027 end (paired data:\nof the first read). The adapter and subsequent bases are\ntrimmed. If a \u0027$\u0027 character is appended (\u0027anchoring\u0027), the\nadapter is only found if it is a suffix of the read.\n"
}
,
"front_r2_fasta": {
"type":
"string",
"description": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read)",
"help_text": "Type: `file`. Fasta file containing sequences of an adapter ligated to the 5\u0027 end (paired data:\nof the first read). The adapter and any preceding bases\nare trimmed. Partial matches at the 5\u0027 end are allowed. If\na \u0027^\u0027 character is prepended (\u0027anchoring\u0027), the adapter is\nonly found if it is a prefix of the read.\n"
}
,
"anywhere_r2_fasta": {
"type":
"string",
"description": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read)",
"help_text": "Type: `file`. Fasta file containing sequences of an adapter that may be ligated to the 5\u0027 or 3\u0027\nend (paired data: of the first read). Both types of\nmatches as described under -a and -g are allowed. If the\nfirst base of the read is part of the match, the behavior\nis as with -g, otherwise as with -a. This option is mostly\nfor rescuing failed library preparations - do not use if\nyou know which end your adapter was ligated to!\n"
}
}
},
"paired-end options" : {
"title": "Paired-end options",
"type": "object",
"description": "No description",
"properties": {
"pair_adapters": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Treat adapters given with -a/-A etc",
"help_text": "Type: `boolean_true`, default: `false`. Treat adapters given with -a/-A etc. as pairs. Either both\nor none are removed from each read pair.\n"
,
"default":false
}
,
"pair_filter": {
"type":
"string",
"description": "Type: `string`, choices: ``any`, `both`, `first``. Which of the reads in a paired-end read have to match the\nfiltering criterion in order for the pair to be filtered",
"help_text": "Type: `string`, choices: ``any`, `both`, `first``. Which of the reads in a paired-end read have to match the\nfiltering criterion in order for the pair to be filtered.\n",
"enum": ["any", "both", "first"]
}
,
"interleaved": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Read and/or write interleaved paired-end reads",
"help_text": "Type: `boolean_true`, default: `false`. Read and/or write interleaved paired-end reads.\n"
,
"default":false
}
}
},
"input parameters" : {
"title": "Input parameters",
"type": "object",
"description": "No description",
"properties": {
"input": {
"type":
"string",
"description": "Type: `file`, required. Input fastq file for single-end reads or R1 for paired-end reads",
"help_text": "Type: `file`, required. Input fastq file for single-end reads or R1 for paired-end reads.\n"
}
,
"input_r2": {
"type":
"string",
"description": "Type: `file`. Input fastq file for R2 in the case of paired-end reads",
"help_text": "Type: `file`. Input fastq file for R2 in the case of paired-end reads.\n"
}
,
"error_rate": {
"type":
"number",
"description": "Type: `double`, example: `0.1`. Maximum allowed error rate (if 0 \u003c= E \u003c 1), or absolute\nnumber of errors for full-length adapter match (if E is an\ninteger \u003e= 1)",
"help_text": "Type: `double`, example: `0.1`. Maximum allowed error rate (if 0 \u003c= E \u003c 1), or absolute\nnumber of errors for full-length adapter match (if E is an\ninteger \u003e= 1). Error rate = no. of errors divided by\nlength of matching region. Default: 0.1 (10%).\n"
}
,
"no_indels": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Allow only mismatches in alignments",
"help_text": "Type: `boolean_true`, default: `false`. Allow only mismatches in alignments.\n"
,
"default":false
}
,
"times": {
"type":
"integer",
"description": "Type: `integer`, example: `1`. Remove up to COUNT adapters from each read",
"help_text": "Type: `integer`, example: `1`. Remove up to COUNT adapters from each read. Default: 1.\n"
}
,
"overlap": {
"type":
"integer",
"description": "Type: `integer`, example: `3`. Require MINLENGTH overlap between read and adapter for an\nadapter to be found",
"help_text": "Type: `integer`, example: `3`. Require MINLENGTH overlap between read and adapter for an\nadapter to be found. The default is 3.\n"
}
,
"match_read_wildcards": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Interpret IUPAC wildcards in reads",
"help_text": "Type: `boolean_true`, default: `false`. Interpret IUPAC wildcards in reads.\n"
,
"default":false
}
,
"no_match_adapter_wildcards": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Do not interpret IUPAC wildcards in adapters",
"help_text": "Type: `boolean_true`, default: `false`. Do not interpret IUPAC wildcards in adapters.\n"
,
"default":false
}
,
"action": {
"type":
"string",
"description": "Type: `string`, example: `trim`, choices: ``trim`, `retain`, `mask`, `lowercase`, `none``. What to do if a match was found",
"help_text": "Type: `string`, example: `trim`, choices: ``trim`, `retain`, `mask`, `lowercase`, `none``. What to do if a match was found. trim: trim adapter and\nup- or downstream sequence; retain: trim, but retain\nadapter; mask: replace with \u0027N\u0027 characters; lowercase:\nconvert to lowercase; none: leave unchanged.\nThe default is trim.\n",
"enum": ["trim", "retain", "mask", "lowercase", "none"]
}
,
"revcomp": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Check both the read and its reverse complement for adapter\nmatches",
"help_text": "Type: `boolean_true`, default: `false`. Check both the read and its reverse complement for adapter\nmatches. If match is on reverse-complemented version,\noutput that one.\n"
,
"default":false
}
}
},
"demultiplexing options" : {
"title": "Demultiplexing options",
"type": "object",
"description": "No description",
"properties": {
"demultiplex_mode": {
"type":
"string",
"description": "Type: `string`, choices: ``single`, `unique_dual`, `combinatorial_dual``. Enable demultiplexing and set the mode for it",
"help_text": "Type: `string`, choices: ``single`, `unique_dual`, `combinatorial_dual``. Enable demultiplexing and set the mode for it.\nWith mode \u0027unique_dual\u0027, adapters from the first and second read are used,\nand the indexes from the reads are only used in pairs. This implies\n--pair_adapters.\nEnabling mode \u0027combinatorial_dual\u0027 allows all combinations of the sets of indexes\non R1 and R2. It is necessary to write each read pair to an output\nfile depending on the adapters found on both R1 and R2.\nMode \u0027single\u0027, uses indexes or barcodes located at the 5\u0027\nend of the R1 read (single). \n",
"enum": ["single", "unique_dual", "combinatorial_dual"]
}
}
},
"read modifications" : {
"title": "Read modifications",
"type": "object",
"description": "No description",
"properties": {
"cut": {
"type":
"string",
"description": "Type: List of `integer`, multiple_sep: `\";\"`. Remove LEN bases from each read (or R1 if paired; use --cut_r2\noption for R2)",
"help_text": "Type: List of `integer`, multiple_sep: `\";\"`. Remove LEN bases from each read (or R1 if paired; use --cut_r2\noption for R2). If LEN is positive, remove bases from the\nbeginning. If LEN is negative, remove bases from the end.\nCan be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n"
}
,
"cut_r2": {
"type":
"string",
"description": "Type: List of `integer`, multiple_sep: `\";\"`. Remove LEN bases from each read (for R2)",
"help_text": "Type: List of `integer`, multiple_sep: `\";\"`. Remove LEN bases from each read (for R2). If LEN is positive, remove bases from the\nbeginning. If LEN is negative, remove bases from the end.\nCan be used twice if LENs have different signs. Applied\n*before* adapter trimming.\n"
}
,
"nextseq_trim": {
"type":
"string",
"description": "Type: `string`. NextSeq-specific quality trimming (each read)",
"help_text": "Type: `string`. NextSeq-specific quality trimming (each read). Trims also\ndark cycles appearing as high-quality G bases.\n"
}
,
"quality_cutoff": {
"type":
"string",
"description": "Type: `string`. Trim low-quality bases from 5\u0027 and/or 3\u0027 ends of each read\nbefore adapter removal",
"help_text": "Type: `string`. Trim low-quality bases from 5\u0027 and/or 3\u0027 ends of each read\nbefore adapter removal. Applied to both reads if data is\npaired. If one value is given, only the 3\u0027 end is trimmed.\nIf two comma-separated cutoffs are given, the 5\u0027 end is\ntrimmed with the first cutoff, the 3\u0027 end with the second.\n"
}
,
"quality_cutoff_r2": {
"type":
"string",
"description": "Type: `string`. Quality-trimming cutoff for R2",
"help_text": "Type: `string`. Quality-trimming cutoff for R2. Default: same as for R1\n"
}
,
"quality_base": {
"type":
"integer",
"description": "Type: `integer`, example: `33`. Assume that quality values in FASTQ are encoded as\nascii(quality + N)",
"help_text": "Type: `integer`, example: `33`. Assume that quality values in FASTQ are encoded as\nascii(quality + N). This needs to be set to 64 for some\nold Illumina FASTQ files. The default is 33.\n"
}
,
"poly_a": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Trim poly-A tails",
"help_text": "Type: `boolean_true`, default: `false`. Trim poly-A tails"
,
"default":false
}
,
"length": {
"type":
"integer",
"description": "Type: `integer`. Shorten reads to LENGTH",
"help_text": "Type: `integer`. Shorten reads to LENGTH. Positive values remove bases at\nthe end while negative ones remove bases at the beginning.\nThis and the following modifications are applied after\nadapter trimming.\n"
}
,
"trim_n": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Trim N\u0027s on ends of reads",
"help_text": "Type: `boolean_true`, default: `false`. Trim N\u0027s on ends of reads."
,
"default":false
}
,
"length_tag": {
"type":
"string",
"description": "Type: `string`, example: `length=`. Search for TAG followed by a decimal number in the\ndescription field of the read",
"help_text": "Type: `string`, example: `length=`. Search for TAG followed by a decimal number in the\ndescription field of the read. Replace the decimal number\nwith the correct length of the trimmed read. For example,\nuse --length-tag \u0027length=\u0027 to correct fields like\n\u0027length=123\u0027.\n"
}
,
"strip_suffix": {
"type":
"string",
"description": "Type: `string`. Remove this suffix from read names if present",
"help_text": "Type: `string`. Remove this suffix from read names if present. Can be\ngiven multiple times.\n"
}
,
"prefix": {
"type":
"string",
"description": "Type: `string`. Add this prefix to read names",
"help_text": "Type: `string`. Add this prefix to read names. Use {name} to insert the\nname of the matching adapter.\n"
}
,
"suffix": {
"type":
"string",
"description": "Type: `string`. Add this suffix to read names; can also include {name}\n",
"help_text": "Type: `string`. Add this suffix to read names; can also include {name}\n"
}
,
"rename": {
"type":
"string",
"description": "Type: `string`. Rename reads using TEMPLATE containing variables such as\n{id}, {adapter_name} etc",
"help_text": "Type: `string`. Rename reads using TEMPLATE containing variables such as\n{id}, {adapter_name} etc. (see documentation)\n"
}
,
"zero_cap": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Change negative quality values to zero",
"help_text": "Type: `boolean_true`, default: `false`. Change negative quality values to zero."
,
"default":false
}
}
},
"filtering of processed reads" : {
"title": "Filtering of processed reads",
"type": "object",
"description": "Filters are applied after above read modifications. Paired-end reads are\nalways discarded pairwise (see also --pair_filter).\n",
"properties": {
"minimum_length": {
"type":
"string",
"description": "Type: `string`, example: `0`. Discard reads shorter than LEN",
"help_text": "Type: `string`, example: `0`. Discard reads shorter than LEN. Default is 0.\nWhen trimming paired-end reads, the minimum lengths for R1 and R2 can be specified separately by separating them with a colon (:).\nIf the colon syntax is not used, the same minimum length applies to both reads, as discussed above.\nAlso, one of the values can be omitted to impose no restrictions.\nFor example, with -m 17:, the length of R1 must be at least 17, but the length of R2 is ignored.\n"
}
,
"maximum_length": {
"type":
"string",
"description": "Type: `string`. Discard reads longer than LEN",
"help_text": "Type: `string`. Discard reads longer than LEN. Default: no limit.\nFor paired reads, see the remark for --minimum_length\n"
}
,
"max_n": {
"type":
"string",
"description": "Type: `string`. Discard reads with more than COUNT \u0027N\u0027 bases",
"help_text": "Type: `string`. Discard reads with more than COUNT \u0027N\u0027 bases. If COUNT is\na number between 0 and 1, it is interpreted as a fraction\nof the read length.\n"
}
,
"max_expected_errors": {
"type":
"string",
"description": "Type: `long`. Discard reads whose expected number of errors (computed\nfrom quality values) exceeds ERRORS",
"help_text": "Type: `long`. Discard reads whose expected number of errors (computed\nfrom quality values) exceeds ERRORS.\n"
}
,
"max_average_error_rate": {
"type":
"string",
"description": "Type: `long`. as --max_expected_errors (see above), but divided by\nlength to account for reads of varying length",
"help_text": "Type: `long`. as --max_expected_errors (see above), but divided by\nlength to account for reads of varying length.\n"
}
,
"discard_trimmed": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Discard reads that contain an adapter",
"help_text": "Type: `boolean_true`, default: `false`. Discard reads that contain an adapter. Use also -O to\navoid discarding too many randomly matching reads.\n"
,
"default":false
}
,
"discard_untrimmed": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Discard reads that do not contain an adapter",
"help_text": "Type: `boolean_true`, default: `false`. Discard reads that do not contain an adapter.\n"
,
"default":false
}
,
"discard_casava": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Discard reads that did not pass CASAVA filtering (header\nhas :Y:)",
"help_text": "Type: `boolean_true`, default: `false`. Discard reads that did not pass CASAVA filtering (header\nhas :Y:).\n"
,
"default":false
}
}
},
"output parameters" : {
"title": "Output parameters",
"type": "object",
"description": "No description",
"properties": {
"report": {
"type":
"string",
"description": "Type: `string`, example: `full`, choices: ``full`, `minimal``. Which type of report to print: \u0027full\u0027 (default) or \u0027minimal\u0027",
"help_text": "Type: `string`, example: `full`, choices: ``full`, `minimal``. Which type of report to print: \u0027full\u0027 (default) or \u0027minimal\u0027.\n",
"enum": ["full", "minimal"]
}
,
"json": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Write report in JSON format to this file",
"help_text": "Type: `boolean_true`, default: `false`. Write report in JSON format to this file.\n"
,
"default":false
}
,
"output": {
"type":
"string",
"description": "Type: List of `file`, required, default: `$id.$key.output_*.fast[a,q]`, example: `fastq/*_001.fast[a,q]`, multiple_sep: `\";\"`. Glob pattern for matching the expected output files",
"help_text": "Type: List of `file`, required, default: `$id.$key.output_*.fast[a,q]`, example: `fastq/*_001.fast[a,q]`, multiple_sep: `\";\"`. Glob pattern for matching the expected output files.\nShould include `$output_dir`.\n"
,
"default":"$id.$key.output_*.fast[a,q]"
}
,
"fasta": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Output FASTA to standard output even on FASTQ input",
"help_text": "Type: `boolean_true`, default: `false`. Output FASTA to standard output even on FASTQ input.\n"
,
"default":false
}
,
"info_file": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Write information about each read and its adapter matches\ninto info",
"help_text": "Type: `boolean_true`, default: `false`. Write information about each read and its adapter matches\ninto info.txt in the output directory.\nSee the documentation for the file format.\n"
,
"default":false
}
}
},
"debug" : {
"title": "Debug",
"type": "object",
"description": "No description",
"properties": {
"debug": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Print debug information",
"help_text": "Type: `boolean_true`, default: `false`. Print debug information"
,
"default":false
}
}
},
"nextflow input-output arguments" : {
"title": "Nextflow input-output arguments",
"type": "object",
"description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
"properties": {
"publish_dir": {
"type":
"string",
"description": "Type: `string`, required, example: `output/`. Path to an output directory",
"help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
}
,
"param_list": {
"type":
"string",
"description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
"help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
"hidden": true
}
}
}
},
"allOf": [
{
"$ref": "#/definitions/specify adapters for r1"
},
{
"$ref": "#/definitions/specify adapters using fasta files for r1"
},
{
"$ref": "#/definitions/specify adapters for r2"
},
{
"$ref": "#/definitions/specify adapters using fasta files for r2"
},
{
"$ref": "#/definitions/paired-end options"
},
{
"$ref": "#/definitions/input parameters"
},
{
"$ref": "#/definitions/demultiplexing options"
},
{
"$ref": "#/definitions/read modifications"
},
{
"$ref": "#/definitions/filtering of processed reads"
},
{
"$ref": "#/definitions/output parameters"
},
{
"$ref": "#/definitions/debug"
},
{
"$ref": "#/definitions/nextflow input-output arguments"
}
]
}

View File

@@ -0,0 +1,197 @@
name: "concat_text"
version: "v0.1.0"
authors:
- name: "Toni Verbeiren"
roles:
- "author"
- "maintainer"
info:
links:
github: "tverbeiren"
linkedin: "verbeiren"
organizations:
- name: "Data Intuitive"
href: "https://www.data-intuitive.com"
role: "Data Scientist and CEO"
- name: "Dries Schaumont"
roles:
- "reviewer"
info:
links:
email: "dries@data-intuitive.com"
github: "DriesSchaumont"
orcid: "0000-0002-4389-0440"
linkedin: "dries-schaumont"
organizations:
- name: "Data Intuitive"
href: "https://www.data-intuitive.com"
role: "Data Scientist"
argument_groups:
- name: "Input arguments"
arguments:
- type: "file"
name: "--input"
description: "A list of (gzipped) text files."
info: null
example:
- "input?.txt.gz"
must_exist: true
create_parent: true
required: true
direction: "input"
multiple: true
multiple_sep: ";"
- name: "Output arguments"
arguments:
- type: "boolean_true"
name: "--gzip_output"
description: "Should the output be zipped?"
info: null
direction: "input"
- type: "file"
name: "--output"
description: "File to write the output to, optionally gzipped."
info: null
example:
- "output.txt"
must_exist: true
create_parent: true
required: false
direction: "output"
multiple: false
multiple_sep: ";"
resources:
- type: "bash_script"
path: "script.sh"
is_executable: true
description: "Concatenate a number of text files, handle gzipped text files gracefully\
\ and\noptionally gzip the output text file.\n\nThis component is useful for concatening\
\ fastq files from different lanes, for instance.\n"
test_resources:
- type: "bash_script"
path: "test.sh"
is_executable: true
info:
improvements: "This component could be improved in 2 ways:\n 1. Allow for a mix\
\ of zipped and plain input files\n 2. Allow to specify a compression algorithm\
\ for the output\n"
status: "enabled"
requirements:
commands:
- "ps"
license: "MIT"
links:
repository: "https://github.com/viash-hub/craftbox"
runners:
- type: "executable"
id: "executable"
docker_setup_strategy: "ifneedbepullelsecachedbuild"
- type: "nextflow"
id: "nextflow"
directives:
tag: "$id"
auto:
simplifyInput: true
simplifyOutput: false
transcript: false
publish: false
config:
labels:
mem1gb: "memory = 1000000000.B"
mem2gb: "memory = 2000000000.B"
mem5gb: "memory = 5000000000.B"
mem10gb: "memory = 10000000000.B"
mem20gb: "memory = 20000000000.B"
mem50gb: "memory = 50000000000.B"
mem100gb: "memory = 100000000000.B"
mem200gb: "memory = 200000000000.B"
mem500gb: "memory = 500000000000.B"
mem1tb: "memory = 1000000000000.B"
mem2tb: "memory = 2000000000000.B"
mem5tb: "memory = 5000000000000.B"
mem10tb: "memory = 10000000000000.B"
mem20tb: "memory = 20000000000000.B"
mem50tb: "memory = 50000000000000.B"
mem100tb: "memory = 100000000000000.B"
mem200tb: "memory = 200000000000000.B"
mem500tb: "memory = 500000000000000.B"
mem1gib: "memory = 1073741824.B"
mem2gib: "memory = 2147483648.B"
mem4gib: "memory = 4294967296.B"
mem8gib: "memory = 8589934592.B"
mem16gib: "memory = 17179869184.B"
mem32gib: "memory = 34359738368.B"
mem64gib: "memory = 68719476736.B"
mem128gib: "memory = 137438953472.B"
mem256gib: "memory = 274877906944.B"
mem512gib: "memory = 549755813888.B"
mem1tib: "memory = 1099511627776.B"
mem2tib: "memory = 2199023255552.B"
mem4tib: "memory = 4398046511104.B"
mem8tib: "memory = 8796093022208.B"
mem16tib: "memory = 17592186044416.B"
mem32tib: "memory = 35184372088832.B"
mem64tib: "memory = 70368744177664.B"
mem128tib: "memory = 140737488355328.B"
mem256tib: "memory = 281474976710656.B"
mem512tib: "memory = 562949953421312.B"
cpu1: "cpus = 1"
cpu2: "cpus = 2"
cpu5: "cpus = 5"
cpu10: "cpus = 10"
cpu20: "cpus = 20"
cpu50: "cpus = 50"
cpu100: "cpus = 100"
cpu200: "cpus = 200"
cpu500: "cpus = 500"
cpu1000: "cpus = 1000"
debug: false
container: "docker"
engines:
- type: "docker"
id: "docker"
image: "alpine:latest"
target_registry: "images.viash-hub.com"
target_tag: "v0.1.0"
namespace_separator: "/"
setup:
- type: "apk"
packages:
- "bash"
- "procps"
- "file"
entrypoint: []
cmd: null
- type: "native"
id: "native"
build_info:
config: "src/concat_text/config.vsh.yaml"
runner: "nextflow"
engine: "docker|native"
output: "target/nextflow/concat_text"
executable: "target/nextflow/concat_text/main.nf"
viash_version: "0.9.0"
git_commit: "3143dd6e4c2c3107f79639fe8602d92f3141ad82"
git_remote: "https://github.com/viash-hub/craftbox"
package_config:
name: "craftbox"
version: "v0.1.0"
description: "A collection of custom-tailored scripts and applied tools.\n"
info: null
viash_version: "0.9.0"
source: "src"
target: "target"
config_mods:
- ".requirements.commands := ['ps']\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.1.0'"
keywords:
- "scripts"
- "custom"
- "implementations"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/craftbox"
issue_tracker: "https://github.com/viash-hub/craftbox/issues"

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,126 @@
manifest {
name = 'concat_text'
mainScript = 'main.nf'
nextflowVersion = '!>=20.12.1-edge'
version = 'v0.1.0'
description = 'Concatenate a number of text files, handle gzipped text files gracefully and\noptionally gzip the output text file.\n\nThis component is useful for concatening fastq files from different lanes, for instance.\n'
author = 'Toni Verbeiren, Dries Schaumont'
}
process.container = 'nextflow/bash:latest'
// detect tempdir
tempDir = java.nio.file.Paths.get(
System.getenv('NXF_TEMP') ?:
System.getenv('VIASH_TEMP') ?:
System.getenv('TEMPDIR') ?:
System.getenv('TMPDIR') ?:
'/tmp'
).toAbsolutePath()
profiles {
no_publish {
process {
withName: '.*' {
publishDir = [
enabled: false
]
}
}
}
mount_temp {
docker.temp = tempDir
podman.temp = tempDir
charliecloud.temp = tempDir
}
docker {
docker.enabled = true
// docker.userEmulation = true
singularity.enabled = false
podman.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
singularity {
singularity.enabled = true
singularity.autoMounts = true
docker.enabled = false
podman.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
podman {
podman.enabled = true
docker.enabled = false
singularity.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
shifter {
shifter.enabled = true
docker.enabled = false
singularity.enabled = false
podman.enabled = false
charliecloud.enabled = false
}
charliecloud {
charliecloud.enabled = true
docker.enabled = false
singularity.enabled = false
podman.enabled = false
shifter.enabled = false
}
}
process{
withLabel: mem1gb { memory = 1000000000.B }
withLabel: mem2gb { memory = 2000000000.B }
withLabel: mem5gb { memory = 5000000000.B }
withLabel: mem10gb { memory = 10000000000.B }
withLabel: mem20gb { memory = 20000000000.B }
withLabel: mem50gb { memory = 50000000000.B }
withLabel: mem100gb { memory = 100000000000.B }
withLabel: mem200gb { memory = 200000000000.B }
withLabel: mem500gb { memory = 500000000000.B }
withLabel: mem1tb { memory = 1000000000000.B }
withLabel: mem2tb { memory = 2000000000000.B }
withLabel: mem5tb { memory = 5000000000000.B }
withLabel: mem10tb { memory = 10000000000000.B }
withLabel: mem20tb { memory = 20000000000000.B }
withLabel: mem50tb { memory = 50000000000000.B }
withLabel: mem100tb { memory = 100000000000000.B }
withLabel: mem200tb { memory = 200000000000000.B }
withLabel: mem500tb { memory = 500000000000000.B }
withLabel: mem1gib { memory = 1073741824.B }
withLabel: mem2gib { memory = 2147483648.B }
withLabel: mem4gib { memory = 4294967296.B }
withLabel: mem8gib { memory = 8589934592.B }
withLabel: mem16gib { memory = 17179869184.B }
withLabel: mem32gib { memory = 34359738368.B }
withLabel: mem64gib { memory = 68719476736.B }
withLabel: mem128gib { memory = 137438953472.B }
withLabel: mem256gib { memory = 274877906944.B }
withLabel: mem512gib { memory = 549755813888.B }
withLabel: mem1tib { memory = 1099511627776.B }
withLabel: mem2tib { memory = 2199023255552.B }
withLabel: mem4tib { memory = 4398046511104.B }
withLabel: mem8tib { memory = 8796093022208.B }
withLabel: mem16tib { memory = 17592186044416.B }
withLabel: mem32tib { memory = 35184372088832.B }
withLabel: mem64tib { memory = 70368744177664.B }
withLabel: mem128tib { memory = 140737488355328.B }
withLabel: mem256tib { memory = 281474976710656.B }
withLabel: mem512tib { memory = 562949953421312.B }
withLabel: cpu1 { cpus = 1 }
withLabel: cpu2 { cpus = 2 }
withLabel: cpu5 { cpus = 5 }
withLabel: cpu10 { cpus = 10 }
withLabel: cpu20 { cpus = 20 }
withLabel: cpu50 { cpus = 50 }
withLabel: cpu100 { cpus = 100 }
withLabel: cpu200 { cpus = 200 }
withLabel: cpu500 { cpus = 500 }
withLabel: cpu1000 { cpus = 1000 }
}

View File

@@ -0,0 +1,106 @@
{
"$schema": "http://json-schema.org/draft-07/schema",
"title": "concat_text",
"description": "Concatenate a number of text files, handle gzipped text files gracefully and\noptionally gzip the output text file.\n\nThis component is useful for concatening fastq files from different lanes, for instance.\n",
"type": "object",
"definitions": {
"input arguments" : {
"title": "Input arguments",
"type": "object",
"description": "No description",
"properties": {
"input": {
"type":
"string",
"description": "Type: List of `file`, required, example: `input?.txt.gz`, multiple_sep: `\";\"`. A list of (gzipped) text files",
"help_text": "Type: List of `file`, required, example: `input?.txt.gz`, multiple_sep: `\";\"`. A list of (gzipped) text files."
}
}
},
"output arguments" : {
"title": "Output arguments",
"type": "object",
"description": "No description",
"properties": {
"gzip_output": {
"type":
"boolean",
"description": "Type: `boolean_true`, default: `false`. Should the output be zipped?",
"help_text": "Type: `boolean_true`, default: `false`. Should the output be zipped?"
,
"default": "False"
}
,
"output": {
"type":
"string",
"description": "Type: `file`, default: `$id.$key.output.txt`, example: `output.txt`. File to write the output to, optionally gzipped",
"help_text": "Type: `file`, default: `$id.$key.output.txt`, example: `output.txt`. File to write the output to, optionally gzipped."
,
"default": "$id.$key.output.txt"
}
}
},
"nextflow input-output arguments" : {
"title": "Nextflow input-output arguments",
"type": "object",
"description": "Input/output parameters for Nextflow itself. Please note that both publishDir and publish_dir are supported but at least one has to be configured.",
"properties": {
"publish_dir": {
"type":
"string",
"description": "Type: `string`, required, example: `output/`. Path to an output directory",
"help_text": "Type: `string`, required, example: `output/`. Path to an output directory."
}
,
"param_list": {
"type":
"string",
"description": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel",
"help_text": "Type: `string`, example: `my_params.yaml`. Allows inputting multiple parameter sets to initialise a Nextflow channel. A `param_list` can either be a list of maps, a csv file, a json file, a yaml file, or simply a yaml blob.\n\n* A list of maps (as-is) where the keys of each map corresponds to the arguments of the pipeline. Example: in a `nextflow.config` file: `param_list: [ [\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027], [\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027] ]`.\n* A csv file should have column names which correspond to the different arguments of this pipeline. Example: `--param_list data.csv` with columns `id,input`.\n* A json or a yaml file should be a list of maps, each of which has keys corresponding to the arguments of the pipeline. Example: `--param_list data.json` with contents `[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]`.\n* A yaml blob can also be passed directly as a string. Example: `--param_list \"[ {\u0027id\u0027: \u0027foo\u0027, \u0027input\u0027: \u0027foo.txt\u0027}, {\u0027id\u0027: \u0027bar\u0027, \u0027input\u0027: \u0027bar.txt\u0027} ]\"`.\n\nWhen passing a csv, json or yaml file, relative path names are relativized to the location of the parameter file. No relativation is performed when `param_list` is a list of maps (as-is) or a yaml blob.",
"hidden": true
}
}
}
},
"allOf": [
{
"$ref": "#/definitions/input arguments"
},
{
"$ref": "#/definitions/output arguments"
},
{
"$ref": "#/definitions/nextflow input-output arguments"
}
]
}

View File

@@ -0,0 +1,232 @@
name: "create_eset"
namespace: "eset"
version: "v0.3.0"
authors:
- name: "Dries Schaumont"
roles:
- "maintainer"
info:
links:
email: "dries@data-intuitive.com"
github: "DriesSchaumont"
orcid: "0000-0002-4389-0440"
linkedin: "dries-schaumont"
organizations:
- name: "Data Intuitive"
href: "https://www.data-intuitive.com"
role: "Data Scientist"
- name: "Marijke Van Moerbeke"
roles:
- "author"
info:
links:
github: "mvanmoerbeke"
orcid: "0000-0002-3097-5621"
linkedin: "marijke-van-moerbeke-84303a34"
organizations:
- name: "OpenAnalytics"
href: "https://www.openanalytics.eu"
role: "Statistical Consultant"
argument_groups:
- name: "Arguments"
arguments:
- type: "file"
name: "--pDataFile"
info: null
must_exist: true
create_parent: true
required: true
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--fDataFile"
info: null
must_exist: true
create_parent: true
required: true
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--mappingDir"
info: null
must_exist: true
create_parent: true
required: true
direction: "input"
multiple: true
multiple_sep: ";"
- type: "string"
name: "--poolName"
info: null
required: true
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--output"
info: null
default:
- "eset.$id.rds"
must_exist: true
create_parent: true
required: true
direction: "output"
multiple: false
multiple_sep: ";"
resources:
- type: "r_script"
path: "script.R"
is_executable: true
- type: "file"
path: "nextflow_labels.config"
dest: "nextflow_labels.config"
test_resources:
- type: "r_script"
path: "test.R"
is_executable: true
- type: "file"
path: "pData.tsv"
- type: "file"
path: "fData.tsv"
- type: "file"
path: "mapping_dir"
info: null
status: "enabled"
requirements:
commands:
- "ps"
license: "MIT"
links:
repository: "https://github.com/viash-hub/htrnaseq"
runners:
- type: "executable"
id: "executable"
docker_setup_strategy: "ifneedbepullelsecachedbuild"
- type: "nextflow"
id: "nextflow"
directives:
tag: "$id"
auto:
simplifyInput: true
simplifyOutput: false
transcript: false
publish: false
config:
labels:
mem1gb: "memory = 1000000000.B"
mem2gb: "memory = 2000000000.B"
mem5gb: "memory = 5000000000.B"
mem10gb: "memory = 10000000000.B"
mem20gb: "memory = 20000000000.B"
mem50gb: "memory = 50000000000.B"
mem100gb: "memory = 100000000000.B"
mem200gb: "memory = 200000000000.B"
mem500gb: "memory = 500000000000.B"
mem1tb: "memory = 1000000000000.B"
mem2tb: "memory = 2000000000000.B"
mem5tb: "memory = 5000000000000.B"
mem10tb: "memory = 10000000000000.B"
mem20tb: "memory = 20000000000000.B"
mem50tb: "memory = 50000000000000.B"
mem100tb: "memory = 100000000000000.B"
mem200tb: "memory = 200000000000000.B"
mem500tb: "memory = 500000000000000.B"
mem1gib: "memory = 1073741824.B"
mem2gib: "memory = 2147483648.B"
mem4gib: "memory = 4294967296.B"
mem8gib: "memory = 8589934592.B"
mem16gib: "memory = 17179869184.B"
mem32gib: "memory = 34359738368.B"
mem64gib: "memory = 68719476736.B"
mem128gib: "memory = 137438953472.B"
mem256gib: "memory = 274877906944.B"
mem512gib: "memory = 549755813888.B"
mem1tib: "memory = 1099511627776.B"
mem2tib: "memory = 2199023255552.B"
mem4tib: "memory = 4398046511104.B"
mem8tib: "memory = 8796093022208.B"
mem16tib: "memory = 17592186044416.B"
mem32tib: "memory = 35184372088832.B"
mem64tib: "memory = 70368744177664.B"
mem128tib: "memory = 140737488355328.B"
mem256tib: "memory = 281474976710656.B"
mem512tib: "memory = 562949953421312.B"
cpu1: "cpus = 1"
cpu2: "cpus = 2"
cpu5: "cpus = 5"
cpu10: "cpus = 10"
cpu20: "cpus = 20"
cpu50: "cpus = 50"
cpu100: "cpus = 100"
cpu200: "cpus = 200"
cpu500: "cpus = 500"
cpu1000: "cpus = 1000"
script:
- "includeConfig(\"nextflow_labels.config\")"
debug: false
container: "docker"
engines:
- type: "docker"
id: "docker"
image: "rocker/r2u:24.04"
target_registry: "images.viash-hub.com"
target_tag: "v0.3.0"
namespace_separator: "/"
setup:
- type: "r"
cran:
- "data.table"
- "nlcv"
bioc:
- "Seurat"
bioc_force_install: false
test_setup:
- type: "r"
cran:
- "testthat"
bioc_force_install: false
entrypoint: []
cmd: null
- type: "native"
id: "native"
build_info:
config: "src/eset/create_eset/config.vsh.yaml"
runner: "executable"
engine: "docker|native"
output: "target/executable/eset/create_eset"
executable: "target/executable/eset/create_eset/create_eset"
viash_version: "0.9.0"
git_commit: "bc7a95f98ff78b2c49be97128d8b31e8d29daa6d"
git_remote: "https://x-access-token:ghs_7LDB6nHZEjlpesiFpOviJpZtnArMPy0dy3S4@github.com/viash-hub/htrnaseq"
package_config:
name: "htrnaseq"
version: "v0.3.0"
description: "High-throughput pipeline [WIP]\n"
info:
test_resources:
- path: "gs://viash-hub-test-data/htrnaseq/v1/"
dest: "resources_test"
viash_version: "0.9.0"
source: "src"
target: "target"
config_mods:
- ".requirements.commands := ['ps']\n.runners[.type == 'nextflow'].config.script\
\ := 'includeConfig(\"nextflow_labels.config\")'\n.resources += {path: '/src/config/labels.config',\
\ dest: 'nextflow_labels.config'}\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.3.0'"
keywords:
- "bioinformatics"
- "sequence"
- "high-throughput"
- "mapping"
- "counting"
- "pipeline"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/htrnaseq"
issue_tracker: "https://github.com/viash-hub/htrnaseq/issues"

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,108 @@
executor {
$k8s {
submitRateLimit = '10sec'
pollInterval = '1 sec'
}
}
process {
container = 'nextflow/bash:latest'
// default resources
memory = { 8.Gb * task.attempt }
cpus = 8
maxForks = 36
// Retry for exit codes that have something to do with memory issues
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
maxRetries = 3
maxMemory = 192.GB
// Resource labels
withLabel: verylowcpu { cpus = 2 }
withLabel: lowcpu { cpus = 8 }
withLabel: midcpu { cpus = 16 }
withLabel: highcpu { cpus = 32 }
withLabel: verylowmem { memory = { get_memory( 4.GB * task.attempt ) } }
withLabel: lowmem { memory = { get_memory( 8.GB * task.attempt ) } }
withLabel: midmem { memory = { get_memory( 16.GB * task.attempt ) } }
withLabel: highmem { memory = { get_memory( 64.GB * task.attempt ) } }
}
profiles {
// detect tempdir
tempDir = java.nio.file.Paths.get(
System.getenv('NXF_TEMP') ?:
System.getenv('VIASH_TEMP') ?:
System.getenv('TEMPDIR') ?:
System.getenv('TMPDIR') ?:
'/tmp'
).toAbsolutePath()
mount_temp {
docker.temp = tempDir
podman.temp = tempDir
charliecloud.temp = tempDir
}
no_publish {
process {
withName: '.*' {
publishDir = [
enabled: false
]
}
}
}
docker {
docker.fixOwnership = true
docker.enabled = true
// docker.userEmulation = true
singularity.enabled = false
podman.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
local {
// This config is for local processing.
process {
withName: ".*parallel_map_process" {
maxForks = 1
}
maxMemory = 25.GB
withLabel: verylowcpu { cpus = 2 }
withLabel: lowcpu { cpus = 4 }
withLabel: midcpu { cpus = 6 }
withLabel: highcpu { cpus = 8 }
withLabel: lowmem { memory = { get_memory( 8.GB * task.attempt ) } }
withLabel: midmem { memory = { get_memory( 12.GB * task.attempt ) } }
withLabel: highmem { memory = { get_memory( 20.GB * task.attempt ) } }
}
}
}
def get_memory(to_compare) {
if (!process.containsKey("maxMemory") || !process.maxMemory) {
return to_compare
}
try {
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
return process.maxMemory
}
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
return max_memory as nextflow.util.MemoryUnit
}
else {
return to_compare
}
} catch (all) {
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
System.exit(1)
}
}

View File

@@ -0,0 +1,211 @@
name: "create_fdata"
namespace: "eset"
version: "v0.3.0"
authors:
- name: "Dries Schaumont"
roles:
- "maintainer"
info:
links:
email: "dries@data-intuitive.com"
github: "DriesSchaumont"
orcid: "0000-0002-4389-0440"
linkedin: "dries-schaumont"
organizations:
- name: "Data Intuitive"
href: "https://www.data-intuitive.com"
role: "Data Scientist"
- name: "Marijke Van Moerbeke"
roles:
- "contributor"
info:
links:
github: "mvanmoerbeke"
orcid: "0000-0002-3097-5621"
linkedin: "marijke-van-moerbeke-84303a34"
organizations:
- name: "OpenAnalytics"
href: "https://www.openanalytics.eu"
role: "Statistical Consultant"
argument_groups:
- name: "Arguments"
arguments:
- type: "file"
name: "--gtf"
description: "Genome annotation file in GTF format."
info: null
must_exist: true
create_parent: true
required: true
direction: "input"
multiple: false
multiple_sep: ";"
- type: "file"
name: "--output"
description: "Tab-delimited text file containing information about the 'gene'\
\ or 'transcript'\nentries from the input GTF file. The 'transcript' entries\
\ are used in case the source\nof the GTF was 'refGene' or 'ncbiRefSeq'. \n"
info: null
default:
- "fData.$id.txt"
must_exist: true
create_parent: true
required: false
direction: "output"
multiple: false
multiple_sep: ";"
resources:
- type: "python_script"
path: "create_fdata.py"
is_executable: true
- type: "file"
path: "nextflow_labels.config"
dest: "nextflow_labels.config"
description: "Create a fdata file\n"
test_resources:
- type: "python_script"
path: "test.py"
is_executable: true
- type: "file"
path: "test_annotation.gtf"
info: null
status: "enabled"
requirements:
commands:
- "ps"
license: "MIT"
links:
repository: "https://github.com/viash-hub/htrnaseq"
runners:
- type: "executable"
id: "executable"
docker_setup_strategy: "ifneedbepullelsecachedbuild"
- type: "nextflow"
id: "nextflow"
directives:
tag: "$id"
auto:
simplifyInput: true
simplifyOutput: false
transcript: false
publish: false
config:
labels:
mem1gb: "memory = 1000000000.B"
mem2gb: "memory = 2000000000.B"
mem5gb: "memory = 5000000000.B"
mem10gb: "memory = 10000000000.B"
mem20gb: "memory = 20000000000.B"
mem50gb: "memory = 50000000000.B"
mem100gb: "memory = 100000000000.B"
mem200gb: "memory = 200000000000.B"
mem500gb: "memory = 500000000000.B"
mem1tb: "memory = 1000000000000.B"
mem2tb: "memory = 2000000000000.B"
mem5tb: "memory = 5000000000000.B"
mem10tb: "memory = 10000000000000.B"
mem20tb: "memory = 20000000000000.B"
mem50tb: "memory = 50000000000000.B"
mem100tb: "memory = 100000000000000.B"
mem200tb: "memory = 200000000000000.B"
mem500tb: "memory = 500000000000000.B"
mem1gib: "memory = 1073741824.B"
mem2gib: "memory = 2147483648.B"
mem4gib: "memory = 4294967296.B"
mem8gib: "memory = 8589934592.B"
mem16gib: "memory = 17179869184.B"
mem32gib: "memory = 34359738368.B"
mem64gib: "memory = 68719476736.B"
mem128gib: "memory = 137438953472.B"
mem256gib: "memory = 274877906944.B"
mem512gib: "memory = 549755813888.B"
mem1tib: "memory = 1099511627776.B"
mem2tib: "memory = 2199023255552.B"
mem4tib: "memory = 4398046511104.B"
mem8tib: "memory = 8796093022208.B"
mem16tib: "memory = 17592186044416.B"
mem32tib: "memory = 35184372088832.B"
mem64tib: "memory = 70368744177664.B"
mem128tib: "memory = 140737488355328.B"
mem256tib: "memory = 281474976710656.B"
mem512tib: "memory = 562949953421312.B"
cpu1: "cpus = 1"
cpu2: "cpus = 2"
cpu5: "cpus = 5"
cpu10: "cpus = 10"
cpu20: "cpus = 20"
cpu50: "cpus = 50"
cpu100: "cpus = 100"
cpu200: "cpus = 200"
cpu500: "cpus = 500"
cpu1000: "cpus = 1000"
script:
- "includeConfig(\"nextflow_labels.config\")"
debug: false
container: "docker"
engines:
- type: "docker"
id: "docker"
image: "python:3.12-slim"
target_registry: "images.viash-hub.com"
target_tag: "v0.3.0"
namespace_separator: "/"
setup:
- type: "apt"
packages:
- "procps"
interactive: false
- type: "python"
user: false
packages:
- "pandas"
upgrade: true
test_setup:
- type: "python"
user: false
packages:
- "viashpy"
upgrade: true
entrypoint: []
cmd: null
- type: "native"
id: "native"
build_info:
config: "src/eset/create_fdata/config.vsh.yaml"
runner: "executable"
engine: "docker|native"
output: "target/executable/eset/create_fdata"
executable: "target/executable/eset/create_fdata/create_fdata"
viash_version: "0.9.0"
git_commit: "bc7a95f98ff78b2c49be97128d8b31e8d29daa6d"
git_remote: "https://x-access-token:ghs_7LDB6nHZEjlpesiFpOviJpZtnArMPy0dy3S4@github.com/viash-hub/htrnaseq"
package_config:
name: "htrnaseq"
version: "v0.3.0"
description: "High-throughput pipeline [WIP]\n"
info:
test_resources:
- path: "gs://viash-hub-test-data/htrnaseq/v1/"
dest: "resources_test"
viash_version: "0.9.0"
source: "src"
target: "target"
config_mods:
- ".requirements.commands := ['ps']\n.runners[.type == 'nextflow'].config.script\
\ := 'includeConfig(\"nextflow_labels.config\")'\n.resources += {path: '/src/config/labels.config',\
\ dest: 'nextflow_labels.config'}\n"
- ".engines += { type: \"native\" }"
- ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
- ".engines[.type == 'docker'].target_tag := 'v0.3.0'"
keywords:
- "bioinformatics"
- "sequence"
- "high-throughput"
- "mapping"
- "counting"
- "pipeline"
license: "MIT"
organization: "vsh"
links:
repository: "https://github.com/viash-hub/htrnaseq"
issue_tracker: "https://github.com/viash-hub/htrnaseq/issues"

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,108 @@
executor {
$k8s {
submitRateLimit = '10sec'
pollInterval = '1 sec'
}
}
process {
container = 'nextflow/bash:latest'
// default resources
memory = { 8.Gb * task.attempt }
cpus = 8
maxForks = 36
// Retry for exit codes that have something to do with memory issues
errorStrategy = { task.exitStatus in 137..140 ? 'retry' : 'terminate' }
maxRetries = 3
maxMemory = 192.GB
// Resource labels
withLabel: verylowcpu { cpus = 2 }
withLabel: lowcpu { cpus = 8 }
withLabel: midcpu { cpus = 16 }
withLabel: highcpu { cpus = 32 }
withLabel: verylowmem { memory = { get_memory( 4.GB * task.attempt ) } }
withLabel: lowmem { memory = { get_memory( 8.GB * task.attempt ) } }
withLabel: midmem { memory = { get_memory( 16.GB * task.attempt ) } }
withLabel: highmem { memory = { get_memory( 64.GB * task.attempt ) } }
}
profiles {
// detect tempdir
tempDir = java.nio.file.Paths.get(
System.getenv('NXF_TEMP') ?:
System.getenv('VIASH_TEMP') ?:
System.getenv('TEMPDIR') ?:
System.getenv('TMPDIR') ?:
'/tmp'
).toAbsolutePath()
mount_temp {
docker.temp = tempDir
podman.temp = tempDir
charliecloud.temp = tempDir
}
no_publish {
process {
withName: '.*' {
publishDir = [
enabled: false
]
}
}
}
docker {
docker.fixOwnership = true
docker.enabled = true
// docker.userEmulation = true
singularity.enabled = false
podman.enabled = false
shifter.enabled = false
charliecloud.enabled = false
}
local {
// This config is for local processing.
process {
withName: ".*parallel_map_process" {
maxForks = 1
}
maxMemory = 25.GB
withLabel: verylowcpu { cpus = 2 }
withLabel: lowcpu { cpus = 4 }
withLabel: midcpu { cpus = 6 }
withLabel: highcpu { cpus = 8 }
withLabel: lowmem { memory = { get_memory( 8.GB * task.attempt ) } }
withLabel: midmem { memory = { get_memory( 12.GB * task.attempt ) } }
withLabel: highmem { memory = { get_memory( 20.GB * task.attempt ) } }
}
}
}
def get_memory(to_compare) {
if (!process.containsKey("maxMemory") || !process.maxMemory) {
return to_compare
}
try {
if (process.containsKey("maxRetries") && process.maxRetries && task.attempt == (process.maxRetries as int)) {
return process.maxMemory
}
else if (to_compare.compareTo(process.maxMemory as nextflow.util.MemoryUnit) == 1) {
return max_memory as nextflow.util.MemoryUnit
}
else {
return to_compare
}
} catch (all) {
println "Error processing memory resources. Please check that process.maxMemory '${process.maxMemory}' and process.maxRetries '${process.maxRetries}' are valid!"
System.exit(1)
}
}

Some files were not shown because too many files have changed in this diff Show More