vsh/biobox
1
0
Fork 0
Code Issues Pull Requests Actions Packages Projects Releases Wiki Activity

Build branch gatk_applybqsrspark with version gatk_applybqsrspark (c4ea23a)

Browse Source 
Build pipeline: viash-hub.biobox.gatk-applybqsrspark-jpq6r

Source commit: c4ea23a0f5

Source message: Add RSEM prepare reference component (#89)

* initial commit

* incorporaate some requested changes

* update test

* change argument reference_fasta_files to multiple true and update docker setup

* Update src/rsem/rsem_prepare_reference/config.vsh.yaml

Co-authored-by: Robrecht Cannoodt <rcannood@gmail.com>

* Update src/rsem/rsem_prepare_reference/config.vsh.yaml

Co-authored-by: Robrecht Cannoodt <rcannood@gmail.com>

* Update src/rsem/rsem_prepare_reference/script.sh

Co-authored-by: Robrecht Cannoodt <rcannood@gmail.com>

* set multiple true

* update changelog

* Apply suggestions from code review

* fix script

---------

Co-authored-by: Robrecht Cannoodt <rcannood@gmail.com>
This commit is contained in:
CI
2024-09-01 17:36:53 +00:00
commit 6df312e701
629 changed files with 365261 additions and 0 deletions
Download Patch File Download Diff File Expand all files Collapse all files

18
.gitignore vendored Normal file
View File

@@ -0,0 +1,18 @@
*.DS_Store
*__pycache__
# IDE ignores
.idea/
.vscode/
# R specific ignores
.Rhistory
.Rproj.user
*.Rproj
# viash specific ignores
target/
# nextflow specific ignores
.nextflow*
work

154
CHANGELOG.md Normal file
View File

@@ -0,0 +1,154 @@
# biobox x.x.x
## BREAKING CHANGES
* `star/star_align_reads`: Change all arguments from `--camelCase` to `--snake_case` (PR #62).
* `star/star_genome_generate`: Change all arguments from `--camelCase` to `--snake_case` (PR #62).
## NEW FUNCTIONALITY
* `star/star_align_reads`: Add star solo related arguments (PR #62).
* `bd_rhapsody/bd_rhapsody_make_reference`: Create a reference for the BD Rhapsody pipeline (PR #75).
* `umitools/umitools_dedup`: Deduplicate reads based on the mapping co-ordinate and the UMI attached to the read (PR #54).
* `seqtk`:
- `seqtk/seqtk_sample`: Subsamples sequences from FASTA/Q files (PR #68).
- `seqtk/seqtk_subseq`: Extract the sequences (complete or subsequence) from the FASTA/FASTQ files
based on a provided sequence IDs or region coordinates file (PR #85).
* `agat`:
- `agat/agat_convert_sp_gff2gtf`: convert any GTF/GFF file into a proper GTF file (PR #76).
- `agat/agat_convert_bed2gff`: convert bed file to gff format (PR #97).
- `agat/agat_convert_embl2gff`: convert an EMBL file into GFF format (PR #99).
- `agat/agat_convert_sp_gff2tsv`: convert gtf/gff file into tabulated file (PR #102).
- `agat/agat_convert_sp_gxf2gxf`: fixes and/or standardizes any GTF/GFF file into full sorted GTF/GFF file (PR #103).
* `bedtools`:
- `bedtools/bedtools_intersect`: Allows one to screen for overlaps between two sets of genomic features (PR #94).
- `bedtools/bedtools_sort`: Sorts a feature file (bed/gff/vcf) by chromosome and other criteria (PR #98).
- `bedtools/bedtools_bamtofastq`: Convert BAM alignments to FASTQ files (PR #101).
- `bedtools/bedtools_bedtobam`: Converts genomic feature records (bed/gff/vcf) to BAM format (PR #111).
* `qualimap/qualimap_rnaseq`: RNA-seq QC analysis using qualimap (PR #74).
* `rsem/rsem_prepare_reference`: Prepare transcript references for RSEM (PR #89).
## MINOR CHANGES
* `busco` components: update BUSCO to `5.7.1` (PR #72).
* Update CI to reusable workflow in `viash-io/viash-actions` (PR #86).
* Update several components in order to avoid duplicate code when using `unset` on boolean arguments (PR #133).
* Bump viash to `0.9.0-RC7` (PR #134)
## DOCUMENTATION
* Extend the contributing guidelines (PR #82):
- Update format to Viash 0.9.
- Descriptions should be formatted in markdown.
- Add defaults to descriptions, not as a default of the argument.
- Explain parameter expansion.
- Mention that the contents of the output of components in tests should be checked.
* Add authorship to existing components (PR #88).
## BUG FIXES
* `pear`: fix component not exiting with the correct exitcode when PEAR fails (PR #70).
* `cutadapt`: fix `--par_quality_cutoff_r2` argument (PR #69).
* `cutadapt`: demultiplexing is now disabled by default. It can be re-enabled by using `demultiplex_mode` (PR #69).
* `multiqc`: update multiple separator to `;` (PR #81).
# biobox 0.1.0
## NEW FEATURES
* `arriba`: Detect gene fusions from RNA-seq data (PR #1).
* `fastp`: An ultra-fast all-in-one FASTQ preprocessor (PR #3).
* `busco`:
- `busco/busco_run`: Assess genome assembly and annotation completeness with single copy orthologs (PR #6).
- `busco/busco_list_datasets`: Lists available busco datasets (PR #18).
- `busco/busco_download_datasets`: Download busco datasets (PR #19).
* `cutadapt`: Remove adapter sequences from high-throughput sequencing reads (PR #7).
* `featurecounts`: Assign sequence reads to genomic features (PR #11).
* `bgzip`: Add bgzip functionality to compress and decompress files (PR #13).
* `pear`: Paired-end read merger (PR #10).
* `lofreq/call`: Call variants from a BAM file (PR #17).
* `lofreq/indelqual`: Insert indel qualities into BAM file (PR #17).
* `multiqc`: Aggregate results from bioinformatics analyses across many samples into a single report (PR #42).
* `star`:
- `star/star_align_reads`: Align reads to a reference genome (PR #22).
- `star/star_genome_generate`: Generate a genome index for STAR alignment (PR #58).
* `gffread`: Validate, filter, convert and perform other operations on GFF files (PR #29).
* `salmon`:
- `salmon/salmon_index`: Create a salmon index for the transcriptome to use Salmon in the mapping-based mode (PR #24).
- `salmon/salmon_quant`: Transcript quantification from RNA-seq data (PR #24).
* `samtools`:
- `samtools/samtools_flagstat`: Counts the number of alignments in SAM/BAM/CRAM files for each FLAG type (PR #31).
- `samtools/samtools_idxstats`: Reports alignment summary statistics for a SAM/BAM/CRAM file (PR #32).
- `samtools/samtools_index`: Index SAM/BAM/CRAM files (PR #35).
- `samtools/samtools_sort`: Sort SAM/BAM/CRAM files (PR #36).
- `samtools/samtools_stats`: Reports alignment summary statistics for a BAM file (PR #39).
- `samtools/samtools_faidx`: Indexes FASTA files to enable random access to fasta and fastq files (PR #41).
- `samtools/samtools_collate`: Shuffles and groups reads in SAM/BAM/CRAM files together by their names (PR #42).
- `samtools/samtools_view`: Views and converts SAM/BAM/CRAM files (PR #48).
- `samtools/samtools_fastq`: Converts a SAM/BAM/CRAM file to FASTQ (PR #52).
- `samtools/samtools_fastq`: Converts a SAM/BAM/CRAM file to FASTA (PR #53).
* `umi_tools`:
-`umi_tools/umi_tools_extract`: Flexible removal of UMI sequences from fastq reads (PR #71).
* `falco`: A C++ drop-in replacement of FastQC to assess the quality of sequence read data (PR #43).
* `bedtools`:
- `bedtools_getfasta`: extract sequences from a FASTA file for each of the
intervals defined in a BED/GFF/VCF file (PR #59).
## MINOR CHANGES
* Uniformize component metadata (PR #23).
* Update to Viash 0.8.5 (PR #25).
* Update to Viash 0.9.0-RC3 (PR #51).
* Update to Viash 0.9.0-RC6 (PR #63).
* Switch to viash-hub/toolbox actions (PR #64).
## DOCUMENTATION
* Update README (PR #64).
## BUG FIXES
* Add escaping character before leading hashtag in the description field of the config file (PR #50).
* Format URL in biobase/bcl_convert description (PR #55).

439
CONTRIBUTING.md Normal file
View File

@@ -0,0 +1,439 @@
# Contributing guidelines
We encourage contributions from the community. To contribute:
1. **Fork the Repository**: Start by forking this repository to your account.
2. **Develop Your Component**: Create your Viash component, ensuring it aligns with our best practices (detailed below).
3. **Submit a Pull Request**: After testing your component, submit a pull request for review.
## Procedure of adding a component
### Step 1: Find a component to contribute
* Find a tool to contribute to this repo.
* Check whether it is already in the [Project board](https://github.com/orgs/viash-hub/projects/1).
* Check whether there is a corresponding [Snakemake wrapper](https://github.com/snakemake/snakemake-wrappers/blob/master/bio) or [nf-core module](https://github.com/nf-core/modules/tree/master/modules/nf-core) which we can use as inspiration.
* Create an issue to show that you are working on this component.
### Step 2: Add config template
Change all occurrences of `xxx` to the name of the component.
Create a file at `src/xxx/config.vsh.yaml` with contents:
```yaml
name: xxx
description: xxx
keywords: [tag1, tag2]
links:
homepage: yyy
documentation: yyy
issue_tracker: yyy
repository: yyy
references:
doi: 12345/12345678.yz
license: MIT/Apache-2.0/GPL-3.0/...
argument_groups:
- name: Inputs
arguments: <...>
- name: Outputs
arguments: <...>
- name: Arguments
arguments: <...>
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
- type: file
path: test_data
engines:
- <...>
runners:
- type: executable
- type: nextflow
```
### Step 3: Fill in the metadata
Fill in the relevant metadata fields in the config. Here is an example of the metadata of an existing component.
```yaml
name: arriba
description: Detect gene fusions from RNA-Seq data
keywords: [Gene fusion, RNA-Seq]
links:
homepage: https://arriba.readthedocs.io/en/latest/
documentation: https://arriba.readthedocs.io/en/latest/
repository: https://github.com/suhrig/arriba
issue_tracker: https://github.com/suhrig/arriba/issues
references:
doi: 10.1101/gr.257246.119
bibtex: |
@article{
... a bibtex entry in case the doi is not available ...
}
license: MIT
```
### Step 4: Find a suitable container
Google `biocontainer <name of component>` and find the container that is most suitable. Typically the link will be `https://quay.io/repository/biocontainers/xxx?tab=tags`.
If no such container is found, you can create a custom container in the next step.
### Step 5: Create help file
To help develop the component, we store the `--help` output of the tool in a file at `src/xxx/help.txt`.
````bash
cat <<EOF > src/xxx/help.txt
```sh
xxx --help
```
EOF
docker run quay.io/biocontainers/xxx:tag xxx --help >> src/xxx/help.txt
````
Notes:
* This help file has no functional purpose, but it is useful for the developer to see the help output of the tool.
* Some tools might not have a `--help` argument but instead have a `-h` argument. For example, for `arriba`, the help message is obtained by running `arriba -h`:
```bash
docker run quay.io/biocontainers/arriba:2.4.0--h0033a41_2 arriba -h
```
### Step 6: Create or fetch test data
To help develop the component, it's interesting to have some test data available. In most cases, we can use the test data from the Snakemake wrappers.
To make sure we can reproduce the test data in the future, we store the command to fetch the test data in a file at `src/xxx/test_data/script.sh`.
```bash
cat <<EOF > src/xxx/test_data/script.sh
# clone repo
if [ ! -d /tmp/snakemake-wrappers ]; then
git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers
fi
# copy test data
cp -r /tmp/snakemake-wrappers/bio/xxx/test/* src/xxx/test_data
EOF
```
The test data should be suitable for testing this component. Ensure that the test data is small enough: ideally <1KB, preferably <10KB, if need be <100KB.
### Step 7: Add arguments for the input files
By looking at the help file, we add the input arguments to the config file. Here is an example of the input arguments of an existing component.
For instance, in the [arriba help file](src/arriba/help.txt), we see the following:
Usage: arriba [-c Chimeric.out.sam] -x Aligned.out.bam \
-g annotation.gtf -a assembly.fa [-b blacklists.tsv] [-k known_fusions.tsv] \
[-t tags.tsv] [-p protein_domains.gff3] [-d structural_variants_from_WGS.tsv] \
-o fusions.tsv [-O fusions.discarded.tsv] \
[OPTIONS]
-x FILE File in SAM/BAM/CRAM format with main alignments as generated by STAR
(Aligned.out.sam). Arriba extracts candidate reads from this file.
Based on this information, we can add the following input arguments to the config file.
```yaml
argument_groups:
- name: Inputs
arguments:
- name: --bam
alternatives: -x
type: file
description: |
File in SAM/BAM/CRAM format with main alignments as generated by STAR
(`Aligned.out.sam`). Arriba extracts candidate reads from this file.
required: true
example: Aligned.out.bam
```
Check the [documentation](https://viash.io/reference/config/functionality/arguments) for more information on the format of input arguments.
Several notes:
* Argument names should be formatted in `--snake_case`. This means arguments like `--foo-bar` should be formatted as `--foo_bar`, and short arguments like `-f` should receive a longer name like `--foo`.
* Input arguments can have `multiple: true` to allow the user to specify multiple files.
* The description should be formatted in markdown.
### Step 8: Add arguments for the output files
By looking at the help file, we now also add output arguments to the config file.
For example, in the [arriba help file](src/arriba/help.txt), we see the following:
Usage: arriba [-c Chimeric.out.sam] -x Aligned.out.bam \
-g annotation.gtf -a assembly.fa [-b blacklists.tsv] [-k known_fusions.tsv] \
[-t tags.tsv] [-p protein_domains.gff3] [-d structural_variants_from_WGS.tsv] \
-o fusions.tsv [-O fusions.discarded.tsv] \
[OPTIONS]
-o FILE Output file with fusions that have passed all filters.
-O FILE Output file with fusions that were discarded due to filtering.
Based on this information, we can add the following output arguments to the config file.
```yaml
argument_groups:
- name: Outputs
arguments:
- name: --fusions
alternatives: -o
type: file
direction: output
description: |
Output file with fusions that have passed all filters.
required: true
example: fusions.tsv
- name: --fusions_discarded
alternatives: -O
type: file
direction: output
description: |
Output file with fusions that were discarded due to filtering.
required: false
example: fusions.discarded.tsv
```
Note:
* Preferably, these outputs should not be directories but files. For example, if a tool outputs a directory `foo/` containing files `foo/bar.txt` and `foo/baz.txt`, there should be two output arguments `--bar` and `--baz` (as opposed to one output argument which outputs the whole `foo/` directory).
### Step 9: Add arguments for the other arguments
Finally, add all other arguments to the config file. There are a few exceptions:
* Arguments related to specifying CPU and memory requirements are handled separately and should not be added to the config file.
* Arguments related to printing the information such as printing the version (`-v`, `--version`) or printing the help (`-h`, `--help`) should not be added to the config file.
* If the help lists defaults, do not add them as defaults but to the description. Example: `description: <Explanation of parameter>. Default: 10.`
### Step 10: Add a Docker engine
To ensure reproducibility of components, we require that all components are run in a Docker container.
```yaml
engines:
- type: docker
image: quay.io/biocontainers/xxx:0.1.0--py_0
```
The container should have your tool installed, as well as `ps`.
If you didn't find a suitable container in the previous step, you can create a custom container. For example:
```yaml
engines:
- type: docker
image: python:3.10
setup:
- type: python
packages: numpy
```
For more information on how to do this, see the [documentation](https://viash.io/guide/component/add-dependencies.html#steps-for-creating-a-custom-docker-platform).
Here is a list of base containers we can recommend:
* Bash: [`bash`](https://hub.docker.com/_/bash), [`ubuntu`](https://hub.docker.com/_/ubuntu)
* C#: [`ghcr.io/data-intuitive/dotnet-script`](https://github.com/data-intuitive/ghcr-dotnet-script/pkgs/container/dotnet-script)
* JavaScript: [`node`](https://hub.docker.com/_/node)
* Python: [`python`](https://hub.docker.com/_/python), [`nvcr.io/nvidia/pytorch`](https://catalog.ngc.nvidia.com/orgs/nvidia/containers/pytorch)
* R: [`eddelbuettel/r2u`](https://hub.docker.com/r/eddelbuettel/r2u), [`rocker/tidyverse`](https://hub.docker.com/r/rocker/tidyverse)
* Scala: [`sbtscala/scala-sbt`](https://hub.docker.com/r/sbtscala/scala-sbt)
### Step 11: Write a runner script
Next, we need to write a runner script that runs the tool with the input arguments. Create a Bash script named `src/xxx/script.sh` which runs the tool with the input arguments.
```bash
#!/bin/bash
## VIASH START
## VIASH END
# unset flags
[[ "$par_option" == "false" ]] && unset par_option
xxx \
--input "$par_input" \
--output "$par_output" \
${par_option:+--option}
```
When building a Viash component, Viash will automatically replace the `## VIASH START` and `## VIASH END` lines (and anything in between) with environment variables based on the arguments specified in the config.
As an example, this is what the Bash script for the `arriba` component looks like:
```bash
#!/bin/bash
## VIASH START
## VIASH END
# unset flags
[[ "$par_skip_duplicate_marking" == "false" ]] && unset par_skip_duplicate_marking
[[ "$par_extra_information" == "false" ]] && unset par_extra_information
[[ "$par_fill_gaps" == "false" ]] && unset par_fill_gaps
arriba \
-x "$par_bam" \
-a "$par_genome" \
-g "$par_gene_annotation" \
-o "$par_fusions" \
${par_known_fusions:+-k "${par_known_fusions}"} \
${par_blacklist:+-b "${par_blacklist}"} \
# ...
${par_extra_information:+-X} \
${par_fill_gaps:+-I}
```
Notes:
* If your arguments can contain special variables (e.g. `$`), you can use quoting (need to find a documentation page for this) to make sure you can use the string as input. Example: `-x ${par_bam@Q}`.
* Optional arguments can be passed to the command conditionally using Bash [parameter expansion](https://www.gnu.org/software/bash/manual/html_node/Shell-Parameter-Expansion.html). For example: `${par_known_fusions:+-k ${par_known_fusions@Q}}`
* If your tool allows for multiple inputs using a separator other than `;` (which is the default Viash multiple separator), you can substitute these values with a command like: `par_disable_filters=$(echo $par_disable_filters | tr ';' ',')`.
* If you have a lot of boolean variables that you would like to unset when the value is `false`, you can avoid duplicate code by using the following syntax:
```bash
unset_if_false=(
par_argument_1
par_argument_2
par_argument_3
par_argument_4
)
for par in ${unset_if_false[@]}; do
test_val="${!par}"
[[ "$test_val" == "false" ]] && unset $par
done
```
this code is equivalent to
```bash
[[ "$par_argument_1" == "false" ]] && unset par_argument_1
[[ "$par_argument_2" == "false" ]] && unset par_argument_2
[[ "$par_argument_3" == "false" ]] && unset par_argument_3
[[ "$par_argument_4" == "false" ]] && unset par_argument_4
```
### Step 12: Create test script
If the unit test requires test resources, these should be provided in the `test_resources` section of the component.
```yaml
test_resources:
- type: bash_script
path: test.sh
- type: file
path: test_data
```
Create a test script at `src/xxx/test.sh` that runs the component with the test data. This script should run the component (available with `$meta_executable`) with the test data and check if the output is as expected. The script should exit with a non-zero exit code if the output is not as expected. For example:
```bash
#!/bin/bash
set -e
## VIASH START
## VIASH END
#############################################
# helper functions
assert_file_exists() {
[ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
}
assert_file_doesnt_exist() {
[ ! -f "$1" ] || { echo "File '$1' exists but shouldn't" && exit 1; }
}
assert_file_empty() {
[ ! -s "$1" ] || { echo "File '$1' is not empty but should be" && exit 1; }
}
assert_file_not_empty() {
[ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
}
assert_file_contains() {
grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
}
assert_file_not_contains() {
grep -q "$2" "$1" && { echo "File '$1' contains '$2' but shouldn't" && exit 1; }
}
assert_file_contains_regex() {
grep -q -E "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
}
assert_file_not_contains_regex() {
grep -q -E "$2" "$1" && { echo "File '$1' contains '$2' but shouldn't" && exit 1; }
}
#############################################
echo "> Run $meta_name with test data"
"$meta_executable" \
--input "$meta_resources_dir/test_data/reads_R1.fastq" \
--output "output.txt" \
--option
echo ">> Check if output exists"
assert_file_exists "output.txt"
echo ">> Check if output is empty"
assert_file_not_empty "output.txt"
echo ">> Check if output is correct"
assert_file_contains "output.txt" "some expected output"
echo "> All tests succeeded!"
```
Notes:
* Do always check the contents of the output file. If the output is not deterministic, you can use regular expressions to check the output.
* If possible, generate your own test data instead of copying it from an external resource.
### Step 13: Create a `/var/software_versions.txt` file
For the sake of transparency and reproducibility, we require that the versions of the software used in the component are documented.
For now, this is managed by creating a file `/var/software_versions.txt` in the `setup` section of the Docker engine.
```yaml
engines:
- type: docker
image: quay.io/biocontainers/xxx:0.1.0--py_0
setup:
- type: docker
# note: /var/software_versions.txt should contain:
# arriba: "2.4.0"
run: |
echo "xxx: \"0.1.0\"" > /var/software_versions.txt
```

21
LICENSE Normal file
View File

@@ -0,0 +1,21 @@
MIT License
Copyright (c) 2024 Data Intuitive
Permission is hereby granted, free of charge, to any person obtaining a copy
of this software and associated documentation files (the "Software"), to deal
in the Software without restriction, including without limitation the rights
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
copies of the Software, and to permit persons to whom the Software is
furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in all
copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.

72
README.md Normal file
View File

@@ -0,0 +1,72 @@
# 🌱📦 biobox
[![ViashHub](https://img.shields.io/badge/ViashHub-biobox-7a4baa.png)](https://web.viash-hub.com/packages/biobox)
[![GitHub](https://img.shields.io/badge/GitHub-viash--hub%2Fbiobox-blue.png)](https://github.com/viash-hub/biobox)
[![GitHub
License](https://img.shields.io/github/license/viash-hub/biobox.png)](https://github.com/viash-hub/biobox/blob/main/LICENSE)
[![GitHub
Issues](https://img.shields.io/github/issues/viash-hub/biobox.png)](https://github.com/viash-hub/biobox/issues)
[![Viash
version](https://img.shields.io/badge/Viash-v0.9.0--RC6-blue)](https://viash.io)
A collection of bioinformatics tools for working with sequence data.
## Objectives
- **Reusability**: Facilitating the use of components across various
projects and contexts.
- **Reproducibility**: Ensuring that components are reproducible and can
be easily shared.
- **Best Practices**: Adhering to established standards in software
development and bioinformatics.
## Contributing
We encourage contributions from the community. To contribute:
1. **Fork the Repository**: Start by forking this repository to your
account.
2. **Develop Your Component**: Create your Viash component, ensuring it
aligns with our best practices (detailed below).
3. **Submit a Pull Request**: After testing your component, submit a
pull request for review.
## Contribution Guidelines
The contribution guidelines describes which steps you should follow to
contribute a component to this repository.
1. Find a component to contribute
2. Add config template
3. Fill in the metadata
4. Find a suitable container
5. Create help file
6. Create or fetch test data
7. Add arguments for the input files
8. Add arguments for the output files
9. Add arguments for the other arguments
10. Add a Docker engine
11. Write a runner script
12. Create test script
13. Create a `/var/software_versions.txt` file
See the
[CONTRIBUTING](https://github.com/viash-hub/biobox/blob/main/CONTRIBUTING.md)
file for more details.
## Support and Community
For support, questions, or to join our community:
- **Issues**: Submit questions or issues via the [GitHub issue
tracker](https://github.com/viash-hub/biobox/issues).
- **Discussions**: Join our discussions via [GitHub
Discussions](https://github.com/viash-hub/biobox/discussions).
## License
This repository is licensed under an MIT license. See the
[LICENSE](https://github.com/viash-hub/biobox/blob/main/LICENSE) file
for details.

62
README.qmd Normal file
View File

@@ -0,0 +1,62 @@
---
format: gfm
---
```{r setup, include=FALSE}
project <- yaml::read_yaml("_viash.yaml")
license <- paste0(project$links$repository, "/blob/main/LICENSE")
contributing <- paste0(project$links$repository, "/blob/main/CONTRIBUTING.md")
```
# 🌱📦 `r project$name`
[![ViashHub](https://img.shields.io/badge/ViashHub-`r project$name`-7a4baa)](https://web.viash-hub.com/packages/`r project$name`)
[![GitHub](https://img.shields.io/badge/GitHub-viash--hub%2F`r project$name`-blue)](`r project$links$repository`)
[![GitHub License](https://img.shields.io/github/license/viash-hub/`r project$name`)](`r license`)
[![GitHub Issues](https://img.shields.io/github/issues/viash-hub/`r project$name`)](`r project$links$issue_tracker`)
[![Viash version](https://img.shields.io/badge/Viash-v`r gsub("-", "--", project$viash_version)`-blue)](https://viash.io)
`r project$description`
## Objectives
- **Reusability**: Facilitating the use of components across various projects and contexts.
- **Reproducibility**: Ensuring that components are reproducible and can be easily shared.
- **Best Practices**: Adhering to established standards in software development and bioinformatics.
## Contributing
We encourage contributions from the community. To contribute:
1. **Fork the Repository**: Start by forking this repository to your account.
2. **Develop Your Component**: Create your Viash component, ensuring it aligns with our best practices (detailed below).
3. **Submit a Pull Request**: After testing your component, submit a pull request for review.
## Contribution Guidelines
The contribution guidelines describes which steps you should follow to contribute a component to this repository.
```{r echo=FALSE}
lines <- readr::read_lines("CONTRIBUTING.md")
index_start <- grep("^### Step [0-9]*:", lines)
index_end <- c(index_start[-1] - 1, length(lines))
name <- gsub("^### Step [0-9]*: *", "", lines[index_start])
knitr::asis_output(
paste(paste0(" 1. ", name, "\n"), collapse = "")
)
```
See the [CONTRIBUTING](`r contributing`) file for more details.
## Support and Community
For support, questions, or to join our community:
- **Issues**: Submit questions or issues via the [GitHub issue tracker](`r project$links$issue_tracker`).
- **Discussions**: Join our discussions via [GitHub Discussions](`r project$links$repository`/discussions).
## License
This repository is licensed under an MIT license. See the [LICENSE](`r license`) file for details.

13
_viash.yaml Normal file
View File

@@ -0,0 +1,13 @@
name: biobox
description: |
A collection of bioinformatics tools for working with sequence data.
license: MIT
keywords: [bioinformatics, modules, sequencing]
links:
issue_tracker: https://github.com/viash-hub/biobox/issues
repository: https://github.com/viash-hub/biobox
viash_version: 0.9.0-RC7
config_mods: |
.requirements.commands := ['ps']

3
main.nf Normal file
View File

@@ -0,0 +1,3 @@
workflow {
print("This is a dummy placeholder for pipeline execution. Please use the corresponding nf files for running pipelines.")
}

6
nextflow.config Normal file
View File

@@ -0,0 +1,6 @@
manifest {
name = "biobox"
version = "gatk_applybqsrspark"
defaultBranch = "main"
nextflowVersion = "!>=20.12.1-edge"
}

14
src/_authors/angela_o_pisco.yaml Normal file
View File

@@ -0,0 +1,14 @@
name: Angela Oliveira Pisco
info:
role: Contributor
links:
github: aopisco
orcid: "0000-0003-0142-2355"
linkedin: aopisco
organizations:
- name: Insitro
href: https://insitro.com
role: Director of Computational Biology
- name: Open Problems
href: https://openproblems.bio
role: Core Member

10
src/_authors/dorien_roosen.yaml Normal file
View File

@@ -0,0 +1,10 @@
name: Dorien Roosen
info:
links:
email: dorien@data-intuitive.com
github: dorien-er
linkedin: dorien-roosen
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Data Scientist

11
src/_authors/dries_schaumont.yaml Normal file
View File

@@ -0,0 +1,11 @@
name: Dries Schaumont
info:
links:
email: dries@data-intuitive.com
github: DriesSchaumont
orcid: "0000-0002-4389-0440"
linkedin: dries-schaumont
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Data Scientist

10
src/_authors/emma_rousseau.yaml Normal file
View File

@@ -0,0 +1,10 @@
name: Emma Rousseau
info:
links:
email: emma@data-intuitive.com
github: emmarousseau
linkedin: emmarousseau1
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Bioinformatician

10
src/_authors/jakub_majercik.yaml Normal file
View File

@@ -0,0 +1,10 @@
name: Jakub Majercik
info:
links:
email: jakub@data-intuitive.com
github: jakubmajercik
linkedin: jakubmajercik
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Bioinformatics Engineer

14
src/_authors/kai_waldrant.yaml Normal file
View File

@@ -0,0 +1,14 @@
name: Kai Waldrant
info:
links:
email: kai@data-intuitive.com
github: KaiWaldrant
orcid: "0009-0003-8555-1361"
linkedin: kaiwaldrant
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Bioinformatician
- name: Open Problems
href: https://openproblems.bio
role: Contributor

10
src/_authors/leila_paquay.yaml Normal file
View File

@@ -0,0 +1,10 @@
name: Leïla Paquay
info:
links:
email: leila@data-intuitive.com
github: Leila011
linkedin: leilapaquay
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Software Developer

14
src/_authors/robrecht_cannoodt.yaml Normal file
View File

@@ -0,0 +1,14 @@
name: Robrecht Cannoodt
info:
links:
email: robrecht@data-intuitive.com
github: rcannood
orcid: "0000-0003-3641-729X"
linkedin: robrechtcannoodt
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Data Science Engineer
- name: Open Problems
href: https://openproblems.bio
role: Core Member

10
src/_authors/sai_nirmayi_yasa.yaml Normal file
View File

@@ -0,0 +1,10 @@
name: Sai Nirmayi Yasa
info:
links:
email: nirmayi@data-intuitive.com
github: sainirmayi
linkedin: sai-nirmayi-yasa
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Junior Bioinformatics Researcher

10
src/_authors/theodoro_gasperin.yaml Normal file
View File

@@ -0,0 +1,10 @@
name: Theodoro Gasperin Terra Camargo
info:
links:
email: theodorogtc@gmail.com
github: tgaspe
linkedin: theodoro-gasperin-terra-camargo
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Bioinformatician

9
src/_authors/toni_verbeiren.yaml Normal file
View File

@@ -0,0 +1,9 @@
name: Toni Verbeiren
info:
links:
github: tverbeiren
linkedin: verbeiren
organizations:
- name: Data Intuitive
href: https://www.data-intuitive.com
role: Data Scientist and CEO

5
src/_authors/weiwei_schultz.yaml Normal file
View File

@@ -0,0 +1,5 @@
name: Weiwei Schultz
info:
organizations:
- name: Janssen R&D US
role: Associate Director Data Sciences

86
src/agat/agat_convert_bed2gff/config.vsh.yaml Normal file
View File

@@ -0,0 +1,86 @@
name: agat_convert_bed2gff
namespace: agat
description: |
The script takes a bed file as input, and will translate it in gff format. The BED format is described here The script converts 0-based, half-open [start-1, end) bed file to 1-based, closed [start, end] General Feature Format v3 (GFF3).
keywords: [gene annotations, GFF conversion]
links:
homepage: https://github.com/NBISweden/AGAT
documentation: https://agat.readthedocs.io/en/latest/tools/agat_convert_bed2gff.html
issue_tracker: https://github.com/NBISweden/AGAT/issues
repository: https://github.com/NBISweden/AGAT
references:
doi: 10.5281/zenodo.3552717
license: GPL-3.0
authors:
- __merge__: /src/_authors/leila_paquay.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --bed
description: Input bed file that will be converted.
type: file
required: true
direction: input
example: input.bed
- name: Outputs
arguments:
- name: --output
alternatives: [-o, --out, --outfile, --gff]
description: Output GFF file. If no output file is specified, the output will be written to STDOUT.
type: file
direction: output
required: true
example: output.gff
- name: Arguments
arguments:
- name: --source
description: |
The source informs about the tool used to produce the data and is stored in 2nd field of a gff file. Example: Stringtie, Maker, Augustus, etc. [default: data]
type: string
required: false
example: Stringtie
- name: --primary_tag
description: |
The primary_tag corresponds to the data type and is stored in 3rd field of a gff file. Example: gene, mRNA, CDS, etc. [default: gene]
type: string
required: false
example: gene
- name: --inflate_off
description: |
By default we inflate the block fields (blockCount, blockSizes, blockStarts) to create subfeatures of the main feature (primary_tag). The type of subfeature created is based on the inflate_type parameter. If you do not want this inflating behaviour you can deactivate it by using the --inflate_off option.
type: boolean_false
- name: --inflate_type
description: |
Feature type (3rd column in gff) created when inflate parameter activated [default: exon].
type: string
required: false
example: exon
- name: --verbose
description: add verbosity
type: boolean_true
- name: --config
alternatives: [-c]
description: |
Input agat config file. By default AGAT takes as input agat_config.yaml file from the working directory if any, otherwise it takes the orignal agat_config.yaml shipped with AGAT. To get the agat_config.yaml locally type: "agat config --expose". The --config option gives you the possibility to use your own AGAT config file (located elsewhere or named differently).
type: file
required: false
example: custom_agat_config.yaml
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
- type: file
path: test_data
engines:
- type: docker
image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
setup:
- type: docker
run: |
agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

89
src/agat/agat_convert_bed2gff/help.txt Normal file
View File

@@ -0,0 +1,89 @@
```sh
agat_convert_bed2gff.pl --help
```
------------------------------------------------------------------------------
| Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0 |
| https://github.com/NBISweden/AGAT |
| National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se |
------------------------------------------------------------------------------
Name:
agat_convert_bed2gff.pl
Description:
The script takes a bed file as input, and will translate it in gff
format. The BED format is described here:
https://genome.ucsc.edu/FAQ/FAQformat.html#format1 The script converts
0-based, half-open [start-1, end) bed file to 1-based, closed [start,
end] General Feature Format v3 (GFF3).
Usage:
agat_convert_bed2gff.pl --bed infile.bed [ -o outfile ]
agat_convert_bed2gff.pl -h
Options:
--bed Input bed file that will be converted.
--source
The source informs about the tool used to produce the data and
is stored in 2nd field of a gff file. Example:
Stringtie,Maker,Augustus,etc. [default: data]
--primary_tag
The primary_tag corresponds to the data type and is stored in
3rd field of a gff file. Example: gene,mRNA,CDS,etc. [default:
gene]
--inflate_off
By default we inflate the block fields (blockCount, blockSizes,
blockStarts) to create subfeatures of the main feature
(primary_tag). The type of subfeature created is based on the
inflate_type parameter. If you do not want this inflating
behaviour you can deactivate it by using the --inflate_off
option.
--inflate_type
Feature type (3rd column in gff) created when inflate parameter
activated [default: exon].
--verbose
add verbosity
-o , --output , --out , --outfile or --gff
Output GFF file. If no output file is specified, the output will
be written to STDOUT.
-c or --config
String - Input agat config file. By default AGAT takes as input
agat_config.yaml file from the working directory if any,
otherwise it takes the orignal agat_config.yaml shipped with
AGAT. To get the agat_config.yaml locally type: "agat config
--expose". The --config option gives you the possibility to use
your own AGAT config file (located elsewhere or named
differently).
-h or --help
Display this helpful text.
Feedback:
Did you find a bug?:
Do not hesitate to report bugs to help us keep track of the bugs and
their resolution. Please use the GitHub issue tracking system available
at this address:
https://github.com/NBISweden/AGAT/issues
Ensure that the bug was not already reported by searching under Issues.
If you're unable to find an (open) issue addressing the problem, open a new one.
Try as much as possible to include in the issue when relevant:
- a clear description,
- as much relevant information as possible,
- the command used,
- a data sample,
- an explanation of the expected behaviour that is not occurring.
Do you want to contribute?:
You are very welcome, visit this address for the Contributing
guidelines:
https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md

19
src/agat/agat_convert_bed2gff/script.sh Normal file
View File

@@ -0,0 +1,19 @@
#!/bin/bash
## VIASH START
## VIASH END
# unset flags
[[ "$par_inflate_off" == "true" ]] && unset par_inflate_off
[[ "$par_verbose" == "false" ]] && unset par_verbose
# run agat_convert_sp_bed2gff.pl
agat_convert_bed2gff.pl \
--bed "$par_bed" \
-o "$par_output" \
${par_source:+--source "${par_source}"} \
${par_primary_tag:+--primary_tag "${par_primary_tag}"} \
${par_inflate_off:+--inflate_off} \
${par_inflate_type:+--inflate_type "${par_inflate_type}"} \
${par_verbose:+--verbose}
${par_config:+--config "${par_config}"} \

27
src/agat/agat_convert_bed2gff/test.sh Normal file
View File

@@ -0,0 +1,27 @@
#!/bin/bash
## VIASH START
## VIASH END
test_dir="${meta_resources_dir}/test_data"
out_dir="${meta_resources_dir}/out_data"
echo "> Run $meta_name with test data"
"$meta_executable" \
--bed "$test_dir/test.bed" \
--output "$out_dir/output.gff"
echo ">> Checking output"
[ ! -f "$out_dir/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
echo ">> Check if output is empty"
[ ! -s "$out_dir/output.gff" ] && echo "Output file output.gff is empty" && exit 1
echo ">> Check if output matches expected output"
diff "$out_dir/output.gff" "$test_dir/agat_convert_bed2gff_1.gff"
if [ $? -ne 0 ]; then
echo "Output file output.gff does not match expected output"
exit 1
fi
echo "> Test successful"

12
src/agat/agat_convert_bed2gff/test_data/agat_convert_bed2gff_1.gff Normal file
View File

@@ -0,0 +1,12 @@
##gff-version 3
scaffold625 data gene 337818 343277 . + . ID=1;Name=CLUHART00000008717;blockCount=4;blockSizes=154%2C109%2C111%2C1314;blockStarts=0%2C2915%2C3700%2C4146;itemRgb=255%2C0%2C0;thickEnd=343033;thickStart=337914
scaffold625 data exon 337818 337971 . + . ID=exon1;Parent=1
scaffold625 data exon 340733 340841 . + . ID=exon2;Parent=1
scaffold625 data exon 341518 341628 . + . ID=exon3;Parent=1
scaffold625 data exon 341964 343277 . + . ID=exon4;Parent=1
scaffold625 data CDS 337915 337971 . + 0 ID=CDS1;Parent=1
scaffold625 data CDS 340733 340841 . + 0 ID=CDS2;Parent=1
scaffold625 data CDS 341518 341628 . + 2 ID=CDS3;Parent=1
scaffold625 data CDS 341964 343033 . + 2 ID=CDS4;Parent=1
scaffold625 data five_prime_UTR 337818 337914 . + . ID=five_prime_UTR1;Parent=1
scaffold625 data three_prime_UTR 343034 343277 . + . ID=three_prime_UTR1;Parent=1

10
src/agat/agat_convert_bed2gff/test_data/script.sh Executable file
View File

@@ -0,0 +1,10 @@
#!/bin/bash
# clone repo
if [ ! -d /tmp/agat_source ]; then
git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
fi
# copy test data
cp -r /tmp/agat_source/t/scripts_output/in/test.bed src/agat/agat_convert_bed2gff/test_data/test.bed
cp -r /tmp/agat_source/t/scripts_output/out/agat_convert_bed2gff_1.gff src/agat/agat_convert_bed2gff/test_data/agat_convert_bed2gff_1.gff

1
src/agat/agat_convert_bed2gff/test_data/test.bed Normal file
View File

@@ -0,0 +1 @@
scaffold625 337817 343277 CLUHART00000008717 0 + 337914 343033 255,0,0 4 154,109,111,1314 0,2915,3700,4146

84
src/agat/agat_convert_embl2gff/config.vsh.yaml Normal file
View File

@@ -0,0 +1,84 @@
name: agat_convert_embl2gff
namespace: agat
description: |
The script takes an EMBL file as input, and will translate it in gff format.
keywords: [gene annotations, GFF conversion]
links:
homepage: https://github.com/NBISweden/AGAT
documentation: https://agat.readthedocs.io/en/latest/tools/agat_convert_embl2gff.html
issue_tracker: https://github.com/NBISweden/AGAT/issues
repository: https://github.com/NBISweden/AGAT
references:
doi: 10.5281/zenodo.3552717
license: GPL-3.0
authors:
- __merge__: /src/_authors/leila_paquay.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --embl
description: Input EMBL file that will be read.
type: file
required: true
direction: input
example: input.embl
- name: Outputs
arguments:
- name: --output
alternatives: [-o, --out, --outfile, --gff]
description: Output GFF file. If no output file is specified, the output will be written to STDOUT.
type: file
direction: output
required: false
example: output.gff
- name: Arguments
arguments:
- name: --emblmygff3
description: |
Means that the EMBL flat file comes from the EMBLmyGFF3 software. This is an EMBL format dedicated for submission and contains particularity to deal with. This parameter is needed to get a proper sequence id in the GFF3 from an embl made with EMBLmyGFF3.
type: boolean_true
- name: --primary_tag
alternatives: [--pt, -t]
description: |
List of "primary tag". Useful to discard or keep specific features. Multiple tags must be comma-separated.
type: string
multiple: true
required: false
example: [tag1, tag2]
- name: --discard
alternatives: [-d]
description: |
Means that primary tags provided by the option "primary_tag" will be discarded.
type: boolean_true
- name: --keep
alternatives: [-k]
description: |
Means that only primary tags provided by the option "primary_tag" will be kept.
type: boolean_true
- name: --config
alternatives: [-c]
description: |
Input agat config file. By default AGAT takes as input agat_config.yaml file from the working directory if any, otherwise it takes the original agat_config.yaml shipped with AGAT. To get the agat_config.yaml locally type: "agat config --expose". The --config option gives you the possibility to use your own AGAT config file (located elsewhere or named differently).
type: file
required: false
example: custom_agat_config.yaml
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
- type: file
path: test_data
engines:
- type: docker
image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
setup:
- type: docker
run: |
agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

78
src/agat/agat_convert_embl2gff/help.txt Normal file
View File

@@ -0,0 +1,78 @@
```sh
agat_convert_embl2gff.pl --help
```
------------------------------------------------------------------------------
| Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0 |
| https://github.com/NBISweden/AGAT |
| National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se |
------------------------------------------------------------------------------
Name:
agat_converter_embl2gff.pl
Description:
The script takes an EMBL file as input, and will translate it in gff
format.
Usage:
agat_converter_embl2gff.pl --embl infile.embl [ -o outfile ]
Options:
--embl Input EMBL file that will be read
--emblmygff3
Bolean - Means that the EMBL flat file comes from the EMBLmyGFF3
software. This is an EMBL format dedicated for submission and
contains particularity to deal with. This parameter is needed to
get a proper sequence id in the GFF3 from an embl made with
EMBLmyGFF3.
--primary_tag, --pt, -t
List of "primary tag". Useful to discard or keep specific
features. Multiple tags must be coma-separated.
-d Bolean - Means that primary tags provided by the option
"primary_tag" will be discarded.
-k Bolean - Means that only primary tags provided by the option
"primary_tag" will be kept.
-o, --output, --out, --outfile or --gff
Output GFF file. If no output file is specified, the output will
be written to STDOUT.
-c or --config
String - Input agat config file. By default AGAT takes as input
agat_config.yaml file from the working directory if any,
otherwise it takes the orignal agat_config.yaml shipped with
AGAT. To get the agat_config.yaml locally type: "agat config
--expose". The --config option gives you the possibility to use
your own AGAT config file (located elsewhere or named
differently).
-h or --help
Display this helpful text.
Feedback:
Did you find a bug?:
Do not hesitate to report bugs to help us keep track of the bugs and
their resolution. Please use the GitHub issue tracking system available
at this address:
https://github.com/NBISweden/AGAT/issues
Ensure that the bug was not already reported by searching under Issues.
If you're unable to find an (open) issue addressing the problem, open a new one.
Try as much as possible to include in the issue when relevant:
- a clear description,
- as much relevant information as possible,
- the command used,
- a data sample,
- an explanation of the expected behaviour that is not occurring.
Do you want to contribute?:
You are very welcome, visit this address for the Contributing
guidelines:
https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md

23
src/agat/agat_convert_embl2gff/script.sh Normal file
View File

@@ -0,0 +1,23 @@
#!/bin/bash
## VIASH START
## VIASH END
# unset flags
[[ "$par_emblmygff3" == "false" ]] && unset par_emblmygff3
[[ "$par_discard" == "false" ]] && unset par_discard
[[ "$par_keep" == "false" ]] && unset par_keep
# replace ';' with ','
par_primary_tag=$(echo $par_primary_tag | tr ';' ',')
# run agat_convert_embl2gff
agat_convert_embl2gff.pl \
--embl "$par_embl" \
-o "$par_output" \
${par_emblmygff3:+--emblmygff3} \
${par_primary_tag:+--primary_tag "${par_primary_tag}"} \
${par_discard:+-d} \
${par_keep:+-k} \
${par_config:+--config "${par_config}"}

28
src/agat/agat_convert_embl2gff/test.sh Normal file
View File

@@ -0,0 +1,28 @@
#!/bin/bash
## VIASH START
## VIASH END
test_dir="${meta_resources_dir}/test_data"
out_dir="${meta_resources_dir}/out_data"
echo "> Run $meta_name with test data and --emblmygff3"
"$meta_executable" \
--embl "$test_dir/agat_convert_embl2gff_1.embl" \
--output "$out_dir/output.gff" \
--emblmygff3
echo ">> Checking output"
[ ! -f "$out_dir/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
echo ">> Check if output is empty"
[ ! -s "$out_dir/output.gff" ] && echo "Output file output.gff is empty" && exit 1
echo ">> Check if output matches expected output"
diff "$out_dir/output.gff" "$test_dir/agat_convert_embl2gff_1.gff"
if [ $? -ne 0 ]; then
echo "Output file output.gff does not match expected output"
exit 1
fi
echo "> Test successful"

51
src/agat/agat_convert_embl2gff/test_data/agat_convert_embl2gff_1.embl Normal file
View File

@@ -0,0 +1,51 @@
ID patatrac; SV 1; circular; genomic DNA; XXX; PRO; 317941 BP.
XX
AC XXX;
XX
AC * _ERS324955|SC|contig000001
XX
PR Project:PRJEBNNNN;
XX
DE XXX
XX
RN [1]
RP 1-2149
RA XXX;
RT ;
RL Submitted {(DD-MMM-YYYY)} to the INSDC.
XX
FH Key Location/Qualifiers
FH
FT source 1..588788
FT /organism={"scientific organism name"}
FT /mol_type={"in vivo molecule type of sequence"}
XX
SQ Sequence 588788 BP; 101836 A; 193561 C; 192752 G; 100639 T; 0 other;
tgcgtactcg aagagacgcg cccagattat ataagggcgt cgtctcgagg ccgacggcgc 60
gccggcgagt acgcgtgatc cacaacccga agcgaccgtc gggagaccga gggtcgtcga 120
gggtggatac gttcctgcct tcgtgccggg aaacggccga agggaacgtg gcgacctgcg 180
//
ID fdssf; SV 1; circular; genomic DNA; XXX; PRO; 317941 BP.
XX
AC XXX;
XX
AC * _ERS344554
XX
PR Project:PRJEBNNNN;
XX
DE XXX
XX
RN [1]
RP 1-2149
RA XXX;
RT ;
RL Submitted {(DD-MMM-YYYY)} to the INSDC.
XX
FH Key Location/Qualifiers
FH
FT source 1..588788
FT /organism={"scientific organism name"}
FT /mol_type={"in vivo molecule type of sequence"}
XX
SQ Sequence 588788 BP; 101836 A; 193561 C; 192752 G; 100639 T; 0 other;
TTTTTTTTTT aagagacgcg cccagattat ataagggcgt cgtctcgagg ccgacggcgc 60

10
src/agat/agat_convert_embl2gff/test_data/agat_convert_embl2gff_1.gff Normal file
View File

@@ -0,0 +1,10 @@
##gff-version 3
ERS324955|SC|contig000001 EMBL/GenBank/SwissProt source 1 588788 . + 1 mol_type={"in vivo molecule type of sequence"};organism={"scientific organism name"}
ERS344554 EMBL/GenBank/SwissProt source 1 588788 . + 1 mol_type={"in vivo molecule type of sequence"};organism={"scientific organism name"}
##FASTA
>ERS324955|SC|contig000001 XXX
TGCGTACTCGAAGAGACGCGCCCAGATTATATAAGGGCGTCGTCTCGAGGCCGACGGCGCGCCGGCGAGTACGCGTGATC
CACAACCCGAAGCGACCGTCGGGAGACCGAGGGTCGTCGAGGGTGGATACGTTCCTGCCTTCGTGCCGGGAAACGGCCGA
AGGGAACGTGGCGACCTGCG
>ERS344554 XXX
TTTTTTTTTTAAGAGACGCGCCCAGATTATATAAGGGCGTCGTCTCGAGGCCGACGGCGC

10
src/agat/agat_convert_embl2gff/test_data/script.sh Executable file
View File

@@ -0,0 +1,10 @@
#!/bin/bash
# clone repo
if [ ! -d /tmp/agat_source ]; then
git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
fi
# copy test data
cp -r /tmp/agat_source/t/scripts_output/in/agat_convert_embl2gff_1.embl src/agat/agat_convert_embl2gff/test_data/agat_convert_embl2gff_1.embl
cp -r /tmp/agat_source/t/scripts_output/out/agat_convert_embl2gff_1.gff src/agat/agat_convert_embl2gff/test_data/agat_convert_embl2gff_1.gff

94
src/agat/agat_convert_sp_gff2gtf/config.vsh.yaml Normal file
View File

@@ -0,0 +1,94 @@
name: agat_convert_sp_gff2gtf
namespace: agat
description: |
The script aims to convert any GTF/GFF file into a proper GTF file. Full
information about the format can be found here:
https://agat.readthedocs.io/en/latest/gxf.html You can choose among 7
different GTF types (1, 2, 2.1, 2.2, 2.5, 3 or relax). Depending the
version selected the script will filter out the features that are not
accepted. For GTF2.5 and 3, every level1 feature (e.g nc_gene
pseudogene) will be converted into gene feature and every level2 feature
(e.g mRNA ncRNA) will be converted into transcript feature. Using the
"relax" option you will produce a GTF-like output keeping all original
feature types (3rd column). No modification will occur e.g. mRNA to
transcript.
To be fully GTF compliant all feature have a gene_id and a transcript_id
attribute. The gene_id is unique identifier for the genomic source of
the transcript, which is used to group transcripts into genes. The
transcript_id is a unique identifier for the predicted transcript, which
is used to group features into transcripts.
keywords: [gene annotations, GTF conversion]
links:
homepage: https://github.com/NBISweden/AGAT
documentation: https://agat.readthedocs.io/
issue_tracker: https://github.com/NBISweden/AGAT/issues
repository: https://github.com/NBISweden/AGAT
references:
doi: 10.5281/zenodo.3552717
license: GPL-3.0
authors:
- __merge__: /src/_authors/leila_paquay.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --gff
alternatives: [-i]
description: Input GFF/GTF file that will be read
type: file
required: true
direction: input
example: input.gff
- name: Outputs
arguments:
- name: --output
alternatives: [-o, --out, --outfile, --gtf]
description: Output GTF file. If no output file is specified, the output will be written to STDOUT.
type: file
direction: output
required: true
example: output.gtf
- name: Arguments
arguments:
- name: --gtf_version
description: |
Version of the GTF output (1,2,2.1,2.2,2.5,3 or relax). Default value from AGAT config file (relax for the default config). The script option has the higher priority.
* relax: all feature types are accepted.
* GTF3 (9 feature types accepted): gene, transcript, exon, CDS, Selenocysteine, start_codon, stop_codon, three_prime_utr and five_prime_utr.
* GTF2.5 (8 feature types accepted): gene, transcript, exon, CDS, UTR, start_codon, stop_codon, Selenocysteine.
* GTF2.2 (9 feature types accepted): CDS, start_codon, stop_codon, 5UTR, 3UTR, inter, inter_CNS, intron_CNS and exon.
* GTF2.1 (6 feature types accepted): CDS, start_codon, stop_codon, exon, 5UTR, 3UTR.
* GTF2 (4 feature types accepted): CDS, start_codon, stop_codon, exon.
* GTF1 (5 feature types accepted): CDS, start_codon, stop_codon, exon, intron.
type: string
choices: [relax, "1", "2", "2.1", "2.2", "2.5", "3"]
required: false
example: "3"
- name: --config
alternatives: [-c]
description: |
Input agat config file. By default AGAT takes as input agat_config.yaml file from the working directory if any, otherwise it takes the orignal agat_config.yaml shipped with AGAT. To get the agat_config.yaml locally type: "agat config --expose". The --config option gives you the possibility to use your own AGAT config file (located elsewhere or named differently).
type: file
required: false
example: custom_agat_config.yaml
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
- type: file
path: test_data
engines:
- type: docker
image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
setup:
- type: docker
run: |
agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

102
src/agat/agat_convert_sp_gff2gtf/help.txt Normal file
View File

@@ -0,0 +1,102 @@
```sh
agat_convert_sp_gff2gtf.pl --help
```
------------------------------------------------------------------------------
| Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0 |
| https://github.com/NBISweden/AGAT |
| National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se |
------------------------------------------------------------------------------
Name:
agat_convert_sp_gff2gtf.pl
Description:
The script aims to convert any GTF/GFF file into a proper GTF file. Full
information about the format can be found here:
https://agat.readthedocs.io/en/latest/gxf.html You can choose among 7
different GTF types (1, 2, 2.1, 2.2, 2.5, 3 or relax). Depending the
version selected the script will filter out the features that are not
accepted. For GTF2.5 and 3, every level1 feature (e.g nc_gene
pseudogene) will be converted into gene feature and every level2 feature
(e.g mRNA ncRNA) will be converted into transcript feature. Using the
"relax" option you will produce a GTF-like output keeping all original
feature types (3rd column). No modification will occur e.g. mRNA to
transcript.
To be fully GTF compliant all feature have a gene_id and a transcript_id
attribute. The gene_id is unique identifier for the genomic source of
the transcript, which is used to group transcripts into genes. The
transcript_id is a unique identifier for the predicted transcript, which
is used to group features into transcripts.
Usage:
agat_convert_sp_gff2gtf.pl --gff infile.gff [ -o outfile ]
agat_convert_sp_gff2gtf -h
Options:
--gff, --gtf or -i
Input GFF/GTF file that will be read
--gtf_version version of the GTF output (1,2,2.1,2.2,2.5,3 or relax).
Default value from AGAT config file (relax for the default config). The
script option has the higher priority.
relax: all feature types are accepted.
GTF3 (9 feature types accepted): gene, transcript, exon, CDS,
Selenocysteine, start_codon, stop_codon, three_prime_utr and
five_prime_utr
GTF2.5 (8 feature types accepted): gene, transcript, exon, CDS,
UTR, start_codon, stop_codon, Selenocysteine
GTF2.2 (9 feature types accepted): CDS, start_codon, stop_codon,
5UTR, 3UTR, inter, inter_CNS, intron_CNS and exon
GTF2.1 (6 feature types accepted): CDS, start_codon, stop_codon,
exon, 5UTR, 3UTR
GTF2 (4 feature types accepted): CDS, start_codon, stop_codon,
exon
GTF1 (5 feature types accepted): CDS, start_codon, stop_codon,
exon, intron
-o , --output , --out , --outfile or --gtf
Output GTF file. If no output file is specified, the output will
be written to STDOUT.
-c or --config
String - Input agat config file. By default AGAT takes as input
agat_config.yaml file from the working directory if any,
otherwise it takes the orignal agat_config.yaml shipped with
AGAT. To get the agat_config.yaml locally type: "agat config
--expose". The --config option gives you the possibility to use
your own AGAT config file (located elsewhere or named
differently).
-h or --help
Display this helpful text.
Feedback:
Did you find a bug?:
Do not hesitate to report bugs to help us keep track of the bugs and
their resolution. Please use the GitHub issue tracking system available
at this address:
https://github.com/NBISweden/AGAT/issues
Ensure that the bug was not already reported by searching under Issues.
If you're unable to find an (open) issue addressing the problem, open a new one.
Try as much as possible to include in the issue when relevant:
- a clear description,
- as much relevant information as possible,
- the command used,
- a data sample,
- an explanation of the expected behaviour that is not occurring.
Do you want to contribute?:
You are very welcome, visit this address for the Contributing
guidelines:
https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md

10
src/agat/agat_convert_sp_gff2gtf/script.sh Normal file
View File

@@ -0,0 +1,10 @@
#!/bin/bash
## VIASH START
## VIASH END
agat_convert_sp_gff2gtf.pl \
-i "$par_gff" \
-o "$par_output" \
${par_gtf_version:+--gtf_version "${par_gtf_version}"} \
${par_config:+--config "${par_config}"}

37
src/agat/agat_convert_sp_gff2gtf/test.sh Normal file
View File

@@ -0,0 +1,37 @@
#!/bin/bash
## VIASH START
## VIASH END
test_dir="${meta_resources_dir}/test_data"
echo "> Run $meta_name with test data"
"$meta_executable" \
--gff "$test_dir/0_test.gff" \
--output "output.gtf"
echo ">> Checking output"
[ ! -f "output.gtf" ] && echo "Output file output.gtf does not exist" && exit 1
echo ">> Check if output is empty"
[ ! -s "output.gtf" ] && echo "Output file output.gtf is empty" && exit 1
echo ">> Check if the conversion resulted in the right GTF format"
idGFF=$(head -n 2 "$test_dir/0_test.gff" | grep -o 'ID=[^;]*' | cut -d '=' -f 2-)
expectedGTF="gene_id \"$idGFF\"; ID \"$idGFF\";"
extractedGTF=$(head -n 3 "output.gtf" | grep -o 'gene_id "[^"]*"; ID "[^"]*";')
[ "$extractedGTF" != "$expectedGTF" ] && echo "Output file output.gtf does not have the right format" && exit 1
rm output.gtf
echo "> Run $meta_name with test data and GTF version 2.5"
"$meta_executable" \
--gff "$test_dir/0_test.gff" \
--output "output.gtf" \
--gtf_version "2.5"
echo ">> Check if the output file header display the right GTF version"
grep -q "##gtf-version 2.5" "output.gtf"
[ $? -ne 0 ] && echo "Output file output.gtf header does not display the right GTF version" && exit 1
echo "> Test successful"

36
src/agat/agat_convert_sp_gff2gtf/test_data/0_test.gff Normal file
View File

@@ -0,0 +1,36 @@
##gff-version 3
scaffold625 maker gene 337818 343277 . + . ID=CLUHARG00000005458;Name=TUBB3_2
scaffold625 maker mRNA 337818 343277 . + . ID=CLUHART00000008717;Parent=CLUHARG00000005458
scaffold625 maker exon 337818 337971 . + . ID=CLUHART00000008717:exon:1404;Parent=CLUHART00000008717
scaffold625 maker exon 340733 340841 . + . ID=CLUHART00000008717:exon:1405;Parent=CLUHART00000008717
scaffold625 maker exon 341518 341628 . + . ID=CLUHART00000008717:exon:1406;Parent=CLUHART00000008717
scaffold625 maker exon 341964 343277 . + . ID=CLUHART00000008717:exon:1407;Parent=CLUHART00000008717
scaffold625 maker CDS 337915 337971 . + 0 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker CDS 340733 340841 . + 0 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker CDS 341518 341628 . + 2 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker CDS 341964 343033 . + 2 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker five_prime_UTR 337818 337914 . + . ID=CLUHART00000008717:five_prime_utr;Parent=CLUHART00000008717
scaffold625 maker three_prime_UTR 343034 343277 . + . ID=CLUHART00000008717:three_prime_utr;Parent=CLUHART00000008717
scaffold789 maker gene 558184 564780 . + . ID=CLUHARG00000003852;Name=PF11_0240
scaffold789 maker mRNA 558184 564780 . + . ID=CLUHART00000006146;Parent=CLUHARG00000003852
scaffold789 maker exon 558184 560123 . + . ID=CLUHART00000006146:exon:995;Parent=CLUHART00000006146
scaffold789 maker exon 561401 561519 . + . ID=CLUHART00000006146:exon:996;Parent=CLUHART00000006146
scaffold789 maker exon 564171 564235 . + . ID=CLUHART00000006146:exon:997;Parent=CLUHART00000006146
scaffold789 maker exon 564372 564780 . + . ID=CLUHART00000006146:exon:998;Parent=CLUHART00000006146
scaffold789 maker CDS 558191 560123 . + 0 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker CDS 561401 561519 . + 2 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker CDS 564171 564235 . + 0 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker CDS 564372 564588 . + 1 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker five_prime_UTR 558184 558190 . + . ID=CLUHART00000006146:five_prime_utr;Parent=CLUHART00000006146
scaffold789 maker three_prime_UTR 564589 564780 . + . ID=CLUHART00000006146:three_prime_utr;Parent=CLUHART00000006146
scaffold789 maker mRNA 558184 564780 . + . ID=CLUHART00000006147;Parent=CLUHARG00000003852
scaffold789 maker exon 558184 560123 . + . ID=CLUHART00000006147:exon:997;Parent=CLUHART00000006147
scaffold789 maker exon 561401 561519 . + . ID=CLUHART00000006147:exon:998;Parent=CLUHART00000006147
scaffold789 maker exon 562057 562121 . + . ID=CLUHART00000006147:exon:999;Parent=CLUHART00000006147
scaffold789 maker exon 564372 564780 . + . ID=CLUHART00000006147:exon:1000;Parent=CLUHART00000006147
scaffold789 maker CDS 558191 560123 . + 0 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker CDS 561401 561519 . + 2 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker CDS 562057 562121 . + 0 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker CDS 564372 564588 . + 1 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker five_prime_UTR 558184 558190 . + . ID=CLUHART00000006147:five_prime_utr;Parent=CLUHART00000006147
scaffold789 maker three_prime_UTR 564589 564780 . + . ID=CLUHART00000006147:three_prime_utr;Parent=CLUHART00000006147

9
src/agat/agat_convert_sp_gff2gtf/test_data/script.sh Executable file
View File

@@ -0,0 +1,9 @@
#!/bin/bash
# clone repo
if [ ! -d /tmp/agat_source ]; then
git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
fi
# copy test data
cp -r /tmp/agat_source/t/gff_syntax/in/0_test.gff src/agat/agat_convert_sp_gff2gtf/test_data

70
src/agat/agat_convert_sp_gff2tsv/config.vsh.yaml Normal file
View File

@@ -0,0 +1,70 @@
name: agat_convert_sp_gff2tsv
namespace: agat
description: |
The script aims to convert gtf/gff file into tabulated file. Attribute's
tags from the 9th column become column titles.
keywords: [gene annotations, GFF conversion]
links:
homepage: https://github.com/NBISweden/AGAT
documentation: https://agat.readthedocs.io/en/latest/tools/agat_convert_sp_gff2tsv.html
issue_tracker: https://github.com/NBISweden/AGAT/issues
repository: https://github.com/NBISweden/AGAT
references:
doi: 10.5281/zenodo.3552717
license: GPL-3.0
authors:
- __merge__: /src/_authors/leila_paquay.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --gff
alternatives: [-f]
description: Input GTF/GFF file.
type: file
required: true
direction: input
example: input.gff
- name: Outputs
arguments:
- name: --output
alternatives: [-o, --out, --outfile]
description: Output GFF file. If no output file is specified, the output will be written to STDOUT.
type: file
direction: output
required: true
example: output.gff
- name: Arguments
arguments:
- name: --config
alternatives: [-c]
description: |
String - Input agat config file. By default AGAT takes as input
agat_config.yaml file from the working directory if any,
otherwise it takes the orignal agat_config.yaml shipped with
AGAT. To get the agat_config.yaml locally type: "agat config
--expose". The --config option gives you the possibility to use
your own AGAT config file (located elsewhere or named
differently).
type: file
required: false
example: custom_agat_config.yaml
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
- type: file
path: test_data
engines:
- type: docker
image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
setup:
- type: docker
run: |
agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

63
src/agat/agat_convert_sp_gff2tsv/help.txt Normal file
View File

@@ -0,0 +1,63 @@
```sh
agat_convert_sp_gff2tsv.pl --help
```
------------------------------------------------------------------------------
| Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0 |
| https://github.com/NBISweden/AGAT |
| National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se |
------------------------------------------------------------------------------
Name:
agat_convert_sp_gff2tsv.pl
Description:
The script aims to convert gtf/gff file into tabulated file. Attribute's
tags from the 9th column become column titles.
Usage:
agat_convert_sp_gff2tsv.pl -gff file.gff [ -o outfile ]
agat_convert_sp_gff2tsv.pl --help
Options:
--gff or -f
Input GTF/GFF file.
-o , --output , --out or --outfile
Output GFF file. If no output file is specified, the output will
be written to STDOUT.
-c or --config
String - Input agat config file. By default AGAT takes as input
agat_config.yaml file from the working directory if any,
otherwise it takes the orignal agat_config.yaml shipped with
AGAT. To get the agat_config.yaml locally type: "agat config
--expose". The --config option gives you the possibility to use
your own AGAT config file (located elsewhere or named
differently).
-h or --help
Display this helpful text.
Feedback:
Did you find a bug?:
Do not hesitate to report bugs to help us keep track of the bugs and
their resolution. Please use the GitHub issue tracking system available
at this address:
https://github.com/NBISweden/AGAT/issues
Ensure that the bug was not already reported by searching under Issues.
If you're unable to find an (open) issue addressing the problem, open a new one.
Try as much as possible to include in the issue when relevant:
- a clear description,
- as much relevant information as possible,
- the command used,
- a data sample,
- an explanation of the expected behaviour that is not occurring.
Do you want to contribute?:
You are very welcome, visit this address for the Contributing
guidelines:
https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md

9
src/agat/agat_convert_sp_gff2tsv/script.sh Normal file
View File

@@ -0,0 +1,9 @@
#!/bin/bash
## VIASH START
## VIASH END
agat_convert_sp_gff2tsv.pl \
-f "$par_gff" \
-o "$par_output" \
${par_config:+--config "${par_config}"}

27
src/agat/agat_convert_sp_gff2tsv/test.sh Normal file
View File

@@ -0,0 +1,27 @@
#!/bin/bash
## VIASH START
## VIASH END
test_dir="${meta_resources_dir}/test_data"
out_dir="${meta_resources_dir}/out_data"
echo "> Run $meta_name with test data"
"$meta_executable" \
--gff "$test_dir/1.gff" \
--output "$out_dir/output.gff"
echo ">> Checking output"
[ ! -f "$out_dir/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
echo ">> Check if output is empty"
[ ! -s "$out_dir/output.gff" ] && echo "Output file output.gff is empty" && exit 1
echo ">> Check if output matches expected output"
diff "$out_dir/output.gff" "$test_dir/agat_convert_sp_gff2tsv_1.tsv"
if [ $? -ne 0 ]; then
echo "Output file output.gff does not match expected output"
exit 1
fi
echo "> Test successful"

942
src/agat/agat_convert_sp_gff2tsv/test_data/1.gff Normal file
View File

@@ -0,0 +1,942 @@
##gff-version 3
##sequence-region 1 1 43270923
#!genome-build RAP-DB IRGSP-1.0
#!genome-version IRGSP-1.0
#!genome-date 2015-10
#!genome-build-accession GCA_001433935.1
1 RAP-DB chromosome 1 43270923 . . . ID=chromosome:1;Alias=Chr1,AP014957.1,NC_029256.1
###
1 irgsp repeat_region 2000 2100 . + . ID=fakeRepeat1
###
1 irgsp gene 2983 10815 . + . ID=gene:Os01g0100100;biotype=protein_coding;description=RabGAP/TBC domain containing protein. (Os01t0100100-01);gene_id=Os01g0100100;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 2983 10815 . + . ID=transcript:Os01t0100100-01;Parent=gene:Os01g0100100;biotype=protein_coding;transcript_id=Os01t0100100-01
1 irgsp exon 2983 3268 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon1;rank=1
1 irgsp five_prime_UTR 2983 3268 . + . Parent=transcript:Os01t0100100-01
1 irgsp five_prime_UTR 3354 3448 . + . Parent=transcript:Os01t0100100-01
1 irgsp exon 3354 3616 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100100-01.exon2;rank=2
1 irgsp CDS 3449 3616 . + 0 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp exon 4357 4455 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon3;rank=3
1 irgsp CDS 4357 4455 . + 0 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp exon 5457 5560 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100100-01.exon4;rank=4
1 irgsp CDS 5457 5560 . + 0 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp exon 7136 7944 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100100-01.exon5;rank=5
1 irgsp CDS 7136 7944 . + 1 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp exon 8028 8150 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon6;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100100-01.exon6;rank=6
1 irgsp CDS 8028 8150 . + 2 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp exon 8232 8320 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon7;rank=7
1 irgsp CDS 8232 8320 . + 2 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp exon 8408 8608 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon8;rank=8
1 irgsp CDS 8408 8608 . + 0 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp exon 9210 9615 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon9;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100100-01.exon9;rank=9
1 irgsp CDS 9210 9615 . + 0 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp exon 10102 10187 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon10;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon10;rank=10
1 irgsp CDS 10102 10187 . + 2 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp CDS 10274 10297 . + 0 ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
1 irgsp exon 10274 10430 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon11;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100100-01.exon11;rank=11
1 irgsp three_prime_UTR 10298 10430 . + . Parent=transcript:Os01t0100100-01
1 irgsp exon 10504 10815 . + . Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon12;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon12;rank=12
1 irgsp three_prime_UTR 10504 10815 . + . Parent=transcript:Os01t0100100-01
###
1 irgsp gene 11218 12435 . + . ID=gene:Os01g0100200;biotype=protein_coding;description=Conserved hypothetical protein. (Os01t0100200-01);gene_id=Os01g0100200;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 11218 12435 . + . ID=transcript:Os01t0100200-01;Parent=gene:Os01g0100200;biotype=protein_coding;transcript_id=Os01t0100200-01
1 irgsp five_prime_UTR 11218 11797 . + . Parent=transcript:Os01t0100200-01
1 irgsp exon 11218 12060 . + . Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100200-01.exon1;rank=1
1 irgsp CDS 11798 12060 . + 0 ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
1 irgsp CDS 12152 12317 . + 1 ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
1 irgsp exon 12152 12435 . + . Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100200-01.exon2;rank=2
1 irgsp three_prime_UTR 12318 12435 . + . Parent=transcript:Os01t0100200-01
###
1 irgsp gene 11372 12284 . - . ID=gene:Os01g0100300;biotype=protein_coding;description=Cytochrome P450 domain containing protein. (Os01t0100300-00);gene_id=Os01g0100300;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 11372 12284 . - . ID=transcript:Os01t0100300-00;Parent=gene:Os01g0100300;biotype=protein_coding;transcript_id=Os01t0100300-00
1 irgsp exon 11372 12042 . - . Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100300-00.exon2;rank=2
1 irgsp CDS 11372 12042 . - 2 ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
1 irgsp exon 12146 12284 . - . Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon1;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100300-00.exon1;rank=1
1 irgsp CDS 12146 12284 . - 0 ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
###
1 irgsp gene 12721 15685 . + . ID=gene:Os01g0100400;biotype=protein_coding;description=Similar to Pectinesterase-like protein. (Os01t0100400-01);gene_id=Os01g0100400;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 12721 15685 . + . ID=transcript:Os01t0100400-01;Parent=gene:Os01g0100400;biotype=protein_coding;transcript_id=Os01t0100400-01
1 irgsp five_prime_UTR 12721 12773 . + . Parent=transcript:Os01t0100400-01
1 irgsp exon 12721 13813 . + . Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100400-01.exon1;rank=1
1 irgsp CDS 12774 13813 . + 0 ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
1 irgsp exon 13906 14271 . + . Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100400-01.exon2;rank=2
1 irgsp CDS 13906 14271 . + 1 ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
1 irgsp exon 14359 14437 . + . Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0100400-01.exon3;rank=3
1 irgsp CDS 14359 14437 . + 1 ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
1 irgsp exon 14969 15171 . + . Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100400-01.exon4;rank=4
1 irgsp CDS 14969 15171 . + 0 ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
1 irgsp CDS 15266 15359 . + 1 ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
1 irgsp exon 15266 15685 . + . Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon5;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100400-01.exon5;rank=5
1 irgsp three_prime_UTR 15360 15685 . + . Parent=transcript:Os01t0100400-01
###
1 irgsp gene 12808 13978 . - . ID=gene:Os01g0100466;biotype=protein_coding;description=Hypothetical protein. (Os01t0100466-00);gene_id=Os01g0100466;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 12808 13978 . - . ID=transcript:Os01t0100466-00;Parent=gene:Os01g0100466;biotype=protein_coding;transcript_id=Os01t0100466-00
1 irgsp three_prime_UTR 12808 12868 . - . Parent=transcript:Os01t0100466-00
1 irgsp exon 12808 13782 . - . Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon2;rank=2
1 irgsp CDS 12869 13102 . - 0 ID=CDS:Os01t0100466-00;Parent=transcript:Os01t0100466-00;protein_id=Os01t0100466-00
1 irgsp five_prime_UTR 13103 13782 . - . Parent=transcript:Os01t0100466-00
1 irgsp exon 13880 13978 . - . Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon1;rank=1
1 irgsp five_prime_UTR 13880 13978 . - . Parent=transcript:Os01t0100466-00
###
1 irgsp gene 16399 20144 . + . ID=gene:Os01g0100500;biotype=protein_coding;description=Immunoglobulin-like domain containing protein. (Os01t0100500-01);gene_id=Os01g0100500;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 16399 20144 . + . ID=transcript:Os01t0100500-01;Parent=gene:Os01g0100500;biotype=protein_coding;transcript_id=Os01t0100500-01
1 irgsp five_prime_UTR 16399 16598 . + . Parent=transcript:Os01t0100500-01
1 irgsp exon 16399 16976 . + . Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100500-01.exon1;rank=1
1 irgsp CDS 16599 16976 . + 0 ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
1 irgsp exon 17383 17474 . + . Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100500-01.exon2;rank=2
1 irgsp CDS 17383 17474 . + 0 ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
1 irgsp exon 17558 18258 . + . Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100500-01.exon3;rank=3
1 irgsp CDS 17558 18258 . + 1 ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
1 irgsp exon 18501 18571 . + . Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100500-01.exon4;rank=4
1 irgsp CDS 18501 18571 . + 2 ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
1 irgsp exon 18968 19057 . + . Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon5;rank=5
1 irgsp CDS 18968 19057 . + 0 ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
1 irgsp exon 19142 19321 . + . Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon6;rank=6
1 irgsp CDS 19142 19321 . + 0 ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
1 irgsp CDS 19531 19593 . + 0 ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
1 irgsp exon 19531 19629 . + . Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100500-01.exon7;rank=7
1 irgsp three_prime_UTR 19594 19629 . + . Parent=transcript:Os01t0100500-01
1 irgsp exon 19734 20144 . + . Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon8;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100500-01.exon8;rank=8
1 irgsp three_prime_UTR 19734 20144 . + . Parent=transcript:Os01t0100500-01
###
1 irgsp gene 22841 26892 . + . ID=gene:Os01g0100600;biotype=protein_coding;description=Single-stranded nucleic acid binding R3H domain containing protein. (Os01t0100600-01);gene_id=Os01g0100600;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 22841 26892 . + . ID=transcript:Os01t0100600-01;Parent=gene:Os01g0100600;biotype=protein_coding;transcript_id=Os01t0100600-01
1 irgsp five_prime_UTR 22841 23231 . + . Parent=transcript:Os01t0100600-01
1 irgsp exon 22841 23281 . + . Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100600-01.exon1;rank=1
1 irgsp CDS 23232 23281 . + 0 ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
1 irgsp exon 23572 23847 . + . Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon2;rank=2
1 irgsp CDS 23572 23847 . + 1 ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
1 irgsp exon 23962 24033 . + . Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon3;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon3;rank=3
1 irgsp CDS 23962 24033 . + 1 ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
1 irgsp exon 24492 24577 . + . Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon4;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100600-01.exon4;rank=4
1 irgsp CDS 24492 24577 . + 1 ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
1 irgsp exon 25445 25519 . + . Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100600-01.exon5;rank=5
1 irgsp CDS 25445 25519 . + 2 ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
1 irgsp CDS 25883 26391 . + 2 ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
1 irgsp exon 25883 26892 . + . Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon6;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0100600-01.exon6;rank=6
1 irgsp three_prime_UTR 26392 26892 . + . Parent=transcript:Os01t0100600-01
###
1 irgsp gene 25861 26424 . - . ID=gene:Os01g0100650;biotype=protein_coding;description=Hypothetical gene. (Os01t0100650-00);gene_id=Os01g0100650;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 25861 26424 . - . ID=transcript:Os01t0100650-00;Parent=gene:Os01g0100650;biotype=protein_coding;transcript_id=Os01t0100650-00
1 irgsp three_prime_UTR 25861 26039 . - . Parent=transcript:Os01t0100650-00
1 irgsp exon 25861 26424 . - . Parent=transcript:Os01t0100650-00;Name=Os01t0100650-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100650-00.exon1;rank=1
1 irgsp CDS 26040 26423 . - 0 ID=CDS:Os01t0100650-00;Parent=transcript:Os01t0100650-00;protein_id=Os01t0100650-00
1 irgsp five_prime_UTR 26424 26424 . - . Parent=transcript:Os01t0100650-00
###
1 irgsp gene 27143 28644 . + . ID=gene:Os01g0100700;biotype=protein_coding;description=Similar to 40S ribosomal protein S5-1. (Os01t0100700-01);gene_id=Os01g0100700;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 27143 28644 . + . ID=transcript:Os01t0100700-01;Parent=gene:Os01g0100700;biotype=protein_coding;transcript_id=Os01t0100700-01
1 irgsp five_prime_UTR 27143 27220 . + . Parent=transcript:Os01t0100700-01
1 irgsp exon 27143 27292 . + . Parent=transcript:Os01t0100700-01;Name=Os01t0100700-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100700-01.exon1;rank=1
1 irgsp CDS 27221 27292 . + 0 ID=CDS:Os01t0100700-01;Parent=transcript:Os01t0100700-01;protein_id=Os01t0100700-01
1 irgsp exon 27370 27641 . + . Parent=transcript:Os01t0100700-01;Name=Os01t0100700-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100700-01.exon2;rank=2
1 irgsp CDS 27370 27641 . + 0 ID=CDS:Os01t0100700-01;Parent=transcript:Os01t0100700-01;protein_id=Os01t0100700-01
1 irgsp exon 28090 28293 . + . Parent=transcript:Os01t0100700-01;Name=Os01t0100700-01.exon3;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100700-01.exon3;rank=3
1 irgsp CDS 28090 28293 . + 1 ID=CDS:Os01t0100700-01;Parent=transcript:Os01t0100700-01;protein_id=Os01t0100700-01
1 irgsp CDS 28365 28419 . + 1 ID=CDS:Os01t0100700-01;Parent=transcript:Os01t0100700-01;protein_id=Os01t0100700-01
1 irgsp exon 28365 28644 . + . Parent=transcript:Os01t0100700-01;Name=Os01t0100700-01.exon4;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100700-01.exon4;rank=4
1 irgsp three_prime_UTR 28420 28644 . + . Parent=transcript:Os01t0100700-01
###
1 irgsp gene 29818 34453 . + . ID=gene:Os01g0100800;biotype=protein_coding;description=Protein of unknown function DUF1664 family protein. (Os01t0100800-01);gene_id=Os01g0100800;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 29818 34453 . + . ID=transcript:Os01t0100800-01;Parent=gene:Os01g0100800;biotype=protein_coding;transcript_id=Os01t0100800-01
1 irgsp five_prime_UTR 29818 29939 . + . Parent=transcript:Os01t0100800-01
1 irgsp exon 29818 29976 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon1;constitutive=1;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0100800-01.exon1;rank=1
1 irgsp CDS 29940 29976 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 30146 30228 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100800-01.exon2;rank=2
1 irgsp CDS 30146 30228 . + 2 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 30735 30806 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100800-01.exon3;rank=3
1 irgsp CDS 30735 30806 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 30885 30963 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon4;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100800-01.exon4;rank=4
1 irgsp CDS 30885 30963 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 31258 31325 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100800-01.exon5;rank=5
1 irgsp CDS 31258 31325 . + 2 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 31505 31606 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100800-01.exon6;rank=6
1 irgsp CDS 31505 31606 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 32377 32466 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100800-01.exon7;rank=7
1 irgsp CDS 32377 32466 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 32542 32616 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100800-01.exon8;rank=8
1 irgsp CDS 32542 32616 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 32712 32744 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon9;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100800-01.exon9;rank=9
1 irgsp CDS 32712 32744 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 32828 32905 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon10;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100800-01.exon10;rank=10
1 irgsp CDS 32828 32905 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 33274 33330 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon11;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100800-01.exon11;rank=11
1 irgsp CDS 33274 33330 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 33400 33471 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon12;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100800-01.exon12;rank=12
1 irgsp CDS 33400 33471 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 33543 33617 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon13;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100800-01.exon13;rank=13
1 irgsp CDS 33543 33617 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp CDS 33975 34124 . + 0 ID=CDS:Os01t0100800-01;Parent=transcript:Os01t0100800-01;protein_id=Os01t0100800-01
1 irgsp exon 33975 34453 . + . Parent=transcript:Os01t0100800-01;Name=Os01t0100800-01.exon14;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100800-01.exon14;rank=14
1 irgsp three_prime_UTR 34125 34453 . + . Parent=transcript:Os01t0100800-01
###
1 irgsp gene 35623 41136 . + . ID=gene:Os01g0100900;Name=SPHINGOSINE-1-PHOSPHATE LYASE 1%2C Sphingosine-1-Phoshpate Lyase 1;biotype=protein_coding;description=Sphingosine-1-phosphate lyase%2C Disease resistance response (Os01t0100900-01);gene_id=Os01g0100900;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 35623 41136 . + . ID=transcript:Os01t0100900-01;Parent=gene:Os01g0100900;biotype=protein_coding;transcript_id=Os01t0100900-01
1 irgsp five_prime_UTR 35623 35742 . + . Parent=transcript:Os01t0100900-01
1 irgsp exon 35623 35939 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100900-01.exon1;rank=1
1 irgsp CDS 35743 35939 . + 0 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 36027 36072 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0100900-01.exon2;rank=2
1 irgsp CDS 36027 36072 . + 1 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 36517 36668 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon3;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100900-01.exon3;rank=3
1 irgsp CDS 36517 36668 . + 0 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 36818 36877 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100900-01.exon4;rank=4
1 irgsp CDS 36818 36877 . + 1 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 37594 37818 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon5;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100900-01.exon5;rank=5
1 irgsp CDS 37594 37818 . + 1 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 37892 38033 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0100900-01.exon6;rank=6
1 irgsp CDS 37892 38033 . + 1 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 38276 38326 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100900-01.exon7;rank=7
1 irgsp CDS 38276 38326 . + 0 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 38434 38525 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon8;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100900-01.exon8;rank=8
1 irgsp CDS 38434 38525 . + 0 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 39319 39445 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon9;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0100900-01.exon9;rank=9
1 irgsp CDS 39319 39445 . + 1 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 39553 39568 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon10;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100900-01.exon10;rank=10
1 irgsp CDS 39553 39568 . + 0 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 39939 40046 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon11;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100900-01.exon11;rank=11
1 irgsp CDS 39939 40046 . + 2 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 40135 40189 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon12;constitutive=1;ensembl_end_phase=2;ensembl_phase=1;exon_id=Os01t0100900-01.exon12;rank=12
1 irgsp CDS 40135 40189 . + 2 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 40456 40602 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon13;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100900-01.exon13;rank=13
1 irgsp CDS 40456 40602 . + 1 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 40703 40781 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon14;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0100900-01.exon14;rank=14
1 irgsp CDS 40703 40781 . + 1 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp CDS 40885 41007 . + 0 ID=CDS:Os01t0100900-01;Parent=transcript:Os01t0100900-01;protein_id=Os01t0100900-01
1 irgsp exon 40885 41136 . + . Parent=transcript:Os01t0100900-01;Name=Os01t0100900-01.exon15;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100900-01.exon15;rank=15
1 irgsp three_prime_UTR 41008 41136 . + . Parent=transcript:Os01t0100900-01
###
1 irgsp gene 58658 61090 . + . ID=gene:Os01g0101150;biotype=protein_coding;description=Hypothetical conserved gene. (Os01t0101150-00);gene_id=Os01g0101150;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 58658 61090 . + . ID=transcript:Os01t0101150-00;Parent=gene:Os01g0101150;biotype=protein_coding;transcript_id=Os01t0101150-00
1 irgsp exon 58658 61090 . + . Parent=transcript:Os01t0101150-00;Name=Os01t0101150-00.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0101150-00.exon1;rank=1
1 irgsp CDS 58658 61090 . + 0 ID=CDS:Os01t0101150-00;Parent=transcript:Os01t0101150-00;protein_id=Os01t0101150-00
###
1 irgsp gene 62060 65537 . + . ID=gene:Os01g0101200;biotype=protein_coding;description=2%2C3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein. (Os01t0101200-01)%3B2%2C3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein. (Os01t0101200-02);gene_id=Os01g0101200;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 62060 63576 . + . ID=transcript:Os01t0101200-01;Parent=gene:Os01g0101200;biotype=protein_coding;transcript_id=Os01t0101200-01
1 irgsp five_prime_UTR 62060 62103 . + . Parent=transcript:Os01t0101200-01
1 irgsp exon 62060 62295 . + . Parent=transcript:Os01t0101200-01;Name=Os01t0101200-01.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0101200-01.exon1;rank=1
1 irgsp CDS 62104 62295 . + 0 ID=CDS:Os01t0101200-01;Parent=transcript:Os01t0101200-01;protein_id=Os01t0101200-01
1 irgsp exon 62385 62905 . + . Parent=transcript:Os01t0101200-01;Name=Os01t0101200-02.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0101200-02.exon2;rank=2
1 irgsp CDS 62385 62905 . + 0 ID=CDS:Os01t0101200-01;Parent=transcript:Os01t0101200-01;protein_id=Os01t0101200-01
1 irgsp exon 62996 63114 . + . Parent=transcript:Os01t0101200-01;Name=Os01t0101200-02.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0101200-02.exon3;rank=3
1 irgsp CDS 62996 63114 . + 1 ID=CDS:Os01t0101200-01;Parent=transcript:Os01t0101200-01;protein_id=Os01t0101200-01
1 irgsp CDS 63248 63345 . + 2 ID=CDS:Os01t0101200-01;Parent=transcript:Os01t0101200-01;protein_id=Os01t0101200-01
1 irgsp exon 63248 63576 . + . Parent=transcript:Os01t0101200-01;Name=Os01t0101200-01.exon4;constitutive=0;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0101200-01.exon4;rank=4
1 irgsp three_prime_UTR 63346 63576 . + . Parent=transcript:Os01t0101200-01
1 irgsp mRNA 62112 65537 . + . ID=transcript:Os01t0101200-02;Parent=gene:Os01g0101200;biotype=protein_coding;transcript_id=Os01t0101200-02
1 irgsp five_prime_UTR 62112 62112 . + . Parent=transcript:Os01t0101200-02
1 irgsp exon 62112 62295 . + . Parent=transcript:Os01t0101200-02;Name=Os01t0101200-02.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0101200-02.exon1;rank=1
1 irgsp CDS 62113 62295 . + 0 ID=CDS:Os01t0101200-02;Parent=transcript:Os01t0101200-02;protein_id=Os01t0101200-02
1 irgsp exon 62385 62905 . + . Parent=transcript:Os01t0101200-02;Name=Os01t0101200-02.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0101200-02.exon2;rank=2
1 irgsp CDS 62385 62905 . + 0 ID=CDS:Os01t0101200-02;Parent=transcript:Os01t0101200-02;protein_id=Os01t0101200-02
1 irgsp exon 62996 63114 . + . Parent=transcript:Os01t0101200-02;Name=Os01t0101200-02.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0101200-02.exon3;rank=3
1 irgsp CDS 62996 63114 . + 1 ID=CDS:Os01t0101200-02;Parent=transcript:Os01t0101200-02;protein_id=Os01t0101200-02
1 irgsp CDS 63248 63345 . + 2 ID=CDS:Os01t0101200-02;Parent=transcript:Os01t0101200-02;protein_id=Os01t0101200-02
1 irgsp exon 63248 65537 . + . Parent=transcript:Os01t0101200-02;Name=Os01t0101200-02.exon4;constitutive=0;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0101200-02.exon4;rank=4
1 irgsp three_prime_UTR 63346 65537 . + . Parent=transcript:Os01t0101200-02
###
1 irgsp gene 63350 66302 . - . ID=gene:Os01g0101300;biotype=protein_coding;description=Similar to MRNA%2C partial cds%2C clone: RAFL22-26-L17. (Fragment). (Os01t0101300-01);gene_id=Os01g0101300;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 63350 66302 . - . ID=transcript:Os01t0101300-01;Parent=gene:Os01g0101300;biotype=protein_coding;transcript_id=Os01t0101300-01
1 irgsp three_prime_UTR 63350 63669 . - . Parent=transcript:Os01t0101300-01
1 irgsp exon 63350 63783 . - . Parent=transcript:Os01t0101300-01;Name=Os01t0101300-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0101300-01.exon7;rank=7
1 irgsp CDS 63670 63783 . - 0 ID=CDS:Os01t0101300-01;Parent=transcript:Os01t0101300-01;protein_id=Os01t0101300-01
1 irgsp exon 63877 64020 . - . Parent=transcript:Os01t0101300-01;Name=Os01t0101300-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0101300-01.exon6;rank=6
1 irgsp CDS 63877 64020 . - 0 ID=CDS:Os01t0101300-01;Parent=transcript:Os01t0101300-01;protein_id=Os01t0101300-01
1 irgsp exon 64339 64431 . - . Parent=transcript:Os01t0101300-01;Name=Os01t0101300-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0101300-01.exon5;rank=5
1 irgsp CDS 64339 64431 . - 0 ID=CDS:Os01t0101300-01;Parent=transcript:Os01t0101300-01;protein_id=Os01t0101300-01
1 irgsp exon 64665 64779 . - . Parent=transcript:Os01t0101300-01;Name=Os01t0101300-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0101300-01.exon4;rank=4
1 irgsp CDS 64665 64779 . - 1 ID=CDS:Os01t0101300-01;Parent=transcript:Os01t0101300-01;protein_id=Os01t0101300-01
1 irgsp exon 64902 65152 . - . Parent=transcript:Os01t0101300-01;Name=Os01t0101300-01.exon3;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0101300-01.exon3;rank=3
1 irgsp CDS 64902 65152 . - 0 ID=CDS:Os01t0101300-01;Parent=transcript:Os01t0101300-01;protein_id=Os01t0101300-01
1 irgsp exon 65248 65431 . - . Parent=transcript:Os01t0101300-01;Name=Os01t0101300-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0101300-01.exon2;rank=2
1 irgsp CDS 65248 65431 . - 1 ID=CDS:Os01t0101300-01;Parent=transcript:Os01t0101300-01;protein_id=Os01t0101300-01
1 irgsp CDS 65628 65950 . - 0 ID=CDS:Os01t0101300-01;Parent=transcript:Os01t0101300-01;protein_id=Os01t0101300-01
1 irgsp exon 65628 66302 . - . Parent=transcript:Os01t0101300-01;Name=Os01t0101300-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0101300-01.exon1;rank=1
1 irgsp five_prime_UTR 65951 66302 . - . Parent=transcript:Os01t0101300-01
###
1 irgsp gene 72816 78349 . + . ID=gene:Os01g0101600;biotype=protein_coding;description=Immunoglobulin-like fold domain containing protein. (Os01t0101600-01)%3BImmunoglobulin-like fold domain containing protein. (Os01t0101600-02)%3BHypothetical conserved gene. (Os01t0101600-03);gene_id=Os01g0101600;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 72816 78349 . + . ID=transcript:Os01t0101600-01;Parent=gene:Os01g0101600;biotype=protein_coding;transcript_id=Os01t0101600-01
1 irgsp five_prime_UTR 72816 72902 . + . Parent=transcript:Os01t0101600-01
1 irgsp exon 72816 73935 . + . Parent=transcript:Os01t0101600-01;Name=Os01t0101600-01.exon1;constitutive=0;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0101600-01.exon1;rank=1
1 irgsp CDS 72903 73935 . + 0 ID=CDS:Os01t0101600-01;Parent=transcript:Os01t0101600-01;protein_id=Os01t0101600-01
1 irgsp exon 74468 74981 . + . Parent=transcript:Os01t0101600-01;Name=Os01t0101600-02.exon2;constitutive=0;ensembl_end_phase=2;ensembl_phase=1;exon_id=Os01t0101600-02.exon2;rank=2
1 irgsp CDS 74468 74981 . + 2 ID=CDS:Os01t0101600-01;Parent=transcript:Os01t0101600-01;protein_id=Os01t0101600-01
1 irgsp CDS 75619 77008 . + 1 ID=CDS:Os01t0101600-01;Parent=transcript:Os01t0101600-01;protein_id=Os01t0101600-01
1 irgsp exon 75619 77205 . + . Parent=transcript:Os01t0101600-01;Name=Os01t0101600-01.exon3;constitutive=0;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0101600-01.exon3;rank=3
1 irgsp three_prime_UTR 77009 77205 . + . Parent=transcript:Os01t0101600-01
1 irgsp exon 77333 78349 . + . Parent=transcript:Os01t0101600-01;Name=Os01t0101600-01.exon4;constitutive=0;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0101600-01.exon4;rank=4
1 irgsp three_prime_UTR 77333 78349 . + . Parent=transcript:Os01t0101600-01
1 irgsp mRNA 72823 77699 . + . ID=transcript:Os01t0101600-02;Parent=gene:Os01g0101600;biotype=protein_coding;transcript_id=Os01t0101600-02
1 irgsp five_prime_UTR 72823 72902 . + . Parent=transcript:Os01t0101600-02
1 irgsp exon 72823 73935 . + . Parent=transcript:Os01t0101600-02;Name=Os01t0101600-02.exon1;constitutive=0;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0101600-02.exon1;rank=1
1 irgsp CDS 72903 73935 . + 0 ID=CDS:Os01t0101600-02;Parent=transcript:Os01t0101600-02;protein_id=Os01t0101600-02
1 irgsp exon 74468 74981 . + . Parent=transcript:Os01t0101600-02;Name=Os01t0101600-02.exon2;constitutive=0;ensembl_end_phase=2;ensembl_phase=1;exon_id=Os01t0101600-02.exon2;rank=2
1 irgsp CDS 74468 74981 . + 2 ID=CDS:Os01t0101600-02;Parent=transcript:Os01t0101600-02;protein_id=Os01t0101600-02
1 irgsp CDS 75619 77008 . + 1 ID=CDS:Os01t0101600-02;Parent=transcript:Os01t0101600-02;protein_id=Os01t0101600-02
1 irgsp exon 75619 77699 . + . Parent=transcript:Os01t0101600-02;Name=Os01t0101600-02.exon3;constitutive=0;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0101600-02.exon3;rank=3
1 irgsp three_prime_UTR 77009 77699 . + . Parent=transcript:Os01t0101600-02
1 irgsp mRNA 75942 77699 . + . ID=transcript:Os01t0101600-03;Parent=gene:Os01g0101600;biotype=protein_coding;transcript_id=Os01t0101600-03
1 irgsp five_prime_UTR 75942 75943 . + . Parent=transcript:Os01t0101600-03
1 irgsp exon 75942 77699 . + . Parent=transcript:Os01t0101600-03;Name=Os01t0101600-03.exon1;constitutive=0;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0101600-03.exon1;rank=1
1 irgsp CDS 75944 77008 . + 0 ID=CDS:Os01t0101600-03;Parent=transcript:Os01t0101600-03;protein_id=Os01t0101600-03
1 irgsp three_prime_UTR 77009 77699 . + . Parent=transcript:Os01t0101600-03
###
1 irgsp gene 82426 84095 . + . ID=gene:Os01g0101700;Name=DnaJ domain protein C1%2C rice DJC26 homolog;biotype=protein_coding;description=Similar to chaperone protein dnaJ 20. (Os01t0101700-00);gene_id=Os01g0101700;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 82426 84095 . + . ID=transcript:Os01t0101700-00;Parent=gene:Os01g0101700;biotype=protein_coding;transcript_id=Os01t0101700-00
1 irgsp five_prime_UTR 82426 82506 . + . Parent=transcript:Os01t0101700-00
1 irgsp exon 82426 82932 . + . Parent=transcript:Os01t0101700-00;Name=Os01t0101700-00.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0101700-00.exon1;rank=1
1 irgsp CDS 82507 82932 . + 0 ID=CDS:Os01t0101700-00;Parent=transcript:Os01t0101700-00;protein_id=Os01t0101700-00
1 irgsp CDS 83724 83864 . + 0 ID=CDS:Os01t0101700-00;Parent=transcript:Os01t0101700-00;protein_id=Os01t0101700-00
1 irgsp exon 83724 84095 . + . Parent=transcript:Os01t0101700-00;Name=Os01t0101700-00.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0101700-00.exon2;rank=2
1 irgsp three_prime_UTR 83865 84095 . + . Parent=transcript:Os01t0101700-00
###
1 irgsp gene 85337 88844 . + . ID=gene:Os01g0101800;biotype=protein_coding;description=Conserved hypothetical protein. (Os01t0101800-01);gene_id=Os01g0101800;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 85337 88844 . + . ID=transcript:Os01t0101800-01;Parent=gene:Os01g0101800;biotype=protein_coding;transcript_id=Os01t0101800-01
1 irgsp five_prime_UTR 85337 85378 . + . Parent=transcript:Os01t0101800-01
1 irgsp exon 85337 85600 . + . Parent=transcript:Os01t0101800-01;Name=Os01t0101800-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0101800-01.exon1;rank=1
1 irgsp CDS 85379 85600 . + 0 ID=CDS:Os01t0101800-01;Parent=transcript:Os01t0101800-01;protein_id=Os01t0101800-01
1 irgsp exon 85737 85830 . + . Parent=transcript:Os01t0101800-01;Name=Os01t0101800-01.exon2;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0101800-01.exon2;rank=2
1 irgsp CDS 85737 85830 . + 0 ID=CDS:Os01t0101800-01;Parent=transcript:Os01t0101800-01;protein_id=Os01t0101800-01
1 irgsp exon 85935 86086 . + . Parent=transcript:Os01t0101800-01;Name=Os01t0101800-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0101800-01.exon3;rank=3
1 irgsp CDS 85935 86086 . + 2 ID=CDS:Os01t0101800-01;Parent=transcript:Os01t0101800-01;protein_id=Os01t0101800-01
1 irgsp exon 86212 86299 . + . Parent=transcript:Os01t0101800-01;Name=Os01t0101800-01.exon4;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0101800-01.exon4;rank=4
1 irgsp CDS 86212 86299 . + 0 ID=CDS:Os01t0101800-01;Parent=transcript:Os01t0101800-01;protein_id=Os01t0101800-01
1 irgsp exon 86399 87681 . + . Parent=transcript:Os01t0101800-01;Name=Os01t0101800-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0101800-01.exon5;rank=5
1 irgsp CDS 86399 87681 . + 2 ID=CDS:Os01t0101800-01;Parent=transcript:Os01t0101800-01;protein_id=Os01t0101800-01
1 irgsp exon 88291 88398 . + . Parent=transcript:Os01t0101800-01;Name=Os01t0101800-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0101800-01.exon6;rank=6
1 irgsp CDS 88291 88398 . + 0 ID=CDS:Os01t0101800-01;Parent=transcript:Os01t0101800-01;protein_id=Os01t0101800-01
1 irgsp CDS 88500 88583 . + 0 ID=CDS:Os01t0101800-01;Parent=transcript:Os01t0101800-01;protein_id=Os01t0101800-01
1 irgsp exon 88500 88844 . + . Parent=transcript:Os01t0101800-01;Name=Os01t0101800-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0101800-01.exon7;rank=7
1 irgsp three_prime_UTR 88584 88844 . + . Parent=transcript:Os01t0101800-01
###
1 irgsp gene 86211 88583 . - . ID=gene:Os01g0101850;biotype=protein_coding;description=Hypothetical protein. (Os01t0101850-00);gene_id=Os01g0101850;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 86211 88583 . - . ID=transcript:Os01t0101850-00;Parent=gene:Os01g0101850;biotype=protein_coding;transcript_id=Os01t0101850-00
1 irgsp exon 86211 86277 . - . Parent=transcript:Os01t0101850-00;Name=Os01t0101850-00.exon4;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0101850-00.exon4;rank=4
1 irgsp three_prime_UTR 86211 86277 . - . Parent=transcript:Os01t0101850-00
1 irgsp three_prime_UTR 86384 87326 . - . Parent=transcript:Os01t0101850-00
1 irgsp exon 86384 87694 . - . Parent=transcript:Os01t0101850-00;Name=Os01t0101850-00.exon3;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0101850-00.exon3;rank=3
1 irgsp CDS 87327 87662 . - 0 ID=CDS:Os01t0101850-00;Parent=transcript:Os01t0101850-00;protein_id=Os01t0101850-00
1 irgsp five_prime_UTR 87663 87694 . - . Parent=transcript:Os01t0101850-00
1 irgsp exon 88308 88396 . - . Parent=transcript:Os01t0101850-00;Name=Os01t0101850-00.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0101850-00.exon2;rank=2
1 irgsp five_prime_UTR 88308 88396 . - . Parent=transcript:Os01t0101850-00
1 irgsp exon 88496 88583 . - . Parent=transcript:Os01t0101850-00;Name=Os01t0101850-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0101850-00.exon1;rank=1
1 irgsp five_prime_UTR 88496 88583 . - . Parent=transcript:Os01t0101850-00
###
1 irgsp gene 88883 89228 . - . ID=gene:Os01g0101900;biotype=protein_coding;description=Similar to OSIGBa0075F02.3 protein. (Os01t0101900-00);gene_id=Os01g0101900;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 88883 89228 . - . ID=transcript:Os01t0101900-00;Parent=gene:Os01g0101900;biotype=protein_coding;transcript_id=Os01t0101900-00
1 irgsp three_prime_UTR 88883 88985 . - . Parent=transcript:Os01t0101900-00
1 irgsp exon 88883 89228 . - . Parent=transcript:Os01t0101900-00;Name=Os01t0101900-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0101900-00.exon1;rank=1
1 irgsp CDS 88986 89204 . - 0 ID=CDS:Os01t0101900-00;Parent=transcript:Os01t0101900-00;protein_id=Os01t0101900-00
1 irgsp five_prime_UTR 89205 89228 . - . Parent=transcript:Os01t0101900-00
###
1 irgsp gene 89763 91465 . - . ID=gene:Os01g0102000;Name=NON-SPECIFIC PHOSPHOLIPASE C5;biotype=protein_coding;description=Phosphoesterase family protein. (Os01t0102000-01);gene_id=Os01g0102000;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 89763 91465 . - . ID=transcript:Os01t0102000-01;Parent=gene:Os01g0102000;biotype=protein_coding;transcript_id=Os01t0102000-01
1 irgsp three_prime_UTR 89763 89824 . - . Parent=transcript:Os01t0102000-01
1 irgsp exon 89763 91465 . - . Parent=transcript:Os01t0102000-01;Name=Os01t0102000-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0102000-01.exon1;rank=1
1 irgsp CDS 89825 91411 . - 0 ID=CDS:Os01t0102000-01;Parent=transcript:Os01t0102000-01;protein_id=Os01t0102000-01
1 irgsp five_prime_UTR 91412 91465 . - . Parent=transcript:Os01t0102000-01
###
1 irgsp gene 134300 135439 . + . ID=gene:Os01g0102300;Name=OsTLP27;biotype=protein_coding;description=Thylakoid lumen protein%2C Photosynthesis and chloroplast development (Os01t0102300-01);gene_id=Os01g0102300;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 134300 135439 . + . ID=transcript:Os01t0102300-01;Parent=gene:Os01g0102300;biotype=protein_coding;transcript_id=Os01t0102300-01
1 irgsp five_prime_UTR 134300 134310 . + . Parent=transcript:Os01t0102300-01
1 irgsp exon 134300 134615 . + . Parent=transcript:Os01t0102300-01;Name=Os01t0102300-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0102300-01.exon1;rank=1
1 irgsp CDS 134311 134615 . + 0 ID=CDS:Os01t0102300-01;Parent=transcript:Os01t0102300-01;protein_id=Os01t0102300-01
1 irgsp exon 134698 134824 . + . Parent=transcript:Os01t0102300-01;Name=Os01t0102300-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0102300-01.exon2;rank=2
1 irgsp CDS 134698 134824 . + 1 ID=CDS:Os01t0102300-01;Parent=transcript:Os01t0102300-01;protein_id=Os01t0102300-01
1 irgsp CDS 134912 135253 . + 0 ID=CDS:Os01t0102300-01;Parent=transcript:Os01t0102300-01;protein_id=Os01t0102300-01
1 irgsp exon 134912 135439 . + . Parent=transcript:Os01t0102300-01;Name=Os01t0102300-01.exon3;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0102300-01.exon3;rank=3
1 irgsp three_prime_UTR 135254 135439 . + . Parent=transcript:Os01t0102300-01
###
1 irgsp gene 139826 141555 . + . ID=gene:Os01g0102400;Name=HAP5H SUBUNIT OF CCAAT-BOX BINDING COMPLEX;biotype=protein_coding;description=Histone-fold domain containing protein. (Os01t0102400-01);gene_id=Os01g0102400;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 139826 141555 . + . ID=transcript:Os01t0102400-01;Parent=gene:Os01g0102400;biotype=protein_coding;transcript_id=Os01t0102400-01
1 irgsp exon 139826 139906 . + . Parent=transcript:Os01t0102400-01;Name=Os01t0102400-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0102400-01.exon1;rank=1
1 irgsp five_prime_UTR 139826 139906 . + . Parent=transcript:Os01t0102400-01
1 irgsp five_prime_UTR 140120 140149 . + . Parent=transcript:Os01t0102400-01
1 irgsp exon 140120 141555 . + . Parent=transcript:Os01t0102400-01;Name=Os01t0102400-01.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0102400-01.exon2;rank=2
1 irgsp CDS 140150 141415 . + 0 ID=CDS:Os01t0102400-01;Parent=transcript:Os01t0102400-01;protein_id=Os01t0102400-01
1 irgsp three_prime_UTR 141416 141555 . + . Parent=transcript:Os01t0102400-01
###
1 irgsp gene 141959 144554 . + . ID=gene:Os01g0102500;biotype=protein_coding;description=Conserved hypothetical protein. (Os01t0102500-01);gene_id=Os01g0102500;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 141959 144554 . + . ID=transcript:Os01t0102500-01;Parent=gene:Os01g0102500;biotype=protein_coding;transcript_id=Os01t0102500-01
1 irgsp five_prime_UTR 141959 142083 . + . Parent=transcript:Os01t0102500-01
1 irgsp exon 141959 142631 . + . Parent=transcript:Os01t0102500-01;Name=Os01t0102500-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0102500-01.exon1;rank=1
1 irgsp CDS 142084 142631 . + 0 ID=CDS:Os01t0102500-01;Parent=transcript:Os01t0102500-01;protein_id=Os01t0102500-01
1 irgsp exon 143191 143431 . + . Parent=transcript:Os01t0102500-01;Name=Os01t0102500-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0102500-01.exon2;rank=2
1 irgsp CDS 143191 143431 . + 1 ID=CDS:Os01t0102500-01;Parent=transcript:Os01t0102500-01;protein_id=Os01t0102500-01
1 irgsp exon 143563 143680 . + . Parent=transcript:Os01t0102500-01;Name=Os01t0102500-01.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0102500-01.exon3;rank=3
1 irgsp CDS 143563 143680 . + 0 ID=CDS:Os01t0102500-01;Parent=transcript:Os01t0102500-01;protein_id=Os01t0102500-01
1 irgsp CDS 143817 143908 . + 2 ID=CDS:Os01t0102500-01;Parent=transcript:Os01t0102500-01;protein_id=Os01t0102500-01
1 irgsp exon 143817 144554 . + . Parent=transcript:Os01t0102500-01;Name=Os01t0102500-01.exon4;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0102500-01.exon4;rank=4
1 irgsp three_prime_UTR 143909 144554 . + . Parent=transcript:Os01t0102500-01
###
1 irgsp gene 145603 147847 . + . ID=gene:Os01g0102600;Name=Shikimate kinase 4;biotype=protein_coding;description=Shikimate kinase domain containing protein. (Os01t0102600-01)%3BSimilar to shikimate kinase family protein. (Os01t0102600-02);gene_id=Os01g0102600;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 145603 147847 . + . ID=transcript:Os01t0102600-01;Parent=gene:Os01g0102600;biotype=protein_coding;transcript_id=Os01t0102600-01
1 irgsp five_prime_UTR 145603 145644 . + . Parent=transcript:Os01t0102600-01
1 irgsp exon 145603 145786 . + . Parent=transcript:Os01t0102600-01;Name=Os01t0102600-01.exon1;constitutive=0;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0102600-01.exon1;rank=1
1 irgsp CDS 145645 145786 . + 0 ID=CDS:Os01t0102600-01;Parent=transcript:Os01t0102600-01;protein_id=Os01t0102600-01
1 irgsp exon 145905 145951 . + . Parent=transcript:Os01t0102600-01;Name=Os01t0102600-01.exon2;constitutive=0;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0102600-01.exon2;rank=2
1 irgsp CDS 145905 145951 . + 2 ID=CDS:Os01t0102600-01;Parent=transcript:Os01t0102600-01;protein_id=Os01t0102600-01
1 irgsp exon 146028 146082 . + . Parent=transcript:Os01t0102600-01;Name=Os01t0102600-01.exon3;constitutive=0;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0102600-01.exon3;rank=3
1 irgsp CDS 146028 146082 . + 0 ID=CDS:Os01t0102600-01;Parent=transcript:Os01t0102600-01;protein_id=Os01t0102600-01
1 irgsp exon 146179 146339 . + . Parent=transcript:Os01t0102600-01;Name=Os01t0102600-01.exon4;constitutive=0;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0102600-01.exon4;rank=4
1 irgsp CDS 146179 146339 . + 2 ID=CDS:Os01t0102600-01;Parent=transcript:Os01t0102600-01;protein_id=Os01t0102600-01
1 irgsp exon 146450 146532 . + . Parent=transcript:Os01t0102600-01;Name=Os01t0102600-01.exon5;constitutive=0;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0102600-01.exon5;rank=5
1 irgsp CDS 146450 146532 . + 0 ID=CDS:Os01t0102600-01;Parent=transcript:Os01t0102600-01;protein_id=Os01t0102600-01
1 irgsp exon 146611 146719 . + . Parent=transcript:Os01t0102600-01;Name=Os01t0102600-01.exon6;constitutive=0;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0102600-01.exon6;rank=6
1 irgsp CDS 146611 146719 . + 1 ID=CDS:Os01t0102600-01;Parent=transcript:Os01t0102600-01;protein_id=Os01t0102600-01
1 irgsp exon 147106 147184 . + . Parent=transcript:Os01t0102600-01;Name=Os01t0102600-01.exon7;constitutive=0;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0102600-01.exon7;rank=7
1 irgsp CDS 147106 147184 . + 0 ID=CDS:Os01t0102600-01;Parent=transcript:Os01t0102600-01;protein_id=Os01t0102600-01
1 irgsp exon 147311 147375 . + . Parent=transcript:Os01t0102600-01;Name=Os01t0102600-02.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0102600-02.exon2;rank=8
1 irgsp CDS 147311 147375 . + 2 ID=CDS:Os01t0102600-01;Parent=transcript:Os01t0102600-01;protein_id=Os01t0102600-01
1 irgsp CDS 147507 147575 . + 0 ID=CDS:Os01t0102600-01;Parent=transcript:Os01t0102600-01;protein_id=Os01t0102600-01
1 irgsp exon 147507 147847 . + . Parent=transcript:Os01t0102600-01;Name=Os01t0102600-01.exon9;constitutive=0;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0102600-01.exon9;rank=9
1 irgsp three_prime_UTR 147576 147847 . + . Parent=transcript:Os01t0102600-01
1 irgsp mRNA 147104 147805 . + . ID=transcript:Os01t0102600-02;Parent=gene:Os01g0102600;biotype=protein_coding;transcript_id=Os01t0102600-02
1 irgsp five_prime_UTR 147104 147105 . + . Parent=transcript:Os01t0102600-02
1 irgsp exon 147104 147184 . + . Parent=transcript:Os01t0102600-02;Name=Os01t0102600-02.exon1;constitutive=0;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0102600-02.exon1;rank=1
1 irgsp CDS 147106 147184 . + 0 ID=CDS:Os01t0102600-02;Parent=transcript:Os01t0102600-02;protein_id=Os01t0102600-02
1 irgsp exon 147311 147375 . + . Parent=transcript:Os01t0102600-02;Name=Os01t0102600-02.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0102600-02.exon2;rank=2
1 irgsp CDS 147311 147375 . + 2 ID=CDS:Os01t0102600-02;Parent=transcript:Os01t0102600-02;protein_id=Os01t0102600-02
1 irgsp CDS 147507 147575 . + 0 ID=CDS:Os01t0102600-02;Parent=transcript:Os01t0102600-02;protein_id=Os01t0102600-02
1 irgsp exon 147507 147805 . + . Parent=transcript:Os01t0102600-02;Name=Os01t0102600-02.exon3;constitutive=0;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0102600-02.exon3;rank=3
1 irgsp three_prime_UTR 147576 147805 . + . Parent=transcript:Os01t0102600-02
###
1 irgsp gene 148085 150568 . + . ID=gene:Os01g0102700;biotype=protein_coding;description=Translocon-associated beta family protein. (Os01t0102700-01);gene_id=Os01g0102700;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 148085 150568 . + . ID=transcript:Os01t0102700-01;Parent=gene:Os01g0102700;biotype=protein_coding;transcript_id=Os01t0102700-01
1 irgsp five_prime_UTR 148085 148146 . + . Parent=transcript:Os01t0102700-01
1 irgsp exon 148085 148313 . + . Parent=transcript:Os01t0102700-01;Name=Os01t0102700-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0102700-01.exon1;rank=1
1 irgsp CDS 148147 148313 . + 0 ID=CDS:Os01t0102700-01;Parent=transcript:Os01t0102700-01;protein_id=Os01t0102700-01
1 irgsp exon 149450 149548 . + . Parent=transcript:Os01t0102700-01;Name=Os01t0102700-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0102700-01.exon2;rank=2
1 irgsp CDS 149450 149548 . + 1 ID=CDS:Os01t0102700-01;Parent=transcript:Os01t0102700-01;protein_id=Os01t0102700-01
1 irgsp exon 149634 149742 . + . Parent=transcript:Os01t0102700-01;Name=Os01t0102700-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0102700-01.exon3;rank=3
1 irgsp CDS 149634 149742 . + 1 ID=CDS:Os01t0102700-01;Parent=transcript:Os01t0102700-01;protein_id=Os01t0102700-01
1 irgsp exon 149856 149931 . + . Parent=transcript:Os01t0102700-01;Name=Os01t0102700-01.exon4;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0102700-01.exon4;rank=4
1 irgsp CDS 149856 149931 . + 0 ID=CDS:Os01t0102700-01;Parent=transcript:Os01t0102700-01;protein_id=Os01t0102700-01
1 irgsp CDS 150152 150318 . + 2 ID=CDS:Os01t0102700-01;Parent=transcript:Os01t0102700-01;protein_id=Os01t0102700-01
1 irgsp exon 150152 150568 . + . Parent=transcript:Os01t0102700-01;Name=Os01t0102700-01.exon5;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0102700-01.exon5;rank=5
1 irgsp three_prime_UTR 150319 150568 . + . Parent=transcript:Os01t0102700-01
###
1 irgsp gene 152853 156449 . + . ID=gene:Os01g0102800;Name=Cockayne syndrome WD-repeat protein;biotype=protein_coding;description=Similar to chromatin remodeling complex subunit. (Os01t0102800-01);gene_id=Os01g0102800;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 152853 156449 . + . ID=transcript:Os01t0102800-01;Parent=gene:Os01g0102800;biotype=protein_coding;transcript_id=Os01t0102800-01
1 irgsp five_prime_UTR 152853 152853 . + . Parent=transcript:Os01t0102800-01
1 irgsp exon 152853 153025 . + . Parent=transcript:Os01t0102800-01;Name=Os01t0102800-01.exon1;constitutive=1;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0102800-01.exon1;rank=1
1 irgsp CDS 152854 153025 . + 0 ID=CDS:Os01t0102800-01;Parent=transcript:Os01t0102800-01;protein_id=Os01t0102800-01
1 irgsp exon 153178 154646 . + . Parent=transcript:Os01t0102800-01;Name=Os01t0102800-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0102800-01.exon2;rank=2
1 irgsp CDS 153178 154646 . + 2 ID=CDS:Os01t0102800-01;Parent=transcript:Os01t0102800-01;protein_id=Os01t0102800-01
1 irgsp exon 155010 155450 . + . Parent=transcript:Os01t0102800-01;Name=Os01t0102800-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0102800-01.exon3;rank=3
1 irgsp CDS 155010 155450 . + 0 ID=CDS:Os01t0102800-01;Parent=transcript:Os01t0102800-01;protein_id=Os01t0102800-01
1 irgsp CDS 155543 156214 . + 0 ID=CDS:Os01t0102800-01;Parent=transcript:Os01t0102800-01;protein_id=Os01t0102800-01
1 irgsp exon 155543 156449 . + . Parent=transcript:Os01t0102800-01;Name=Os01t0102800-01.exon4;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0102800-01.exon4;rank=4
1 irgsp three_prime_UTR 156215 156449 . + . Parent=transcript:Os01t0102800-01
###
1 irgsp gene 164577 168921 . + . ID=gene:Os01g0102850;biotype=protein_coding;description=Similar to nitrilase 2. (Os01t0102850-00);gene_id=Os01g0102850;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 164577 168921 . + . ID=transcript:Os01t0102850-00;Parent=gene:Os01g0102850;biotype=protein_coding;transcript_id=Os01t0102850-00
1 irgsp exon 164577 164905 . + . Parent=transcript:Os01t0102850-00;Name=Os01t0102850-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0102850-00.exon1;rank=1
1 irgsp five_prime_UTR 164577 164905 . + . Parent=transcript:Os01t0102850-00
1 irgsp five_prime_UTR 168499 168804 . + . Parent=transcript:Os01t0102850-00
1 irgsp exon 168499 168921 . + . Parent=transcript:Os01t0102850-00;Name=Os01t0102850-00.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0102850-00.exon2;rank=2
1 irgsp CDS 168805 168921 . + 0 ID=CDS:Os01t0102850-00;Parent=transcript:Os01t0102850-00;protein_id=Os01t0102850-00
###
1 irgsp gene 169390 170316 . - . ID=gene:Os01g0102900;Name=LIGHT-REGULATED GENE 1;biotype=protein_coding;description=Light-regulated protein%2C Regulation of light-dependent attachment of LEAF-TYPE FERREDOXIN-NADP+ OXIDOREDUCTASE (LFNR) to the thylakoid membrane (Os01t0102900-01);gene_id=Os01g0102900;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 169390 170316 . - . ID=transcript:Os01t0102900-01;Parent=gene:Os01g0102900;biotype=protein_coding;transcript_id=Os01t0102900-01
1 irgsp three_prime_UTR 169390 169598 . - . Parent=transcript:Os01t0102900-01
1 irgsp exon 169390 169656 . - . Parent=transcript:Os01t0102900-01;Name=Os01t0102900-01.exon3;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0102900-01.exon3;rank=3
1 irgsp CDS 169599 169656 . - 1 ID=CDS:Os01t0102900-01;Parent=transcript:Os01t0102900-01;protein_id=Os01t0102900-01
1 irgsp exon 169751 169909 . - . Parent=transcript:Os01t0102900-01;Name=Os01t0102900-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0102900-01.exon2;rank=2
1 irgsp CDS 169751 169909 . - 1 ID=CDS:Os01t0102900-01;Parent=transcript:Os01t0102900-01;protein_id=Os01t0102900-01
1 irgsp CDS 170091 170260 . - 0 ID=CDS:Os01t0102900-01;Parent=transcript:Os01t0102900-01;protein_id=Os01t0102900-01
1 irgsp exon 170091 170316 . - . Parent=transcript:Os01t0102900-01;Name=Os01t0102900-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0102900-01.exon1;rank=1
1 irgsp five_prime_UTR 170261 170316 . - . Parent=transcript:Os01t0102900-01
###
1 irgsp gene 170798 173144 . - . ID=gene:Os01g0103000;biotype=protein_coding;description=Snf7 family protein. (Os01t0103000-01);gene_id=Os01g0103000;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 170798 173144 . - . ID=transcript:Os01t0103000-01;Parent=gene:Os01g0103000;biotype=protein_coding;transcript_id=Os01t0103000-01
1 irgsp three_prime_UTR 170798 171044 . - . Parent=transcript:Os01t0103000-01
1 irgsp exon 170798 171095 . - . Parent=transcript:Os01t0103000-01;Name=Os01t0103000-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0103000-01.exon7;rank=7
1 irgsp CDS 171045 171095 . - 0 ID=CDS:Os01t0103000-01;Parent=transcript:Os01t0103000-01;protein_id=Os01t0103000-01
1 irgsp exon 171406 171554 . - . Parent=transcript:Os01t0103000-01;Name=Os01t0103000-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0103000-01.exon6;rank=6
1 irgsp CDS 171406 171554 . - 2 ID=CDS:Os01t0103000-01;Parent=transcript:Os01t0103000-01;protein_id=Os01t0103000-01
1 irgsp exon 171764 171875 . - . Parent=transcript:Os01t0103000-01;Name=Os01t0103000-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0103000-01.exon5;rank=5
1 irgsp CDS 171764 171875 . - 0 ID=CDS:Os01t0103000-01;Parent=transcript:Os01t0103000-01;protein_id=Os01t0103000-01
1 irgsp exon 172398 172469 . - . Parent=transcript:Os01t0103000-01;Name=Os01t0103000-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0103000-01.exon4;rank=4
1 irgsp CDS 172398 172469 . - 0 ID=CDS:Os01t0103000-01;Parent=transcript:Os01t0103000-01;protein_id=Os01t0103000-01
1 irgsp exon 172578 172671 . - . Parent=transcript:Os01t0103000-01;Name=Os01t0103000-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0103000-01.exon3;rank=3
1 irgsp CDS 172578 172671 . - 1 ID=CDS:Os01t0103000-01;Parent=transcript:Os01t0103000-01;protein_id=Os01t0103000-01
1 irgsp exon 172770 172921 . - . Parent=transcript:Os01t0103000-01;Name=Os01t0103000-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0103000-01.exon2;rank=2
1 irgsp CDS 172770 172921 . - 0 ID=CDS:Os01t0103000-01;Parent=transcript:Os01t0103000-01;protein_id=Os01t0103000-01
1 irgsp CDS 173004 173072 . - 0 ID=CDS:Os01t0103000-01;Parent=transcript:Os01t0103000-01;protein_id=Os01t0103000-01
1 irgsp exon 173004 173144 . - . Parent=transcript:Os01t0103000-01;Name=Os01t0103000-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0103000-01.exon1;rank=1
1 irgsp five_prime_UTR 173073 173144 . - . Parent=transcript:Os01t0103000-01
###
1 irgsp gene 178607 180575 . + . ID=gene:Os01g0103100;biotype=protein_coding;description=TGF-beta receptor%2C type I/II extracellular region family protein. (Os01t0103100-01)%3BSimilar to predicted protein. (Os01t0103100-02);gene_id=Os01g0103100;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 178607 180548 . + . ID=transcript:Os01t0103100-01;Parent=gene:Os01g0103100;biotype=protein_coding;transcript_id=Os01t0103100-01
1 irgsp five_prime_UTR 178607 178641 . + . Parent=transcript:Os01t0103100-01
1 irgsp exon 178607 180548 . + . Parent=transcript:Os01t0103100-01;Name=Os01t0103100-01.exon1;constitutive=0;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0103100-01.exon1;rank=1
1 irgsp CDS 178642 180462 . + 0 ID=CDS:Os01t0103100-01;Parent=transcript:Os01t0103100-01;protein_id=Os01t0103100-01
1 irgsp three_prime_UTR 180463 180548 . + . Parent=transcript:Os01t0103100-01
1 irgsp mRNA 178652 180575 . + . ID=transcript:Os01t0103100-02;Parent=gene:Os01g0103100;biotype=protein_coding;transcript_id=Os01t0103100-02
1 irgsp five_prime_UTR 178652 178677 . + . Parent=transcript:Os01t0103100-02
1 irgsp exon 178652 180575 . + . Parent=transcript:Os01t0103100-02;Name=Os01t0103100-02.exon1;constitutive=0;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0103100-02.exon1;rank=1
1 irgsp CDS 178678 180462 . + 0 ID=CDS:Os01t0103100-02;Parent=transcript:Os01t0103100-02;protein_id=Os01t0103100-02
1 irgsp three_prime_UTR 180463 180575 . + . Parent=transcript:Os01t0103100-02
###
1 irgsp gene 178815 180433 . - . ID=gene:Os01g0103075;biotype=protein_coding;description=Hypothetical protein. (Os01t0103075-00);gene_id=Os01g0103075;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 178815 180433 . - . ID=transcript:Os01t0103075-00;Parent=gene:Os01g0103075;biotype=protein_coding;transcript_id=Os01t0103075-00
1 irgsp three_prime_UTR 178815 179511 . - . Parent=transcript:Os01t0103075-00
1 irgsp exon 178815 180433 . - . Parent=transcript:Os01t0103075-00;Name=Os01t0103075-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0103075-00.exon1;rank=1
1 irgsp CDS 179512 180054 . - 0 ID=CDS:Os01t0103075-00;Parent=transcript:Os01t0103075-00;protein_id=Os01t0103075-00
1 irgsp five_prime_UTR 180055 180433 . - . Parent=transcript:Os01t0103075-00
###
1 Ensembl_Plants ncRNA_gene 182074 182154 . + . ID=gene:ENSRNA049442722;Name=tRNA-Leu;biotype=tRNA;description=tRNA-Leu for anticodon AAG;gene_id=ENSRNA049442722;logic_name=trnascan_gene
1 Ensembl_Plants tRNA 182074 182154 . + . ID=transcript:ENSRNA049442722-T1;Parent=gene:ENSRNA049442722;biotype=tRNA;transcript_id=ENSRNA049442722-T1
1 Ensembl_Plants exon 182074 182154 . + . Parent=transcript:ENSRNA049442722-T1;Name=ENSRNA049442722-E1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=ENSRNA049442722-E1;rank=1
###
1 irgsp gene 185189 185828 . - . ID=gene:Os01g0103400;biotype=protein_coding;description=Hypothetical gene. (Os01t0103400-01);gene_id=Os01g0103400;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 185189 185828 . - . ID=transcript:Os01t0103400-01;Parent=gene:Os01g0103400;biotype=protein_coding;transcript_id=Os01t0103400-01
1 irgsp three_prime_UTR 185189 185434 . - . Parent=transcript:Os01t0103400-01
1 irgsp exon 185189 185828 . - . Parent=transcript:Os01t0103400-01;Name=Os01t0103400-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0103400-01.exon1;rank=1
1 irgsp CDS 185435 185827 . - 0 ID=CDS:Os01t0103400-01;Parent=transcript:Os01t0103400-01;protein_id=Os01t0103400-01
1 irgsp five_prime_UTR 185828 185828 . - . Parent=transcript:Os01t0103400-01
###
1 irgsp repeat_region 186000 186100 . + . ID=fakeRepeat2
###
1 irgsp gene 186250 190904 . - . ID=gene:Os01g0103600;biotype=protein_coding;description=Similar to sterol-8%2C7-isomerase. (Os01t0103600-01)%3BEmopamil-binding family protein. (Os01t0103600-02);gene_id=Os01g0103600;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 186250 190262 . - . ID=transcript:Os01t0103600-02;Parent=gene:Os01g0103600;biotype=protein_coding;transcript_id=Os01t0103600-02
1 irgsp three_prime_UTR 186250 186515 . - . Parent=transcript:Os01t0103600-02
1 irgsp exon 186250 186771 . - . Parent=transcript:Os01t0103600-02;Name=Os01t0103600-02.exon4;constitutive=0;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0103600-02.exon4;rank=4
1 irgsp CDS 186516 186771 . - 1 ID=CDS:Os01t0103600-02;Parent=transcript:Os01t0103600-02;protein_id=Os01t0103600-02
1 irgsp exon 189607 189715 . - . Parent=transcript:Os01t0103600-02;Name=Os01t0103600-02.exon3;constitutive=0;ensembl_end_phase=2;ensembl_phase=1;exon_id=Os01t0103600-02.exon3;rank=3
1 irgsp CDS 189607 189715 . - 2 ID=CDS:Os01t0103600-02;Parent=transcript:Os01t0103600-02;protein_id=Os01t0103600-02
1 irgsp exon 189841 189990 . - . Parent=transcript:Os01t0103600-02;Name=Os01t0103600-02.exon2;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0103600-02.exon2;rank=2
1 irgsp CDS 189841 189990 . - 2 ID=CDS:Os01t0103600-02;Parent=transcript:Os01t0103600-02;protein_id=Os01t0103600-02
1 irgsp CDS 190087 190231 . - 0 ID=CDS:Os01t0103600-02;Parent=transcript:Os01t0103600-02;protein_id=Os01t0103600-02
1 irgsp exon 190087 190262 . - . Parent=transcript:Os01t0103600-02;Name=Os01t0103600-02.exon1;constitutive=0;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0103600-02.exon1;rank=1
1 irgsp five_prime_UTR 190232 190262 . - . Parent=transcript:Os01t0103600-02
1 irgsp mRNA 187345 190904 . - . ID=transcript:Os01t0103600-01;Parent=gene:Os01g0103600;biotype=protein_coding;transcript_id=Os01t0103600-01
1 irgsp three_prime_UTR 187345 189395 . - . Parent=transcript:Os01t0103600-01
1 irgsp exon 187345 189715 . - . Parent=transcript:Os01t0103600-01;Name=Os01t0103600-01.exon3;constitutive=0;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0103600-01.exon3;rank=3
1 irgsp CDS 189396 189715 . - 2 ID=CDS:Os01t0103600-01;Parent=transcript:Os01t0103600-01;protein_id=Os01t0103600-01
1 irgsp exon 189841 189990 . - . Parent=transcript:Os01t0103600-01;Name=Os01t0103600-02.exon2;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0103600-02.exon2;rank=2
1 irgsp CDS 189841 189990 . - 2 ID=CDS:Os01t0103600-01;Parent=transcript:Os01t0103600-01;protein_id=Os01t0103600-01
1 irgsp CDS 190087 190231 . - 0 ID=CDS:Os01t0103600-01;Parent=transcript:Os01t0103600-01;protein_id=Os01t0103600-01
1 irgsp exon 190087 190904 . - . Parent=transcript:Os01t0103600-01;Name=Os01t0103600-01.exon1;constitutive=0;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0103600-01.exon1;rank=1
1 irgsp five_prime_UTR 190232 190904 . - . Parent=transcript:Os01t0103600-01
###
1 irgsp gene 187545 188586 . + . ID=gene:Os01g0103650;biotype=protein_coding;description=Hypothetical gene. (Os01t0103650-00);gene_id=Os01g0103650;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 187545 188586 . + . ID=transcript:Os01t0103650-00;Parent=gene:Os01g0103650;biotype=protein_coding;transcript_id=Os01t0103650-00
1 irgsp five_prime_UTR 187545 187546 . + . Parent=transcript:Os01t0103650-00
1 irgsp exon 187545 188020 . + . Parent=transcript:Os01t0103650-00;Name=Os01t0103650-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0103650-00.exon1;rank=1
1 irgsp CDS 187547 187768 . + 0 ID=CDS:Os01t0103650-00;Parent=transcript:Os01t0103650-00;protein_id=Os01t0103650-00
1 irgsp three_prime_UTR 187769 188020 . + . Parent=transcript:Os01t0103650-00
1 irgsp exon 188060 188385 . + . Parent=transcript:Os01t0103650-00;Name=Os01t0103650-00.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0103650-00.exon2;rank=2
1 irgsp three_prime_UTR 188060 188385 . + . Parent=transcript:Os01t0103650-00
1 irgsp exon 188455 188586 . + . Parent=transcript:Os01t0103650-00;Name=Os01t0103650-00.exon3;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0103650-00.exon3;rank=3
1 irgsp three_prime_UTR 188455 188586 . + . Parent=transcript:Os01t0103650-00
###
1 irgsp gene 191037 196287 . + . ID=gene:Os01g0103700;biotype=protein_coding;description=Conserved hypothetical protein. (Os01t0103700-01);gene_id=Os01g0103700;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 191037 196287 . + . ID=transcript:Os01t0103700-01;Parent=gene:Os01g0103700;biotype=protein_coding;transcript_id=Os01t0103700-01
1 irgsp exon 191037 191161 . + . Parent=transcript:Os01t0103700-01;Name=Os01t0103700-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0103700-01.exon1;rank=1
1 irgsp five_prime_UTR 191037 191161 . + . Parent=transcript:Os01t0103700-01
1 irgsp five_prime_UTR 191625 191693 . + . Parent=transcript:Os01t0103700-01
1 irgsp exon 191625 191705 . + . Parent=transcript:Os01t0103700-01;Name=Os01t0103700-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0103700-01.exon2;rank=2
1 irgsp CDS 191694 191705 . + 0 ID=CDS:Os01t0103700-01;Parent=transcript:Os01t0103700-01;protein_id=Os01t0103700-01
1 irgsp exon 192399 192506 . + . Parent=transcript:Os01t0103700-01;Name=Os01t0103700-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0103700-01.exon3;rank=3
1 irgsp CDS 192399 192506 . + 0 ID=CDS:Os01t0103700-01;Parent=transcript:Os01t0103700-01;protein_id=Os01t0103700-01
1 irgsp exon 192958 193161 . + . Parent=transcript:Os01t0103700-01;Name=Os01t0103700-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0103700-01.exon4;rank=4
1 irgsp CDS 192958 193161 . + 0 ID=CDS:Os01t0103700-01;Parent=transcript:Os01t0103700-01;protein_id=Os01t0103700-01
1 irgsp exon 193248 193356 . + . Parent=transcript:Os01t0103700-01;Name=Os01t0103700-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0103700-01.exon5;rank=5
1 irgsp CDS 193248 193356 . + 0 ID=CDS:Os01t0103700-01;Parent=transcript:Os01t0103700-01;protein_id=Os01t0103700-01
1 irgsp CDS 193434 193507 . + 2 ID=CDS:Os01t0103700-01;Parent=transcript:Os01t0103700-01;protein_id=Os01t0103700-01
1 irgsp exon 193434 196287 . + . Parent=transcript:Os01t0103700-01;Name=Os01t0103700-01.exon6;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0103700-01.exon6;rank=6
1 irgsp three_prime_UTR 193508 196287 . + . Parent=transcript:Os01t0103700-01
###
1 irgsp gene 197647 200803 . + . ID=gene:Os01g0103800;Name=OsDW1-01g;biotype=protein_coding;description=Conserved hypothetical protein. (Os01t0103800-01);gene_id=Os01g0103800;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 197647 200803 . + . ID=transcript:Os01t0103800-01;Parent=gene:Os01g0103800;biotype=protein_coding;transcript_id=Os01t0103800-01
1 irgsp exon 197647 197838 . + . Parent=transcript:Os01t0103800-01;Name=Os01t0103800-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0103800-01.exon1;rank=1
1 irgsp five_prime_UTR 197647 197838 . + . Parent=transcript:Os01t0103800-01
1 irgsp five_prime_UTR 198034 198129 . + . Parent=transcript:Os01t0103800-01
1 irgsp exon 198034 198225 . + . Parent=transcript:Os01t0103800-01;Name=Os01t0103800-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0103800-01.exon2;rank=2
1 irgsp CDS 198130 198225 . + 0 ID=CDS:Os01t0103800-01;Parent=transcript:Os01t0103800-01;protein_id=Os01t0103800-01
1 irgsp exon 198830 200036 . + . Parent=transcript:Os01t0103800-01;Name=Os01t0103800-01.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0103800-01.exon3;rank=3
1 irgsp CDS 198830 200036 . + 0 ID=CDS:Os01t0103800-01;Parent=transcript:Os01t0103800-01;protein_id=Os01t0103800-01
1 irgsp CDS 200253 200479 . + 2 ID=CDS:Os01t0103800-01;Parent=transcript:Os01t0103800-01;protein_id=Os01t0103800-01
1 irgsp exon 200253 200803 . + . Parent=transcript:Os01t0103800-01;Name=Os01t0103800-01.exon4;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0103800-01.exon4;rank=4
1 irgsp three_prime_UTR 200480 200803 . + . Parent=transcript:Os01t0103800-01
###
1 irgsp gene 201944 206202 . + . ID=gene:Os01g0103900;biotype=protein_coding;description=Polynucleotidyl transferase%2C Ribonuclease H fold domain containing protein. (Os01t0103900-01);gene_id=Os01g0103900;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 201944 206202 . + . ID=transcript:Os01t0103900-01;Parent=gene:Os01g0103900;biotype=protein_coding;transcript_id=Os01t0103900-01
1 irgsp five_prime_UTR 201944 202041 . + . Parent=transcript:Os01t0103900-01
1 irgsp exon 201944 202110 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0103900-01.exon1;rank=1
1 irgsp CDS 202042 202110 . + 0 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 202252 202359 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0103900-01.exon2;rank=2
1 irgsp CDS 202252 202359 . + 0 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 203007 203127 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0103900-01.exon3;rank=3
1 irgsp CDS 203007 203127 . + 0 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 203302 203429 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0103900-01.exon4;rank=4
1 irgsp CDS 203302 203429 . + 2 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 203511 203658 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0103900-01.exon5;rank=5
1 irgsp CDS 203511 203658 . + 0 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 203760 203938 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0103900-01.exon6;rank=6
1 irgsp CDS 203760 203938 . + 2 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 204203 204440 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon7;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0103900-01.exon7;rank=7
1 irgsp CDS 204203 204440 . + 0 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 204543 204635 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon8;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0103900-01.exon8;rank=8
1 irgsp CDS 204543 204635 . + 2 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 204730 204875 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon9;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0103900-01.exon9;rank=9
1 irgsp CDS 204730 204875 . + 2 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 205042 205149 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon10;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0103900-01.exon10;rank=10
1 irgsp CDS 205042 205149 . + 0 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 205290 205378 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon11;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0103900-01.exon11;rank=11
1 irgsp CDS 205290 205378 . + 0 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp CDS 205534 205543 . + 1 ID=CDS:Os01t0103900-01;Parent=transcript:Os01t0103900-01;protein_id=Os01t0103900-01
1 irgsp exon 205534 206202 . + . Parent=transcript:Os01t0103900-01;Name=Os01t0103900-01.exon12;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0103900-01.exon12;rank=12
1 irgsp three_prime_UTR 205544 206202 . + . Parent=transcript:Os01t0103900-01
###
1 irgsp gene 206131 209606 . - . ID=gene:Os01g0104000;biotype=protein_coding;description=C-type lectin domain containing protein. (Os01t0104000-01)%3BSimilar to predicted protein. (Os01t0104000-02);gene_id=Os01g0104000;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 206131 209581 . - . ID=transcript:Os01t0104000-02;Parent=gene:Os01g0104000;biotype=protein_coding;transcript_id=Os01t0104000-02
1 irgsp three_prime_UTR 206131 206449 . - . Parent=transcript:Os01t0104000-02
1 irgsp exon 206131 207029 . - . Parent=transcript:Os01t0104000-02;Name=Os01t0104000-02.exon4;constitutive=0;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0104000-02.exon4;rank=4
1 irgsp CDS 206450 207029 . - 1 ID=CDS:Os01t0104000-02;Parent=transcript:Os01t0104000-02;protein_id=Os01t0104000-02
1 irgsp exon 207706 208273 . - . Parent=transcript:Os01t0104000-02;Name=Os01t0104000-02.exon3;constitutive=0;ensembl_end_phase=2;ensembl_phase=1;exon_id=Os01t0104000-02.exon3;rank=3
1 irgsp CDS 207706 208273 . - 2 ID=CDS:Os01t0104000-02;Parent=transcript:Os01t0104000-02;protein_id=Os01t0104000-02
1 irgsp exon 208408 208836 . - . Parent=transcript:Os01t0104000-02;Name=Os01t0104000-01.exon2;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0104000-01.exon2;rank=2
1 irgsp CDS 208408 208836 . - 2 ID=CDS:Os01t0104000-02;Parent=transcript:Os01t0104000-02;protein_id=Os01t0104000-02
1 irgsp CDS 209438 209525 . - 0 ID=CDS:Os01t0104000-02;Parent=transcript:Os01t0104000-02;protein_id=Os01t0104000-02
1 irgsp exon 209438 209581 . - . Parent=transcript:Os01t0104000-02;Name=Os01t0104000-02.exon1;constitutive=0;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0104000-02.exon1;rank=1
1 irgsp five_prime_UTR 209526 209581 . - . Parent=transcript:Os01t0104000-02
1 irgsp mRNA 206134 209606 . - . ID=transcript:Os01t0104000-01;Parent=gene:Os01g0104000;biotype=protein_coding;transcript_id=Os01t0104000-01
1 irgsp three_prime_UTR 206134 206449 . - . Parent=transcript:Os01t0104000-01
1 irgsp exon 206134 207029 . - . Parent=transcript:Os01t0104000-01;Name=Os01t0104000-01.exon4;constitutive=0;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0104000-01.exon4;rank=4
1 irgsp CDS 206450 207029 . - 1 ID=CDS:Os01t0104000-01;Parent=transcript:Os01t0104000-01;protein_id=Os01t0104000-01
1 irgsp exon 207706 208276 . - . Parent=transcript:Os01t0104000-01;Name=Os01t0104000-01.exon3;constitutive=0;ensembl_end_phase=2;ensembl_phase=1;exon_id=Os01t0104000-01.exon3;rank=3
1 irgsp CDS 207706 208276 . - 2 ID=CDS:Os01t0104000-01;Parent=transcript:Os01t0104000-01;protein_id=Os01t0104000-01
1 irgsp exon 208408 208836 . - . Parent=transcript:Os01t0104000-01;Name=Os01t0104000-01.exon2;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0104000-01.exon2;rank=2
1 irgsp CDS 208408 208836 . - 2 ID=CDS:Os01t0104000-01;Parent=transcript:Os01t0104000-01;protein_id=Os01t0104000-01
1 irgsp CDS 209438 209525 . - 0 ID=CDS:Os01t0104000-01;Parent=transcript:Os01t0104000-01;protein_id=Os01t0104000-01
1 irgsp exon 209438 209606 . - . Parent=transcript:Os01t0104000-01;Name=Os01t0104000-01.exon1;constitutive=0;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0104000-01.exon1;rank=1
1 irgsp five_prime_UTR 209526 209606 . - . Parent=transcript:Os01t0104000-01
###
1 irgsp gene 209771 214173 . + . ID=gene:Os01g0104100;Name=cold-inducible%2C cold-inducible zinc finger protein;biotype=protein_coding;description=Similar to protein binding / zinc ion binding. (Os01t0104100-01)%3BSimilar to protein binding / zinc ion binding. (Os01t0104100-02);gene_id=Os01g0104100;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 209771 214173 . + . ID=transcript:Os01t0104100-01;Parent=gene:Os01g0104100;biotype=protein_coding;transcript_id=Os01t0104100-01
1 irgsp exon 209771 209896 . + . Parent=transcript:Os01t0104100-01;Name=Os01t0104100-01.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104100-01.exon1;rank=1
1 irgsp CDS 209771 209896 . + 0 ID=CDS:Os01t0104100-01;Parent=transcript:Os01t0104100-01;protein_id=Os01t0104100-01
1 irgsp exon 210244 210563 . + . Parent=transcript:Os01t0104100-01;Name=Os01t0104100-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104100-01.exon2;rank=2
1 irgsp CDS 210244 210563 . + 0 ID=CDS:Os01t0104100-01;Parent=transcript:Os01t0104100-01;protein_id=Os01t0104100-01
1 irgsp exon 210659 210890 . + . Parent=transcript:Os01t0104100-01;Name=Os01t0104100-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104100-01.exon3;rank=3
1 irgsp CDS 210659 210890 . + 1 ID=CDS:Os01t0104100-01;Parent=transcript:Os01t0104100-01;protein_id=Os01t0104100-01
1 irgsp exon 211015 211160 . + . Parent=transcript:Os01t0104100-01;Name=Os01t0104100-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104100-01.exon4;rank=4
1 irgsp CDS 211015 211160 . + 0 ID=CDS:Os01t0104100-01;Parent=transcript:Os01t0104100-01;protein_id=Os01t0104100-01
1 irgsp exon 212265 212352 . + . Parent=transcript:Os01t0104100-01;Name=Os01t0104100-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104100-01.exon5;rank=5
1 irgsp CDS 212265 212352 . + 1 ID=CDS:Os01t0104100-01;Parent=transcript:Os01t0104100-01;protein_id=Os01t0104100-01
1 irgsp exon 212433 212579 . + . Parent=transcript:Os01t0104100-01;Name=Os01t0104100-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104100-01.exon6;rank=6
1 irgsp CDS 212433 212579 . + 0 ID=CDS:Os01t0104100-01;Parent=transcript:Os01t0104100-01;protein_id=Os01t0104100-01
1 irgsp exon 213490 213639 . + . Parent=transcript:Os01t0104100-01;Name=Os01t0104100-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104100-01.exon7;rank=7
1 irgsp CDS 213490 213639 . + 0 ID=CDS:Os01t0104100-01;Parent=transcript:Os01t0104100-01;protein_id=Os01t0104100-01
1 irgsp CDS 213741 213788 . + 0 ID=CDS:Os01t0104100-01;Parent=transcript:Os01t0104100-01;protein_id=Os01t0104100-01
1 irgsp exon 213741 214173 . + . Parent=transcript:Os01t0104100-01;Name=Os01t0104100-01.exon8;constitutive=0;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0104100-01.exon8;rank=8
1 irgsp three_prime_UTR 213789 214173 . + . Parent=transcript:Os01t0104100-01
1 irgsp mRNA 209794 214147 . + . ID=transcript:Os01t0104100-02;Parent=gene:Os01g0104100;biotype=protein_coding;transcript_id=Os01t0104100-02
1 irgsp five_prime_UTR 209794 209794 . + . Parent=transcript:Os01t0104100-02
1 irgsp exon 209794 209896 . + . Parent=transcript:Os01t0104100-02;Name=Os01t0104100-02.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0104100-02.exon1;rank=1
1 irgsp CDS 209795 209896 . + 0 ID=CDS:Os01t0104100-02;Parent=transcript:Os01t0104100-02;protein_id=Os01t0104100-02
1 irgsp exon 210244 210563 . + . Parent=transcript:Os01t0104100-02;Name=Os01t0104100-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104100-01.exon2;rank=2
1 irgsp CDS 210244 210563 . + 0 ID=CDS:Os01t0104100-02;Parent=transcript:Os01t0104100-02;protein_id=Os01t0104100-02
1 irgsp exon 210659 210890 . + . Parent=transcript:Os01t0104100-02;Name=Os01t0104100-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104100-01.exon3;rank=3
1 irgsp CDS 210659 210890 . + 1 ID=CDS:Os01t0104100-02;Parent=transcript:Os01t0104100-02;protein_id=Os01t0104100-02
1 irgsp exon 211015 211160 . + . Parent=transcript:Os01t0104100-02;Name=Os01t0104100-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104100-01.exon4;rank=4
1 irgsp CDS 211015 211160 . + 0 ID=CDS:Os01t0104100-02;Parent=transcript:Os01t0104100-02;protein_id=Os01t0104100-02
1 irgsp exon 212265 212352 . + . Parent=transcript:Os01t0104100-02;Name=Os01t0104100-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104100-01.exon5;rank=5
1 irgsp CDS 212265 212352 . + 1 ID=CDS:Os01t0104100-02;Parent=transcript:Os01t0104100-02;protein_id=Os01t0104100-02
1 irgsp exon 212433 212579 . + . Parent=transcript:Os01t0104100-02;Name=Os01t0104100-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104100-01.exon6;rank=6
1 irgsp CDS 212433 212579 . + 0 ID=CDS:Os01t0104100-02;Parent=transcript:Os01t0104100-02;protein_id=Os01t0104100-02
1 irgsp exon 213490 213639 . + . Parent=transcript:Os01t0104100-02;Name=Os01t0104100-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104100-01.exon7;rank=7
1 irgsp CDS 213490 213639 . + 0 ID=CDS:Os01t0104100-02;Parent=transcript:Os01t0104100-02;protein_id=Os01t0104100-02
1 irgsp CDS 213741 213788 . + 0 ID=CDS:Os01t0104100-02;Parent=transcript:Os01t0104100-02;protein_id=Os01t0104100-02
1 irgsp exon 213741 214147 . + . Parent=transcript:Os01t0104100-02;Name=Os01t0104100-02.exon8;constitutive=0;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0104100-02.exon8;rank=8
1 irgsp three_prime_UTR 213789 214147 . + . Parent=transcript:Os01t0104100-02
###
1 irgsp gene 216212 217345 . + . ID=gene:Os01g0104200;Name=NAC DOMAIN-CONTAINING PROTEIN 16;biotype=protein_coding;description=No apical meristem (NAM) protein domain containing protein. (Os01t0104200-00);gene_id=Os01g0104200;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 216212 217345 . + . ID=transcript:Os01t0104200-00;Parent=gene:Os01g0104200;biotype=protein_coding;transcript_id=Os01t0104200-00
1 irgsp exon 216212 216769 . + . Parent=transcript:Os01t0104200-00;Name=Os01t0104200-00.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104200-00.exon1;rank=1
1 irgsp CDS 216212 216769 . + 0 ID=CDS:Os01t0104200-00;Parent=transcript:Os01t0104200-00;protein_id=Os01t0104200-00
1 irgsp exon 216884 217345 . + . Parent=transcript:Os01t0104200-00;Name=Os01t0104200-00.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104200-00.exon2;rank=2
1 irgsp CDS 216884 217345 . + 0 ID=CDS:Os01t0104200-00;Parent=transcript:Os01t0104200-00;protein_id=Os01t0104200-00
###
1 irgsp gene 226897 229301 . + . ID=gene:Os01g0104400;biotype=protein_coding;description=Ricin B-related lectin domain containing protein. (Os01t0104400-01)%3BRicin B-related lectin domain containing protein. (Os01t0104400-02)%3BRicin B-related lectin domain containing protein. (Os01t0104400-03);gene_id=Os01g0104400;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 226897 229229 . + . ID=transcript:Os01t0104400-01;Parent=gene:Os01g0104400;biotype=protein_coding;transcript_id=Os01t0104400-01
1 irgsp five_prime_UTR 226897 227181 . + . Parent=transcript:Os01t0104400-01
1 irgsp exon 226897 227634 . + . Parent=transcript:Os01t0104400-01;Name=Os01t0104400-01.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0104400-01.exon1;rank=1
1 irgsp CDS 227182 227634 . + 0 ID=CDS:Os01t0104400-01;Parent=transcript:Os01t0104400-01;protein_id=Os01t0104400-01
1 irgsp exon 227742 227864 . + . Parent=transcript:Os01t0104400-01;Name=Os01t0104400-03.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104400-03.exon2;rank=2
1 irgsp CDS 227742 227864 . + 0 ID=CDS:Os01t0104400-01;Parent=transcript:Os01t0104400-01;protein_id=Os01t0104400-01
1 irgsp exon 228557 228785 . + . Parent=transcript:Os01t0104400-01;Name=Os01t0104400-03.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0104400-03.exon3;rank=3
1 irgsp CDS 228557 228785 . + 0 ID=CDS:Os01t0104400-01;Parent=transcript:Os01t0104400-01;protein_id=Os01t0104400-01
1 irgsp CDS 228930 228931 . + 2 ID=CDS:Os01t0104400-01;Parent=transcript:Os01t0104400-01;protein_id=Os01t0104400-01
1 irgsp exon 228930 229229 . + . Parent=transcript:Os01t0104400-01;Name=Os01t0104400-01.exon4;constitutive=0;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0104400-01.exon4;rank=4
1 irgsp three_prime_UTR 228932 229229 . + . Parent=transcript:Os01t0104400-01
1 irgsp mRNA 227139 229301 . + . ID=transcript:Os01t0104400-02;Parent=gene:Os01g0104400;biotype=protein_coding;transcript_id=Os01t0104400-02
1 irgsp five_prime_UTR 227139 227181 . + . Parent=transcript:Os01t0104400-02
1 irgsp exon 227139 227634 . + . Parent=transcript:Os01t0104400-02;Name=Os01t0104400-02.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0104400-02.exon1;rank=1
1 irgsp CDS 227182 227634 . + 0 ID=CDS:Os01t0104400-02;Parent=transcript:Os01t0104400-02;protein_id=Os01t0104400-02
1 irgsp exon 227742 227864 . + . Parent=transcript:Os01t0104400-02;Name=Os01t0104400-03.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104400-03.exon2;rank=2
1 irgsp CDS 227742 227864 . + 0 ID=CDS:Os01t0104400-02;Parent=transcript:Os01t0104400-02;protein_id=Os01t0104400-02
1 irgsp exon 228557 228785 . + . Parent=transcript:Os01t0104400-02;Name=Os01t0104400-03.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0104400-03.exon3;rank=3
1 irgsp CDS 228557 228785 . + 0 ID=CDS:Os01t0104400-02;Parent=transcript:Os01t0104400-02;protein_id=Os01t0104400-02
1 irgsp CDS 228930 228931 . + 2 ID=CDS:Os01t0104400-02;Parent=transcript:Os01t0104400-02;protein_id=Os01t0104400-02
1 irgsp exon 228930 229301 . + . Parent=transcript:Os01t0104400-02;Name=Os01t0104400-02.exon4;constitutive=0;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0104400-02.exon4;rank=4
1 irgsp three_prime_UTR 228932 229301 . + . Parent=transcript:Os01t0104400-02
1 irgsp mRNA 227179 229214 . + . ID=transcript:Os01t0104400-03;Parent=gene:Os01g0104400;biotype=protein_coding;transcript_id=Os01t0104400-03
1 irgsp five_prime_UTR 227179 227181 . + . Parent=transcript:Os01t0104400-03
1 irgsp exon 227179 227634 . + . Parent=transcript:Os01t0104400-03;Name=Os01t0104400-03.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0104400-03.exon1;rank=1
1 irgsp CDS 227182 227634 . + 0 ID=CDS:Os01t0104400-03;Parent=transcript:Os01t0104400-03;protein_id=Os01t0104400-03
1 irgsp exon 227742 227864 . + . Parent=transcript:Os01t0104400-03;Name=Os01t0104400-03.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104400-03.exon2;rank=2
1 irgsp CDS 227742 227864 . + 0 ID=CDS:Os01t0104400-03;Parent=transcript:Os01t0104400-03;protein_id=Os01t0104400-03
1 irgsp exon 228557 228785 . + . Parent=transcript:Os01t0104400-03;Name=Os01t0104400-03.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0104400-03.exon3;rank=3
1 irgsp CDS 228557 228785 . + 0 ID=CDS:Os01t0104400-03;Parent=transcript:Os01t0104400-03;protein_id=Os01t0104400-03
1 irgsp CDS 228930 228931 . + 2 ID=CDS:Os01t0104400-03;Parent=transcript:Os01t0104400-03;protein_id=Os01t0104400-03
1 irgsp exon 228930 229214 . + . Parent=transcript:Os01t0104400-03;Name=Os01t0104400-03.exon4;constitutive=0;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0104400-03.exon4;rank=4
1 irgsp three_prime_UTR 228932 229214 . + . Parent=transcript:Os01t0104400-03
###
1 irgsp gene 241680 243440 . + . ID=gene:Os01g0104500;Name=NAC DOMAIN-CONTAINING PROTEIN 20;biotype=protein_coding;description=No apical meristem (NAM) protein domain containing protein. (Os01t0104500-01);gene_id=Os01g0104500;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 241680 243440 . + . ID=transcript:Os01t0104500-01;Parent=gene:Os01g0104500;biotype=protein_coding;transcript_id=Os01t0104500-01
1 irgsp exon 241680 241702 . + . Parent=transcript:Os01t0104500-01;Name=Os01t0104500-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0104500-01.exon1;rank=1
1 irgsp five_prime_UTR 241680 241702 . + . Parent=transcript:Os01t0104500-01
1 irgsp five_prime_UTR 241866 241907 . + . Parent=transcript:Os01t0104500-01
1 irgsp exon 241866 242091 . + . Parent=transcript:Os01t0104500-01;Name=Os01t0104500-01.exon2;constitutive=1;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0104500-01.exon2;rank=2
1 irgsp CDS 241908 242091 . + 0 ID=CDS:Os01t0104500-01;Parent=transcript:Os01t0104500-01;protein_id=Os01t0104500-01
1 irgsp CDS 242199 242977 . + 2 ID=CDS:Os01t0104500-01;Parent=transcript:Os01t0104500-01;protein_id=Os01t0104500-01
1 irgsp exon 242199 243440 . + . Parent=transcript:Os01t0104500-01;Name=Os01t0104500-01.exon3;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0104500-01.exon3;rank=3
1 irgsp three_prime_UTR 242978 243440 . + . Parent=transcript:Os01t0104500-01
###
1 irgsp gene 248828 256872 . - . ID=gene:Os01g0104600;Name=DE-ETIOLATED1;biotype=protein_coding;description=Homolog of Arabidopsis DE-ETIOLATED1 (DET1)%2C Modulation of the ABA signaling pathway and ABA biosynthesis%2C Regulation of chlorophyll content (Os01t0104600-01)%3BSimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). (Os01t0104600-02);gene_id=Os01g0104600;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 248828 256571 . - . ID=transcript:Os01t0104600-02;Parent=gene:Os01g0104600;biotype=protein_coding;transcript_id=Os01t0104600-02
1 irgsp three_prime_UTR 248828 248970 . - . Parent=transcript:Os01t0104600-02
1 irgsp exon 248828 249107 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon11;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0104600-01.exon11;rank=11
1 irgsp CDS 248971 249107 . - 2 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 249369 249468 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon10;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0104600-01.exon10;rank=10
1 irgsp CDS 249369 249468 . - 0 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 249861 249956 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon9;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon9;rank=9
1 irgsp CDS 249861 249956 . - 0 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 250617 250781 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon8;rank=8
1 irgsp CDS 250617 250781 . - 0 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 250860 250940 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon7;rank=7
1 irgsp CDS 250860 250940 . - 0 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 251026 251082 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon6;rank=6
1 irgsp CDS 251026 251082 . - 0 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 251316 251384 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon5;rank=5
1 irgsp CDS 251316 251384 . - 0 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 251695 251790 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon4;rank=4
1 irgsp CDS 251695 251790 . - 0 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 255325 255553 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104600-01.exon3;rank=3
1 irgsp CDS 255325 255553 . - 1 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 255674 256098 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104600-01.exon2;rank=2
1 irgsp CDS 255674 256098 . - 0 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp CDS 256361 256441 . - 0 ID=CDS:Os01t0104600-02;Parent=transcript:Os01t0104600-02;protein_id=Os01t0104600-02
1 irgsp exon 256361 256571 . - . Parent=transcript:Os01t0104600-02;Name=Os01t0104600-02.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0104600-02.exon1;rank=1
1 irgsp five_prime_UTR 256442 256571 . - . Parent=transcript:Os01t0104600-02
1 irgsp mRNA 248828 256872 . - . ID=transcript:Os01t0104600-01;Parent=gene:Os01g0104600;biotype=protein_coding;transcript_id=Os01t0104600-01
1 irgsp three_prime_UTR 248828 248970 . - . Parent=transcript:Os01t0104600-01
1 irgsp exon 248828 249107 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon11;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0104600-01.exon11;rank=11
1 irgsp CDS 248971 249107 . - 2 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 249369 249468 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon10;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0104600-01.exon10;rank=10
1 irgsp CDS 249369 249468 . - 0 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 249861 249956 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon9;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon9;rank=9
1 irgsp CDS 249861 249956 . - 0 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 250617 250781 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon8;rank=8
1 irgsp CDS 250617 250781 . - 0 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 250860 250940 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon7;rank=7
1 irgsp CDS 250860 250940 . - 0 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 251026 251082 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon6;rank=6
1 irgsp CDS 251026 251082 . - 0 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 251316 251384 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon5;rank=5
1 irgsp CDS 251316 251384 . - 0 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 251695 251790 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104600-01.exon4;rank=4
1 irgsp CDS 251695 251790 . - 0 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 255325 255553 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104600-01.exon3;rank=3
1 irgsp CDS 255325 255553 . - 1 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 255674 256098 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104600-01.exon2;rank=2
1 irgsp CDS 255674 256098 . - 0 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp CDS 256361 256441 . - 0 ID=CDS:Os01t0104600-01;Parent=transcript:Os01t0104600-01;protein_id=Os01t0104600-01
1 irgsp exon 256361 256872 . - . Parent=transcript:Os01t0104600-01;Name=Os01t0104600-01.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0104600-01.exon1;rank=1
1 irgsp five_prime_UTR 256442 256872 . - . Parent=transcript:Os01t0104600-01
###
1 irgsp gene 261530 268145 . + . ID=gene:Os01g0104800;biotype=protein_coding;description=Sas10/Utp3 family protein. (Os01t0104800-01)%3BHypothetical conserved gene. (Os01t0104800-02);gene_id=Os01g0104800;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 261530 268145 . + . ID=transcript:Os01t0104800-01;Parent=gene:Os01g0104800;biotype=protein_coding;transcript_id=Os01t0104800-01
1 irgsp five_prime_UTR 261530 261561 . + . Parent=transcript:Os01t0104800-01
1 irgsp exon 261530 261661 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon1;constitutive=0;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0104800-01.exon1;rank=1
1 irgsp CDS 261562 261661 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 261767 261805 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon2;constitutive=0;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0104800-01.exon2;rank=2
1 irgsp CDS 261767 261805 . + 2 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 261895 261941 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon3;constitutive=0;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0104800-01.exon3;rank=3
1 irgsp CDS 261895 261941 . + 2 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 262582 262681 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon4;constitutive=0;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0104800-01.exon4;rank=4
1 irgsp CDS 262582 262681 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 262925 263181 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon5;constitutive=0;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0104800-01.exon5;rank=5
1 irgsp CDS 262925 263181 . + 2 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 263525 263640 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon6;constitutive=0;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104800-01.exon6;rank=6
1 irgsp CDS 263525 263640 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 264014 264098 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104800-01.exon7;rank=7
1 irgsp CDS 264014 264098 . + 1 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 265236 265415 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104800-01.exon8;rank=8
1 irgsp CDS 265236 265415 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 265506 265649 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon9;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104800-01.exon9;rank=9
1 irgsp CDS 265506 265649 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 265740 265817 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon10;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104800-01.exon10;rank=10
1 irgsp CDS 265740 265817 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 265909 266045 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon11;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104800-01.exon11;rank=11
1 irgsp CDS 265909 266045 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 266138 266246 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon12;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104800-01.exon12;rank=12
1 irgsp CDS 266138 266246 . + 1 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 267237 267514 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon13;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104800-01.exon13;rank=13
1 irgsp CDS 267237 267514 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 267591 267657 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon14;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104800-01.exon14;rank=14
1 irgsp CDS 267591 267657 . + 1 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 267734 267802 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon15;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104800-01.exon15;rank=15
1 irgsp CDS 267734 267802 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp CDS 267880 268011 . + 0 ID=CDS:Os01t0104800-01;Parent=transcript:Os01t0104800-01;protein_id=Os01t0104800-01
1 irgsp exon 267880 268145 . + . Parent=transcript:Os01t0104800-01;Name=Os01t0104800-01.exon16;constitutive=0;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0104800-01.exon16;rank=16
1 irgsp three_prime_UTR 268012 268145 . + . Parent=transcript:Os01t0104800-01
1 irgsp mRNA 263523 268120 . + . ID=transcript:Os01t0104800-02;Parent=gene:Os01g0104800;biotype=protein_coding;transcript_id=Os01t0104800-02
1 irgsp five_prime_UTR 263523 263524 . + . Parent=transcript:Os01t0104800-02
1 irgsp exon 263523 263640 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-02.exon1;constitutive=0;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0104800-02.exon1;rank=1
1 irgsp CDS 263525 263640 . + 0 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 264014 264098 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104800-01.exon7;rank=2
1 irgsp CDS 264014 264098 . + 1 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 265236 265415 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104800-01.exon8;rank=3
1 irgsp CDS 265236 265415 . + 0 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 265506 265649 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-01.exon9;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104800-01.exon9;rank=4
1 irgsp CDS 265506 265649 . + 0 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 265740 265817 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-01.exon10;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104800-01.exon10;rank=5
1 irgsp CDS 265740 265817 . + 0 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 265909 266045 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-01.exon11;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104800-01.exon11;rank=6
1 irgsp CDS 265909 266045 . + 0 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 266138 266246 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-01.exon12;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104800-01.exon12;rank=7
1 irgsp CDS 266138 266246 . + 1 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 267237 267514 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-01.exon13;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0104800-01.exon13;rank=8
1 irgsp CDS 267237 267514 . + 0 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 267591 267657 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-01.exon14;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0104800-01.exon14;rank=9
1 irgsp CDS 267591 267657 . + 1 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 267734 267802 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-01.exon15;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0104800-01.exon15;rank=10
1 irgsp CDS 267734 267802 . + 0 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp CDS 267880 268011 . + 0 ID=CDS:Os01t0104800-02;Parent=transcript:Os01t0104800-02;protein_id=Os01t0104800-02
1 irgsp exon 267880 268120 . + . Parent=transcript:Os01t0104800-02;Name=Os01t0104800-02.exon11;constitutive=0;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0104800-02.exon11;rank=11
1 irgsp three_prime_UTR 268012 268120 . + . Parent=transcript:Os01t0104800-02
###
1 irgsp gene 270179 275084 . - . ID=gene:Os01g0104900;biotype=protein_coding;description=Transferase family protein. (Os01t0104900-01)%3BHypothetical conserved gene. (Os01t0104900-02);gene_id=Os01g0104900;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 270179 275084 . - . ID=transcript:Os01t0104900-01;Parent=gene:Os01g0104900;biotype=protein_coding;transcript_id=Os01t0104900-01
1 irgsp three_prime_UTR 270179 270355 . - . Parent=transcript:Os01t0104900-01
1 irgsp exon 270179 271333 . - . Parent=transcript:Os01t0104900-01;Name=Os01t0104900-01.exon2;constitutive=0;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0104900-01.exon2;rank=2
1 irgsp CDS 270356 271333 . - 0 ID=CDS:Os01t0104900-01;Parent=transcript:Os01t0104900-01;protein_id=Os01t0104900-01
1 irgsp CDS 274529 274957 . - 0 ID=CDS:Os01t0104900-01;Parent=transcript:Os01t0104900-01;protein_id=Os01t0104900-01
1 irgsp exon 274529 275084 . - . Parent=transcript:Os01t0104900-01;Name=Os01t0104900-01.exon1;constitutive=0;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0104900-01.exon1;rank=1
1 irgsp five_prime_UTR 274958 275084 . - . Parent=transcript:Os01t0104900-01
1 irgsp mRNA 270250 271518 . - . ID=transcript:Os01t0104900-02;Parent=gene:Os01g0104900;biotype=protein_coding;transcript_id=Os01t0104900-02
1 irgsp three_prime_UTR 270250 270355 . - . Parent=transcript:Os01t0104900-02
1 irgsp exon 270250 271333 . - . Parent=transcript:Os01t0104900-02;Name=Os01t0104900-02.exon2;constitutive=0;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0104900-02.exon2;rank=2
1 irgsp CDS 270356 271309 . - 0 ID=CDS:Os01t0104900-02;Parent=transcript:Os01t0104900-02;protein_id=Os01t0104900-02
1 irgsp five_prime_UTR 271310 271333 . - . Parent=transcript:Os01t0104900-02
1 irgsp exon 271457 271518 . - . Parent=transcript:Os01t0104900-02;Name=Os01t0104900-02.exon1;constitutive=0;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0104900-02.exon1;rank=1
1 irgsp five_prime_UTR 271457 271518 . - . Parent=transcript:Os01t0104900-02
###
1 irgsp gene 284762 291892 . - . ID=gene:Os01g0105300;biotype=protein_coding;description=Similar to HAT family dimerisation domain containing protein%2C expressed. (Os01t0105300-01);gene_id=Os01g0105300;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 284762 291892 . - . ID=transcript:Os01t0105300-01;Parent=gene:Os01g0105300;biotype=protein_coding;transcript_id=Os01t0105300-01
1 irgsp three_prime_UTR 284762 284930 . - . Parent=transcript:Os01t0105300-01
1 irgsp exon 284762 287047 . - . Parent=transcript:Os01t0105300-01;Name=Os01t0105300-01.exon5;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105300-01.exon5;rank=5
1 irgsp CDS 284931 285020 . - 0 ID=CDS:Os01t0105300-01;Parent=transcript:Os01t0105300-01;protein_id=Os01t0105300-01
1 irgsp five_prime_UTR 285021 287047 . - . Parent=transcript:Os01t0105300-01
1 irgsp exon 291398 291436 . - . Parent=transcript:Os01t0105300-01;Name=Os01t0105300-01.exon4;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105300-01.exon4;rank=4
1 irgsp five_prime_UTR 291398 291436 . - . Parent=transcript:Os01t0105300-01
1 irgsp exon 291520 291534 . - . Parent=transcript:Os01t0105300-01;Name=Os01t0105300-01.exon3;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105300-01.exon3;rank=3
1 irgsp five_prime_UTR 291520 291534 . - . Parent=transcript:Os01t0105300-01
1 irgsp exon 291678 291738 . - . Parent=transcript:Os01t0105300-01;Name=Os01t0105300-01.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105300-01.exon2;rank=2
1 irgsp five_prime_UTR 291678 291738 . - . Parent=transcript:Os01t0105300-01
1 irgsp exon 291838 291892 . - . Parent=transcript:Os01t0105300-01;Name=Os01t0105300-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105300-01.exon1;rank=1
1 irgsp five_prime_UTR 291838 291892 . - . Parent=transcript:Os01t0105300-01
###
1 irgsp gene 288372 292296 . + . ID=gene:Os01g0105400;biotype=protein_coding;description=Similar to Kinesin heavy chain. (Os01t0105400-01);gene_id=Os01g0105400;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 288372 292296 . + . ID=transcript:Os01t0105400-01;Parent=gene:Os01g0105400;biotype=protein_coding;transcript_id=Os01t0105400-01
1 irgsp exon 288372 288846 . + . Parent=transcript:Os01t0105400-01;Name=Os01t0105400-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105400-01.exon1;rank=1
1 irgsp five_prime_UTR 288372 288846 . + . Parent=transcript:Os01t0105400-01
1 irgsp exon 288950 289116 . + . Parent=transcript:Os01t0105400-01;Name=Os01t0105400-01.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105400-01.exon2;rank=2
1 irgsp five_prime_UTR 288950 289116 . + . Parent=transcript:Os01t0105400-01
1 irgsp exon 289202 289572 . + . Parent=transcript:Os01t0105400-01;Name=Os01t0105400-01.exon3;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105400-01.exon3;rank=3
1 irgsp five_prime_UTR 289202 289572 . + . Parent=transcript:Os01t0105400-01
1 irgsp exon 289661 289830 . + . Parent=transcript:Os01t0105400-01;Name=Os01t0105400-01.exon4;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105400-01.exon4;rank=4
1 irgsp five_prime_UTR 289661 289830 . + . Parent=transcript:Os01t0105400-01
1 irgsp five_prime_UTR 290395 290432 . + . Parent=transcript:Os01t0105400-01
1 irgsp exon 290395 290512 . + . Parent=transcript:Os01t0105400-01;Name=Os01t0105400-01.exon5;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0105400-01.exon5;rank=5
1 irgsp CDS 290433 290512 . + 0 ID=CDS:Os01t0105400-01;Parent=transcript:Os01t0105400-01;protein_id=Os01t0105400-01
1 irgsp CDS 291372 291558 . + 1 ID=CDS:Os01t0105400-01;Parent=transcript:Os01t0105400-01;protein_id=Os01t0105400-01
1 irgsp exon 291372 291574 . + . Parent=transcript:Os01t0105400-01;Name=Os01t0105400-01.exon6;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0105400-01.exon6;rank=6
1 irgsp three_prime_UTR 291559 291574 . + . Parent=transcript:Os01t0105400-01
1 irgsp exon 291648 291779 . + . Parent=transcript:Os01t0105400-01;Name=Os01t0105400-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105400-01.exon7;rank=7
1 irgsp three_prime_UTR 291648 291779 . + . Parent=transcript:Os01t0105400-01
1 irgsp exon 291859 291948 . + . Parent=transcript:Os01t0105400-01;Name=Os01t0105400-01.exon8;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105400-01.exon8;rank=8
1 irgsp three_prime_UTR 291859 291948 . + . Parent=transcript:Os01t0105400-01
1 irgsp exon 292073 292296 . + . Parent=transcript:Os01t0105400-01;Name=Os01t0105400-01.exon9;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105400-01.exon9;rank=9
1 irgsp three_prime_UTR 292073 292296 . + . Parent=transcript:Os01t0105400-01
###
1 irgsp gene 303233 306736 . + . ID=gene:Os01g0105700;Name=basic helix-loop-helix protein 071;biotype=protein_coding;description=Basic helix-loop-helix dimerisation region bHLH domain containing protein. (Os01t0105700-01);gene_id=Os01g0105700;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 303233 306736 . + . ID=transcript:Os01t0105700-01;Parent=gene:Os01g0105700;biotype=protein_coding;transcript_id=Os01t0105700-01
1 irgsp five_prime_UTR 303233 303328 . + . Parent=transcript:Os01t0105700-01
1 irgsp exon 303233 303471 . + . Parent=transcript:Os01t0105700-01;Name=Os01t0105700-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0105700-01.exon1;rank=1
1 irgsp CDS 303329 303471 . + 0 ID=CDS:Os01t0105700-01;Parent=transcript:Os01t0105700-01;protein_id=Os01t0105700-01
1 irgsp exon 303981 304509 . + . Parent=transcript:Os01t0105700-01;Name=Os01t0105700-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0105700-01.exon2;rank=2
1 irgsp CDS 303981 304509 . + 1 ID=CDS:Os01t0105700-01;Parent=transcript:Os01t0105700-01;protein_id=Os01t0105700-01
1 irgsp exon 305572 305718 . + . Parent=transcript:Os01t0105700-01;Name=Os01t0105700-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0105700-01.exon3;rank=3
1 irgsp CDS 305572 305718 . + 0 ID=CDS:Os01t0105700-01;Parent=transcript:Os01t0105700-01;protein_id=Os01t0105700-01
1 irgsp exon 305834 305899 . + . Parent=transcript:Os01t0105700-01;Name=Os01t0105700-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0105700-01.exon4;rank=4
1 irgsp CDS 305834 305899 . + 0 ID=CDS:Os01t0105700-01;Parent=transcript:Os01t0105700-01;protein_id=Os01t0105700-01
1 irgsp exon 305993 306058 . + . Parent=transcript:Os01t0105700-01;Name=Os01t0105700-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0105700-01.exon5;rank=5
1 irgsp CDS 305993 306058 . + 0 ID=CDS:Os01t0105700-01;Parent=transcript:Os01t0105700-01;protein_id=Os01t0105700-01
1 irgsp exon 306171 306245 . + . Parent=transcript:Os01t0105700-01;Name=Os01t0105700-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0105700-01.exon6;rank=6
1 irgsp CDS 306171 306245 . + 0 ID=CDS:Os01t0105700-01;Parent=transcript:Os01t0105700-01;protein_id=Os01t0105700-01
1 irgsp CDS 306353 306493 . + 0 ID=CDS:Os01t0105700-01;Parent=transcript:Os01t0105700-01;protein_id=Os01t0105700-01
1 irgsp exon 306353 306736 . + . Parent=transcript:Os01t0105700-01;Name=Os01t0105700-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0105700-01.exon7;rank=7
1 irgsp three_prime_UTR 306494 306736 . + . Parent=transcript:Os01t0105700-01
###
1 irgsp gene 306871 308842 . - . ID=gene:Os01g0105800;Name=IRON-SULFUR CLUSTER PROTEIN 9;biotype=protein_coding;description=Similar to Iron sulfur assembly protein 1. (Os01t0105800-01);gene_id=Os01g0105800;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 306871 308842 . - . ID=transcript:Os01t0105800-01;Parent=gene:Os01g0105800;biotype=protein_coding;transcript_id=Os01t0105800-01
1 irgsp three_prime_UTR 306871 307123 . - . Parent=transcript:Os01t0105800-01
1 irgsp exon 306871 307217 . - . Parent=transcript:Os01t0105800-01;Name=Os01t0105800-01.exon4;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0105800-01.exon4;rank=4
1 irgsp CDS 307124 307217 . - 1 ID=CDS:Os01t0105800-01;Parent=transcript:Os01t0105800-01;protein_id=Os01t0105800-01
1 irgsp exon 307296 307413 . - . Parent=transcript:Os01t0105800-01;Name=Os01t0105800-01.exon3;constitutive=1;ensembl_end_phase=2;ensembl_phase=1;exon_id=Os01t0105800-01.exon3;rank=3
1 irgsp CDS 307296 307413 . - 2 ID=CDS:Os01t0105800-01;Parent=transcript:Os01t0105800-01;protein_id=Os01t0105800-01
1 irgsp CDS 308397 308601 . - 0 ID=CDS:Os01t0105800-01;Parent=transcript:Os01t0105800-01;protein_id=Os01t0105800-01
1 irgsp exon 308397 308626 . - . Parent=transcript:Os01t0105800-01;Name=Os01t0105800-01.exon2;constitutive=1;ensembl_end_phase=1;ensembl_phase=-1;exon_id=Os01t0105800-01.exon2;rank=2
1 irgsp five_prime_UTR 308602 308626 . - . Parent=transcript:Os01t0105800-01
1 irgsp exon 308703 308842 . - . Parent=transcript:Os01t0105800-01;Name=Os01t0105800-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0105800-01.exon1;rank=1
1 irgsp five_prime_UTR 308703 308842 . - . Parent=transcript:Os01t0105800-01
###
1 irgsp gene 309520 313170 . - . ID=gene:Os01g0105900;biotype=protein_coding;description=Carbohydrate/purine kinase domain containing protein. (Os01t0105900-01);gene_id=Os01g0105900;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 309520 313170 . - . ID=transcript:Os01t0105900-01;Parent=gene:Os01g0105900;biotype=protein_coding;transcript_id=Os01t0105900-01
1 irgsp three_prime_UTR 309520 309821 . - . Parent=transcript:Os01t0105900-01
1 irgsp exon 309520 310070 . - . Parent=transcript:Os01t0105900-01;Name=Os01t0105900-01.exon8;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0105900-01.exon8;rank=8
1 irgsp CDS 309822 310070 . - 0 ID=CDS:Os01t0105900-01;Parent=transcript:Os01t0105900-01;protein_id=Os01t0105900-01
1 irgsp exon 310256 310367 . - . Parent=transcript:Os01t0105900-01;Name=Os01t0105900-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0105900-01.exon7;rank=7
1 irgsp CDS 310256 310367 . - 1 ID=CDS:Os01t0105900-01;Parent=transcript:Os01t0105900-01;protein_id=Os01t0105900-01
1 irgsp exon 310455 310552 . - . Parent=transcript:Os01t0105900-01;Name=Os01t0105900-01.exon6;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0105900-01.exon6;rank=6
1 irgsp CDS 310455 310552 . - 0 ID=CDS:Os01t0105900-01;Parent=transcript:Os01t0105900-01;protein_id=Os01t0105900-01
1 irgsp exon 310632 310739 . - . Parent=transcript:Os01t0105900-01;Name=Os01t0105900-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0105900-01.exon5;rank=5
1 irgsp CDS 310632 310739 . - 0 ID=CDS:Os01t0105900-01;Parent=transcript:Os01t0105900-01;protein_id=Os01t0105900-01
1 irgsp exon 310880 310918 . - . Parent=transcript:Os01t0105900-01;Name=Os01t0105900-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0105900-01.exon4;rank=4
1 irgsp CDS 310880 310918 . - 0 ID=CDS:Os01t0105900-01;Parent=transcript:Os01t0105900-01;protein_id=Os01t0105900-01
1 irgsp exon 311002 311073 . - . Parent=transcript:Os01t0105900-01;Name=Os01t0105900-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0105900-01.exon3;rank=3
1 irgsp CDS 311002 311073 . - 0 ID=CDS:Os01t0105900-01;Parent=transcript:Os01t0105900-01;protein_id=Os01t0105900-01
1 irgsp exon 311163 311426 . - . Parent=transcript:Os01t0105900-01;Name=Os01t0105900-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0105900-01.exon2;rank=2
1 irgsp CDS 311163 311426 . - 0 ID=CDS:Os01t0105900-01;Parent=transcript:Os01t0105900-01;protein_id=Os01t0105900-01
1 irgsp CDS 312867 313064 . - 0 ID=CDS:Os01t0105900-01;Parent=transcript:Os01t0105900-01;protein_id=Os01t0105900-01
1 irgsp exon 312867 313170 . - . Parent=transcript:Os01t0105900-01;Name=Os01t0105900-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0105900-01.exon1;rank=1
1 irgsp five_prime_UTR 313065 313170 . - . Parent=transcript:Os01t0105900-01
###
1 irgsp gene 319754 322205 . + . ID=gene:Os01g0106200;biotype=protein_coding;description=Similar to RER1A protein (AtRER1A). (Os01t0106200-01);gene_id=Os01g0106200;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 319754 322205 . + . ID=transcript:Os01t0106200-01;Parent=gene:Os01g0106200;biotype=protein_coding;transcript_id=Os01t0106200-01
1 irgsp five_prime_UTR 319754 319874 . + . Parent=transcript:Os01t0106200-01
1 irgsp exon 319754 320236 . + . Parent=transcript:Os01t0106200-01;Name=Os01t0106200-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0106200-01.exon1;rank=1
1 irgsp CDS 319875 320236 . + 0 ID=CDS:Os01t0106200-01;Parent=transcript:Os01t0106200-01;protein_id=Os01t0106200-01
1 irgsp exon 321468 321648 . + . Parent=transcript:Os01t0106200-01;Name=Os01t0106200-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0106200-01.exon2;rank=2
1 irgsp CDS 321468 321648 . + 1 ID=CDS:Os01t0106200-01;Parent=transcript:Os01t0106200-01;protein_id=Os01t0106200-01
1 irgsp CDS 321928 321975 . + 0 ID=CDS:Os01t0106200-01;Parent=transcript:Os01t0106200-01;protein_id=Os01t0106200-01
1 irgsp exon 321928 322205 . + . Parent=transcript:Os01t0106200-01;Name=Os01t0106200-01.exon3;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0106200-01.exon3;rank=3
1 irgsp three_prime_UTR 321976 322205 . + . Parent=transcript:Os01t0106200-01
###
1 irgsp gene 322591 323923 . - . ID=gene:Os01g0106300;biotype=protein_coding;description=Similar to Isoflavone reductase homolog IRL (EC 1.3.1.-). (Os01t0106300-01);gene_id=Os01g0106300;logic_name=irgspv1.0-20170804-genes
1 irgsp mRNA 322591 323923 . - . ID=transcript:Os01t0106300-01;Parent=gene:Os01g0106300;biotype=protein_coding;transcript_id=Os01t0106300-01
1 irgsp three_prime_UTR 322591 322809 . - . Parent=transcript:Os01t0106300-01
1 irgsp exon 322591 322973 . - . Parent=transcript:Os01t0106300-01;Name=Os01t0106300-01.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0106300-01.exon2;rank=2

881
src/agat/agat_convert_sp_gff2tsv/test_data/agat_convert_sp_gff2tsv_1.tsv Normal file
View File

@@ -0,0 +1,881 @@
seq_id source_tag primary_tag start end score strand frame Alias biotype constitutive description ensembl_end_phase ensembl_phase exon_id gene_id ID logic_name Name Parent protein_id rank transcript_id
1 irgsp repeat_region 2000 2100 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A fakeRepeat1 N/A N/A N/A N/A N/A N/A
1 irgsp gene 2983 10815 . 1 . N/A protein_coding N/A RabGAP/TBC domain containing protein. (Os01t0100100-01) N/A N/A N/A Os01g0100100 gene:Os01g0100100 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 2983 10815 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100100-01 N/A N/A gene:Os01g0100100 N/A N/A Os01t0100100-01
1 irgsp exon 2983 3268 . 1 . N/A N/A 1 N/A -1 -1 Os01t0100100-01.exon1 N/A Os01t0100100-01.exon1 N/A Os01t0100100-01.exon1 transcript:Os01t0100100-01 N/A 1 N/A
1 irgsp exon 3354 3616 . 1 . N/A N/A 1 N/A 0 -1 Os01t0100100-01.exon2 N/A Os01t0100100-01.exon2 N/A Os01t0100100-01.exon2 transcript:Os01t0100100-01 N/A 2 N/A
1 irgsp exon 4357 4455 . 1 . N/A N/A 1 N/A 0 0 Os01t0100100-01.exon3 N/A Os01t0100100-01.exon3 N/A Os01t0100100-01.exon3 transcript:Os01t0100100-01 N/A 3 N/A
1 irgsp exon 5457 5560 . 1 . N/A N/A 1 N/A 2 0 Os01t0100100-01.exon4 N/A Os01t0100100-01.exon4 N/A Os01t0100100-01.exon4 transcript:Os01t0100100-01 N/A 4 N/A
1 irgsp exon 7136 7944 . 1 . N/A N/A 1 N/A 1 2 Os01t0100100-01.exon5 N/A Os01t0100100-01.exon5 N/A Os01t0100100-01.exon5 transcript:Os01t0100100-01 N/A 5 N/A
1 irgsp exon 8028 8150 . 1 . N/A N/A 1 N/A 1 1 Os01t0100100-01.exon6 N/A Os01t0100100-01.exon6 N/A Os01t0100100-01.exon6 transcript:Os01t0100100-01 N/A 6 N/A
1 irgsp exon 8232 8320 . 1 . N/A N/A 1 N/A 0 1 Os01t0100100-01.exon7 N/A Os01t0100100-01.exon7 N/A Os01t0100100-01.exon7 transcript:Os01t0100100-01 N/A 7 N/A
1 irgsp exon 8408 8608 . 1 . N/A N/A 1 N/A 0 0 Os01t0100100-01.exon8 N/A Os01t0100100-01.exon8 N/A Os01t0100100-01.exon8 transcript:Os01t0100100-01 N/A 8 N/A
1 irgsp exon 9210 9615 . 1 . N/A N/A 1 N/A 1 0 Os01t0100100-01.exon9 N/A Os01t0100100-01.exon9 N/A Os01t0100100-01.exon9 transcript:Os01t0100100-01 N/A 9 N/A
1 irgsp exon 10102 10187 . 1 . N/A N/A 1 N/A 0 1 Os01t0100100-01.exon10 N/A Os01t0100100-01.exon10 N/A Os01t0100100-01.exon10 transcript:Os01t0100100-01 N/A 10 N/A
1 irgsp exon 10274 10430 . 1 . N/A N/A 1 N/A -1 0 Os01t0100100-01.exon11 N/A Os01t0100100-01.exon11 N/A Os01t0100100-01.exon11 transcript:Os01t0100100-01 N/A 11 N/A
1 irgsp exon 10504 10815 . 1 . N/A N/A 1 N/A -1 -1 Os01t0100100-01.exon12 N/A Os01t0100100-01.exon12 N/A Os01t0100100-01.exon12 transcript:Os01t0100100-01 N/A 12 N/A
1 irgsp CDS 3449 3616 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp CDS 4357 4455 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp CDS 5457 5560 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp CDS 7136 7944 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp CDS 8028 8150 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp CDS 8232 8320 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp CDS 8408 8608 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp CDS 9210 9615 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp CDS 10102 10187 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp CDS 10274 10297 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
1 irgsp five_prime_UTR 2983 3268 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-1 N/A N/A transcript:Os01t0100100-01 N/A N/A N/A
1 irgsp five_prime_UTR 3354 3448 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-2 N/A N/A transcript:Os01t0100100-01 N/A N/A N/A
1 irgsp three_prime_UTR 10298 10430 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-1 N/A N/A transcript:Os01t0100100-01 N/A N/A N/A
1 irgsp three_prime_UTR 10504 10815 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-2 N/A N/A transcript:Os01t0100100-01 N/A N/A N/A
1 irgsp gene 11218 12435 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0100200-01) N/A N/A N/A Os01g0100200 gene:Os01g0100200 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 11218 12435 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100200-01 N/A N/A gene:Os01g0100200 N/A N/A Os01t0100200-01
1 irgsp exon 11218 12060 . 1 . N/A N/A 1 N/A 2 -1 Os01t0100200-01.exon1 N/A Os01t0100200-01.exon1 N/A Os01t0100200-01.exon1 transcript:Os01t0100200-01 N/A 1 N/A
1 irgsp exon 12152 12435 . 1 . N/A N/A 1 N/A -1 2 Os01t0100200-01.exon2 N/A Os01t0100200-01.exon2 N/A Os01t0100200-01.exon2 transcript:Os01t0100200-01 N/A 2 N/A
1 irgsp CDS 11798 12060 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100200-01 N/A N/A transcript:Os01t0100200-01 Os01t0100200-01 N/A N/A
1 irgsp CDS 12152 12317 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100200-01 N/A N/A transcript:Os01t0100200-01 Os01t0100200-01 N/A N/A
1 irgsp five_prime_UTR 11218 11797 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-3 N/A N/A transcript:Os01t0100200-01 N/A N/A N/A
1 irgsp three_prime_UTR 12318 12435 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-3 N/A N/A transcript:Os01t0100200-01 N/A N/A N/A
1 irgsp gene 11372 12284 . -1 . N/A protein_coding N/A Cytochrome P450 domain containing protein. (Os01t0100300-00) N/A N/A N/A Os01g0100300 gene:Os01g0100300 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 11372 12284 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100300-00 N/A N/A gene:Os01g0100300 N/A N/A Os01t0100300-00
1 irgsp exon 11372 12042 . -1 . N/A N/A 1 N/A 0 1 Os01t0100300-00.exon2 N/A Os01t0100300-00.exon2 N/A Os01t0100300-00.exon2 transcript:Os01t0100300-00 N/A 2 N/A
1 irgsp exon 12146 12284 . -1 . N/A N/A 1 N/A 1 0 Os01t0100300-00.exon1 N/A Os01t0100300-00.exon1 N/A Os01t0100300-00.exon1 transcript:Os01t0100300-00 N/A 1 N/A
1 irgsp CDS 11372 12042 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100300-00 N/A N/A transcript:Os01t0100300-00 Os01t0100300-00 N/A N/A
1 irgsp CDS 12146 12284 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100300-00 N/A N/A transcript:Os01t0100300-00 Os01t0100300-00 N/A N/A
1 irgsp gene 12721 15685 . 1 . N/A protein_coding N/A Similar to Pectinesterase-like protein. (Os01t0100400-01) N/A N/A N/A Os01g0100400 gene:Os01g0100400 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 12721 15685 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100400-01 N/A N/A gene:Os01g0100400 N/A N/A Os01t0100400-01
1 irgsp exon 12721 13813 . 1 . N/A N/A 1 N/A 2 -1 Os01t0100400-01.exon1 N/A Os01t0100400-01.exon1 N/A Os01t0100400-01.exon1 transcript:Os01t0100400-01 N/A 1 N/A
1 irgsp exon 13906 14271 . 1 . N/A N/A 1 N/A 2 2 Os01t0100400-01.exon2 N/A Os01t0100400-01.exon2 N/A Os01t0100400-01.exon2 transcript:Os01t0100400-01 N/A 2 N/A
1 irgsp exon 14359 14437 . 1 . N/A N/A 1 N/A 0 2 Os01t0100400-01.exon3 N/A Os01t0100400-01.exon3 N/A Os01t0100400-01.exon3 transcript:Os01t0100400-01 N/A 3 N/A
1 irgsp exon 14969 15171 . 1 . N/A N/A 1 N/A 2 0 Os01t0100400-01.exon4 N/A Os01t0100400-01.exon4 N/A Os01t0100400-01.exon4 transcript:Os01t0100400-01 N/A 4 N/A
1 irgsp exon 15266 15685 . 1 . N/A N/A 1 N/A -1 2 Os01t0100400-01.exon5 N/A Os01t0100400-01.exon5 N/A Os01t0100400-01.exon5 transcript:Os01t0100400-01 N/A 5 N/A
1 irgsp CDS 12774 13813 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
1 irgsp CDS 13906 14271 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
1 irgsp CDS 14359 14437 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
1 irgsp CDS 14969 15171 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
1 irgsp CDS 15266 15359 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
1 irgsp five_prime_UTR 12721 12773 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-4 N/A N/A transcript:Os01t0100400-01 N/A N/A N/A
1 irgsp three_prime_UTR 15360 15685 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-4 N/A N/A transcript:Os01t0100400-01 N/A N/A N/A
1 irgsp gene 12808 13978 . -1 . N/A protein_coding N/A Hypothetical protein. (Os01t0100466-00) N/A N/A N/A Os01g0100466 gene:Os01g0100466 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 12808 13978 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100466-00 N/A N/A gene:Os01g0100466 N/A N/A Os01t0100466-00
1 irgsp exon 12808 13782 . -1 . N/A N/A 1 N/A -1 -1 Os01t0100466-00.exon2 N/A Os01t0100466-00.exon2 N/A Os01t0100466-00.exon2 transcript:Os01t0100466-00 N/A 2 N/A
1 irgsp exon 13880 13978 . -1 . N/A N/A 1 N/A -1 -1 Os01t0100466-00.exon1 N/A Os01t0100466-00.exon1 N/A Os01t0100466-00.exon1 transcript:Os01t0100466-00 N/A 1 N/A
1 irgsp CDS 12869 13102 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100466-00 N/A N/A transcript:Os01t0100466-00 Os01t0100466-00 N/A N/A
1 irgsp five_prime_UTR 13103 13782 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-5 N/A N/A transcript:Os01t0100466-00 N/A N/A N/A
1 irgsp five_prime_UTR 13880 13978 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-6 N/A N/A transcript:Os01t0100466-00 N/A N/A N/A
1 irgsp three_prime_UTR 12808 12868 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-5 N/A N/A transcript:Os01t0100466-00 N/A N/A N/A
1 irgsp gene 16399 20144 . 1 . N/A protein_coding N/A Immunoglobulin-like domain containing protein. (Os01t0100500-01) N/A N/A N/A Os01g0100500 gene:Os01g0100500 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 16399 20144 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100500-01 N/A N/A gene:Os01g0100500 N/A N/A Os01t0100500-01
1 irgsp exon 16399 16976 . 1 . N/A N/A 1 N/A 0 -1 Os01t0100500-01.exon1 N/A Os01t0100500-01.exon1 N/A Os01t0100500-01.exon1 transcript:Os01t0100500-01 N/A 1 N/A
1 irgsp exon 17383 17474 . 1 . N/A N/A 1 N/A 2 0 Os01t0100500-01.exon2 N/A Os01t0100500-01.exon2 N/A Os01t0100500-01.exon2 transcript:Os01t0100500-01 N/A 2 N/A
1 irgsp exon 17558 18258 . 1 . N/A N/A 1 N/A 1 2 Os01t0100500-01.exon3 N/A Os01t0100500-01.exon3 N/A Os01t0100500-01.exon3 transcript:Os01t0100500-01 N/A 3 N/A
1 irgsp exon 18501 18571 . 1 . N/A N/A 1 N/A 0 1 Os01t0100500-01.exon4 N/A Os01t0100500-01.exon4 N/A Os01t0100500-01.exon4 transcript:Os01t0100500-01 N/A 4 N/A
1 irgsp exon 18968 19057 . 1 . N/A N/A 1 N/A 0 0 Os01t0100500-01.exon5 N/A Os01t0100500-01.exon5 N/A Os01t0100500-01.exon5 transcript:Os01t0100500-01 N/A 5 N/A
1 irgsp exon 19142 19321 . 1 . N/A N/A 1 N/A 0 0 Os01t0100500-01.exon6 N/A Os01t0100500-01.exon6 N/A Os01t0100500-01.exon6 transcript:Os01t0100500-01 N/A 6 N/A
1 irgsp exon 19531 19629 . 1 . N/A N/A 1 N/A -1 0 Os01t0100500-01.exon7 N/A Os01t0100500-01.exon7 N/A Os01t0100500-01.exon7 transcript:Os01t0100500-01 N/A 7 N/A
1 irgsp exon 19734 20144 . 1 . N/A N/A 1 N/A -1 -1 Os01t0100500-01.exon8 N/A Os01t0100500-01.exon8 N/A Os01t0100500-01.exon8 transcript:Os01t0100500-01 N/A 8 N/A
1 irgsp CDS 16599 16976 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
1 irgsp CDS 17383 17474 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
1 irgsp CDS 17558 18258 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
1 irgsp CDS 18501 18571 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
1 irgsp CDS 18968 19057 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
1 irgsp CDS 19142 19321 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
1 irgsp CDS 19531 19593 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
1 irgsp five_prime_UTR 16399 16598 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-7 N/A N/A transcript:Os01t0100500-01 N/A N/A N/A
1 irgsp three_prime_UTR 19594 19629 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-6 N/A N/A transcript:Os01t0100500-01 N/A N/A N/A
1 irgsp three_prime_UTR 19734 20144 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-7 N/A N/A transcript:Os01t0100500-01 N/A N/A N/A
1 irgsp gene 22841 26892 . 1 . N/A protein_coding N/A Single-stranded nucleic acid binding R3H domain containing protein. (Os01t0100600-01) N/A N/A N/A Os01g0100600 gene:Os01g0100600 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 22841 26892 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100600-01 N/A N/A gene:Os01g0100600 N/A N/A Os01t0100600-01
1 irgsp exon 22841 23281 . 1 . N/A N/A 1 N/A 2 -1 Os01t0100600-01.exon1 N/A Os01t0100600-01.exon1 N/A Os01t0100600-01.exon1 transcript:Os01t0100600-01 N/A 1 N/A
1 irgsp exon 23572 23847 . 1 . N/A N/A 1 N/A 2 2 Os01t0100600-01.exon2 N/A Os01t0100600-01.exon2 N/A Os01t0100600-01.exon2 transcript:Os01t0100600-01 N/A 2 N/A
1 irgsp exon 23962 24033 . 1 . N/A N/A 1 N/A 2 2 Os01t0100600-01.exon3 N/A Os01t0100600-01.exon3 N/A Os01t0100600-01.exon3 transcript:Os01t0100600-01 N/A 3 N/A
1 irgsp exon 24492 24577 . 1 . N/A N/A 1 N/A 1 2 Os01t0100600-01.exon4 N/A Os01t0100600-01.exon4 N/A Os01t0100600-01.exon4 transcript:Os01t0100600-01 N/A 4 N/A
1 irgsp exon 25445 25519 . 1 . N/A N/A 1 N/A 1 1 Os01t0100600-01.exon5 N/A Os01t0100600-01.exon5 N/A Os01t0100600-01.exon5 transcript:Os01t0100600-01 N/A 5 N/A
1 irgsp exon 25883 26892 . 1 . N/A N/A 1 N/A -1 1 Os01t0100600-01.exon6 N/A Os01t0100600-01.exon6 N/A Os01t0100600-01.exon6 transcript:Os01t0100600-01 N/A 6 N/A
1 irgsp CDS 23232 23281 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
1 irgsp CDS 23572 23847 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
1 irgsp CDS 23962 24033 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
1 irgsp CDS 24492 24577 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
1 irgsp CDS 25445 25519 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
1 irgsp CDS 25883 26391 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
1 irgsp five_prime_UTR 22841 23231 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-8 N/A N/A transcript:Os01t0100600-01 N/A N/A N/A
1 irgsp three_prime_UTR 26392 26892 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-8 N/A N/A transcript:Os01t0100600-01 N/A N/A N/A
1 irgsp gene 25861 26424 . -1 . N/A protein_coding N/A Hypothetical gene. (Os01t0100650-00) N/A N/A N/A Os01g0100650 gene:Os01g0100650 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 25861 26424 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100650-00 N/A N/A gene:Os01g0100650 N/A N/A Os01t0100650-00
1 irgsp exon 25861 26424 . -1 . N/A N/A 1 N/A -1 -1 Os01t0100650-00.exon1 N/A Os01t0100650-00.exon1 N/A Os01t0100650-00.exon1 transcript:Os01t0100650-00 N/A 1 N/A
1 irgsp CDS 26040 26423 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100650-00 N/A N/A transcript:Os01t0100650-00 Os01t0100650-00 N/A N/A
1 irgsp five_prime_UTR 26424 26424 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-9 N/A N/A transcript:Os01t0100650-00 N/A N/A N/A
1 irgsp three_prime_UTR 25861 26039 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-9 N/A N/A transcript:Os01t0100650-00 N/A N/A N/A
1 irgsp gene 27143 28644 . 1 . N/A protein_coding N/A Similar to 40S ribosomal protein S5-1. (Os01t0100700-01) N/A N/A N/A Os01g0100700 gene:Os01g0100700 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 27143 28644 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100700-01 N/A N/A gene:Os01g0100700 N/A N/A Os01t0100700-01
1 irgsp exon 27143 27292 . 1 . N/A N/A 1 N/A 0 -1 Os01t0100700-01.exon1 N/A Os01t0100700-01.exon1 N/A Os01t0100700-01.exon1 transcript:Os01t0100700-01 N/A 1 N/A
1 irgsp exon 27370 27641 . 1 . N/A N/A 1 N/A 2 0 Os01t0100700-01.exon2 N/A Os01t0100700-01.exon2 N/A Os01t0100700-01.exon2 transcript:Os01t0100700-01 N/A 2 N/A
1 irgsp exon 28090 28293 . 1 . N/A N/A 1 N/A 2 2 Os01t0100700-01.exon3 N/A Os01t0100700-01.exon3 N/A Os01t0100700-01.exon3 transcript:Os01t0100700-01 N/A 3 N/A
1 irgsp exon 28365 28644 . 1 . N/A N/A 1 N/A -1 2 Os01t0100700-01.exon4 N/A Os01t0100700-01.exon4 N/A Os01t0100700-01.exon4 transcript:Os01t0100700-01 N/A 4 N/A
1 irgsp CDS 27221 27292 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100700-01 N/A N/A transcript:Os01t0100700-01 Os01t0100700-01 N/A N/A
1 irgsp CDS 27370 27641 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100700-01 N/A N/A transcript:Os01t0100700-01 Os01t0100700-01 N/A N/A
1 irgsp CDS 28090 28293 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100700-01 N/A N/A transcript:Os01t0100700-01 Os01t0100700-01 N/A N/A
1 irgsp CDS 28365 28419 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100700-01 N/A N/A transcript:Os01t0100700-01 Os01t0100700-01 N/A N/A
1 irgsp five_prime_UTR 27143 27220 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-10 N/A N/A transcript:Os01t0100700-01 N/A N/A N/A
1 irgsp three_prime_UTR 28420 28644 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-10 N/A N/A transcript:Os01t0100700-01 N/A N/A N/A
1 irgsp gene 29818 34453 . 1 . N/A protein_coding N/A Protein of unknown function DUF1664 family protein. (Os01t0100800-01) N/A N/A N/A Os01g0100800 gene:Os01g0100800 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 29818 34453 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100800-01 N/A N/A gene:Os01g0100800 N/A N/A Os01t0100800-01
1 irgsp exon 29818 29976 . 1 . N/A N/A 1 N/A 1 -1 Os01t0100800-01.exon1 N/A Os01t0100800-01.exon1 N/A Os01t0100800-01.exon1 transcript:Os01t0100800-01 N/A 1 N/A
1 irgsp exon 30146 30228 . 1 . N/A N/A 1 N/A 0 1 Os01t0100800-01.exon2 N/A Os01t0100800-01.exon2 N/A Os01t0100800-01.exon2 transcript:Os01t0100800-01 N/A 2 N/A
1 irgsp exon 30735 30806 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon3 N/A Os01t0100800-01.exon3 N/A Os01t0100800-01.exon3 transcript:Os01t0100800-01 N/A 3 N/A
1 irgsp exon 30885 30963 . 1 . N/A N/A 1 N/A 1 0 Os01t0100800-01.exon4 N/A Os01t0100800-01.exon4 N/A Os01t0100800-01.exon4 transcript:Os01t0100800-01 N/A 4 N/A
1 irgsp exon 31258 31325 . 1 . N/A N/A 1 N/A 0 1 Os01t0100800-01.exon5 N/A Os01t0100800-01.exon5 N/A Os01t0100800-01.exon5 transcript:Os01t0100800-01 N/A 5 N/A
1 irgsp exon 31505 31606 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon6 N/A Os01t0100800-01.exon6 N/A Os01t0100800-01.exon6 transcript:Os01t0100800-01 N/A 6 N/A
1 irgsp exon 32377 32466 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon7 N/A Os01t0100800-01.exon7 N/A Os01t0100800-01.exon7 transcript:Os01t0100800-01 N/A 7 N/A
1 irgsp exon 32542 32616 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon8 N/A Os01t0100800-01.exon8 N/A Os01t0100800-01.exon8 transcript:Os01t0100800-01 N/A 8 N/A
1 irgsp exon 32712 32744 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon9 N/A Os01t0100800-01.exon9 N/A Os01t0100800-01.exon9 transcript:Os01t0100800-01 N/A 9 N/A
1 irgsp exon 32828 32905 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon10 N/A Os01t0100800-01.exon10 N/A Os01t0100800-01.exon10 transcript:Os01t0100800-01 N/A 10 N/A
1 irgsp exon 33274 33330 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon11 N/A Os01t0100800-01.exon11 N/A Os01t0100800-01.exon11 transcript:Os01t0100800-01 N/A 11 N/A
1 irgsp exon 33400 33471 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon12 N/A Os01t0100800-01.exon12 N/A Os01t0100800-01.exon12 transcript:Os01t0100800-01 N/A 12 N/A
1 irgsp exon 33543 33617 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon13 N/A Os01t0100800-01.exon13 N/A Os01t0100800-01.exon13 transcript:Os01t0100800-01 N/A 13 N/A
1 irgsp exon 33975 34453 . 1 . N/A N/A 1 N/A -1 0 Os01t0100800-01.exon14 N/A Os01t0100800-01.exon14 N/A Os01t0100800-01.exon14 transcript:Os01t0100800-01 N/A 14 N/A
1 irgsp CDS 29940 29976 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 30146 30228 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 30735 30806 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 30885 30963 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 31258 31325 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 31505 31606 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 32377 32466 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 32542 32616 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 32712 32744 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 32828 32905 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 33274 33330 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 33400 33471 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 33543 33617 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp CDS 33975 34124 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
1 irgsp five_prime_UTR 29818 29939 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-11 N/A N/A transcript:Os01t0100800-01 N/A N/A N/A
1 irgsp three_prime_UTR 34125 34453 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-11 N/A N/A transcript:Os01t0100800-01 N/A N/A N/A
1 irgsp gene 35623 41136 . 1 . N/A protein_coding N/A Sphingosine-1-phosphate lyase, Disease resistance response (Os01t0100900-01) N/A N/A N/A Os01g0100900 gene:Os01g0100900 irgspv1.0-20170804-genes SPHINGOSINE-1-PHOSPHATE LYASE 1, Sphingosine-1-Phoshpate Lyase 1 N/A N/A N/A N/A
1 irgsp mRNA 35623 41136 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100900-01 N/A N/A gene:Os01g0100900 N/A N/A Os01t0100900-01
1 irgsp exon 35623 35939 . 1 . N/A N/A 1 N/A 2 -1 Os01t0100900-01.exon1 N/A Os01t0100900-01.exon1 N/A Os01t0100900-01.exon1 transcript:Os01t0100900-01 N/A 1 N/A
1 irgsp exon 36027 36072 . 1 . N/A N/A 1 N/A 0 2 Os01t0100900-01.exon2 N/A Os01t0100900-01.exon2 N/A Os01t0100900-01.exon2 transcript:Os01t0100900-01 N/A 2 N/A
1 irgsp exon 36517 36668 . 1 . N/A N/A 1 N/A 2 0 Os01t0100900-01.exon3 N/A Os01t0100900-01.exon3 N/A Os01t0100900-01.exon3 transcript:Os01t0100900-01 N/A 3 N/A
1 irgsp exon 36818 36877 . 1 . N/A N/A 1 N/A 2 2 Os01t0100900-01.exon4 N/A Os01t0100900-01.exon4 N/A Os01t0100900-01.exon4 transcript:Os01t0100900-01 N/A 4 N/A
1 irgsp exon 37594 37818 . 1 . N/A N/A 1 N/A 2 2 Os01t0100900-01.exon5 N/A Os01t0100900-01.exon5 N/A Os01t0100900-01.exon5 transcript:Os01t0100900-01 N/A 5 N/A
1 irgsp exon 37892 38033 . 1 . N/A N/A 1 N/A 0 2 Os01t0100900-01.exon6 N/A Os01t0100900-01.exon6 N/A Os01t0100900-01.exon6 transcript:Os01t0100900-01 N/A 6 N/A
1 irgsp exon 38276 38326 . 1 . N/A N/A 1 N/A 0 0 Os01t0100900-01.exon7 N/A Os01t0100900-01.exon7 N/A Os01t0100900-01.exon7 transcript:Os01t0100900-01 N/A 7 N/A
1 irgsp exon 38434 38525 . 1 . N/A N/A 1 N/A 2 0 Os01t0100900-01.exon8 N/A Os01t0100900-01.exon8 N/A Os01t0100900-01.exon8 transcript:Os01t0100900-01 N/A 8 N/A
1 irgsp exon 39319 39445 . 1 . N/A N/A 1 N/A 0 2 Os01t0100900-01.exon9 N/A Os01t0100900-01.exon9 N/A Os01t0100900-01.exon9 transcript:Os01t0100900-01 N/A 9 N/A
1 irgsp exon 39553 39568 . 1 . N/A N/A 1 N/A 1 0 Os01t0100900-01.exon10 N/A Os01t0100900-01.exon10 N/A Os01t0100900-01.exon10 transcript:Os01t0100900-01 N/A 10 N/A
1 irgsp exon 39939 40046 . 1 . N/A N/A 1 N/A 1 1 Os01t0100900-01.exon11 N/A Os01t0100900-01.exon11 N/A Os01t0100900-01.exon11 transcript:Os01t0100900-01 N/A 11 N/A
1 irgsp exon 40135 40189 . 1 . N/A N/A 1 N/A 2 1 Os01t0100900-01.exon12 N/A Os01t0100900-01.exon12 N/A Os01t0100900-01.exon12 transcript:Os01t0100900-01 N/A 12 N/A
1 irgsp exon 40456 40602 . 1 . N/A N/A 1 N/A 2 2 Os01t0100900-01.exon13 N/A Os01t0100900-01.exon13 N/A Os01t0100900-01.exon13 transcript:Os01t0100900-01 N/A 13 N/A
1 irgsp exon 40703 40781 . 1 . N/A N/A 1 N/A 0 2 Os01t0100900-01.exon14 N/A Os01t0100900-01.exon14 N/A Os01t0100900-01.exon14 transcript:Os01t0100900-01 N/A 14 N/A
1 irgsp exon 40885 41136 . 1 . N/A N/A 1 N/A -1 0 Os01t0100900-01.exon15 N/A Os01t0100900-01.exon15 N/A Os01t0100900-01.exon15 transcript:Os01t0100900-01 N/A 15 N/A
1 irgsp CDS 35743 35939 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 36027 36072 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 36517 36668 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 36818 36877 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 37594 37818 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 37892 38033 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 38276 38326 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 38434 38525 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 39319 39445 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 39553 39568 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 39939 40046 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 40135 40189 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 40456 40602 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 40703 40781 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp CDS 40885 41007 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
1 irgsp five_prime_UTR 35623 35742 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-12 N/A N/A transcript:Os01t0100900-01 N/A N/A N/A
1 irgsp three_prime_UTR 41008 41136 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-12 N/A N/A transcript:Os01t0100900-01 N/A N/A N/A
1 irgsp gene 58658 61090 . 1 . N/A protein_coding N/A Hypothetical conserved gene. (Os01t0101150-00) N/A N/A N/A Os01g0101150 gene:Os01g0101150 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 58658 61090 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101150-00 N/A N/A gene:Os01g0101150 N/A N/A Os01t0101150-00
1 irgsp exon 58658 61090 . 1 . N/A N/A 1 N/A 0 0 Os01t0101150-00.exon1 N/A Os01t0101150-00.exon1 N/A Os01t0101150-00.exon1 transcript:Os01t0101150-00 N/A 1 N/A
1 irgsp CDS 58658 61090 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101150-00 N/A N/A transcript:Os01t0101150-00 Os01t0101150-00 N/A N/A
1 irgsp gene 62060 65537 . 1 . N/A protein_coding N/A 2,3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein. (Os01t0101200-01);2,3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein. (Os01t0101200-02) N/A N/A N/A Os01g0101200 gene:Os01g0101200 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 62060 63576 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101200-01 N/A N/A gene:Os01g0101200 N/A N/A Os01t0101200-01
1 irgsp exon 62060 62295 . 1 . N/A N/A 0 N/A 0 -1 Os01t0101200-01.exon1 N/A Os01t0101200-01.exon1 N/A Os01t0101200-01.exon1 transcript:Os01t0101200-01 N/A 1 N/A
1 irgsp exon 62385 62905 . 1 . N/A N/A 1 N/A 2 0 Os01t0101200-02.exon2 N/A Os01t0101200-02.exon2 N/A Os01t0101200-02.exon2 transcript:Os01t0101200-01 N/A 2 N/A
1 irgsp exon 62996 63114 . 1 . N/A N/A 1 N/A 1 2 Os01t0101200-02.exon3 N/A Os01t0101200-02.exon3 N/A Os01t0101200-02.exon3 transcript:Os01t0101200-01 N/A 3 N/A
1 irgsp exon 63248 63576 . 1 . N/A N/A 0 N/A -1 1 Os01t0101200-01.exon4 N/A Os01t0101200-01.exon4 N/A Os01t0101200-01.exon4 transcript:Os01t0101200-01 N/A 4 N/A
1 irgsp CDS 62104 62295 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-01 N/A N/A transcript:Os01t0101200-01 Os01t0101200-01 N/A N/A
1 irgsp CDS 62385 62905 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-01 N/A N/A transcript:Os01t0101200-01 Os01t0101200-01 N/A N/A
1 irgsp CDS 62996 63114 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-01 N/A N/A transcript:Os01t0101200-01 Os01t0101200-01 N/A N/A
1 irgsp CDS 63248 63345 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-01 N/A N/A transcript:Os01t0101200-01 Os01t0101200-01 N/A N/A
1 irgsp five_prime_UTR 62060 62103 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-13 N/A N/A transcript:Os01t0101200-01 N/A N/A N/A
1 irgsp three_prime_UTR 63346 63576 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-13 N/A N/A transcript:Os01t0101200-01 N/A N/A N/A
1 irgsp mRNA 62112 65537 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101200-02 N/A N/A gene:Os01g0101200 N/A N/A Os01t0101200-02
1 irgsp exon 62112 62295 . 1 . N/A N/A 0 N/A 0 -1 Os01t0101200-02.exon1 N/A Os01t0101200-02.exon1 N/A Os01t0101200-02.exon1 transcript:Os01t0101200-02 N/A 1 N/A
1 irgsp exon 62385 62905 . 1 . N/A N/A 1 N/A 2 0 Os01t0101200-02.exon2 N/A agat-exon-1 N/A Os01t0101200-02.exon2 transcript:Os01t0101200-02 N/A 2 N/A
1 irgsp exon 62996 63114 . 1 . N/A N/A 1 N/A 1 2 Os01t0101200-02.exon3 N/A agat-exon-2 N/A Os01t0101200-02.exon3 transcript:Os01t0101200-02 N/A 3 N/A
1 irgsp exon 63248 65537 . 1 . N/A N/A 0 N/A -1 1 Os01t0101200-02.exon4 N/A Os01t0101200-02.exon4 N/A Os01t0101200-02.exon4 transcript:Os01t0101200-02 N/A 4 N/A
1 irgsp CDS 62113 62295 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-02 N/A N/A transcript:Os01t0101200-02 Os01t0101200-02 N/A N/A
1 irgsp CDS 62385 62905 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-02 N/A N/A transcript:Os01t0101200-02 Os01t0101200-02 N/A N/A
1 irgsp CDS 62996 63114 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-02 N/A N/A transcript:Os01t0101200-02 Os01t0101200-02 N/A N/A
1 irgsp CDS 63248 63345 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-02 N/A N/A transcript:Os01t0101200-02 Os01t0101200-02 N/A N/A
1 irgsp five_prime_UTR 62112 62112 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-14 N/A N/A transcript:Os01t0101200-02 N/A N/A N/A
1 irgsp three_prime_UTR 63346 65537 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-14 N/A N/A transcript:Os01t0101200-02 N/A N/A N/A
1 irgsp gene 63350 66302 . -1 . N/A protein_coding N/A Similar to MRNA, partial cds, clone: RAFL22-26-L17. (Fragment). (Os01t0101300-01) N/A N/A N/A Os01g0101300 gene:Os01g0101300 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 63350 66302 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101300-01 N/A N/A gene:Os01g0101300 N/A N/A Os01t0101300-01
1 irgsp exon 63350 63783 . -1 . N/A N/A 1 N/A -1 0 Os01t0101300-01.exon7 N/A Os01t0101300-01.exon7 N/A Os01t0101300-01.exon7 transcript:Os01t0101300-01 N/A 7 N/A
1 irgsp exon 63877 64020 . -1 . N/A N/A 1 N/A 0 0 Os01t0101300-01.exon6 N/A Os01t0101300-01.exon6 N/A Os01t0101300-01.exon6 transcript:Os01t0101300-01 N/A 6 N/A
1 irgsp exon 64339 64431 . -1 . N/A N/A 1 N/A 0 0 Os01t0101300-01.exon5 N/A Os01t0101300-01.exon5 N/A Os01t0101300-01.exon5 transcript:Os01t0101300-01 N/A 5 N/A
1 irgsp exon 64665 64779 . -1 . N/A N/A 1 N/A 0 2 Os01t0101300-01.exon4 N/A Os01t0101300-01.exon4 N/A Os01t0101300-01.exon4 transcript:Os01t0101300-01 N/A 4 N/A
1 irgsp exon 64902 65152 . -1 . N/A N/A 1 N/A 2 0 Os01t0101300-01.exon3 N/A Os01t0101300-01.exon3 N/A Os01t0101300-01.exon3 transcript:Os01t0101300-01 N/A 3 N/A
1 irgsp exon 65248 65431 . -1 . N/A N/A 1 N/A 0 2 Os01t0101300-01.exon2 N/A Os01t0101300-01.exon2 N/A Os01t0101300-01.exon2 transcript:Os01t0101300-01 N/A 2 N/A
1 irgsp exon 65628 66302 . -1 . N/A N/A 1 N/A 2 -1 Os01t0101300-01.exon1 N/A Os01t0101300-01.exon1 N/A Os01t0101300-01.exon1 transcript:Os01t0101300-01 N/A 1 N/A
1 irgsp CDS 63670 63783 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
1 irgsp CDS 63877 64020 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
1 irgsp CDS 64339 64431 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
1 irgsp CDS 64665 64779 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
1 irgsp CDS 64902 65152 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
1 irgsp CDS 65248 65431 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
1 irgsp CDS 65628 65950 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
1 irgsp five_prime_UTR 65951 66302 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-15 N/A N/A transcript:Os01t0101300-01 N/A N/A N/A
1 irgsp three_prime_UTR 63350 63669 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-15 N/A N/A transcript:Os01t0101300-01 N/A N/A N/A
1 irgsp gene 72816 78349 . 1 . N/A protein_coding N/A Immunoglobulin-like fold domain containing protein. (Os01t0101600-01);Immunoglobulin-like fold domain containing protein. (Os01t0101600-02);Hypothetical conserved gene. (Os01t0101600-03) N/A N/A N/A Os01g0101600 gene:Os01g0101600 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 72816 78349 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101600-01 N/A N/A gene:Os01g0101600 N/A N/A Os01t0101600-01
1 irgsp exon 72816 73935 . 1 . N/A N/A 0 N/A 1 -1 Os01t0101600-01.exon1 N/A Os01t0101600-01.exon1 N/A Os01t0101600-01.exon1 transcript:Os01t0101600-01 N/A 1 N/A
1 irgsp exon 74468 74981 . 1 . N/A N/A 0 N/A 2 1 Os01t0101600-02.exon2 N/A Os01t0101600-02.exon2 N/A Os01t0101600-02.exon2 transcript:Os01t0101600-01 N/A 2 N/A
1 irgsp exon 75619 77205 . 1 . N/A N/A 0 N/A -1 2 Os01t0101600-01.exon3 N/A Os01t0101600-01.exon3 N/A Os01t0101600-01.exon3 transcript:Os01t0101600-01 N/A 3 N/A
1 irgsp exon 77333 78349 . 1 . N/A N/A 0 N/A -1 -1 Os01t0101600-01.exon4 N/A Os01t0101600-01.exon4 N/A Os01t0101600-01.exon4 transcript:Os01t0101600-01 N/A 4 N/A
1 irgsp CDS 72903 73935 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-01 N/A N/A transcript:Os01t0101600-01 Os01t0101600-01 N/A N/A
1 irgsp CDS 74468 74981 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-01 N/A N/A transcript:Os01t0101600-01 Os01t0101600-01 N/A N/A
1 irgsp CDS 75619 77008 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-01 N/A N/A transcript:Os01t0101600-01 Os01t0101600-01 N/A N/A
1 irgsp five_prime_UTR 72816 72902 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-16 N/A N/A transcript:Os01t0101600-01 N/A N/A N/A
1 irgsp three_prime_UTR 77009 77205 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-16 N/A N/A transcript:Os01t0101600-01 N/A N/A N/A
1 irgsp three_prime_UTR 77333 78349 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-17 N/A N/A transcript:Os01t0101600-01 N/A N/A N/A
1 irgsp mRNA 72823 77699 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101600-02 N/A N/A gene:Os01g0101600 N/A N/A Os01t0101600-02
1 irgsp exon 72823 73935 . 1 . N/A N/A 0 N/A 1 -1 Os01t0101600-02.exon1 N/A Os01t0101600-02.exon1 N/A Os01t0101600-02.exon1 transcript:Os01t0101600-02 N/A 1 N/A
1 irgsp exon 74468 74981 . 1 . N/A N/A 0 N/A 2 1 Os01t0101600-02.exon2 N/A agat-exon-3 N/A Os01t0101600-02.exon2 transcript:Os01t0101600-02 N/A 2 N/A
1 irgsp exon 75619 77699 . 1 . N/A N/A 0 N/A -1 2 Os01t0101600-02.exon3 N/A Os01t0101600-02.exon3 N/A Os01t0101600-02.exon3 transcript:Os01t0101600-02 N/A 3 N/A
1 irgsp CDS 72903 73935 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-02 N/A N/A transcript:Os01t0101600-02 Os01t0101600-02 N/A N/A
1 irgsp CDS 74468 74981 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-02 N/A N/A transcript:Os01t0101600-02 Os01t0101600-02 N/A N/A
1 irgsp CDS 75619 77008 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-02 N/A N/A transcript:Os01t0101600-02 Os01t0101600-02 N/A N/A
1 irgsp five_prime_UTR 72823 72902 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-17 N/A N/A transcript:Os01t0101600-02 N/A N/A N/A
1 irgsp three_prime_UTR 77009 77699 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-18 N/A N/A transcript:Os01t0101600-02 N/A N/A N/A
1 irgsp mRNA 75942 77699 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101600-03 N/A N/A gene:Os01g0101600 N/A N/A Os01t0101600-03
1 irgsp exon 75942 77699 . 1 . N/A N/A 0 N/A -1 -1 Os01t0101600-03.exon1 N/A Os01t0101600-03.exon1 N/A Os01t0101600-03.exon1 transcript:Os01t0101600-03 N/A 1 N/A
1 irgsp CDS 75944 77008 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-03 N/A N/A transcript:Os01t0101600-03 Os01t0101600-03 N/A N/A
1 irgsp five_prime_UTR 75942 75943 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-18 N/A N/A transcript:Os01t0101600-03 N/A N/A N/A
1 irgsp three_prime_UTR 77009 77699 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-19 N/A N/A transcript:Os01t0101600-03 N/A N/A N/A
1 irgsp gene 82426 84095 . 1 . N/A protein_coding N/A Similar to chaperone protein dnaJ 20. (Os01t0101700-00) N/A N/A N/A Os01g0101700 gene:Os01g0101700 irgspv1.0-20170804-genes DnaJ domain protein C1, rice DJC26 homolog N/A N/A N/A N/A
1 irgsp mRNA 82426 84095 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101700-00 N/A N/A gene:Os01g0101700 N/A N/A Os01t0101700-00
1 irgsp exon 82426 82932 . 1 . N/A N/A 1 N/A 0 -1 Os01t0101700-00.exon1 N/A Os01t0101700-00.exon1 N/A Os01t0101700-00.exon1 transcript:Os01t0101700-00 N/A 1 N/A
1 irgsp exon 83724 84095 . 1 . N/A N/A 1 N/A -1 0 Os01t0101700-00.exon2 N/A Os01t0101700-00.exon2 N/A Os01t0101700-00.exon2 transcript:Os01t0101700-00 N/A 2 N/A
1 irgsp CDS 82507 82932 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101700-00 N/A N/A transcript:Os01t0101700-00 Os01t0101700-00 N/A N/A
1 irgsp CDS 83724 83864 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101700-00 N/A N/A transcript:Os01t0101700-00 Os01t0101700-00 N/A N/A
1 irgsp five_prime_UTR 82426 82506 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-19 N/A N/A transcript:Os01t0101700-00 N/A N/A N/A
1 irgsp three_prime_UTR 83865 84095 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-20 N/A N/A transcript:Os01t0101700-00 N/A N/A N/A
1 irgsp gene 85337 88844 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0101800-01) N/A N/A N/A Os01g0101800 gene:Os01g0101800 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 85337 88844 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101800-01 N/A N/A gene:Os01g0101800 N/A N/A Os01t0101800-01
1 irgsp exon 85337 85600 . 1 . N/A N/A 1 N/A 0 -1 Os01t0101800-01.exon1 N/A Os01t0101800-01.exon1 N/A Os01t0101800-01.exon1 transcript:Os01t0101800-01 N/A 1 N/A
1 irgsp exon 85737 85830 . 1 . N/A N/A 1 N/A 1 0 Os01t0101800-01.exon2 N/A Os01t0101800-01.exon2 N/A Os01t0101800-01.exon2 transcript:Os01t0101800-01 N/A 2 N/A
1 irgsp exon 85935 86086 . 1 . N/A N/A 1 N/A 0 1 Os01t0101800-01.exon3 N/A Os01t0101800-01.exon3 N/A Os01t0101800-01.exon3 transcript:Os01t0101800-01 N/A 3 N/A
1 irgsp exon 86212 86299 . 1 . N/A N/A 1 N/A 1 0 Os01t0101800-01.exon4 N/A Os01t0101800-01.exon4 N/A Os01t0101800-01.exon4 transcript:Os01t0101800-01 N/A 4 N/A
1 irgsp exon 86399 87681 . 1 . N/A N/A 1 N/A 0 1 Os01t0101800-01.exon5 N/A Os01t0101800-01.exon5 N/A Os01t0101800-01.exon5 transcript:Os01t0101800-01 N/A 5 N/A
1 irgsp exon 88291 88398 . 1 . N/A N/A 1 N/A 0 0 Os01t0101800-01.exon6 N/A Os01t0101800-01.exon6 N/A Os01t0101800-01.exon6 transcript:Os01t0101800-01 N/A 6 N/A
1 irgsp exon 88500 88844 . 1 . N/A N/A 1 N/A -1 0 Os01t0101800-01.exon7 N/A Os01t0101800-01.exon7 N/A Os01t0101800-01.exon7 transcript:Os01t0101800-01 N/A 7 N/A
1 irgsp CDS 85379 85600 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
1 irgsp CDS 85737 85830 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
1 irgsp CDS 85935 86086 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
1 irgsp CDS 86212 86299 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
1 irgsp CDS 86399 87681 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
1 irgsp CDS 88291 88398 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
1 irgsp CDS 88500 88583 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
1 irgsp five_prime_UTR 85337 85378 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-20 N/A N/A transcript:Os01t0101800-01 N/A N/A N/A
1 irgsp three_prime_UTR 88584 88844 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-21 N/A N/A transcript:Os01t0101800-01 N/A N/A N/A
1 irgsp gene 86211 88583 . -1 . N/A protein_coding N/A Hypothetical protein. (Os01t0101850-00) N/A N/A N/A Os01g0101850 gene:Os01g0101850 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 86211 88583 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101850-00 N/A N/A gene:Os01g0101850 N/A N/A Os01t0101850-00
1 irgsp exon 86211 86277 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101850-00.exon4 N/A Os01t0101850-00.exon4 N/A Os01t0101850-00.exon4 transcript:Os01t0101850-00 N/A 4 N/A
1 irgsp exon 86384 87694 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101850-00.exon3 N/A Os01t0101850-00.exon3 N/A Os01t0101850-00.exon3 transcript:Os01t0101850-00 N/A 3 N/A
1 irgsp exon 88308 88396 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101850-00.exon2 N/A Os01t0101850-00.exon2 N/A Os01t0101850-00.exon2 transcript:Os01t0101850-00 N/A 2 N/A
1 irgsp exon 88496 88583 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101850-00.exon1 N/A Os01t0101850-00.exon1 N/A Os01t0101850-00.exon1 transcript:Os01t0101850-00 N/A 1 N/A
1 irgsp CDS 87327 87662 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101850-00 N/A N/A transcript:Os01t0101850-00 Os01t0101850-00 N/A N/A
1 irgsp five_prime_UTR 87663 87694 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-21 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
1 irgsp five_prime_UTR 88308 88396 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-22 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
1 irgsp five_prime_UTR 88496 88583 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-23 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
1 irgsp three_prime_UTR 86211 86277 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-22 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
1 irgsp three_prime_UTR 86384 87326 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-23 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
1 irgsp gene 88883 89228 . -1 . N/A protein_coding N/A Similar to OSIGBa0075F02.3 protein. (Os01t0101900-00) N/A N/A N/A Os01g0101900 gene:Os01g0101900 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 88883 89228 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101900-00 N/A N/A gene:Os01g0101900 N/A N/A Os01t0101900-00
1 irgsp exon 88883 89228 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101900-00.exon1 N/A Os01t0101900-00.exon1 N/A Os01t0101900-00.exon1 transcript:Os01t0101900-00 N/A 1 N/A
1 irgsp CDS 88986 89204 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101900-00 N/A N/A transcript:Os01t0101900-00 Os01t0101900-00 N/A N/A
1 irgsp five_prime_UTR 89205 89228 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-24 N/A N/A transcript:Os01t0101900-00 N/A N/A N/A
1 irgsp three_prime_UTR 88883 88985 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-24 N/A N/A transcript:Os01t0101900-00 N/A N/A N/A
1 irgsp gene 89763 91465 . -1 . N/A protein_coding N/A Phosphoesterase family protein. (Os01t0102000-01) N/A N/A N/A Os01g0102000 gene:Os01g0102000 irgspv1.0-20170804-genes NON-SPECIFIC PHOSPHOLIPASE C5 N/A N/A N/A N/A
1 irgsp mRNA 89763 91465 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102000-01 N/A N/A gene:Os01g0102000 N/A N/A Os01t0102000-01
1 irgsp exon 89763 91465 . -1 . N/A N/A 1 N/A -1 -1 Os01t0102000-01.exon1 N/A Os01t0102000-01.exon1 N/A Os01t0102000-01.exon1 transcript:Os01t0102000-01 N/A 1 N/A
1 irgsp CDS 89825 91411 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102000-01 N/A N/A transcript:Os01t0102000-01 Os01t0102000-01 N/A N/A
1 irgsp five_prime_UTR 91412 91465 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-25 N/A N/A transcript:Os01t0102000-01 N/A N/A N/A
1 irgsp three_prime_UTR 89763 89824 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-25 N/A N/A transcript:Os01t0102000-01 N/A N/A N/A
1 irgsp gene 134300 135439 . 1 . N/A protein_coding N/A Thylakoid lumen protein, Photosynthesis and chloroplast development (Os01t0102300-01) N/A N/A N/A Os01g0102300 gene:Os01g0102300 irgspv1.0-20170804-genes OsTLP27 N/A N/A N/A N/A
1 irgsp mRNA 134300 135439 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102300-01 N/A N/A gene:Os01g0102300 N/A N/A Os01t0102300-01
1 irgsp exon 134300 134615 . 1 . N/A N/A 1 N/A 2 -1 Os01t0102300-01.exon1 N/A Os01t0102300-01.exon1 N/A Os01t0102300-01.exon1 transcript:Os01t0102300-01 N/A 1 N/A
1 irgsp exon 134698 134824 . 1 . N/A N/A 1 N/A 0 2 Os01t0102300-01.exon2 N/A Os01t0102300-01.exon2 N/A Os01t0102300-01.exon2 transcript:Os01t0102300-01 N/A 2 N/A
1 irgsp exon 134912 135439 . 1 . N/A N/A 1 N/A -1 0 Os01t0102300-01.exon3 N/A Os01t0102300-01.exon3 N/A Os01t0102300-01.exon3 transcript:Os01t0102300-01 N/A 3 N/A
1 irgsp CDS 134311 134615 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102300-01 N/A N/A transcript:Os01t0102300-01 Os01t0102300-01 N/A N/A
1 irgsp CDS 134698 134824 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102300-01 N/A N/A transcript:Os01t0102300-01 Os01t0102300-01 N/A N/A
1 irgsp CDS 134912 135253 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102300-01 N/A N/A transcript:Os01t0102300-01 Os01t0102300-01 N/A N/A
1 irgsp five_prime_UTR 134300 134310 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-26 N/A N/A transcript:Os01t0102300-01 N/A N/A N/A
1 irgsp three_prime_UTR 135254 135439 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-26 N/A N/A transcript:Os01t0102300-01 N/A N/A N/A
1 irgsp gene 139826 141555 . 1 . N/A protein_coding N/A Histone-fold domain containing protein. (Os01t0102400-01) N/A N/A N/A Os01g0102400 gene:Os01g0102400 irgspv1.0-20170804-genes HAP5H SUBUNIT OF CCAAT-BOX BINDING COMPLEX N/A N/A N/A N/A
1 irgsp mRNA 139826 141555 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102400-01 N/A N/A gene:Os01g0102400 N/A N/A Os01t0102400-01
1 irgsp exon 139826 139906 . 1 . N/A N/A 1 N/A -1 -1 Os01t0102400-01.exon1 N/A Os01t0102400-01.exon1 N/A Os01t0102400-01.exon1 transcript:Os01t0102400-01 N/A 1 N/A
1 irgsp exon 140120 141555 . 1 . N/A N/A 1 N/A -1 -1 Os01t0102400-01.exon2 N/A Os01t0102400-01.exon2 N/A Os01t0102400-01.exon2 transcript:Os01t0102400-01 N/A 2 N/A
1 irgsp CDS 140150 141415 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102400-01 N/A N/A transcript:Os01t0102400-01 Os01t0102400-01 N/A N/A
1 irgsp five_prime_UTR 139826 139906 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-27 N/A N/A transcript:Os01t0102400-01 N/A N/A N/A
1 irgsp five_prime_UTR 140120 140149 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-28 N/A N/A transcript:Os01t0102400-01 N/A N/A N/A
1 irgsp three_prime_UTR 141416 141555 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-27 N/A N/A transcript:Os01t0102400-01 N/A N/A N/A
1 irgsp gene 141959 144554 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0102500-01) N/A N/A N/A Os01g0102500 gene:Os01g0102500 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 141959 144554 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102500-01 N/A N/A gene:Os01g0102500 N/A N/A Os01t0102500-01
1 irgsp exon 141959 142631 . 1 . N/A N/A 1 N/A 2 -1 Os01t0102500-01.exon1 N/A Os01t0102500-01.exon1 N/A Os01t0102500-01.exon1 transcript:Os01t0102500-01 N/A 1 N/A
1 irgsp exon 143191 143431 . 1 . N/A N/A 1 N/A 0 2 Os01t0102500-01.exon2 N/A Os01t0102500-01.exon2 N/A Os01t0102500-01.exon2 transcript:Os01t0102500-01 N/A 2 N/A
1 irgsp exon 143563 143680 . 1 . N/A N/A 1 N/A 1 0 Os01t0102500-01.exon3 N/A Os01t0102500-01.exon3 N/A Os01t0102500-01.exon3 transcript:Os01t0102500-01 N/A 3 N/A
1 irgsp exon 143817 144554 . 1 . N/A N/A 1 N/A -1 1 Os01t0102500-01.exon4 N/A Os01t0102500-01.exon4 N/A Os01t0102500-01.exon4 transcript:Os01t0102500-01 N/A 4 N/A
1 irgsp CDS 142084 142631 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102500-01 N/A N/A transcript:Os01t0102500-01 Os01t0102500-01 N/A N/A
1 irgsp CDS 143191 143431 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102500-01 N/A N/A transcript:Os01t0102500-01 Os01t0102500-01 N/A N/A
1 irgsp CDS 143563 143680 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102500-01 N/A N/A transcript:Os01t0102500-01 Os01t0102500-01 N/A N/A
1 irgsp CDS 143817 143908 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102500-01 N/A N/A transcript:Os01t0102500-01 Os01t0102500-01 N/A N/A
1 irgsp five_prime_UTR 141959 142083 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-29 N/A N/A transcript:Os01t0102500-01 N/A N/A N/A
1 irgsp three_prime_UTR 143909 144554 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-28 N/A N/A transcript:Os01t0102500-01 N/A N/A N/A
1 irgsp gene 145603 147847 . 1 . N/A protein_coding N/A Shikimate kinase domain containing protein. (Os01t0102600-01);Similar to shikimate kinase family protein. (Os01t0102600-02) N/A N/A N/A Os01g0102600 gene:Os01g0102600 irgspv1.0-20170804-genes Shikimate kinase 4 N/A N/A N/A N/A
1 irgsp mRNA 145603 147847 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102600-01 N/A N/A gene:Os01g0102600 N/A N/A Os01t0102600-01
1 irgsp exon 145603 145786 . 1 . N/A N/A 0 N/A 1 -1 Os01t0102600-01.exon1 N/A Os01t0102600-01.exon1 N/A Os01t0102600-01.exon1 transcript:Os01t0102600-01 N/A 1 N/A
1 irgsp exon 145905 145951 . 1 . N/A N/A 0 N/A 0 1 Os01t0102600-01.exon2 N/A Os01t0102600-01.exon2 N/A Os01t0102600-01.exon2 transcript:Os01t0102600-01 N/A 2 N/A
1 irgsp exon 146028 146082 . 1 . N/A N/A 0 N/A 1 0 Os01t0102600-01.exon3 N/A Os01t0102600-01.exon3 N/A Os01t0102600-01.exon3 transcript:Os01t0102600-01 N/A 3 N/A
1 irgsp exon 146179 146339 . 1 . N/A N/A 0 N/A 0 1 Os01t0102600-01.exon4 N/A Os01t0102600-01.exon4 N/A Os01t0102600-01.exon4 transcript:Os01t0102600-01 N/A 4 N/A
1 irgsp exon 146450 146532 . 1 . N/A N/A 0 N/A 2 0 Os01t0102600-01.exon5 N/A Os01t0102600-01.exon5 N/A Os01t0102600-01.exon5 transcript:Os01t0102600-01 N/A 5 N/A
1 irgsp exon 146611 146719 . 1 . N/A N/A 0 N/A 0 2 Os01t0102600-01.exon6 N/A Os01t0102600-01.exon6 N/A Os01t0102600-01.exon6 transcript:Os01t0102600-01 N/A 6 N/A
1 irgsp exon 147106 147184 . 1 . N/A N/A 0 N/A 1 0 Os01t0102600-01.exon7 N/A Os01t0102600-01.exon7 N/A Os01t0102600-01.exon7 transcript:Os01t0102600-01 N/A 7 N/A
1 irgsp exon 147311 147375 . 1 . N/A N/A 1 N/A 0 1 Os01t0102600-02.exon2 N/A Os01t0102600-02.exon2 N/A Os01t0102600-02.exon2 transcript:Os01t0102600-01 N/A 8 N/A
1 irgsp exon 147507 147847 . 1 . N/A N/A 0 N/A -1 0 Os01t0102600-01.exon9 N/A Os01t0102600-01.exon9 N/A Os01t0102600-01.exon9 transcript:Os01t0102600-01 N/A 9 N/A
1 irgsp CDS 145645 145786 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
1 irgsp CDS 145905 145951 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
1 irgsp CDS 146028 146082 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
1 irgsp CDS 146179 146339 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
1 irgsp CDS 146450 146532 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
1 irgsp CDS 146611 146719 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
1 irgsp CDS 147106 147184 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
1 irgsp CDS 147311 147375 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
1 irgsp CDS 147507 147575 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
1 irgsp five_prime_UTR 145603 145644 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-30 N/A N/A transcript:Os01t0102600-01 N/A N/A N/A
1 irgsp three_prime_UTR 147576 147847 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-29 N/A N/A transcript:Os01t0102600-01 N/A N/A N/A
1 irgsp mRNA 147104 147805 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102600-02 N/A N/A gene:Os01g0102600 N/A N/A Os01t0102600-02
1 irgsp exon 147104 147184 . 1 . N/A N/A 0 N/A 1 -1 Os01t0102600-02.exon1 N/A Os01t0102600-02.exon1 N/A Os01t0102600-02.exon1 transcript:Os01t0102600-02 N/A 1 N/A
1 irgsp exon 147311 147375 . 1 . N/A N/A 1 N/A 0 1 Os01t0102600-02.exon2 N/A agat-exon-4 N/A Os01t0102600-02.exon2 transcript:Os01t0102600-02 N/A 2 N/A
1 irgsp exon 147507 147805 . 1 . N/A N/A 0 N/A -1 0 Os01t0102600-02.exon3 N/A Os01t0102600-02.exon3 N/A Os01t0102600-02.exon3 transcript:Os01t0102600-02 N/A 3 N/A
1 irgsp CDS 147106 147184 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-02 N/A N/A transcript:Os01t0102600-02 Os01t0102600-02 N/A N/A
1 irgsp CDS 147311 147375 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-02 N/A N/A transcript:Os01t0102600-02 Os01t0102600-02 N/A N/A
1 irgsp CDS 147507 147575 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-02 N/A N/A transcript:Os01t0102600-02 Os01t0102600-02 N/A N/A
1 irgsp five_prime_UTR 147104 147105 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-31 N/A N/A transcript:Os01t0102600-02 N/A N/A N/A
1 irgsp three_prime_UTR 147576 147805 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-30 N/A N/A transcript:Os01t0102600-02 N/A N/A N/A
1 irgsp gene 148085 150568 . 1 . N/A protein_coding N/A Translocon-associated beta family protein. (Os01t0102700-01) N/A N/A N/A Os01g0102700 gene:Os01g0102700 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 148085 150568 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102700-01 N/A N/A gene:Os01g0102700 N/A N/A Os01t0102700-01
1 irgsp exon 148085 148313 . 1 . N/A N/A 1 N/A 2 -1 Os01t0102700-01.exon1 N/A Os01t0102700-01.exon1 N/A Os01t0102700-01.exon1 transcript:Os01t0102700-01 N/A 1 N/A
1 irgsp exon 149450 149548 . 1 . N/A N/A 1 N/A 2 2 Os01t0102700-01.exon2 N/A Os01t0102700-01.exon2 N/A Os01t0102700-01.exon2 transcript:Os01t0102700-01 N/A 2 N/A
1 irgsp exon 149634 149742 . 1 . N/A N/A 1 N/A 0 2 Os01t0102700-01.exon3 N/A Os01t0102700-01.exon3 N/A Os01t0102700-01.exon3 transcript:Os01t0102700-01 N/A 3 N/A
1 irgsp exon 149856 149931 . 1 . N/A N/A 1 N/A 1 0 Os01t0102700-01.exon4 N/A Os01t0102700-01.exon4 N/A Os01t0102700-01.exon4 transcript:Os01t0102700-01 N/A 4 N/A
1 irgsp exon 150152 150568 . 1 . N/A N/A 1 N/A -1 1 Os01t0102700-01.exon5 N/A Os01t0102700-01.exon5 N/A Os01t0102700-01.exon5 transcript:Os01t0102700-01 N/A 5 N/A
1 irgsp CDS 148147 148313 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
1 irgsp CDS 149450 149548 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
1 irgsp CDS 149634 149742 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
1 irgsp CDS 149856 149931 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
1 irgsp CDS 150152 150318 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
1 irgsp five_prime_UTR 148085 148146 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-32 N/A N/A transcript:Os01t0102700-01 N/A N/A N/A
1 irgsp three_prime_UTR 150319 150568 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-31 N/A N/A transcript:Os01t0102700-01 N/A N/A N/A
1 irgsp gene 152853 156449 . 1 . N/A protein_coding N/A Similar to chromatin remodeling complex subunit. (Os01t0102800-01) N/A N/A N/A Os01g0102800 gene:Os01g0102800 irgspv1.0-20170804-genes Cockayne syndrome WD-repeat protein N/A N/A N/A N/A
1 irgsp mRNA 152853 156449 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102800-01 N/A N/A gene:Os01g0102800 N/A N/A Os01t0102800-01
1 irgsp exon 152853 153025 . 1 . N/A N/A 1 N/A 1 -1 Os01t0102800-01.exon1 N/A Os01t0102800-01.exon1 N/A Os01t0102800-01.exon1 transcript:Os01t0102800-01 N/A 1 N/A
1 irgsp exon 153178 154646 . 1 . N/A N/A 1 N/A 0 1 Os01t0102800-01.exon2 N/A Os01t0102800-01.exon2 N/A Os01t0102800-01.exon2 transcript:Os01t0102800-01 N/A 2 N/A
1 irgsp exon 155010 155450 . 1 . N/A N/A 1 N/A 0 0 Os01t0102800-01.exon3 N/A Os01t0102800-01.exon3 N/A Os01t0102800-01.exon3 transcript:Os01t0102800-01 N/A 3 N/A
1 irgsp exon 155543 156449 . 1 . N/A N/A 1 N/A -1 0 Os01t0102800-01.exon4 N/A Os01t0102800-01.exon4 N/A Os01t0102800-01.exon4 transcript:Os01t0102800-01 N/A 4 N/A
1 irgsp CDS 152854 153025 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102800-01 N/A N/A transcript:Os01t0102800-01 Os01t0102800-01 N/A N/A
1 irgsp CDS 153178 154646 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102800-01 N/A N/A transcript:Os01t0102800-01 Os01t0102800-01 N/A N/A
1 irgsp CDS 155010 155450 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102800-01 N/A N/A transcript:Os01t0102800-01 Os01t0102800-01 N/A N/A
1 irgsp CDS 155543 156214 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102800-01 N/A N/A transcript:Os01t0102800-01 Os01t0102800-01 N/A N/A
1 irgsp five_prime_UTR 152853 152853 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-33 N/A N/A transcript:Os01t0102800-01 N/A N/A N/A
1 irgsp three_prime_UTR 156215 156449 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-32 N/A N/A transcript:Os01t0102800-01 N/A N/A N/A
1 irgsp gene 164577 168921 . 1 . N/A protein_coding N/A Similar to nitrilase 2. (Os01t0102850-00) N/A N/A N/A Os01g0102850 gene:Os01g0102850 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 164577 168921 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102850-00 N/A N/A gene:Os01g0102850 N/A N/A Os01t0102850-00
1 irgsp exon 164577 164905 . 1 . N/A N/A 1 N/A -1 -1 Os01t0102850-00.exon1 N/A Os01t0102850-00.exon1 N/A Os01t0102850-00.exon1 transcript:Os01t0102850-00 N/A 1 N/A
1 irgsp exon 168499 168921 . 1 . N/A N/A 1 N/A 0 -1 Os01t0102850-00.exon2 N/A Os01t0102850-00.exon2 N/A Os01t0102850-00.exon2 transcript:Os01t0102850-00 N/A 2 N/A
1 irgsp CDS 168805 168921 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102850-00 N/A N/A transcript:Os01t0102850-00 Os01t0102850-00 N/A N/A
1 irgsp five_prime_UTR 164577 164905 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-34 N/A N/A transcript:Os01t0102850-00 N/A N/A N/A
1 irgsp five_prime_UTR 168499 168804 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-35 N/A N/A transcript:Os01t0102850-00 N/A N/A N/A
1 irgsp gene 169390 170316 . -1 . N/A protein_coding N/A Light-regulated protein, Regulation of light-dependent attachment of LEAF-TYPE FERREDOXIN-NADP+ OXIDOREDUCTASE (LFNR) to the thylakoid membrane (Os01t0102900-01) N/A N/A N/A Os01g0102900 gene:Os01g0102900 irgspv1.0-20170804-genes LIGHT-REGULATED GENE 1 N/A N/A N/A N/A
1 irgsp mRNA 169390 170316 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102900-01 N/A N/A gene:Os01g0102900 N/A N/A Os01t0102900-01
1 irgsp exon 169390 169656 . -1 . N/A N/A 1 N/A -1 2 Os01t0102900-01.exon3 N/A Os01t0102900-01.exon3 N/A Os01t0102900-01.exon3 transcript:Os01t0102900-01 N/A 3 N/A
1 irgsp exon 169751 169909 . -1 . N/A N/A 1 N/A 2 2 Os01t0102900-01.exon2 N/A Os01t0102900-01.exon2 N/A Os01t0102900-01.exon2 transcript:Os01t0102900-01 N/A 2 N/A
1 irgsp exon 170091 170316 . -1 . N/A N/A 1 N/A 2 -1 Os01t0102900-01.exon1 N/A Os01t0102900-01.exon1 N/A Os01t0102900-01.exon1 transcript:Os01t0102900-01 N/A 1 N/A
1 irgsp CDS 169599 169656 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102900-01 N/A N/A transcript:Os01t0102900-01 Os01t0102900-01 N/A N/A
1 irgsp CDS 169751 169909 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102900-01 N/A N/A transcript:Os01t0102900-01 Os01t0102900-01 N/A N/A
1 irgsp CDS 170091 170260 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102900-01 N/A N/A transcript:Os01t0102900-01 Os01t0102900-01 N/A N/A
1 irgsp five_prime_UTR 170261 170316 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-36 N/A N/A transcript:Os01t0102900-01 N/A N/A N/A
1 irgsp three_prime_UTR 169390 169598 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-33 N/A N/A transcript:Os01t0102900-01 N/A N/A N/A
1 irgsp gene 170798 173144 . -1 . N/A protein_coding N/A Snf7 family protein. (Os01t0103000-01) N/A N/A N/A Os01g0103000 gene:Os01g0103000 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 170798 173144 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103000-01 N/A N/A gene:Os01g0103000 N/A N/A Os01t0103000-01
1 irgsp exon 170798 171095 . -1 . N/A N/A 1 N/A -1 0 Os01t0103000-01.exon7 N/A Os01t0103000-01.exon7 N/A Os01t0103000-01.exon7 transcript:Os01t0103000-01 N/A 7 N/A
1 irgsp exon 171406 171554 . -1 . N/A N/A 1 N/A 0 1 Os01t0103000-01.exon6 N/A Os01t0103000-01.exon6 N/A Os01t0103000-01.exon6 transcript:Os01t0103000-01 N/A 6 N/A
1 irgsp exon 171764 171875 . -1 . N/A N/A 1 N/A 1 0 Os01t0103000-01.exon5 N/A Os01t0103000-01.exon5 N/A Os01t0103000-01.exon5 transcript:Os01t0103000-01 N/A 5 N/A
1 irgsp exon 172398 172469 . -1 . N/A N/A 1 N/A 0 0 Os01t0103000-01.exon4 N/A Os01t0103000-01.exon4 N/A Os01t0103000-01.exon4 transcript:Os01t0103000-01 N/A 4 N/A
1 irgsp exon 172578 172671 . -1 . N/A N/A 1 N/A 0 2 Os01t0103000-01.exon3 N/A Os01t0103000-01.exon3 N/A Os01t0103000-01.exon3 transcript:Os01t0103000-01 N/A 3 N/A
1 irgsp exon 172770 172921 . -1 . N/A N/A 1 N/A 2 0 Os01t0103000-01.exon2 N/A Os01t0103000-01.exon2 N/A Os01t0103000-01.exon2 transcript:Os01t0103000-01 N/A 2 N/A
1 irgsp exon 173004 173144 . -1 . N/A N/A 1 N/A 0 -1 Os01t0103000-01.exon1 N/A Os01t0103000-01.exon1 N/A Os01t0103000-01.exon1 transcript:Os01t0103000-01 N/A 1 N/A
1 irgsp CDS 171045 171095 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
1 irgsp CDS 171406 171554 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
1 irgsp CDS 171764 171875 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
1 irgsp CDS 172398 172469 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
1 irgsp CDS 172578 172671 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
1 irgsp CDS 172770 172921 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
1 irgsp CDS 173004 173072 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
1 irgsp five_prime_UTR 173073 173144 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-37 N/A N/A transcript:Os01t0103000-01 N/A N/A N/A
1 irgsp three_prime_UTR 170798 171044 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-34 N/A N/A transcript:Os01t0103000-01 N/A N/A N/A
1 irgsp gene 178607 180575 . 1 . N/A protein_coding N/A TGF-beta receptor, type I/II extracellular region family protein. (Os01t0103100-01);Similar to predicted protein. (Os01t0103100-02) N/A N/A N/A Os01g0103100 gene:Os01g0103100 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 178607 180548 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103100-01 N/A N/A gene:Os01g0103100 N/A N/A Os01t0103100-01
1 irgsp exon 178607 180548 . 1 . N/A N/A 0 N/A -1 -1 Os01t0103100-01.exon1 N/A Os01t0103100-01.exon1 N/A Os01t0103100-01.exon1 transcript:Os01t0103100-01 N/A 1 N/A
1 irgsp CDS 178642 180462 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103100-01 N/A N/A transcript:Os01t0103100-01 Os01t0103100-01 N/A N/A
1 irgsp five_prime_UTR 178607 178641 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-38 N/A N/A transcript:Os01t0103100-01 N/A N/A N/A
1 irgsp three_prime_UTR 180463 180548 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-35 N/A N/A transcript:Os01t0103100-01 N/A N/A N/A
1 irgsp mRNA 178652 180575 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103100-02 N/A N/A gene:Os01g0103100 N/A N/A Os01t0103100-02
1 irgsp exon 178652 180575 . 1 . N/A N/A 0 N/A -1 -1 Os01t0103100-02.exon1 N/A Os01t0103100-02.exon1 N/A Os01t0103100-02.exon1 transcript:Os01t0103100-02 N/A 1 N/A
1 irgsp CDS 178678 180462 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103100-02 N/A N/A transcript:Os01t0103100-02 Os01t0103100-02 N/A N/A
1 irgsp five_prime_UTR 178652 178677 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-39 N/A N/A transcript:Os01t0103100-02 N/A N/A N/A
1 irgsp three_prime_UTR 180463 180575 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-36 N/A N/A transcript:Os01t0103100-02 N/A N/A N/A
1 irgsp gene 178815 180433 . -1 . N/A protein_coding N/A Hypothetical protein. (Os01t0103075-00) N/A N/A N/A Os01g0103075 gene:Os01g0103075 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 178815 180433 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103075-00 N/A N/A gene:Os01g0103075 N/A N/A Os01t0103075-00
1 irgsp exon 178815 180433 . -1 . N/A N/A 1 N/A -1 -1 Os01t0103075-00.exon1 N/A Os01t0103075-00.exon1 N/A Os01t0103075-00.exon1 transcript:Os01t0103075-00 N/A 1 N/A
1 irgsp CDS 179512 180054 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103075-00 N/A N/A transcript:Os01t0103075-00 Os01t0103075-00 N/A N/A
1 irgsp five_prime_UTR 180055 180433 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-40 N/A N/A transcript:Os01t0103075-00 N/A N/A N/A
1 irgsp three_prime_UTR 178815 179511 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-37 N/A N/A transcript:Os01t0103075-00 N/A N/A N/A
1 Ensembl_Plants ncRNA_gene 182074 182154 . 1 . N/A tRNA N/A tRNA-Leu for anticodon AAG N/A N/A N/A ENSRNA049442722 gene:ENSRNA049442722 trnascan_gene tRNA-Leu N/A N/A N/A N/A
1 Ensembl_Plants tRNA 182074 182154 . 1 . N/A tRNA N/A N/A N/A N/A N/A N/A transcript:ENSRNA049442722-T1 N/A N/A gene:ENSRNA049442722 N/A N/A ENSRNA049442722-T1
1 Ensembl_Plants exon 182074 182154 . 1 . N/A N/A 1 N/A -1 -1 ENSRNA049442722-E1 N/A ENSRNA049442722-E1 N/A ENSRNA049442722-E1 transcript:ENSRNA049442722-T1 N/A 1 N/A
1 irgsp gene 185189 185828 . -1 . N/A protein_coding N/A Hypothetical gene. (Os01t0103400-01) N/A N/A N/A Os01g0103400 gene:Os01g0103400 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 185189 185828 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103400-01 N/A N/A gene:Os01g0103400 N/A N/A Os01t0103400-01
1 irgsp exon 185189 185828 . -1 . N/A N/A 1 N/A -1 -1 Os01t0103400-01.exon1 N/A Os01t0103400-01.exon1 N/A Os01t0103400-01.exon1 transcript:Os01t0103400-01 N/A 1 N/A
1 irgsp CDS 185435 185827 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103400-01 N/A N/A transcript:Os01t0103400-01 Os01t0103400-01 N/A N/A
1 irgsp five_prime_UTR 185828 185828 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-41 N/A N/A transcript:Os01t0103400-01 N/A N/A N/A
1 irgsp three_prime_UTR 185189 185434 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-38 N/A N/A transcript:Os01t0103400-01 N/A N/A N/A
1 irgsp repeat_region 186000 186100 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A fakeRepeat2 N/A N/A N/A N/A N/A N/A
1 irgsp gene 186250 190904 . -1 . N/A protein_coding N/A Similar to sterol-8,7-isomerase. (Os01t0103600-01);Emopamil-binding family protein. (Os01t0103600-02) N/A N/A N/A Os01g0103600 gene:Os01g0103600 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 186250 190262 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103600-02 N/A N/A gene:Os01g0103600 N/A N/A Os01t0103600-02
1 irgsp exon 186250 186771 . -1 . N/A N/A 0 N/A -1 2 Os01t0103600-02.exon4 N/A Os01t0103600-02.exon4 N/A Os01t0103600-02.exon4 transcript:Os01t0103600-02 N/A 4 N/A
1 irgsp exon 189607 189715 . -1 . N/A N/A 0 N/A 2 1 Os01t0103600-02.exon3 N/A Os01t0103600-02.exon3 N/A Os01t0103600-02.exon3 transcript:Os01t0103600-02 N/A 3 N/A
1 irgsp exon 189841 189990 . -1 . N/A N/A 1 N/A 1 1 Os01t0103600-02.exon2 N/A Os01t0103600-02.exon2 N/A Os01t0103600-02.exon2 transcript:Os01t0103600-02 N/A 2 N/A
1 irgsp exon 190087 190262 . -1 . N/A N/A 0 N/A 1 -1 Os01t0103600-02.exon1 N/A Os01t0103600-02.exon1 N/A Os01t0103600-02.exon1 transcript:Os01t0103600-02 N/A 1 N/A
1 irgsp CDS 186516 186771 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-02 N/A N/A transcript:Os01t0103600-02 Os01t0103600-02 N/A N/A
1 irgsp CDS 189607 189715 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-02 N/A N/A transcript:Os01t0103600-02 Os01t0103600-02 N/A N/A
1 irgsp CDS 189841 189990 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-02 N/A N/A transcript:Os01t0103600-02 Os01t0103600-02 N/A N/A
1 irgsp CDS 190087 190231 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-02 N/A N/A transcript:Os01t0103600-02 Os01t0103600-02 N/A N/A
1 irgsp five_prime_UTR 190232 190262 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-42 N/A N/A transcript:Os01t0103600-02 N/A N/A N/A
1 irgsp three_prime_UTR 186250 186515 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-39 N/A N/A transcript:Os01t0103600-02 N/A N/A N/A
1 irgsp mRNA 187345 190904 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103600-01 N/A N/A gene:Os01g0103600 N/A N/A Os01t0103600-01
1 irgsp exon 187345 189715 . -1 . N/A N/A 0 N/A -1 1 Os01t0103600-01.exon3 N/A Os01t0103600-01.exon3 N/A Os01t0103600-01.exon3 transcript:Os01t0103600-01 N/A 3 N/A
1 irgsp exon 189841 189990 . -1 . N/A N/A 1 N/A 1 1 Os01t0103600-02.exon2 N/A agat-exon-5 N/A Os01t0103600-02.exon2 transcript:Os01t0103600-01 N/A 2 N/A
1 irgsp exon 190087 190904 . -1 . N/A N/A 0 N/A 1 -1 Os01t0103600-01.exon1 N/A Os01t0103600-01.exon1 N/A Os01t0103600-01.exon1 transcript:Os01t0103600-01 N/A 1 N/A
1 irgsp CDS 189396 189715 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-01 N/A N/A transcript:Os01t0103600-01 Os01t0103600-01 N/A N/A
1 irgsp CDS 189841 189990 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-01 N/A N/A transcript:Os01t0103600-01 Os01t0103600-01 N/A N/A
1 irgsp CDS 190087 190231 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-01 N/A N/A transcript:Os01t0103600-01 Os01t0103600-01 N/A N/A
1 irgsp five_prime_UTR 190232 190904 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-43 N/A N/A transcript:Os01t0103600-01 N/A N/A N/A
1 irgsp three_prime_UTR 187345 189395 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-40 N/A N/A transcript:Os01t0103600-01 N/A N/A N/A
1 irgsp gene 187545 188586 . 1 . N/A protein_coding N/A Hypothetical gene. (Os01t0103650-00) N/A N/A N/A Os01g0103650 gene:Os01g0103650 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 187545 188586 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103650-00 N/A N/A gene:Os01g0103650 N/A N/A Os01t0103650-00
1 irgsp exon 187545 188020 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103650-00.exon1 N/A Os01t0103650-00.exon1 N/A Os01t0103650-00.exon1 transcript:Os01t0103650-00 N/A 1 N/A
1 irgsp exon 188060 188385 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103650-00.exon2 N/A Os01t0103650-00.exon2 N/A Os01t0103650-00.exon2 transcript:Os01t0103650-00 N/A 2 N/A
1 irgsp exon 188455 188586 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103650-00.exon3 N/A Os01t0103650-00.exon3 N/A Os01t0103650-00.exon3 transcript:Os01t0103650-00 N/A 3 N/A
1 irgsp CDS 187547 187768 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103650-00 N/A N/A transcript:Os01t0103650-00 Os01t0103650-00 N/A N/A
1 irgsp five_prime_UTR 187545 187546 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-44 N/A N/A transcript:Os01t0103650-00 N/A N/A N/A
1 irgsp three_prime_UTR 187769 188020 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-41 N/A N/A transcript:Os01t0103650-00 N/A N/A N/A
1 irgsp three_prime_UTR 188060 188385 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-42 N/A N/A transcript:Os01t0103650-00 N/A N/A N/A
1 irgsp three_prime_UTR 188455 188586 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-43 N/A N/A transcript:Os01t0103650-00 N/A N/A N/A
1 irgsp gene 191037 196287 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0103700-01) N/A N/A N/A Os01g0103700 gene:Os01g0103700 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 191037 196287 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103700-01 N/A N/A gene:Os01g0103700 N/A N/A Os01t0103700-01
1 irgsp exon 191037 191161 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103700-01.exon1 N/A Os01t0103700-01.exon1 N/A Os01t0103700-01.exon1 transcript:Os01t0103700-01 N/A 1 N/A
1 irgsp exon 191625 191705 . 1 . N/A N/A 1 N/A 0 -1 Os01t0103700-01.exon2 N/A Os01t0103700-01.exon2 N/A Os01t0103700-01.exon2 transcript:Os01t0103700-01 N/A 2 N/A
1 irgsp exon 192399 192506 . 1 . N/A N/A 1 N/A 0 0 Os01t0103700-01.exon3 N/A Os01t0103700-01.exon3 N/A Os01t0103700-01.exon3 transcript:Os01t0103700-01 N/A 3 N/A
1 irgsp exon 192958 193161 . 1 . N/A N/A 1 N/A 0 0 Os01t0103700-01.exon4 N/A Os01t0103700-01.exon4 N/A Os01t0103700-01.exon4 transcript:Os01t0103700-01 N/A 4 N/A
1 irgsp exon 193248 193356 . 1 . N/A N/A 1 N/A 1 0 Os01t0103700-01.exon5 N/A Os01t0103700-01.exon5 N/A Os01t0103700-01.exon5 transcript:Os01t0103700-01 N/A 5 N/A
1 irgsp exon 193434 196287 . 1 . N/A N/A 1 N/A -1 1 Os01t0103700-01.exon6 N/A Os01t0103700-01.exon6 N/A Os01t0103700-01.exon6 transcript:Os01t0103700-01 N/A 6 N/A
1 irgsp CDS 191694 191705 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
1 irgsp CDS 192399 192506 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
1 irgsp CDS 192958 193161 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
1 irgsp CDS 193248 193356 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
1 irgsp CDS 193434 193507 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
1 irgsp five_prime_UTR 191037 191161 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-45 N/A N/A transcript:Os01t0103700-01 N/A N/A N/A
1 irgsp five_prime_UTR 191625 191693 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-46 N/A N/A transcript:Os01t0103700-01 N/A N/A N/A
1 irgsp three_prime_UTR 193508 196287 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-44 N/A N/A transcript:Os01t0103700-01 N/A N/A N/A
1 irgsp gene 197647 200803 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0103800-01) N/A N/A N/A Os01g0103800 gene:Os01g0103800 irgspv1.0-20170804-genes OsDW1-01g N/A N/A N/A N/A
1 irgsp mRNA 197647 200803 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103800-01 N/A N/A gene:Os01g0103800 N/A N/A Os01t0103800-01
1 irgsp exon 197647 197838 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103800-01.exon1 N/A Os01t0103800-01.exon1 N/A Os01t0103800-01.exon1 transcript:Os01t0103800-01 N/A 1 N/A
1 irgsp exon 198034 198225 . 1 . N/A N/A 1 N/A 0 -1 Os01t0103800-01.exon2 N/A Os01t0103800-01.exon2 N/A Os01t0103800-01.exon2 transcript:Os01t0103800-01 N/A 2 N/A
1 irgsp exon 198830 200036 . 1 . N/A N/A 1 N/A 1 0 Os01t0103800-01.exon3 N/A Os01t0103800-01.exon3 N/A Os01t0103800-01.exon3 transcript:Os01t0103800-01 N/A 3 N/A
1 irgsp exon 200253 200803 . 1 . N/A N/A 1 N/A -1 1 Os01t0103800-01.exon4 N/A Os01t0103800-01.exon4 N/A Os01t0103800-01.exon4 transcript:Os01t0103800-01 N/A 4 N/A
1 irgsp CDS 198130 198225 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103800-01 N/A N/A transcript:Os01t0103800-01 Os01t0103800-01 N/A N/A
1 irgsp CDS 198830 200036 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103800-01 N/A N/A transcript:Os01t0103800-01 Os01t0103800-01 N/A N/A
1 irgsp CDS 200253 200479 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103800-01 N/A N/A transcript:Os01t0103800-01 Os01t0103800-01 N/A N/A
1 irgsp five_prime_UTR 197647 197838 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-47 N/A N/A transcript:Os01t0103800-01 N/A N/A N/A
1 irgsp five_prime_UTR 198034 198129 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-48 N/A N/A transcript:Os01t0103800-01 N/A N/A N/A
1 irgsp three_prime_UTR 200480 200803 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-45 N/A N/A transcript:Os01t0103800-01 N/A N/A N/A
1 irgsp gene 201944 206202 . 1 . N/A protein_coding N/A Polynucleotidyl transferase, Ribonuclease H fold domain containing protein. (Os01t0103900-01) N/A N/A N/A Os01g0103900 gene:Os01g0103900 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 201944 206202 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103900-01 N/A N/A gene:Os01g0103900 N/A N/A Os01t0103900-01
1 irgsp exon 201944 202110 . 1 . N/A N/A 1 N/A 0 -1 Os01t0103900-01.exon1 N/A Os01t0103900-01.exon1 N/A Os01t0103900-01.exon1 transcript:Os01t0103900-01 N/A 1 N/A
1 irgsp exon 202252 202359 . 1 . N/A N/A 1 N/A 0 0 Os01t0103900-01.exon2 N/A Os01t0103900-01.exon2 N/A Os01t0103900-01.exon2 transcript:Os01t0103900-01 N/A 2 N/A
1 irgsp exon 203007 203127 . 1 . N/A N/A 1 N/A 1 0 Os01t0103900-01.exon3 N/A Os01t0103900-01.exon3 N/A Os01t0103900-01.exon3 transcript:Os01t0103900-01 N/A 3 N/A
1 irgsp exon 203302 203429 . 1 . N/A N/A 1 N/A 0 1 Os01t0103900-01.exon4 N/A Os01t0103900-01.exon4 N/A Os01t0103900-01.exon4 transcript:Os01t0103900-01 N/A 4 N/A
1 irgsp exon 203511 203658 . 1 . N/A N/A 1 N/A 1 0 Os01t0103900-01.exon5 N/A Os01t0103900-01.exon5 N/A Os01t0103900-01.exon5 transcript:Os01t0103900-01 N/A 5 N/A
1 irgsp exon 203760 203938 . 1 . N/A N/A 1 N/A 0 1 Os01t0103900-01.exon6 N/A Os01t0103900-01.exon6 N/A Os01t0103900-01.exon6 transcript:Os01t0103900-01 N/A 6 N/A
1 irgsp exon 204203 204440 . 1 . N/A N/A 1 N/A 1 0 Os01t0103900-01.exon7 N/A Os01t0103900-01.exon7 N/A Os01t0103900-01.exon7 transcript:Os01t0103900-01 N/A 7 N/A
1 irgsp exon 204543 204635 . 1 . N/A N/A 1 N/A 1 1 Os01t0103900-01.exon8 N/A Os01t0103900-01.exon8 N/A Os01t0103900-01.exon8 transcript:Os01t0103900-01 N/A 8 N/A
1 irgsp exon 204730 204875 . 1 . N/A N/A 1 N/A 0 1 Os01t0103900-01.exon9 N/A Os01t0103900-01.exon9 N/A Os01t0103900-01.exon9 transcript:Os01t0103900-01 N/A 9 N/A
1 irgsp exon 205042 205149 . 1 . N/A N/A 1 N/A 0 0 Os01t0103900-01.exon10 N/A Os01t0103900-01.exon10 N/A Os01t0103900-01.exon10 transcript:Os01t0103900-01 N/A 10 N/A
1 irgsp exon 205290 205378 . 1 . N/A N/A 1 N/A 2 0 Os01t0103900-01.exon11 N/A Os01t0103900-01.exon11 N/A Os01t0103900-01.exon11 transcript:Os01t0103900-01 N/A 11 N/A
1 irgsp exon 205534 206202 . 1 . N/A N/A 1 N/A -1 2 Os01t0103900-01.exon12 N/A Os01t0103900-01.exon12 N/A Os01t0103900-01.exon12 transcript:Os01t0103900-01 N/A 12 N/A
1 irgsp CDS 202042 202110 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 202252 202359 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 203007 203127 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 203302 203429 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 203511 203658 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 203760 203938 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 204203 204440 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 204543 204635 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 204730 204875 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 205042 205149 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 205290 205378 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp CDS 205534 205543 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
1 irgsp five_prime_UTR 201944 202041 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-49 N/A N/A transcript:Os01t0103900-01 N/A N/A N/A
1 irgsp three_prime_UTR 205544 206202 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-46 N/A N/A transcript:Os01t0103900-01 N/A N/A N/A
1 irgsp gene 206131 209606 . -1 . N/A protein_coding N/A C-type lectin domain containing protein. (Os01t0104000-01);Similar to predicted protein. (Os01t0104000-02) N/A N/A N/A Os01g0104000 gene:Os01g0104000 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 206131 209581 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104000-02 N/A N/A gene:Os01g0104000 N/A N/A Os01t0104000-02
1 irgsp exon 206131 207029 . -1 . N/A N/A 0 N/A -1 2 Os01t0104000-02.exon4 N/A Os01t0104000-02.exon4 N/A Os01t0104000-02.exon4 transcript:Os01t0104000-02 N/A 4 N/A
1 irgsp exon 207706 208273 . -1 . N/A N/A 0 N/A 2 1 Os01t0104000-02.exon3 N/A Os01t0104000-02.exon3 N/A Os01t0104000-02.exon3 transcript:Os01t0104000-02 N/A 3 N/A
1 irgsp exon 208408 208836 . -1 . N/A N/A 1 N/A 1 1 Os01t0104000-01.exon2 N/A Os01t0104000-01.exon2 N/A Os01t0104000-01.exon2 transcript:Os01t0104000-02 N/A 2 N/A
1 irgsp exon 209438 209581 . -1 . N/A N/A 0 N/A 1 -1 Os01t0104000-02.exon1 N/A Os01t0104000-02.exon1 N/A Os01t0104000-02.exon1 transcript:Os01t0104000-02 N/A 1 N/A
1 irgsp CDS 206450 207029 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-02 N/A N/A transcript:Os01t0104000-02 Os01t0104000-02 N/A N/A
1 irgsp CDS 207706 208273 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-02 N/A N/A transcript:Os01t0104000-02 Os01t0104000-02 N/A N/A
1 irgsp CDS 208408 208836 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-02 N/A N/A transcript:Os01t0104000-02 Os01t0104000-02 N/A N/A
1 irgsp CDS 209438 209525 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-02 N/A N/A transcript:Os01t0104000-02 Os01t0104000-02 N/A N/A
1 irgsp five_prime_UTR 209526 209581 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-50 N/A N/A transcript:Os01t0104000-02 N/A N/A N/A
1 irgsp three_prime_UTR 206131 206449 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-47 N/A N/A transcript:Os01t0104000-02 N/A N/A N/A
1 irgsp mRNA 206134 209606 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104000-01 N/A N/A gene:Os01g0104000 N/A N/A Os01t0104000-01
1 irgsp exon 206134 207029 . -1 . N/A N/A 0 N/A -1 2 Os01t0104000-01.exon4 N/A Os01t0104000-01.exon4 N/A Os01t0104000-01.exon4 transcript:Os01t0104000-01 N/A 4 N/A
1 irgsp exon 207706 208276 . -1 . N/A N/A 0 N/A 2 1 Os01t0104000-01.exon3 N/A Os01t0104000-01.exon3 N/A Os01t0104000-01.exon3 transcript:Os01t0104000-01 N/A 3 N/A
1 irgsp exon 208408 208836 . -1 . N/A N/A 1 N/A 1 1 Os01t0104000-01.exon2 N/A agat-exon-6 N/A Os01t0104000-01.exon2 transcript:Os01t0104000-01 N/A 2 N/A
1 irgsp exon 209438 209606 . -1 . N/A N/A 0 N/A 1 -1 Os01t0104000-01.exon1 N/A Os01t0104000-01.exon1 N/A Os01t0104000-01.exon1 transcript:Os01t0104000-01 N/A 1 N/A
1 irgsp CDS 206450 207029 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-01 N/A N/A transcript:Os01t0104000-01 Os01t0104000-01 N/A N/A
1 irgsp CDS 207706 208276 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-01 N/A N/A transcript:Os01t0104000-01 Os01t0104000-01 N/A N/A
1 irgsp CDS 208408 208836 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-01 N/A N/A transcript:Os01t0104000-01 Os01t0104000-01 N/A N/A
1 irgsp CDS 209438 209525 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-01 N/A N/A transcript:Os01t0104000-01 Os01t0104000-01 N/A N/A
1 irgsp five_prime_UTR 209526 209606 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-51 N/A N/A transcript:Os01t0104000-01 N/A N/A N/A
1 irgsp three_prime_UTR 206134 206449 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-48 N/A N/A transcript:Os01t0104000-01 N/A N/A N/A
1 irgsp gene 209771 214173 . 1 . N/A protein_coding N/A Similar to protein binding / zinc ion binding. (Os01t0104100-01);Similar to protein binding / zinc ion binding. (Os01t0104100-02) N/A N/A N/A Os01g0104100 gene:Os01g0104100 irgspv1.0-20170804-genes cold-inducible, cold-inducible zinc finger protein N/A N/A N/A N/A
1 irgsp mRNA 209771 214173 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104100-01 N/A N/A gene:Os01g0104100 N/A N/A Os01t0104100-01
1 irgsp exon 209771 209896 . 1 . N/A N/A 0 N/A 0 0 Os01t0104100-01.exon1 N/A Os01t0104100-01.exon1 N/A Os01t0104100-01.exon1 transcript:Os01t0104100-01 N/A 1 N/A
1 irgsp exon 210244 210563 . 1 . N/A N/A 1 N/A 2 0 Os01t0104100-01.exon2 N/A Os01t0104100-01.exon2 N/A Os01t0104100-01.exon2 transcript:Os01t0104100-01 N/A 2 N/A
1 irgsp exon 210659 210890 . 1 . N/A N/A 1 N/A 0 2 Os01t0104100-01.exon3 N/A Os01t0104100-01.exon3 N/A Os01t0104100-01.exon3 transcript:Os01t0104100-01 N/A 3 N/A
1 irgsp exon 211015 211160 . 1 . N/A N/A 1 N/A 2 0 Os01t0104100-01.exon4 N/A Os01t0104100-01.exon4 N/A Os01t0104100-01.exon4 transcript:Os01t0104100-01 N/A 4 N/A
1 irgsp exon 212265 212352 . 1 . N/A N/A 1 N/A 0 2 Os01t0104100-01.exon5 N/A Os01t0104100-01.exon5 N/A Os01t0104100-01.exon5 transcript:Os01t0104100-01 N/A 5 N/A
1 irgsp exon 212433 212579 . 1 . N/A N/A 1 N/A 0 0 Os01t0104100-01.exon6 N/A Os01t0104100-01.exon6 N/A Os01t0104100-01.exon6 transcript:Os01t0104100-01 N/A 6 N/A
1 irgsp exon 213490 213639 . 1 . N/A N/A 1 N/A 0 0 Os01t0104100-01.exon7 N/A Os01t0104100-01.exon7 N/A Os01t0104100-01.exon7 transcript:Os01t0104100-01 N/A 7 N/A
1 irgsp exon 213741 214173 . 1 . N/A N/A 0 N/A -1 0 Os01t0104100-01.exon8 N/A Os01t0104100-01.exon8 N/A Os01t0104100-01.exon8 transcript:Os01t0104100-01 N/A 8 N/A
1 irgsp CDS 209771 209896 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
1 irgsp CDS 210244 210563 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
1 irgsp CDS 210659 210890 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
1 irgsp CDS 211015 211160 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
1 irgsp CDS 212265 212352 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
1 irgsp CDS 212433 212579 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
1 irgsp CDS 213490 213639 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
1 irgsp CDS 213741 213788 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
1 irgsp three_prime_UTR 213789 214173 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-49 N/A N/A transcript:Os01t0104100-01 N/A N/A N/A
1 irgsp mRNA 209794 214147 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104100-02 N/A N/A gene:Os01g0104100 N/A N/A Os01t0104100-02
1 irgsp exon 209794 209896 . 1 . N/A N/A 0 N/A 0 -1 Os01t0104100-02.exon1 N/A Os01t0104100-02.exon1 N/A Os01t0104100-02.exon1 transcript:Os01t0104100-02 N/A 1 N/A
1 irgsp exon 210244 210563 . 1 . N/A N/A 1 N/A 2 0 Os01t0104100-01.exon2 N/A agat-exon-7 N/A Os01t0104100-01.exon2 transcript:Os01t0104100-02 N/A 2 N/A
1 irgsp exon 210659 210890 . 1 . N/A N/A 1 N/A 0 2 Os01t0104100-01.exon3 N/A agat-exon-8 N/A Os01t0104100-01.exon3 transcript:Os01t0104100-02 N/A 3 N/A
1 irgsp exon 211015 211160 . 1 . N/A N/A 1 N/A 2 0 Os01t0104100-01.exon4 N/A agat-exon-9 N/A Os01t0104100-01.exon4 transcript:Os01t0104100-02 N/A 4 N/A
1 irgsp exon 212265 212352 . 1 . N/A N/A 1 N/A 0 2 Os01t0104100-01.exon5 N/A agat-exon-10 N/A Os01t0104100-01.exon5 transcript:Os01t0104100-02 N/A 5 N/A
1 irgsp exon 212433 212579 . 1 . N/A N/A 1 N/A 0 0 Os01t0104100-01.exon6 N/A agat-exon-11 N/A Os01t0104100-01.exon6 transcript:Os01t0104100-02 N/A 6 N/A
1 irgsp exon 213490 213639 . 1 . N/A N/A 1 N/A 0 0 Os01t0104100-01.exon7 N/A agat-exon-12 N/A Os01t0104100-01.exon7 transcript:Os01t0104100-02 N/A 7 N/A
1 irgsp exon 213741 214147 . 1 . N/A N/A 0 N/A -1 0 Os01t0104100-02.exon8 N/A Os01t0104100-02.exon8 N/A Os01t0104100-02.exon8 transcript:Os01t0104100-02 N/A 8 N/A
1 irgsp CDS 209795 209896 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
1 irgsp CDS 210244 210563 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
1 irgsp CDS 210659 210890 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
1 irgsp CDS 211015 211160 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
1 irgsp CDS 212265 212352 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
1 irgsp CDS 212433 212579 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
1 irgsp CDS 213490 213639 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
1 irgsp CDS 213741 213788 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
1 irgsp five_prime_UTR 209794 209794 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-52 N/A N/A transcript:Os01t0104100-02 N/A N/A N/A
1 irgsp three_prime_UTR 213789 214147 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-50 N/A N/A transcript:Os01t0104100-02 N/A N/A N/A
1 irgsp gene 216212 217345 . 1 . N/A protein_coding N/A No apical meristem (NAM) protein domain containing protein. (Os01t0104200-00) N/A N/A N/A Os01g0104200 gene:Os01g0104200 irgspv1.0-20170804-genes NAC DOMAIN-CONTAINING PROTEIN 16 N/A N/A N/A N/A
1 irgsp mRNA 216212 217345 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104200-00 N/A N/A gene:Os01g0104200 N/A N/A Os01t0104200-00
1 irgsp exon 216212 216769 . 1 . N/A N/A 1 N/A 0 0 Os01t0104200-00.exon1 N/A Os01t0104200-00.exon1 N/A Os01t0104200-00.exon1 transcript:Os01t0104200-00 N/A 1 N/A
1 irgsp exon 216884 217345 . 1 . N/A N/A 1 N/A 0 0 Os01t0104200-00.exon2 N/A Os01t0104200-00.exon2 N/A Os01t0104200-00.exon2 transcript:Os01t0104200-00 N/A 2 N/A
1 irgsp CDS 216212 216769 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104200-00 N/A N/A transcript:Os01t0104200-00 Os01t0104200-00 N/A N/A
1 irgsp CDS 216884 217345 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104200-00 N/A N/A transcript:Os01t0104200-00 Os01t0104200-00 N/A N/A
1 irgsp gene 226897 229301 . 1 . N/A protein_coding N/A Ricin B-related lectin domain containing protein. (Os01t0104400-01);Ricin B-related lectin domain containing protein. (Os01t0104400-02);Ricin B-related lectin domain containing protein. (Os01t0104400-03) N/A N/A N/A Os01g0104400 gene:Os01g0104400 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 226897 229229 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104400-01 N/A N/A gene:Os01g0104400 N/A N/A Os01t0104400-01
1 irgsp exon 226897 227634 . 1 . N/A N/A 0 N/A 0 -1 Os01t0104400-01.exon1 N/A Os01t0104400-01.exon1 N/A Os01t0104400-01.exon1 transcript:Os01t0104400-01 N/A 1 N/A
1 irgsp exon 227742 227864 . 1 . N/A N/A 1 N/A 0 0 Os01t0104400-03.exon2 N/A Os01t0104400-03.exon2 N/A Os01t0104400-03.exon2 transcript:Os01t0104400-01 N/A 2 N/A
1 irgsp exon 228557 228785 . 1 . N/A N/A 1 N/A 1 0 Os01t0104400-03.exon3 N/A Os01t0104400-03.exon3 N/A Os01t0104400-03.exon3 transcript:Os01t0104400-01 N/A 3 N/A
1 irgsp exon 228930 229229 . 1 . N/A N/A 0 N/A -1 1 Os01t0104400-01.exon4 N/A Os01t0104400-01.exon4 N/A Os01t0104400-01.exon4 transcript:Os01t0104400-01 N/A 4 N/A
1 irgsp CDS 227182 227634 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-01 N/A N/A transcript:Os01t0104400-01 Os01t0104400-01 N/A N/A
1 irgsp CDS 227742 227864 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-01 N/A N/A transcript:Os01t0104400-01 Os01t0104400-01 N/A N/A
1 irgsp CDS 228557 228785 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-01 N/A N/A transcript:Os01t0104400-01 Os01t0104400-01 N/A N/A
1 irgsp CDS 228930 228931 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-01 N/A N/A transcript:Os01t0104400-01 Os01t0104400-01 N/A N/A
1 irgsp five_prime_UTR 226897 227181 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-53 N/A N/A transcript:Os01t0104400-01 N/A N/A N/A
1 irgsp three_prime_UTR 228932 229229 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-51 N/A N/A transcript:Os01t0104400-01 N/A N/A N/A
1 irgsp mRNA 227139 229301 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104400-02 N/A N/A gene:Os01g0104400 N/A N/A Os01t0104400-02
1 irgsp exon 227139 227634 . 1 . N/A N/A 0 N/A 0 -1 Os01t0104400-02.exon1 N/A Os01t0104400-02.exon1 N/A Os01t0104400-02.exon1 transcript:Os01t0104400-02 N/A 1 N/A
1 irgsp exon 227742 227864 . 1 . N/A N/A 1 N/A 0 0 Os01t0104400-03.exon2 N/A agat-exon-13 N/A Os01t0104400-03.exon2 transcript:Os01t0104400-02 N/A 2 N/A
1 irgsp exon 228557 228785 . 1 . N/A N/A 1 N/A 1 0 Os01t0104400-03.exon3 N/A agat-exon-14 N/A Os01t0104400-03.exon3 transcript:Os01t0104400-02 N/A 3 N/A
1 irgsp exon 228930 229301 . 1 . N/A N/A 0 N/A -1 1 Os01t0104400-02.exon4 N/A Os01t0104400-02.exon4 N/A Os01t0104400-02.exon4 transcript:Os01t0104400-02 N/A 4 N/A
1 irgsp CDS 227182 227634 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-02 N/A N/A transcript:Os01t0104400-02 Os01t0104400-02 N/A N/A
1 irgsp CDS 227742 227864 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-02 N/A N/A transcript:Os01t0104400-02 Os01t0104400-02 N/A N/A
1 irgsp CDS 228557 228785 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-02 N/A N/A transcript:Os01t0104400-02 Os01t0104400-02 N/A N/A
1 irgsp CDS 228930 228931 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-02 N/A N/A transcript:Os01t0104400-02 Os01t0104400-02 N/A N/A
1 irgsp five_prime_UTR 227139 227181 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-54 N/A N/A transcript:Os01t0104400-02 N/A N/A N/A
1 irgsp three_prime_UTR 228932 229301 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-52 N/A N/A transcript:Os01t0104400-02 N/A N/A N/A
1 irgsp mRNA 227179 229214 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104400-03 N/A N/A gene:Os01g0104400 N/A N/A Os01t0104400-03
1 irgsp exon 227179 227634 . 1 . N/A N/A 0 N/A 0 -1 Os01t0104400-03.exon1 N/A Os01t0104400-03.exon1 N/A Os01t0104400-03.exon1 transcript:Os01t0104400-03 N/A 1 N/A
1 irgsp exon 227742 227864 . 1 . N/A N/A 1 N/A 0 0 Os01t0104400-03.exon2 N/A agat-exon-15 N/A Os01t0104400-03.exon2 transcript:Os01t0104400-03 N/A 2 N/A
1 irgsp exon 228557 228785 . 1 . N/A N/A 1 N/A 1 0 Os01t0104400-03.exon3 N/A agat-exon-16 N/A Os01t0104400-03.exon3 transcript:Os01t0104400-03 N/A 3 N/A
1 irgsp exon 228930 229214 . 1 . N/A N/A 0 N/A -1 1 Os01t0104400-03.exon4 N/A Os01t0104400-03.exon4 N/A Os01t0104400-03.exon4 transcript:Os01t0104400-03 N/A 4 N/A
1 irgsp CDS 227182 227634 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-03 N/A N/A transcript:Os01t0104400-03 Os01t0104400-03 N/A N/A
1 irgsp CDS 227742 227864 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-03 N/A N/A transcript:Os01t0104400-03 Os01t0104400-03 N/A N/A
1 irgsp CDS 228557 228785 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-03 N/A N/A transcript:Os01t0104400-03 Os01t0104400-03 N/A N/A
1 irgsp CDS 228930 228931 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-03 N/A N/A transcript:Os01t0104400-03 Os01t0104400-03 N/A N/A
1 irgsp five_prime_UTR 227179 227181 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-55 N/A N/A transcript:Os01t0104400-03 N/A N/A N/A
1 irgsp three_prime_UTR 228932 229214 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-53 N/A N/A transcript:Os01t0104400-03 N/A N/A N/A
1 irgsp gene 241680 243440 . 1 . N/A protein_coding N/A No apical meristem (NAM) protein domain containing protein. (Os01t0104500-01) N/A N/A N/A Os01g0104500 gene:Os01g0104500 irgspv1.0-20170804-genes NAC DOMAIN-CONTAINING PROTEIN 20 N/A N/A N/A N/A
1 irgsp mRNA 241680 243440 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104500-01 N/A N/A gene:Os01g0104500 N/A N/A Os01t0104500-01
1 irgsp exon 241680 241702 . 1 . N/A N/A 1 N/A -1 -1 Os01t0104500-01.exon1 N/A Os01t0104500-01.exon1 N/A Os01t0104500-01.exon1 transcript:Os01t0104500-01 N/A 1 N/A
1 irgsp exon 241866 242091 . 1 . N/A N/A 1 N/A 1 -1 Os01t0104500-01.exon2 N/A Os01t0104500-01.exon2 N/A Os01t0104500-01.exon2 transcript:Os01t0104500-01 N/A 2 N/A
1 irgsp exon 242199 243440 . 1 . N/A N/A 1 N/A -1 1 Os01t0104500-01.exon3 N/A Os01t0104500-01.exon3 N/A Os01t0104500-01.exon3 transcript:Os01t0104500-01 N/A 3 N/A
1 irgsp CDS 241908 242091 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104500-01 N/A N/A transcript:Os01t0104500-01 Os01t0104500-01 N/A N/A
1 irgsp CDS 242199 242977 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104500-01 N/A N/A transcript:Os01t0104500-01 Os01t0104500-01 N/A N/A
1 irgsp five_prime_UTR 241680 241702 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-56 N/A N/A transcript:Os01t0104500-01 N/A N/A N/A
1 irgsp five_prime_UTR 241866 241907 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-57 N/A N/A transcript:Os01t0104500-01 N/A N/A N/A
1 irgsp three_prime_UTR 242978 243440 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-54 N/A N/A transcript:Os01t0104500-01 N/A N/A N/A
1 irgsp gene 248828 256872 . -1 . N/A protein_coding N/A Homolog of Arabidopsis DE-ETIOLATED1 (DET1), Modulation of the ABA signaling pathway and ABA biosynthesis, Regulation of chlorophyll content (Os01t0104600-01);Similar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). (Os01t0104600-02) N/A N/A N/A Os01g0104600 gene:Os01g0104600 irgspv1.0-20170804-genes DE-ETIOLATED1 N/A N/A N/A N/A
1 irgsp mRNA 248828 256571 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104600-02 N/A N/A gene:Os01g0104600 N/A N/A Os01t0104600-02
1 irgsp exon 248828 249107 . -1 . N/A N/A 1 N/A -1 1 Os01t0104600-01.exon11 N/A Os01t0104600-01.exon11 N/A Os01t0104600-01.exon11 transcript:Os01t0104600-02 N/A 11 N/A
1 irgsp exon 249369 249468 . -1 . N/A N/A 1 N/A 1 0 Os01t0104600-01.exon10 N/A Os01t0104600-01.exon10 N/A Os01t0104600-01.exon10 transcript:Os01t0104600-02 N/A 10 N/A
1 irgsp exon 249861 249956 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon9 N/A Os01t0104600-01.exon9 N/A Os01t0104600-01.exon9 transcript:Os01t0104600-02 N/A 9 N/A
1 irgsp exon 250617 250781 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon8 N/A Os01t0104600-01.exon8 N/A Os01t0104600-01.exon8 transcript:Os01t0104600-02 N/A 8 N/A
1 irgsp exon 250860 250940 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon7 N/A Os01t0104600-01.exon7 N/A Os01t0104600-01.exon7 transcript:Os01t0104600-02 N/A 7 N/A
1 irgsp exon 251026 251082 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon6 N/A Os01t0104600-01.exon6 N/A Os01t0104600-01.exon6 transcript:Os01t0104600-02 N/A 6 N/A
1 irgsp exon 251316 251384 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon5 N/A Os01t0104600-01.exon5 N/A Os01t0104600-01.exon5 transcript:Os01t0104600-02 N/A 5 N/A
1 irgsp exon 251695 251790 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon4 N/A Os01t0104600-01.exon4 N/A Os01t0104600-01.exon4 transcript:Os01t0104600-02 N/A 4 N/A
1 irgsp exon 255325 255553 . -1 . N/A N/A 1 N/A 0 2 Os01t0104600-01.exon3 N/A Os01t0104600-01.exon3 N/A Os01t0104600-01.exon3 transcript:Os01t0104600-02 N/A 3 N/A
1 irgsp exon 255674 256098 . -1 . N/A N/A 1 N/A 2 0 Os01t0104600-01.exon2 N/A Os01t0104600-01.exon2 N/A Os01t0104600-01.exon2 transcript:Os01t0104600-02 N/A 2 N/A
1 irgsp exon 256361 256571 . -1 . N/A N/A 0 N/A 0 -1 Os01t0104600-02.exon1 N/A Os01t0104600-02.exon1 N/A Os01t0104600-02.exon1 transcript:Os01t0104600-02 N/A 1 N/A
1 irgsp CDS 248971 249107 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 249369 249468 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 249861 249956 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 250617 250781 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 250860 250940 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 251026 251082 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 251316 251384 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 251695 251790 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 255325 255553 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 255674 256098 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp CDS 256361 256441 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
1 irgsp five_prime_UTR 256442 256571 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-58 N/A N/A transcript:Os01t0104600-02 N/A N/A N/A
1 irgsp three_prime_UTR 248828 248970 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-55 N/A N/A transcript:Os01t0104600-02 N/A N/A N/A
1 irgsp mRNA 248828 256872 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104600-01 N/A N/A gene:Os01g0104600 N/A N/A Os01t0104600-01
1 irgsp exon 248828 249107 . -1 . N/A N/A 1 N/A -1 1 Os01t0104600-01.exon11 N/A agat-exon-17 N/A Os01t0104600-01.exon11 transcript:Os01t0104600-01 N/A 11 N/A
1 irgsp exon 249369 249468 . -1 . N/A N/A 1 N/A 1 0 Os01t0104600-01.exon10 N/A agat-exon-18 N/A Os01t0104600-01.exon10 transcript:Os01t0104600-01 N/A 10 N/A
1 irgsp exon 249861 249956 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon9 N/A agat-exon-19 N/A Os01t0104600-01.exon9 transcript:Os01t0104600-01 N/A 9 N/A
1 irgsp exon 250617 250781 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon8 N/A agat-exon-20 N/A Os01t0104600-01.exon8 transcript:Os01t0104600-01 N/A 8 N/A
1 irgsp exon 250860 250940 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon7 N/A agat-exon-21 N/A Os01t0104600-01.exon7 transcript:Os01t0104600-01 N/A 7 N/A
1 irgsp exon 251026 251082 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon6 N/A agat-exon-22 N/A Os01t0104600-01.exon6 transcript:Os01t0104600-01 N/A 6 N/A
1 irgsp exon 251316 251384 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon5 N/A agat-exon-23 N/A Os01t0104600-01.exon5 transcript:Os01t0104600-01 N/A 5 N/A
1 irgsp exon 251695 251790 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon4 N/A agat-exon-24 N/A Os01t0104600-01.exon4 transcript:Os01t0104600-01 N/A 4 N/A
1 irgsp exon 255325 255553 . -1 . N/A N/A 1 N/A 0 2 Os01t0104600-01.exon3 N/A agat-exon-25 N/A Os01t0104600-01.exon3 transcript:Os01t0104600-01 N/A 3 N/A
1 irgsp exon 255674 256098 . -1 . N/A N/A 1 N/A 2 0 Os01t0104600-01.exon2 N/A agat-exon-26 N/A Os01t0104600-01.exon2 transcript:Os01t0104600-01 N/A 2 N/A
1 irgsp exon 256361 256872 . -1 . N/A N/A 0 N/A 0 -1 Os01t0104600-01.exon1 N/A Os01t0104600-01.exon1 N/A Os01t0104600-01.exon1 transcript:Os01t0104600-01 N/A 1 N/A
1 irgsp CDS 248971 249107 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 249369 249468 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 249861 249956 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 250617 250781 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 250860 250940 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 251026 251082 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 251316 251384 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 251695 251790 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 255325 255553 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 255674 256098 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp CDS 256361 256441 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
1 irgsp five_prime_UTR 256442 256872 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-59 N/A N/A transcript:Os01t0104600-01 N/A N/A N/A
1 irgsp three_prime_UTR 248828 248970 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-56 N/A N/A transcript:Os01t0104600-01 N/A N/A N/A
1 irgsp gene 261530 268145 . 1 . N/A protein_coding N/A Sas10/Utp3 family protein. (Os01t0104800-01);Hypothetical conserved gene. (Os01t0104800-02) N/A N/A N/A Os01g0104800 gene:Os01g0104800 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 261530 268145 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104800-01 N/A N/A gene:Os01g0104800 N/A N/A Os01t0104800-01
1 irgsp exon 261530 261661 . 1 . N/A N/A 0 N/A 1 -1 Os01t0104800-01.exon1 N/A Os01t0104800-01.exon1 N/A Os01t0104800-01.exon1 transcript:Os01t0104800-01 N/A 1 N/A
1 irgsp exon 261767 261805 . 1 . N/A N/A 0 N/A 1 1 Os01t0104800-01.exon2 N/A Os01t0104800-01.exon2 N/A Os01t0104800-01.exon2 transcript:Os01t0104800-01 N/A 2 N/A
1 irgsp exon 261895 261941 . 1 . N/A N/A 0 N/A 0 1 Os01t0104800-01.exon3 N/A Os01t0104800-01.exon3 N/A Os01t0104800-01.exon3 transcript:Os01t0104800-01 N/A 3 N/A
1 irgsp exon 262582 262681 . 1 . N/A N/A 0 N/A 1 0 Os01t0104800-01.exon4 N/A Os01t0104800-01.exon4 N/A Os01t0104800-01.exon4 transcript:Os01t0104800-01 N/A 4 N/A
1 irgsp exon 262925 263181 . 1 . N/A N/A 0 N/A 0 1 Os01t0104800-01.exon5 N/A Os01t0104800-01.exon5 N/A Os01t0104800-01.exon5 transcript:Os01t0104800-01 N/A 5 N/A
1 irgsp exon 263525 263640 . 1 . N/A N/A 0 N/A 2 0 Os01t0104800-01.exon6 N/A Os01t0104800-01.exon6 N/A Os01t0104800-01.exon6 transcript:Os01t0104800-01 N/A 6 N/A
1 irgsp exon 264014 264098 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon7 N/A Os01t0104800-01.exon7 N/A Os01t0104800-01.exon7 transcript:Os01t0104800-01 N/A 7 N/A
1 irgsp exon 265236 265415 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon8 N/A Os01t0104800-01.exon8 N/A Os01t0104800-01.exon8 transcript:Os01t0104800-01 N/A 8 N/A
1 irgsp exon 265506 265649 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon9 N/A Os01t0104800-01.exon9 N/A Os01t0104800-01.exon9 transcript:Os01t0104800-01 N/A 9 N/A
1 irgsp exon 265740 265817 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon10 N/A Os01t0104800-01.exon10 N/A Os01t0104800-01.exon10 transcript:Os01t0104800-01 N/A 10 N/A
1 irgsp exon 265909 266045 . 1 . N/A N/A 1 N/A 2 0 Os01t0104800-01.exon11 N/A Os01t0104800-01.exon11 N/A Os01t0104800-01.exon11 transcript:Os01t0104800-01 N/A 11 N/A
1 irgsp exon 266138 266246 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon12 N/A Os01t0104800-01.exon12 N/A Os01t0104800-01.exon12 transcript:Os01t0104800-01 N/A 12 N/A
1 irgsp exon 267237 267514 . 1 . N/A N/A 1 N/A 2 0 Os01t0104800-01.exon13 N/A Os01t0104800-01.exon13 N/A Os01t0104800-01.exon13 transcript:Os01t0104800-01 N/A 13 N/A
1 irgsp exon 267591 267657 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon14 N/A Os01t0104800-01.exon14 N/A Os01t0104800-01.exon14 transcript:Os01t0104800-01 N/A 14 N/A
1 irgsp exon 267734 267802 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon15 N/A Os01t0104800-01.exon15 N/A Os01t0104800-01.exon15 transcript:Os01t0104800-01 N/A 15 N/A
1 irgsp exon 267880 268145 . 1 . N/A N/A 0 N/A -1 0 Os01t0104800-01.exon16 N/A Os01t0104800-01.exon16 N/A Os01t0104800-01.exon16 transcript:Os01t0104800-01 N/A 16 N/A
1 irgsp CDS 261562 261661 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 261767 261805 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 261895 261941 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 262582 262681 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 262925 263181 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 263525 263640 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 264014 264098 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 265236 265415 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 265506 265649 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 265740 265817 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 265909 266045 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 266138 266246 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 267237 267514 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 267591 267657 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 267734 267802 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp CDS 267880 268011 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
1 irgsp five_prime_UTR 261530 261561 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-60 N/A N/A transcript:Os01t0104800-01 N/A N/A N/A
1 irgsp three_prime_UTR 268012 268145 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-57 N/A N/A transcript:Os01t0104800-01 N/A N/A N/A
1 irgsp mRNA 263523 268120 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104800-02 N/A N/A gene:Os01g0104800 N/A N/A Os01t0104800-02
1 irgsp exon 263523 263640 . 1 . N/A N/A 0 N/A 2 -1 Os01t0104800-02.exon1 N/A Os01t0104800-02.exon1 N/A Os01t0104800-02.exon1 transcript:Os01t0104800-02 N/A 1 N/A
1 irgsp exon 264014 264098 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon7 N/A agat-exon-27 N/A Os01t0104800-01.exon7 transcript:Os01t0104800-02 N/A 2 N/A
1 irgsp exon 265236 265415 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon8 N/A agat-exon-28 N/A Os01t0104800-01.exon8 transcript:Os01t0104800-02 N/A 3 N/A
1 irgsp exon 265506 265649 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon9 N/A agat-exon-29 N/A Os01t0104800-01.exon9 transcript:Os01t0104800-02 N/A 4 N/A
1 irgsp exon 265740 265817 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon10 N/A agat-exon-30 N/A Os01t0104800-01.exon10 transcript:Os01t0104800-02 N/A 5 N/A
1 irgsp exon 265909 266045 . 1 . N/A N/A 1 N/A 2 0 Os01t0104800-01.exon11 N/A agat-exon-31 N/A Os01t0104800-01.exon11 transcript:Os01t0104800-02 N/A 6 N/A
1 irgsp exon 266138 266246 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon12 N/A agat-exon-32 N/A Os01t0104800-01.exon12 transcript:Os01t0104800-02 N/A 7 N/A
1 irgsp exon 267237 267514 . 1 . N/A N/A 1 N/A 2 0 Os01t0104800-01.exon13 N/A agat-exon-33 N/A Os01t0104800-01.exon13 transcript:Os01t0104800-02 N/A 8 N/A
1 irgsp exon 267591 267657 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon14 N/A agat-exon-34 N/A Os01t0104800-01.exon14 transcript:Os01t0104800-02 N/A 9 N/A
1 irgsp exon 267734 267802 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon15 N/A agat-exon-35 N/A Os01t0104800-01.exon15 transcript:Os01t0104800-02 N/A 10 N/A
1 irgsp exon 267880 268120 . 1 . N/A N/A 0 N/A -1 0 Os01t0104800-02.exon11 N/A Os01t0104800-02.exon11 N/A Os01t0104800-02.exon11 transcript:Os01t0104800-02 N/A 11 N/A
1 irgsp CDS 263525 263640 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 264014 264098 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 265236 265415 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 265506 265649 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 265740 265817 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 265909 266045 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 266138 266246 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 267237 267514 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 267591 267657 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 267734 267802 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp CDS 267880 268011 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
1 irgsp five_prime_UTR 263523 263524 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-61 N/A N/A transcript:Os01t0104800-02 N/A N/A N/A
1 irgsp three_prime_UTR 268012 268120 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-58 N/A N/A transcript:Os01t0104800-02 N/A N/A N/A
1 irgsp gene 270179 275084 . -1 . N/A protein_coding N/A Transferase family protein. (Os01t0104900-01);Hypothetical conserved gene. (Os01t0104900-02) N/A N/A N/A Os01g0104900 gene:Os01g0104900 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 270179 275084 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104900-01 N/A N/A gene:Os01g0104900 N/A N/A Os01t0104900-01
1 irgsp exon 270179 271333 . -1 . N/A N/A 0 N/A -1 0 Os01t0104900-01.exon2 N/A Os01t0104900-01.exon2 N/A Os01t0104900-01.exon2 transcript:Os01t0104900-01 N/A 2 N/A
1 irgsp exon 274529 275084 . -1 . N/A N/A 0 N/A 0 -1 Os01t0104900-01.exon1 N/A Os01t0104900-01.exon1 N/A Os01t0104900-01.exon1 transcript:Os01t0104900-01 N/A 1 N/A
1 irgsp CDS 270356 271333 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104900-01 N/A N/A transcript:Os01t0104900-01 Os01t0104900-01 N/A N/A
1 irgsp CDS 274529 274957 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104900-01 N/A N/A transcript:Os01t0104900-01 Os01t0104900-01 N/A N/A
1 irgsp five_prime_UTR 274958 275084 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-62 N/A N/A transcript:Os01t0104900-01 N/A N/A N/A
1 irgsp three_prime_UTR 270179 270355 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-59 N/A N/A transcript:Os01t0104900-01 N/A N/A N/A
1 irgsp mRNA 270250 271518 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104900-02 N/A N/A gene:Os01g0104900 N/A N/A Os01t0104900-02
1 irgsp exon 270250 271333 . -1 . N/A N/A 0 N/A -1 -1 Os01t0104900-02.exon2 N/A Os01t0104900-02.exon2 N/A Os01t0104900-02.exon2 transcript:Os01t0104900-02 N/A 2 N/A
1 irgsp exon 271457 271518 . -1 . N/A N/A 0 N/A -1 -1 Os01t0104900-02.exon1 N/A Os01t0104900-02.exon1 N/A Os01t0104900-02.exon1 transcript:Os01t0104900-02 N/A 1 N/A
1 irgsp CDS 270356 271309 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104900-02 N/A N/A transcript:Os01t0104900-02 Os01t0104900-02 N/A N/A
1 irgsp five_prime_UTR 271310 271333 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-63 N/A N/A transcript:Os01t0104900-02 N/A N/A N/A
1 irgsp five_prime_UTR 271457 271518 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-64 N/A N/A transcript:Os01t0104900-02 N/A N/A N/A
1 irgsp three_prime_UTR 270250 270355 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-60 N/A N/A transcript:Os01t0104900-02 N/A N/A N/A
1 irgsp gene 284762 291892 . -1 . N/A protein_coding N/A Similar to HAT family dimerisation domain containing protein, expressed. (Os01t0105300-01) N/A N/A N/A Os01g0105300 gene:Os01g0105300 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 284762 291892 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105300-01 N/A N/A gene:Os01g0105300 N/A N/A Os01t0105300-01
1 irgsp exon 284762 287047 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon5 N/A Os01t0105300-01.exon5 N/A Os01t0105300-01.exon5 transcript:Os01t0105300-01 N/A 5 N/A
1 irgsp exon 291398 291436 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon4 N/A Os01t0105300-01.exon4 N/A Os01t0105300-01.exon4 transcript:Os01t0105300-01 N/A 4 N/A
1 irgsp exon 291520 291534 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon3 N/A Os01t0105300-01.exon3 N/A Os01t0105300-01.exon3 transcript:Os01t0105300-01 N/A 3 N/A
1 irgsp exon 291678 291738 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon2 N/A Os01t0105300-01.exon2 N/A Os01t0105300-01.exon2 transcript:Os01t0105300-01 N/A 2 N/A
1 irgsp exon 291838 291892 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon1 N/A Os01t0105300-01.exon1 N/A Os01t0105300-01.exon1 transcript:Os01t0105300-01 N/A 1 N/A
1 irgsp CDS 284931 285020 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105300-01 N/A N/A transcript:Os01t0105300-01 Os01t0105300-01 N/A N/A
1 irgsp five_prime_UTR 285021 287047 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-65 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
1 irgsp five_prime_UTR 291398 291436 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-66 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
1 irgsp five_prime_UTR 291520 291534 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-67 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
1 irgsp five_prime_UTR 291678 291738 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-68 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
1 irgsp five_prime_UTR 291838 291892 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-69 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
1 irgsp three_prime_UTR 284762 284930 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-61 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
1 irgsp gene 288372 292296 . 1 . N/A protein_coding N/A Similar to Kinesin heavy chain. (Os01t0105400-01) N/A N/A N/A Os01g0105400 gene:Os01g0105400 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 288372 292296 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105400-01 N/A N/A gene:Os01g0105400 N/A N/A Os01t0105400-01
1 irgsp exon 288372 288846 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon1 N/A Os01t0105400-01.exon1 N/A Os01t0105400-01.exon1 transcript:Os01t0105400-01 N/A 1 N/A
1 irgsp exon 288950 289116 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon2 N/A Os01t0105400-01.exon2 N/A Os01t0105400-01.exon2 transcript:Os01t0105400-01 N/A 2 N/A
1 irgsp exon 289202 289572 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon3 N/A Os01t0105400-01.exon3 N/A Os01t0105400-01.exon3 transcript:Os01t0105400-01 N/A 3 N/A
1 irgsp exon 289661 289830 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon4 N/A Os01t0105400-01.exon4 N/A Os01t0105400-01.exon4 transcript:Os01t0105400-01 N/A 4 N/A
1 irgsp exon 290395 290512 . 1 . N/A N/A 1 N/A 2 -1 Os01t0105400-01.exon5 N/A Os01t0105400-01.exon5 N/A Os01t0105400-01.exon5 transcript:Os01t0105400-01 N/A 5 N/A
1 irgsp exon 291372 291574 . 1 . N/A N/A 1 N/A -1 2 Os01t0105400-01.exon6 N/A Os01t0105400-01.exon6 N/A Os01t0105400-01.exon6 transcript:Os01t0105400-01 N/A 6 N/A
1 irgsp exon 291648 291779 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon7 N/A Os01t0105400-01.exon7 N/A Os01t0105400-01.exon7 transcript:Os01t0105400-01 N/A 7 N/A
1 irgsp exon 291859 291948 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon8 N/A Os01t0105400-01.exon8 N/A Os01t0105400-01.exon8 transcript:Os01t0105400-01 N/A 8 N/A
1 irgsp exon 292073 292296 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon9 N/A Os01t0105400-01.exon9 N/A Os01t0105400-01.exon9 transcript:Os01t0105400-01 N/A 9 N/A
1 irgsp CDS 290433 290512 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105400-01 N/A N/A transcript:Os01t0105400-01 Os01t0105400-01 N/A N/A
1 irgsp CDS 291372 291558 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105400-01 N/A N/A transcript:Os01t0105400-01 Os01t0105400-01 N/A N/A
1 irgsp five_prime_UTR 288372 288846 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-70 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
1 irgsp five_prime_UTR 288950 289116 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-71 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
1 irgsp five_prime_UTR 289202 289572 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-72 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
1 irgsp five_prime_UTR 289661 289830 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-73 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
1 irgsp five_prime_UTR 290395 290432 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-74 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
1 irgsp three_prime_UTR 291559 291574 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-62 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
1 irgsp three_prime_UTR 291648 291779 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-63 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
1 irgsp three_prime_UTR 291859 291948 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-64 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
1 irgsp three_prime_UTR 292073 292296 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-65 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
1 irgsp gene 303233 306736 . 1 . N/A protein_coding N/A Basic helix-loop-helix dimerisation region bHLH domain containing protein. (Os01t0105700-01) N/A N/A N/A Os01g0105700 gene:Os01g0105700 irgspv1.0-20170804-genes basic helix-loop-helix protein 071 N/A N/A N/A N/A
1 irgsp mRNA 303233 306736 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105700-01 N/A N/A gene:Os01g0105700 N/A N/A Os01t0105700-01
1 irgsp exon 303233 303471 . 1 . N/A N/A 1 N/A 2 -1 Os01t0105700-01.exon1 N/A Os01t0105700-01.exon1 N/A Os01t0105700-01.exon1 transcript:Os01t0105700-01 N/A 1 N/A
1 irgsp exon 303981 304509 . 1 . N/A N/A 1 N/A 0 2 Os01t0105700-01.exon2 N/A Os01t0105700-01.exon2 N/A Os01t0105700-01.exon2 transcript:Os01t0105700-01 N/A 2 N/A
1 irgsp exon 305572 305718 . 1 . N/A N/A 1 N/A 0 0 Os01t0105700-01.exon3 N/A Os01t0105700-01.exon3 N/A Os01t0105700-01.exon3 transcript:Os01t0105700-01 N/A 3 N/A
1 irgsp exon 305834 305899 . 1 . N/A N/A 1 N/A 0 0 Os01t0105700-01.exon4 N/A Os01t0105700-01.exon4 N/A Os01t0105700-01.exon4 transcript:Os01t0105700-01 N/A 4 N/A
1 irgsp exon 305993 306058 . 1 . N/A N/A 1 N/A 0 0 Os01t0105700-01.exon5 N/A Os01t0105700-01.exon5 N/A Os01t0105700-01.exon5 transcript:Os01t0105700-01 N/A 5 N/A
1 irgsp exon 306171 306245 . 1 . N/A N/A 1 N/A 0 0 Os01t0105700-01.exon6 N/A Os01t0105700-01.exon6 N/A Os01t0105700-01.exon6 transcript:Os01t0105700-01 N/A 6 N/A
1 irgsp exon 306353 306736 . 1 . N/A N/A 1 N/A -1 0 Os01t0105700-01.exon7 N/A Os01t0105700-01.exon7 N/A Os01t0105700-01.exon7 transcript:Os01t0105700-01 N/A 7 N/A
1 irgsp CDS 303329 303471 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
1 irgsp CDS 303981 304509 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
1 irgsp CDS 305572 305718 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
1 irgsp CDS 305834 305899 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
1 irgsp CDS 305993 306058 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
1 irgsp CDS 306171 306245 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
1 irgsp CDS 306353 306493 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
1 irgsp five_prime_UTR 303233 303328 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-75 N/A N/A transcript:Os01t0105700-01 N/A N/A N/A
1 irgsp three_prime_UTR 306494 306736 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-66 N/A N/A transcript:Os01t0105700-01 N/A N/A N/A
1 irgsp gene 306871 308842 . -1 . N/A protein_coding N/A Similar to Iron sulfur assembly protein 1. (Os01t0105800-01) N/A N/A N/A Os01g0105800 gene:Os01g0105800 irgspv1.0-20170804-genes IRON-SULFUR CLUSTER PROTEIN 9 N/A N/A N/A N/A
1 irgsp mRNA 306871 308842 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105800-01 N/A N/A gene:Os01g0105800 N/A N/A Os01t0105800-01
1 irgsp exon 306871 307217 . -1 . N/A N/A 1 N/A -1 2 Os01t0105800-01.exon4 N/A Os01t0105800-01.exon4 N/A Os01t0105800-01.exon4 transcript:Os01t0105800-01 N/A 4 N/A
1 irgsp exon 307296 307413 . -1 . N/A N/A 1 N/A 2 1 Os01t0105800-01.exon3 N/A Os01t0105800-01.exon3 N/A Os01t0105800-01.exon3 transcript:Os01t0105800-01 N/A 3 N/A
1 irgsp exon 308397 308626 . -1 . N/A N/A 1 N/A 1 -1 Os01t0105800-01.exon2 N/A Os01t0105800-01.exon2 N/A Os01t0105800-01.exon2 transcript:Os01t0105800-01 N/A 2 N/A
1 irgsp exon 308703 308842 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105800-01.exon1 N/A Os01t0105800-01.exon1 N/A Os01t0105800-01.exon1 transcript:Os01t0105800-01 N/A 1 N/A
1 irgsp CDS 307124 307217 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105800-01 N/A N/A transcript:Os01t0105800-01 Os01t0105800-01 N/A N/A
1 irgsp CDS 307296 307413 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105800-01 N/A N/A transcript:Os01t0105800-01 Os01t0105800-01 N/A N/A
1 irgsp CDS 308397 308601 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105800-01 N/A N/A transcript:Os01t0105800-01 Os01t0105800-01 N/A N/A
1 irgsp five_prime_UTR 308602 308626 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-76 N/A N/A transcript:Os01t0105800-01 N/A N/A N/A
1 irgsp five_prime_UTR 308703 308842 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-77 N/A N/A transcript:Os01t0105800-01 N/A N/A N/A
1 irgsp three_prime_UTR 306871 307123 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-67 N/A N/A transcript:Os01t0105800-01 N/A N/A N/A
1 irgsp gene 309520 313170 . -1 . N/A protein_coding N/A Carbohydrate/purine kinase domain containing protein. (Os01t0105900-01) N/A N/A N/A Os01g0105900 gene:Os01g0105900 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 309520 313170 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105900-01 N/A N/A gene:Os01g0105900 N/A N/A Os01t0105900-01
1 irgsp exon 309520 310070 . -1 . N/A N/A 1 N/A -1 0 Os01t0105900-01.exon8 N/A Os01t0105900-01.exon8 N/A Os01t0105900-01.exon8 transcript:Os01t0105900-01 N/A 8 N/A
1 irgsp exon 310256 310367 . -1 . N/A N/A 1 N/A 0 2 Os01t0105900-01.exon7 N/A Os01t0105900-01.exon7 N/A Os01t0105900-01.exon7 transcript:Os01t0105900-01 N/A 7 N/A
1 irgsp exon 310455 310552 . -1 . N/A N/A 1 N/A 2 0 Os01t0105900-01.exon6 N/A Os01t0105900-01.exon6 N/A Os01t0105900-01.exon6 transcript:Os01t0105900-01 N/A 6 N/A
1 irgsp exon 310632 310739 . -1 . N/A N/A 1 N/A 0 0 Os01t0105900-01.exon5 N/A Os01t0105900-01.exon5 N/A Os01t0105900-01.exon5 transcript:Os01t0105900-01 N/A 5 N/A
1 irgsp exon 310880 310918 . -1 . N/A N/A 1 N/A 0 0 Os01t0105900-01.exon4 N/A Os01t0105900-01.exon4 N/A Os01t0105900-01.exon4 transcript:Os01t0105900-01 N/A 4 N/A
1 irgsp exon 311002 311073 . -1 . N/A N/A 1 N/A 0 0 Os01t0105900-01.exon3 N/A Os01t0105900-01.exon3 N/A Os01t0105900-01.exon3 transcript:Os01t0105900-01 N/A 3 N/A
1 irgsp exon 311163 311426 . -1 . N/A N/A 1 N/A 0 0 Os01t0105900-01.exon2 N/A Os01t0105900-01.exon2 N/A Os01t0105900-01.exon2 transcript:Os01t0105900-01 N/A 2 N/A
1 irgsp exon 312867 313170 . -1 . N/A N/A 1 N/A 0 -1 Os01t0105900-01.exon1 N/A Os01t0105900-01.exon1 N/A Os01t0105900-01.exon1 transcript:Os01t0105900-01 N/A 1 N/A
1 irgsp CDS 309822 310070 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
1 irgsp CDS 310256 310367 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
1 irgsp CDS 310455 310552 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
1 irgsp CDS 310632 310739 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
1 irgsp CDS 310880 310918 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
1 irgsp CDS 311002 311073 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
1 irgsp CDS 311163 311426 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
1 irgsp CDS 312867 313064 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
1 irgsp five_prime_UTR 313065 313170 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-78 N/A N/A transcript:Os01t0105900-01 N/A N/A N/A
1 irgsp three_prime_UTR 309520 309821 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-68 N/A N/A transcript:Os01t0105900-01 N/A N/A N/A
1 irgsp gene 319754 322205 . 1 . N/A protein_coding N/A Similar to RER1A protein (AtRER1A). (Os01t0106200-01) N/A N/A N/A Os01g0106200 gene:Os01g0106200 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 319754 322205 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0106200-01 N/A N/A gene:Os01g0106200 N/A N/A Os01t0106200-01
1 irgsp exon 319754 320236 . 1 . N/A N/A 1 N/A 2 -1 Os01t0106200-01.exon1 N/A Os01t0106200-01.exon1 N/A Os01t0106200-01.exon1 transcript:Os01t0106200-01 N/A 1 N/A
1 irgsp exon 321468 321648 . 1 . N/A N/A 1 N/A 0 2 Os01t0106200-01.exon2 N/A Os01t0106200-01.exon2 N/A Os01t0106200-01.exon2 transcript:Os01t0106200-01 N/A 2 N/A
1 irgsp exon 321928 322205 . 1 . N/A N/A 1 N/A -1 0 Os01t0106200-01.exon3 N/A Os01t0106200-01.exon3 N/A Os01t0106200-01.exon3 transcript:Os01t0106200-01 N/A 3 N/A
1 irgsp CDS 319875 320236 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0106200-01 N/A N/A transcript:Os01t0106200-01 Os01t0106200-01 N/A N/A
1 irgsp CDS 321468 321648 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0106200-01 N/A N/A transcript:Os01t0106200-01 Os01t0106200-01 N/A N/A
1 irgsp CDS 321928 321975 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0106200-01 N/A N/A transcript:Os01t0106200-01 Os01t0106200-01 N/A N/A
1 irgsp five_prime_UTR 319754 319874 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-79 N/A N/A transcript:Os01t0106200-01 N/A N/A N/A
1 irgsp three_prime_UTR 321976 322205 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-69 N/A N/A transcript:Os01t0106200-01 N/A N/A N/A
1 irgsp gene 322591 323923 . -1 . N/A protein_coding N/A Similar to Isoflavone reductase homolog IRL (EC 1.3.1.-). (Os01t0106300-01) N/A N/A N/A Os01g0106300 gene:Os01g0106300 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
1 irgsp mRNA 322591 323923 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0106300-01 N/A N/A gene:Os01g0106300 N/A N/A Os01t0106300-01
1 irgsp exon 322591 323923 . -1 . N/A N/A 1 N/A -1 1 Os01t0106300-01.exon2 N/A Os01t0106300-01.exon2 N/A Os01t0106300-01.exon2 transcript:Os01t0106300-01 N/A 2 N/A
1 irgsp three_prime_UTR 322591 322809 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-70 N/A N/A transcript:Os01t0106300-01 N/A N/A N/A
1 seq_id source_tag primary_tag start end score strand frame Alias biotype constitutive description ensembl_end_phase ensembl_phase exon_id gene_id ID logic_name Name Parent protein_id rank transcript_id
2 1 irgsp repeat_region 2000 2100 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A fakeRepeat1 N/A N/A N/A N/A N/A N/A
3 1 irgsp gene 2983 10815 . 1 . N/A protein_coding N/A RabGAP/TBC domain containing protein. (Os01t0100100-01) N/A N/A N/A Os01g0100100 gene:Os01g0100100 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
4 1 irgsp mRNA 2983 10815 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100100-01 N/A N/A gene:Os01g0100100 N/A N/A Os01t0100100-01
5 1 irgsp exon 2983 3268 . 1 . N/A N/A 1 N/A -1 -1 Os01t0100100-01.exon1 N/A Os01t0100100-01.exon1 N/A Os01t0100100-01.exon1 transcript:Os01t0100100-01 N/A 1 N/A
6 1 irgsp exon 3354 3616 . 1 . N/A N/A 1 N/A 0 -1 Os01t0100100-01.exon2 N/A Os01t0100100-01.exon2 N/A Os01t0100100-01.exon2 transcript:Os01t0100100-01 N/A 2 N/A
7 1 irgsp exon 4357 4455 . 1 . N/A N/A 1 N/A 0 0 Os01t0100100-01.exon3 N/A Os01t0100100-01.exon3 N/A Os01t0100100-01.exon3 transcript:Os01t0100100-01 N/A 3 N/A
8 1 irgsp exon 5457 5560 . 1 . N/A N/A 1 N/A 2 0 Os01t0100100-01.exon4 N/A Os01t0100100-01.exon4 N/A Os01t0100100-01.exon4 transcript:Os01t0100100-01 N/A 4 N/A
9 1 irgsp exon 7136 7944 . 1 . N/A N/A 1 N/A 1 2 Os01t0100100-01.exon5 N/A Os01t0100100-01.exon5 N/A Os01t0100100-01.exon5 transcript:Os01t0100100-01 N/A 5 N/A
10 1 irgsp exon 8028 8150 . 1 . N/A N/A 1 N/A 1 1 Os01t0100100-01.exon6 N/A Os01t0100100-01.exon6 N/A Os01t0100100-01.exon6 transcript:Os01t0100100-01 N/A 6 N/A
11 1 irgsp exon 8232 8320 . 1 . N/A N/A 1 N/A 0 1 Os01t0100100-01.exon7 N/A Os01t0100100-01.exon7 N/A Os01t0100100-01.exon7 transcript:Os01t0100100-01 N/A 7 N/A
12 1 irgsp exon 8408 8608 . 1 . N/A N/A 1 N/A 0 0 Os01t0100100-01.exon8 N/A Os01t0100100-01.exon8 N/A Os01t0100100-01.exon8 transcript:Os01t0100100-01 N/A 8 N/A
13 1 irgsp exon 9210 9615 . 1 . N/A N/A 1 N/A 1 0 Os01t0100100-01.exon9 N/A Os01t0100100-01.exon9 N/A Os01t0100100-01.exon9 transcript:Os01t0100100-01 N/A 9 N/A
14 1 irgsp exon 10102 10187 . 1 . N/A N/A 1 N/A 0 1 Os01t0100100-01.exon10 N/A Os01t0100100-01.exon10 N/A Os01t0100100-01.exon10 transcript:Os01t0100100-01 N/A 10 N/A
15 1 irgsp exon 10274 10430 . 1 . N/A N/A 1 N/A -1 0 Os01t0100100-01.exon11 N/A Os01t0100100-01.exon11 N/A Os01t0100100-01.exon11 transcript:Os01t0100100-01 N/A 11 N/A
16 1 irgsp exon 10504 10815 . 1 . N/A N/A 1 N/A -1 -1 Os01t0100100-01.exon12 N/A Os01t0100100-01.exon12 N/A Os01t0100100-01.exon12 transcript:Os01t0100100-01 N/A 12 N/A
17 1 irgsp CDS 3449 3616 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
18 1 irgsp CDS 4357 4455 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
19 1 irgsp CDS 5457 5560 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
20 1 irgsp CDS 7136 7944 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
21 1 irgsp CDS 8028 8150 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
22 1 irgsp CDS 8232 8320 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
23 1 irgsp CDS 8408 8608 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
24 1 irgsp CDS 9210 9615 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
25 1 irgsp CDS 10102 10187 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
26 1 irgsp CDS 10274 10297 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100100-01 N/A N/A transcript:Os01t0100100-01 Os01t0100100-01 N/A N/A
27 1 irgsp five_prime_UTR 2983 3268 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-1 N/A N/A transcript:Os01t0100100-01 N/A N/A N/A
28 1 irgsp five_prime_UTR 3354 3448 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-2 N/A N/A transcript:Os01t0100100-01 N/A N/A N/A
29 1 irgsp three_prime_UTR 10298 10430 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-1 N/A N/A transcript:Os01t0100100-01 N/A N/A N/A
30 1 irgsp three_prime_UTR 10504 10815 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-2 N/A N/A transcript:Os01t0100100-01 N/A N/A N/A
31 1 irgsp gene 11218 12435 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0100200-01) N/A N/A N/A Os01g0100200 gene:Os01g0100200 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
32 1 irgsp mRNA 11218 12435 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100200-01 N/A N/A gene:Os01g0100200 N/A N/A Os01t0100200-01
33 1 irgsp exon 11218 12060 . 1 . N/A N/A 1 N/A 2 -1 Os01t0100200-01.exon1 N/A Os01t0100200-01.exon1 N/A Os01t0100200-01.exon1 transcript:Os01t0100200-01 N/A 1 N/A
34 1 irgsp exon 12152 12435 . 1 . N/A N/A 1 N/A -1 2 Os01t0100200-01.exon2 N/A Os01t0100200-01.exon2 N/A Os01t0100200-01.exon2 transcript:Os01t0100200-01 N/A 2 N/A
35 1 irgsp CDS 11798 12060 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100200-01 N/A N/A transcript:Os01t0100200-01 Os01t0100200-01 N/A N/A
36 1 irgsp CDS 12152 12317 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100200-01 N/A N/A transcript:Os01t0100200-01 Os01t0100200-01 N/A N/A
37 1 irgsp five_prime_UTR 11218 11797 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-3 N/A N/A transcript:Os01t0100200-01 N/A N/A N/A
38 1 irgsp three_prime_UTR 12318 12435 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-3 N/A N/A transcript:Os01t0100200-01 N/A N/A N/A
39 1 irgsp gene 11372 12284 . -1 . N/A protein_coding N/A Cytochrome P450 domain containing protein. (Os01t0100300-00) N/A N/A N/A Os01g0100300 gene:Os01g0100300 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
40 1 irgsp mRNA 11372 12284 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100300-00 N/A N/A gene:Os01g0100300 N/A N/A Os01t0100300-00
41 1 irgsp exon 11372 12042 . -1 . N/A N/A 1 N/A 0 1 Os01t0100300-00.exon2 N/A Os01t0100300-00.exon2 N/A Os01t0100300-00.exon2 transcript:Os01t0100300-00 N/A 2 N/A
42 1 irgsp exon 12146 12284 . -1 . N/A N/A 1 N/A 1 0 Os01t0100300-00.exon1 N/A Os01t0100300-00.exon1 N/A Os01t0100300-00.exon1 transcript:Os01t0100300-00 N/A 1 N/A
43 1 irgsp CDS 11372 12042 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100300-00 N/A N/A transcript:Os01t0100300-00 Os01t0100300-00 N/A N/A
44 1 irgsp CDS 12146 12284 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100300-00 N/A N/A transcript:Os01t0100300-00 Os01t0100300-00 N/A N/A
45 1 irgsp gene 12721 15685 . 1 . N/A protein_coding N/A Similar to Pectinesterase-like protein. (Os01t0100400-01) N/A N/A N/A Os01g0100400 gene:Os01g0100400 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
46 1 irgsp mRNA 12721 15685 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100400-01 N/A N/A gene:Os01g0100400 N/A N/A Os01t0100400-01
47 1 irgsp exon 12721 13813 . 1 . N/A N/A 1 N/A 2 -1 Os01t0100400-01.exon1 N/A Os01t0100400-01.exon1 N/A Os01t0100400-01.exon1 transcript:Os01t0100400-01 N/A 1 N/A
48 1 irgsp exon 13906 14271 . 1 . N/A N/A 1 N/A 2 2 Os01t0100400-01.exon2 N/A Os01t0100400-01.exon2 N/A Os01t0100400-01.exon2 transcript:Os01t0100400-01 N/A 2 N/A
49 1 irgsp exon 14359 14437 . 1 . N/A N/A 1 N/A 0 2 Os01t0100400-01.exon3 N/A Os01t0100400-01.exon3 N/A Os01t0100400-01.exon3 transcript:Os01t0100400-01 N/A 3 N/A
50 1 irgsp exon 14969 15171 . 1 . N/A N/A 1 N/A 2 0 Os01t0100400-01.exon4 N/A Os01t0100400-01.exon4 N/A Os01t0100400-01.exon4 transcript:Os01t0100400-01 N/A 4 N/A
51 1 irgsp exon 15266 15685 . 1 . N/A N/A 1 N/A -1 2 Os01t0100400-01.exon5 N/A Os01t0100400-01.exon5 N/A Os01t0100400-01.exon5 transcript:Os01t0100400-01 N/A 5 N/A
52 1 irgsp CDS 12774 13813 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
53 1 irgsp CDS 13906 14271 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
54 1 irgsp CDS 14359 14437 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
55 1 irgsp CDS 14969 15171 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
56 1 irgsp CDS 15266 15359 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100400-01 N/A N/A transcript:Os01t0100400-01 Os01t0100400-01 N/A N/A
57 1 irgsp five_prime_UTR 12721 12773 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-4 N/A N/A transcript:Os01t0100400-01 N/A N/A N/A
58 1 irgsp three_prime_UTR 15360 15685 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-4 N/A N/A transcript:Os01t0100400-01 N/A N/A N/A
59 1 irgsp gene 12808 13978 . -1 . N/A protein_coding N/A Hypothetical protein. (Os01t0100466-00) N/A N/A N/A Os01g0100466 gene:Os01g0100466 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
60 1 irgsp mRNA 12808 13978 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100466-00 N/A N/A gene:Os01g0100466 N/A N/A Os01t0100466-00
61 1 irgsp exon 12808 13782 . -1 . N/A N/A 1 N/A -1 -1 Os01t0100466-00.exon2 N/A Os01t0100466-00.exon2 N/A Os01t0100466-00.exon2 transcript:Os01t0100466-00 N/A 2 N/A
62 1 irgsp exon 13880 13978 . -1 . N/A N/A 1 N/A -1 -1 Os01t0100466-00.exon1 N/A Os01t0100466-00.exon1 N/A Os01t0100466-00.exon1 transcript:Os01t0100466-00 N/A 1 N/A
63 1 irgsp CDS 12869 13102 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100466-00 N/A N/A transcript:Os01t0100466-00 Os01t0100466-00 N/A N/A
64 1 irgsp five_prime_UTR 13103 13782 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-5 N/A N/A transcript:Os01t0100466-00 N/A N/A N/A
65 1 irgsp five_prime_UTR 13880 13978 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-6 N/A N/A transcript:Os01t0100466-00 N/A N/A N/A
66 1 irgsp three_prime_UTR 12808 12868 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-5 N/A N/A transcript:Os01t0100466-00 N/A N/A N/A
67 1 irgsp gene 16399 20144 . 1 . N/A protein_coding N/A Immunoglobulin-like domain containing protein. (Os01t0100500-01) N/A N/A N/A Os01g0100500 gene:Os01g0100500 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
68 1 irgsp mRNA 16399 20144 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100500-01 N/A N/A gene:Os01g0100500 N/A N/A Os01t0100500-01
69 1 irgsp exon 16399 16976 . 1 . N/A N/A 1 N/A 0 -1 Os01t0100500-01.exon1 N/A Os01t0100500-01.exon1 N/A Os01t0100500-01.exon1 transcript:Os01t0100500-01 N/A 1 N/A
70 1 irgsp exon 17383 17474 . 1 . N/A N/A 1 N/A 2 0 Os01t0100500-01.exon2 N/A Os01t0100500-01.exon2 N/A Os01t0100500-01.exon2 transcript:Os01t0100500-01 N/A 2 N/A
71 1 irgsp exon 17558 18258 . 1 . N/A N/A 1 N/A 1 2 Os01t0100500-01.exon3 N/A Os01t0100500-01.exon3 N/A Os01t0100500-01.exon3 transcript:Os01t0100500-01 N/A 3 N/A
72 1 irgsp exon 18501 18571 . 1 . N/A N/A 1 N/A 0 1 Os01t0100500-01.exon4 N/A Os01t0100500-01.exon4 N/A Os01t0100500-01.exon4 transcript:Os01t0100500-01 N/A 4 N/A
73 1 irgsp exon 18968 19057 . 1 . N/A N/A 1 N/A 0 0 Os01t0100500-01.exon5 N/A Os01t0100500-01.exon5 N/A Os01t0100500-01.exon5 transcript:Os01t0100500-01 N/A 5 N/A
74 1 irgsp exon 19142 19321 . 1 . N/A N/A 1 N/A 0 0 Os01t0100500-01.exon6 N/A Os01t0100500-01.exon6 N/A Os01t0100500-01.exon6 transcript:Os01t0100500-01 N/A 6 N/A
75 1 irgsp exon 19531 19629 . 1 . N/A N/A 1 N/A -1 0 Os01t0100500-01.exon7 N/A Os01t0100500-01.exon7 N/A Os01t0100500-01.exon7 transcript:Os01t0100500-01 N/A 7 N/A
76 1 irgsp exon 19734 20144 . 1 . N/A N/A 1 N/A -1 -1 Os01t0100500-01.exon8 N/A Os01t0100500-01.exon8 N/A Os01t0100500-01.exon8 transcript:Os01t0100500-01 N/A 8 N/A
77 1 irgsp CDS 16599 16976 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
78 1 irgsp CDS 17383 17474 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
79 1 irgsp CDS 17558 18258 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
80 1 irgsp CDS 18501 18571 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
81 1 irgsp CDS 18968 19057 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
82 1 irgsp CDS 19142 19321 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
83 1 irgsp CDS 19531 19593 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100500-01 N/A N/A transcript:Os01t0100500-01 Os01t0100500-01 N/A N/A
84 1 irgsp five_prime_UTR 16399 16598 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-7 N/A N/A transcript:Os01t0100500-01 N/A N/A N/A
85 1 irgsp three_prime_UTR 19594 19629 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-6 N/A N/A transcript:Os01t0100500-01 N/A N/A N/A
86 1 irgsp three_prime_UTR 19734 20144 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-7 N/A N/A transcript:Os01t0100500-01 N/A N/A N/A
87 1 irgsp gene 22841 26892 . 1 . N/A protein_coding N/A Single-stranded nucleic acid binding R3H domain containing protein. (Os01t0100600-01) N/A N/A N/A Os01g0100600 gene:Os01g0100600 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
88 1 irgsp mRNA 22841 26892 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100600-01 N/A N/A gene:Os01g0100600 N/A N/A Os01t0100600-01
89 1 irgsp exon 22841 23281 . 1 . N/A N/A 1 N/A 2 -1 Os01t0100600-01.exon1 N/A Os01t0100600-01.exon1 N/A Os01t0100600-01.exon1 transcript:Os01t0100600-01 N/A 1 N/A
90 1 irgsp exon 23572 23847 . 1 . N/A N/A 1 N/A 2 2 Os01t0100600-01.exon2 N/A Os01t0100600-01.exon2 N/A Os01t0100600-01.exon2 transcript:Os01t0100600-01 N/A 2 N/A
91 1 irgsp exon 23962 24033 . 1 . N/A N/A 1 N/A 2 2 Os01t0100600-01.exon3 N/A Os01t0100600-01.exon3 N/A Os01t0100600-01.exon3 transcript:Os01t0100600-01 N/A 3 N/A
92 1 irgsp exon 24492 24577 . 1 . N/A N/A 1 N/A 1 2 Os01t0100600-01.exon4 N/A Os01t0100600-01.exon4 N/A Os01t0100600-01.exon4 transcript:Os01t0100600-01 N/A 4 N/A
93 1 irgsp exon 25445 25519 . 1 . N/A N/A 1 N/A 1 1 Os01t0100600-01.exon5 N/A Os01t0100600-01.exon5 N/A Os01t0100600-01.exon5 transcript:Os01t0100600-01 N/A 5 N/A
94 1 irgsp exon 25883 26892 . 1 . N/A N/A 1 N/A -1 1 Os01t0100600-01.exon6 N/A Os01t0100600-01.exon6 N/A Os01t0100600-01.exon6 transcript:Os01t0100600-01 N/A 6 N/A
95 1 irgsp CDS 23232 23281 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
96 1 irgsp CDS 23572 23847 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
97 1 irgsp CDS 23962 24033 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
98 1 irgsp CDS 24492 24577 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
99 1 irgsp CDS 25445 25519 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
100 1 irgsp CDS 25883 26391 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100600-01 N/A N/A transcript:Os01t0100600-01 Os01t0100600-01 N/A N/A
101 1 irgsp five_prime_UTR 22841 23231 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-8 N/A N/A transcript:Os01t0100600-01 N/A N/A N/A
102 1 irgsp three_prime_UTR 26392 26892 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-8 N/A N/A transcript:Os01t0100600-01 N/A N/A N/A
103 1 irgsp gene 25861 26424 . -1 . N/A protein_coding N/A Hypothetical gene. (Os01t0100650-00) N/A N/A N/A Os01g0100650 gene:Os01g0100650 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
104 1 irgsp mRNA 25861 26424 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100650-00 N/A N/A gene:Os01g0100650 N/A N/A Os01t0100650-00
105 1 irgsp exon 25861 26424 . -1 . N/A N/A 1 N/A -1 -1 Os01t0100650-00.exon1 N/A Os01t0100650-00.exon1 N/A Os01t0100650-00.exon1 transcript:Os01t0100650-00 N/A 1 N/A
106 1 irgsp CDS 26040 26423 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100650-00 N/A N/A transcript:Os01t0100650-00 Os01t0100650-00 N/A N/A
107 1 irgsp five_prime_UTR 26424 26424 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-9 N/A N/A transcript:Os01t0100650-00 N/A N/A N/A
108 1 irgsp three_prime_UTR 25861 26039 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-9 N/A N/A transcript:Os01t0100650-00 N/A N/A N/A
109 1 irgsp gene 27143 28644 . 1 . N/A protein_coding N/A Similar to 40S ribosomal protein S5-1. (Os01t0100700-01) N/A N/A N/A Os01g0100700 gene:Os01g0100700 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
110 1 irgsp mRNA 27143 28644 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100700-01 N/A N/A gene:Os01g0100700 N/A N/A Os01t0100700-01
111 1 irgsp exon 27143 27292 . 1 . N/A N/A 1 N/A 0 -1 Os01t0100700-01.exon1 N/A Os01t0100700-01.exon1 N/A Os01t0100700-01.exon1 transcript:Os01t0100700-01 N/A 1 N/A
112 1 irgsp exon 27370 27641 . 1 . N/A N/A 1 N/A 2 0 Os01t0100700-01.exon2 N/A Os01t0100700-01.exon2 N/A Os01t0100700-01.exon2 transcript:Os01t0100700-01 N/A 2 N/A
113 1 irgsp exon 28090 28293 . 1 . N/A N/A 1 N/A 2 2 Os01t0100700-01.exon3 N/A Os01t0100700-01.exon3 N/A Os01t0100700-01.exon3 transcript:Os01t0100700-01 N/A 3 N/A
114 1 irgsp exon 28365 28644 . 1 . N/A N/A 1 N/A -1 2 Os01t0100700-01.exon4 N/A Os01t0100700-01.exon4 N/A Os01t0100700-01.exon4 transcript:Os01t0100700-01 N/A 4 N/A
115 1 irgsp CDS 27221 27292 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100700-01 N/A N/A transcript:Os01t0100700-01 Os01t0100700-01 N/A N/A
116 1 irgsp CDS 27370 27641 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100700-01 N/A N/A transcript:Os01t0100700-01 Os01t0100700-01 N/A N/A
117 1 irgsp CDS 28090 28293 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100700-01 N/A N/A transcript:Os01t0100700-01 Os01t0100700-01 N/A N/A
118 1 irgsp CDS 28365 28419 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100700-01 N/A N/A transcript:Os01t0100700-01 Os01t0100700-01 N/A N/A
119 1 irgsp five_prime_UTR 27143 27220 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-10 N/A N/A transcript:Os01t0100700-01 N/A N/A N/A
120 1 irgsp three_prime_UTR 28420 28644 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-10 N/A N/A transcript:Os01t0100700-01 N/A N/A N/A
121 1 irgsp gene 29818 34453 . 1 . N/A protein_coding N/A Protein of unknown function DUF1664 family protein. (Os01t0100800-01) N/A N/A N/A Os01g0100800 gene:Os01g0100800 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
122 1 irgsp mRNA 29818 34453 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100800-01 N/A N/A gene:Os01g0100800 N/A N/A Os01t0100800-01
123 1 irgsp exon 29818 29976 . 1 . N/A N/A 1 N/A 1 -1 Os01t0100800-01.exon1 N/A Os01t0100800-01.exon1 N/A Os01t0100800-01.exon1 transcript:Os01t0100800-01 N/A 1 N/A
124 1 irgsp exon 30146 30228 . 1 . N/A N/A 1 N/A 0 1 Os01t0100800-01.exon2 N/A Os01t0100800-01.exon2 N/A Os01t0100800-01.exon2 transcript:Os01t0100800-01 N/A 2 N/A
125 1 irgsp exon 30735 30806 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon3 N/A Os01t0100800-01.exon3 N/A Os01t0100800-01.exon3 transcript:Os01t0100800-01 N/A 3 N/A
126 1 irgsp exon 30885 30963 . 1 . N/A N/A 1 N/A 1 0 Os01t0100800-01.exon4 N/A Os01t0100800-01.exon4 N/A Os01t0100800-01.exon4 transcript:Os01t0100800-01 N/A 4 N/A
127 1 irgsp exon 31258 31325 . 1 . N/A N/A 1 N/A 0 1 Os01t0100800-01.exon5 N/A Os01t0100800-01.exon5 N/A Os01t0100800-01.exon5 transcript:Os01t0100800-01 N/A 5 N/A
128 1 irgsp exon 31505 31606 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon6 N/A Os01t0100800-01.exon6 N/A Os01t0100800-01.exon6 transcript:Os01t0100800-01 N/A 6 N/A
129 1 irgsp exon 32377 32466 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon7 N/A Os01t0100800-01.exon7 N/A Os01t0100800-01.exon7 transcript:Os01t0100800-01 N/A 7 N/A
130 1 irgsp exon 32542 32616 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon8 N/A Os01t0100800-01.exon8 N/A Os01t0100800-01.exon8 transcript:Os01t0100800-01 N/A 8 N/A
131 1 irgsp exon 32712 32744 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon9 N/A Os01t0100800-01.exon9 N/A Os01t0100800-01.exon9 transcript:Os01t0100800-01 N/A 9 N/A
132 1 irgsp exon 32828 32905 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon10 N/A Os01t0100800-01.exon10 N/A Os01t0100800-01.exon10 transcript:Os01t0100800-01 N/A 10 N/A
133 1 irgsp exon 33274 33330 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon11 N/A Os01t0100800-01.exon11 N/A Os01t0100800-01.exon11 transcript:Os01t0100800-01 N/A 11 N/A
134 1 irgsp exon 33400 33471 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon12 N/A Os01t0100800-01.exon12 N/A Os01t0100800-01.exon12 transcript:Os01t0100800-01 N/A 12 N/A
135 1 irgsp exon 33543 33617 . 1 . N/A N/A 1 N/A 0 0 Os01t0100800-01.exon13 N/A Os01t0100800-01.exon13 N/A Os01t0100800-01.exon13 transcript:Os01t0100800-01 N/A 13 N/A
136 1 irgsp exon 33975 34453 . 1 . N/A N/A 1 N/A -1 0 Os01t0100800-01.exon14 N/A Os01t0100800-01.exon14 N/A Os01t0100800-01.exon14 transcript:Os01t0100800-01 N/A 14 N/A
137 1 irgsp CDS 29940 29976 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
138 1 irgsp CDS 30146 30228 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
139 1 irgsp CDS 30735 30806 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
140 1 irgsp CDS 30885 30963 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
141 1 irgsp CDS 31258 31325 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
142 1 irgsp CDS 31505 31606 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
143 1 irgsp CDS 32377 32466 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
144 1 irgsp CDS 32542 32616 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
145 1 irgsp CDS 32712 32744 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
146 1 irgsp CDS 32828 32905 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
147 1 irgsp CDS 33274 33330 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
148 1 irgsp CDS 33400 33471 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
149 1 irgsp CDS 33543 33617 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
150 1 irgsp CDS 33975 34124 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100800-01 N/A N/A transcript:Os01t0100800-01 Os01t0100800-01 N/A N/A
151 1 irgsp five_prime_UTR 29818 29939 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-11 N/A N/A transcript:Os01t0100800-01 N/A N/A N/A
152 1 irgsp three_prime_UTR 34125 34453 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-11 N/A N/A transcript:Os01t0100800-01 N/A N/A N/A
153 1 irgsp gene 35623 41136 . 1 . N/A protein_coding N/A Sphingosine-1-phosphate lyase, Disease resistance response (Os01t0100900-01) N/A N/A N/A Os01g0100900 gene:Os01g0100900 irgspv1.0-20170804-genes SPHINGOSINE-1-PHOSPHATE LYASE 1, Sphingosine-1-Phoshpate Lyase 1 N/A N/A N/A N/A
154 1 irgsp mRNA 35623 41136 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0100900-01 N/A N/A gene:Os01g0100900 N/A N/A Os01t0100900-01
155 1 irgsp exon 35623 35939 . 1 . N/A N/A 1 N/A 2 -1 Os01t0100900-01.exon1 N/A Os01t0100900-01.exon1 N/A Os01t0100900-01.exon1 transcript:Os01t0100900-01 N/A 1 N/A
156 1 irgsp exon 36027 36072 . 1 . N/A N/A 1 N/A 0 2 Os01t0100900-01.exon2 N/A Os01t0100900-01.exon2 N/A Os01t0100900-01.exon2 transcript:Os01t0100900-01 N/A 2 N/A
157 1 irgsp exon 36517 36668 . 1 . N/A N/A 1 N/A 2 0 Os01t0100900-01.exon3 N/A Os01t0100900-01.exon3 N/A Os01t0100900-01.exon3 transcript:Os01t0100900-01 N/A 3 N/A
158 1 irgsp exon 36818 36877 . 1 . N/A N/A 1 N/A 2 2 Os01t0100900-01.exon4 N/A Os01t0100900-01.exon4 N/A Os01t0100900-01.exon4 transcript:Os01t0100900-01 N/A 4 N/A
159 1 irgsp exon 37594 37818 . 1 . N/A N/A 1 N/A 2 2 Os01t0100900-01.exon5 N/A Os01t0100900-01.exon5 N/A Os01t0100900-01.exon5 transcript:Os01t0100900-01 N/A 5 N/A
160 1 irgsp exon 37892 38033 . 1 . N/A N/A 1 N/A 0 2 Os01t0100900-01.exon6 N/A Os01t0100900-01.exon6 N/A Os01t0100900-01.exon6 transcript:Os01t0100900-01 N/A 6 N/A
161 1 irgsp exon 38276 38326 . 1 . N/A N/A 1 N/A 0 0 Os01t0100900-01.exon7 N/A Os01t0100900-01.exon7 N/A Os01t0100900-01.exon7 transcript:Os01t0100900-01 N/A 7 N/A
162 1 irgsp exon 38434 38525 . 1 . N/A N/A 1 N/A 2 0 Os01t0100900-01.exon8 N/A Os01t0100900-01.exon8 N/A Os01t0100900-01.exon8 transcript:Os01t0100900-01 N/A 8 N/A
163 1 irgsp exon 39319 39445 . 1 . N/A N/A 1 N/A 0 2 Os01t0100900-01.exon9 N/A Os01t0100900-01.exon9 N/A Os01t0100900-01.exon9 transcript:Os01t0100900-01 N/A 9 N/A
164 1 irgsp exon 39553 39568 . 1 . N/A N/A 1 N/A 1 0 Os01t0100900-01.exon10 N/A Os01t0100900-01.exon10 N/A Os01t0100900-01.exon10 transcript:Os01t0100900-01 N/A 10 N/A
165 1 irgsp exon 39939 40046 . 1 . N/A N/A 1 N/A 1 1 Os01t0100900-01.exon11 N/A Os01t0100900-01.exon11 N/A Os01t0100900-01.exon11 transcript:Os01t0100900-01 N/A 11 N/A
166 1 irgsp exon 40135 40189 . 1 . N/A N/A 1 N/A 2 1 Os01t0100900-01.exon12 N/A Os01t0100900-01.exon12 N/A Os01t0100900-01.exon12 transcript:Os01t0100900-01 N/A 12 N/A
167 1 irgsp exon 40456 40602 . 1 . N/A N/A 1 N/A 2 2 Os01t0100900-01.exon13 N/A Os01t0100900-01.exon13 N/A Os01t0100900-01.exon13 transcript:Os01t0100900-01 N/A 13 N/A
168 1 irgsp exon 40703 40781 . 1 . N/A N/A 1 N/A 0 2 Os01t0100900-01.exon14 N/A Os01t0100900-01.exon14 N/A Os01t0100900-01.exon14 transcript:Os01t0100900-01 N/A 14 N/A
169 1 irgsp exon 40885 41136 . 1 . N/A N/A 1 N/A -1 0 Os01t0100900-01.exon15 N/A Os01t0100900-01.exon15 N/A Os01t0100900-01.exon15 transcript:Os01t0100900-01 N/A 15 N/A
170 1 irgsp CDS 35743 35939 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
171 1 irgsp CDS 36027 36072 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
172 1 irgsp CDS 36517 36668 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
173 1 irgsp CDS 36818 36877 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
174 1 irgsp CDS 37594 37818 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
175 1 irgsp CDS 37892 38033 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
176 1 irgsp CDS 38276 38326 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
177 1 irgsp CDS 38434 38525 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
178 1 irgsp CDS 39319 39445 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
179 1 irgsp CDS 39553 39568 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
180 1 irgsp CDS 39939 40046 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
181 1 irgsp CDS 40135 40189 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
182 1 irgsp CDS 40456 40602 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
183 1 irgsp CDS 40703 40781 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
184 1 irgsp CDS 40885 41007 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0100900-01 N/A N/A transcript:Os01t0100900-01 Os01t0100900-01 N/A N/A
185 1 irgsp five_prime_UTR 35623 35742 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-12 N/A N/A transcript:Os01t0100900-01 N/A N/A N/A
186 1 irgsp three_prime_UTR 41008 41136 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-12 N/A N/A transcript:Os01t0100900-01 N/A N/A N/A
187 1 irgsp gene 58658 61090 . 1 . N/A protein_coding N/A Hypothetical conserved gene. (Os01t0101150-00) N/A N/A N/A Os01g0101150 gene:Os01g0101150 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
188 1 irgsp mRNA 58658 61090 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101150-00 N/A N/A gene:Os01g0101150 N/A N/A Os01t0101150-00
189 1 irgsp exon 58658 61090 . 1 . N/A N/A 1 N/A 0 0 Os01t0101150-00.exon1 N/A Os01t0101150-00.exon1 N/A Os01t0101150-00.exon1 transcript:Os01t0101150-00 N/A 1 N/A
190 1 irgsp CDS 58658 61090 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101150-00 N/A N/A transcript:Os01t0101150-00 Os01t0101150-00 N/A N/A
191 1 irgsp gene 62060 65537 . 1 . N/A protein_coding N/A 2,3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein. (Os01t0101200-01);2,3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein. (Os01t0101200-02) N/A N/A N/A Os01g0101200 gene:Os01g0101200 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
192 1 irgsp mRNA 62060 63576 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101200-01 N/A N/A gene:Os01g0101200 N/A N/A Os01t0101200-01
193 1 irgsp exon 62060 62295 . 1 . N/A N/A 0 N/A 0 -1 Os01t0101200-01.exon1 N/A Os01t0101200-01.exon1 N/A Os01t0101200-01.exon1 transcript:Os01t0101200-01 N/A 1 N/A
194 1 irgsp exon 62385 62905 . 1 . N/A N/A 1 N/A 2 0 Os01t0101200-02.exon2 N/A Os01t0101200-02.exon2 N/A Os01t0101200-02.exon2 transcript:Os01t0101200-01 N/A 2 N/A
195 1 irgsp exon 62996 63114 . 1 . N/A N/A 1 N/A 1 2 Os01t0101200-02.exon3 N/A Os01t0101200-02.exon3 N/A Os01t0101200-02.exon3 transcript:Os01t0101200-01 N/A 3 N/A
196 1 irgsp exon 63248 63576 . 1 . N/A N/A 0 N/A -1 1 Os01t0101200-01.exon4 N/A Os01t0101200-01.exon4 N/A Os01t0101200-01.exon4 transcript:Os01t0101200-01 N/A 4 N/A
197 1 irgsp CDS 62104 62295 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-01 N/A N/A transcript:Os01t0101200-01 Os01t0101200-01 N/A N/A
198 1 irgsp CDS 62385 62905 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-01 N/A N/A transcript:Os01t0101200-01 Os01t0101200-01 N/A N/A
199 1 irgsp CDS 62996 63114 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-01 N/A N/A transcript:Os01t0101200-01 Os01t0101200-01 N/A N/A
200 1 irgsp CDS 63248 63345 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-01 N/A N/A transcript:Os01t0101200-01 Os01t0101200-01 N/A N/A
201 1 irgsp five_prime_UTR 62060 62103 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-13 N/A N/A transcript:Os01t0101200-01 N/A N/A N/A
202 1 irgsp three_prime_UTR 63346 63576 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-13 N/A N/A transcript:Os01t0101200-01 N/A N/A N/A
203 1 irgsp mRNA 62112 65537 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101200-02 N/A N/A gene:Os01g0101200 N/A N/A Os01t0101200-02
204 1 irgsp exon 62112 62295 . 1 . N/A N/A 0 N/A 0 -1 Os01t0101200-02.exon1 N/A Os01t0101200-02.exon1 N/A Os01t0101200-02.exon1 transcript:Os01t0101200-02 N/A 1 N/A
205 1 irgsp exon 62385 62905 . 1 . N/A N/A 1 N/A 2 0 Os01t0101200-02.exon2 N/A agat-exon-1 N/A Os01t0101200-02.exon2 transcript:Os01t0101200-02 N/A 2 N/A
206 1 irgsp exon 62996 63114 . 1 . N/A N/A 1 N/A 1 2 Os01t0101200-02.exon3 N/A agat-exon-2 N/A Os01t0101200-02.exon3 transcript:Os01t0101200-02 N/A 3 N/A
207 1 irgsp exon 63248 65537 . 1 . N/A N/A 0 N/A -1 1 Os01t0101200-02.exon4 N/A Os01t0101200-02.exon4 N/A Os01t0101200-02.exon4 transcript:Os01t0101200-02 N/A 4 N/A
208 1 irgsp CDS 62113 62295 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-02 N/A N/A transcript:Os01t0101200-02 Os01t0101200-02 N/A N/A
209 1 irgsp CDS 62385 62905 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-02 N/A N/A transcript:Os01t0101200-02 Os01t0101200-02 N/A N/A
210 1 irgsp CDS 62996 63114 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-02 N/A N/A transcript:Os01t0101200-02 Os01t0101200-02 N/A N/A
211 1 irgsp CDS 63248 63345 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101200-02 N/A N/A transcript:Os01t0101200-02 Os01t0101200-02 N/A N/A
212 1 irgsp five_prime_UTR 62112 62112 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-14 N/A N/A transcript:Os01t0101200-02 N/A N/A N/A
213 1 irgsp three_prime_UTR 63346 65537 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-14 N/A N/A transcript:Os01t0101200-02 N/A N/A N/A
214 1 irgsp gene 63350 66302 . -1 . N/A protein_coding N/A Similar to MRNA, partial cds, clone: RAFL22-26-L17. (Fragment). (Os01t0101300-01) N/A N/A N/A Os01g0101300 gene:Os01g0101300 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
215 1 irgsp mRNA 63350 66302 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101300-01 N/A N/A gene:Os01g0101300 N/A N/A Os01t0101300-01
216 1 irgsp exon 63350 63783 . -1 . N/A N/A 1 N/A -1 0 Os01t0101300-01.exon7 N/A Os01t0101300-01.exon7 N/A Os01t0101300-01.exon7 transcript:Os01t0101300-01 N/A 7 N/A
217 1 irgsp exon 63877 64020 . -1 . N/A N/A 1 N/A 0 0 Os01t0101300-01.exon6 N/A Os01t0101300-01.exon6 N/A Os01t0101300-01.exon6 transcript:Os01t0101300-01 N/A 6 N/A
218 1 irgsp exon 64339 64431 . -1 . N/A N/A 1 N/A 0 0 Os01t0101300-01.exon5 N/A Os01t0101300-01.exon5 N/A Os01t0101300-01.exon5 transcript:Os01t0101300-01 N/A 5 N/A
219 1 irgsp exon 64665 64779 . -1 . N/A N/A 1 N/A 0 2 Os01t0101300-01.exon4 N/A Os01t0101300-01.exon4 N/A Os01t0101300-01.exon4 transcript:Os01t0101300-01 N/A 4 N/A
220 1 irgsp exon 64902 65152 . -1 . N/A N/A 1 N/A 2 0 Os01t0101300-01.exon3 N/A Os01t0101300-01.exon3 N/A Os01t0101300-01.exon3 transcript:Os01t0101300-01 N/A 3 N/A
221 1 irgsp exon 65248 65431 . -1 . N/A N/A 1 N/A 0 2 Os01t0101300-01.exon2 N/A Os01t0101300-01.exon2 N/A Os01t0101300-01.exon2 transcript:Os01t0101300-01 N/A 2 N/A
222 1 irgsp exon 65628 66302 . -1 . N/A N/A 1 N/A 2 -1 Os01t0101300-01.exon1 N/A Os01t0101300-01.exon1 N/A Os01t0101300-01.exon1 transcript:Os01t0101300-01 N/A 1 N/A
223 1 irgsp CDS 63670 63783 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
224 1 irgsp CDS 63877 64020 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
225 1 irgsp CDS 64339 64431 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
226 1 irgsp CDS 64665 64779 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
227 1 irgsp CDS 64902 65152 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
228 1 irgsp CDS 65248 65431 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
229 1 irgsp CDS 65628 65950 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101300-01 N/A N/A transcript:Os01t0101300-01 Os01t0101300-01 N/A N/A
230 1 irgsp five_prime_UTR 65951 66302 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-15 N/A N/A transcript:Os01t0101300-01 N/A N/A N/A
231 1 irgsp three_prime_UTR 63350 63669 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-15 N/A N/A transcript:Os01t0101300-01 N/A N/A N/A
232 1 irgsp gene 72816 78349 . 1 . N/A protein_coding N/A Immunoglobulin-like fold domain containing protein. (Os01t0101600-01);Immunoglobulin-like fold domain containing protein. (Os01t0101600-02);Hypothetical conserved gene. (Os01t0101600-03) N/A N/A N/A Os01g0101600 gene:Os01g0101600 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
233 1 irgsp mRNA 72816 78349 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101600-01 N/A N/A gene:Os01g0101600 N/A N/A Os01t0101600-01
234 1 irgsp exon 72816 73935 . 1 . N/A N/A 0 N/A 1 -1 Os01t0101600-01.exon1 N/A Os01t0101600-01.exon1 N/A Os01t0101600-01.exon1 transcript:Os01t0101600-01 N/A 1 N/A
235 1 irgsp exon 74468 74981 . 1 . N/A N/A 0 N/A 2 1 Os01t0101600-02.exon2 N/A Os01t0101600-02.exon2 N/A Os01t0101600-02.exon2 transcript:Os01t0101600-01 N/A 2 N/A
236 1 irgsp exon 75619 77205 . 1 . N/A N/A 0 N/A -1 2 Os01t0101600-01.exon3 N/A Os01t0101600-01.exon3 N/A Os01t0101600-01.exon3 transcript:Os01t0101600-01 N/A 3 N/A
237 1 irgsp exon 77333 78349 . 1 . N/A N/A 0 N/A -1 -1 Os01t0101600-01.exon4 N/A Os01t0101600-01.exon4 N/A Os01t0101600-01.exon4 transcript:Os01t0101600-01 N/A 4 N/A
238 1 irgsp CDS 72903 73935 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-01 N/A N/A transcript:Os01t0101600-01 Os01t0101600-01 N/A N/A
239 1 irgsp CDS 74468 74981 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-01 N/A N/A transcript:Os01t0101600-01 Os01t0101600-01 N/A N/A
240 1 irgsp CDS 75619 77008 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-01 N/A N/A transcript:Os01t0101600-01 Os01t0101600-01 N/A N/A
241 1 irgsp five_prime_UTR 72816 72902 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-16 N/A N/A transcript:Os01t0101600-01 N/A N/A N/A
242 1 irgsp three_prime_UTR 77009 77205 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-16 N/A N/A transcript:Os01t0101600-01 N/A N/A N/A
243 1 irgsp three_prime_UTR 77333 78349 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-17 N/A N/A transcript:Os01t0101600-01 N/A N/A N/A
244 1 irgsp mRNA 72823 77699 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101600-02 N/A N/A gene:Os01g0101600 N/A N/A Os01t0101600-02
245 1 irgsp exon 72823 73935 . 1 . N/A N/A 0 N/A 1 -1 Os01t0101600-02.exon1 N/A Os01t0101600-02.exon1 N/A Os01t0101600-02.exon1 transcript:Os01t0101600-02 N/A 1 N/A
246 1 irgsp exon 74468 74981 . 1 . N/A N/A 0 N/A 2 1 Os01t0101600-02.exon2 N/A agat-exon-3 N/A Os01t0101600-02.exon2 transcript:Os01t0101600-02 N/A 2 N/A
247 1 irgsp exon 75619 77699 . 1 . N/A N/A 0 N/A -1 2 Os01t0101600-02.exon3 N/A Os01t0101600-02.exon3 N/A Os01t0101600-02.exon3 transcript:Os01t0101600-02 N/A 3 N/A
248 1 irgsp CDS 72903 73935 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-02 N/A N/A transcript:Os01t0101600-02 Os01t0101600-02 N/A N/A
249 1 irgsp CDS 74468 74981 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-02 N/A N/A transcript:Os01t0101600-02 Os01t0101600-02 N/A N/A
250 1 irgsp CDS 75619 77008 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-02 N/A N/A transcript:Os01t0101600-02 Os01t0101600-02 N/A N/A
251 1 irgsp five_prime_UTR 72823 72902 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-17 N/A N/A transcript:Os01t0101600-02 N/A N/A N/A
252 1 irgsp three_prime_UTR 77009 77699 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-18 N/A N/A transcript:Os01t0101600-02 N/A N/A N/A
253 1 irgsp mRNA 75942 77699 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101600-03 N/A N/A gene:Os01g0101600 N/A N/A Os01t0101600-03
254 1 irgsp exon 75942 77699 . 1 . N/A N/A 0 N/A -1 -1 Os01t0101600-03.exon1 N/A Os01t0101600-03.exon1 N/A Os01t0101600-03.exon1 transcript:Os01t0101600-03 N/A 1 N/A
255 1 irgsp CDS 75944 77008 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101600-03 N/A N/A transcript:Os01t0101600-03 Os01t0101600-03 N/A N/A
256 1 irgsp five_prime_UTR 75942 75943 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-18 N/A N/A transcript:Os01t0101600-03 N/A N/A N/A
257 1 irgsp three_prime_UTR 77009 77699 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-19 N/A N/A transcript:Os01t0101600-03 N/A N/A N/A
258 1 irgsp gene 82426 84095 . 1 . N/A protein_coding N/A Similar to chaperone protein dnaJ 20. (Os01t0101700-00) N/A N/A N/A Os01g0101700 gene:Os01g0101700 irgspv1.0-20170804-genes DnaJ domain protein C1, rice DJC26 homolog N/A N/A N/A N/A
259 1 irgsp mRNA 82426 84095 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101700-00 N/A N/A gene:Os01g0101700 N/A N/A Os01t0101700-00
260 1 irgsp exon 82426 82932 . 1 . N/A N/A 1 N/A 0 -1 Os01t0101700-00.exon1 N/A Os01t0101700-00.exon1 N/A Os01t0101700-00.exon1 transcript:Os01t0101700-00 N/A 1 N/A
261 1 irgsp exon 83724 84095 . 1 . N/A N/A 1 N/A -1 0 Os01t0101700-00.exon2 N/A Os01t0101700-00.exon2 N/A Os01t0101700-00.exon2 transcript:Os01t0101700-00 N/A 2 N/A
262 1 irgsp CDS 82507 82932 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101700-00 N/A N/A transcript:Os01t0101700-00 Os01t0101700-00 N/A N/A
263 1 irgsp CDS 83724 83864 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101700-00 N/A N/A transcript:Os01t0101700-00 Os01t0101700-00 N/A N/A
264 1 irgsp five_prime_UTR 82426 82506 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-19 N/A N/A transcript:Os01t0101700-00 N/A N/A N/A
265 1 irgsp three_prime_UTR 83865 84095 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-20 N/A N/A transcript:Os01t0101700-00 N/A N/A N/A
266 1 irgsp gene 85337 88844 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0101800-01) N/A N/A N/A Os01g0101800 gene:Os01g0101800 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
267 1 irgsp mRNA 85337 88844 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101800-01 N/A N/A gene:Os01g0101800 N/A N/A Os01t0101800-01
268 1 irgsp exon 85337 85600 . 1 . N/A N/A 1 N/A 0 -1 Os01t0101800-01.exon1 N/A Os01t0101800-01.exon1 N/A Os01t0101800-01.exon1 transcript:Os01t0101800-01 N/A 1 N/A
269 1 irgsp exon 85737 85830 . 1 . N/A N/A 1 N/A 1 0 Os01t0101800-01.exon2 N/A Os01t0101800-01.exon2 N/A Os01t0101800-01.exon2 transcript:Os01t0101800-01 N/A 2 N/A
270 1 irgsp exon 85935 86086 . 1 . N/A N/A 1 N/A 0 1 Os01t0101800-01.exon3 N/A Os01t0101800-01.exon3 N/A Os01t0101800-01.exon3 transcript:Os01t0101800-01 N/A 3 N/A
271 1 irgsp exon 86212 86299 . 1 . N/A N/A 1 N/A 1 0 Os01t0101800-01.exon4 N/A Os01t0101800-01.exon4 N/A Os01t0101800-01.exon4 transcript:Os01t0101800-01 N/A 4 N/A
272 1 irgsp exon 86399 87681 . 1 . N/A N/A 1 N/A 0 1 Os01t0101800-01.exon5 N/A Os01t0101800-01.exon5 N/A Os01t0101800-01.exon5 transcript:Os01t0101800-01 N/A 5 N/A
273 1 irgsp exon 88291 88398 . 1 . N/A N/A 1 N/A 0 0 Os01t0101800-01.exon6 N/A Os01t0101800-01.exon6 N/A Os01t0101800-01.exon6 transcript:Os01t0101800-01 N/A 6 N/A
274 1 irgsp exon 88500 88844 . 1 . N/A N/A 1 N/A -1 0 Os01t0101800-01.exon7 N/A Os01t0101800-01.exon7 N/A Os01t0101800-01.exon7 transcript:Os01t0101800-01 N/A 7 N/A
275 1 irgsp CDS 85379 85600 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
276 1 irgsp CDS 85737 85830 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
277 1 irgsp CDS 85935 86086 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
278 1 irgsp CDS 86212 86299 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
279 1 irgsp CDS 86399 87681 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
280 1 irgsp CDS 88291 88398 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
281 1 irgsp CDS 88500 88583 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101800-01 N/A N/A transcript:Os01t0101800-01 Os01t0101800-01 N/A N/A
282 1 irgsp five_prime_UTR 85337 85378 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-20 N/A N/A transcript:Os01t0101800-01 N/A N/A N/A
283 1 irgsp three_prime_UTR 88584 88844 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-21 N/A N/A transcript:Os01t0101800-01 N/A N/A N/A
284 1 irgsp gene 86211 88583 . -1 . N/A protein_coding N/A Hypothetical protein. (Os01t0101850-00) N/A N/A N/A Os01g0101850 gene:Os01g0101850 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
285 1 irgsp mRNA 86211 88583 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101850-00 N/A N/A gene:Os01g0101850 N/A N/A Os01t0101850-00
286 1 irgsp exon 86211 86277 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101850-00.exon4 N/A Os01t0101850-00.exon4 N/A Os01t0101850-00.exon4 transcript:Os01t0101850-00 N/A 4 N/A
287 1 irgsp exon 86384 87694 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101850-00.exon3 N/A Os01t0101850-00.exon3 N/A Os01t0101850-00.exon3 transcript:Os01t0101850-00 N/A 3 N/A
288 1 irgsp exon 88308 88396 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101850-00.exon2 N/A Os01t0101850-00.exon2 N/A Os01t0101850-00.exon2 transcript:Os01t0101850-00 N/A 2 N/A
289 1 irgsp exon 88496 88583 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101850-00.exon1 N/A Os01t0101850-00.exon1 N/A Os01t0101850-00.exon1 transcript:Os01t0101850-00 N/A 1 N/A
290 1 irgsp CDS 87327 87662 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101850-00 N/A N/A transcript:Os01t0101850-00 Os01t0101850-00 N/A N/A
291 1 irgsp five_prime_UTR 87663 87694 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-21 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
292 1 irgsp five_prime_UTR 88308 88396 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-22 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
293 1 irgsp five_prime_UTR 88496 88583 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-23 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
294 1 irgsp three_prime_UTR 86211 86277 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-22 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
295 1 irgsp three_prime_UTR 86384 87326 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-23 N/A N/A transcript:Os01t0101850-00 N/A N/A N/A
296 1 irgsp gene 88883 89228 . -1 . N/A protein_coding N/A Similar to OSIGBa0075F02.3 protein. (Os01t0101900-00) N/A N/A N/A Os01g0101900 gene:Os01g0101900 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
297 1 irgsp mRNA 88883 89228 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0101900-00 N/A N/A gene:Os01g0101900 N/A N/A Os01t0101900-00
298 1 irgsp exon 88883 89228 . -1 . N/A N/A 1 N/A -1 -1 Os01t0101900-00.exon1 N/A Os01t0101900-00.exon1 N/A Os01t0101900-00.exon1 transcript:Os01t0101900-00 N/A 1 N/A
299 1 irgsp CDS 88986 89204 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0101900-00 N/A N/A transcript:Os01t0101900-00 Os01t0101900-00 N/A N/A
300 1 irgsp five_prime_UTR 89205 89228 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-24 N/A N/A transcript:Os01t0101900-00 N/A N/A N/A
301 1 irgsp three_prime_UTR 88883 88985 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-24 N/A N/A transcript:Os01t0101900-00 N/A N/A N/A
302 1 irgsp gene 89763 91465 . -1 . N/A protein_coding N/A Phosphoesterase family protein. (Os01t0102000-01) N/A N/A N/A Os01g0102000 gene:Os01g0102000 irgspv1.0-20170804-genes NON-SPECIFIC PHOSPHOLIPASE C5 N/A N/A N/A N/A
303 1 irgsp mRNA 89763 91465 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102000-01 N/A N/A gene:Os01g0102000 N/A N/A Os01t0102000-01
304 1 irgsp exon 89763 91465 . -1 . N/A N/A 1 N/A -1 -1 Os01t0102000-01.exon1 N/A Os01t0102000-01.exon1 N/A Os01t0102000-01.exon1 transcript:Os01t0102000-01 N/A 1 N/A
305 1 irgsp CDS 89825 91411 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102000-01 N/A N/A transcript:Os01t0102000-01 Os01t0102000-01 N/A N/A
306 1 irgsp five_prime_UTR 91412 91465 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-25 N/A N/A transcript:Os01t0102000-01 N/A N/A N/A
307 1 irgsp three_prime_UTR 89763 89824 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-25 N/A N/A transcript:Os01t0102000-01 N/A N/A N/A
308 1 irgsp gene 134300 135439 . 1 . N/A protein_coding N/A Thylakoid lumen protein, Photosynthesis and chloroplast development (Os01t0102300-01) N/A N/A N/A Os01g0102300 gene:Os01g0102300 irgspv1.0-20170804-genes OsTLP27 N/A N/A N/A N/A
309 1 irgsp mRNA 134300 135439 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102300-01 N/A N/A gene:Os01g0102300 N/A N/A Os01t0102300-01
310 1 irgsp exon 134300 134615 . 1 . N/A N/A 1 N/A 2 -1 Os01t0102300-01.exon1 N/A Os01t0102300-01.exon1 N/A Os01t0102300-01.exon1 transcript:Os01t0102300-01 N/A 1 N/A
311 1 irgsp exon 134698 134824 . 1 . N/A N/A 1 N/A 0 2 Os01t0102300-01.exon2 N/A Os01t0102300-01.exon2 N/A Os01t0102300-01.exon2 transcript:Os01t0102300-01 N/A 2 N/A
312 1 irgsp exon 134912 135439 . 1 . N/A N/A 1 N/A -1 0 Os01t0102300-01.exon3 N/A Os01t0102300-01.exon3 N/A Os01t0102300-01.exon3 transcript:Os01t0102300-01 N/A 3 N/A
313 1 irgsp CDS 134311 134615 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102300-01 N/A N/A transcript:Os01t0102300-01 Os01t0102300-01 N/A N/A
314 1 irgsp CDS 134698 134824 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102300-01 N/A N/A transcript:Os01t0102300-01 Os01t0102300-01 N/A N/A
315 1 irgsp CDS 134912 135253 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102300-01 N/A N/A transcript:Os01t0102300-01 Os01t0102300-01 N/A N/A
316 1 irgsp five_prime_UTR 134300 134310 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-26 N/A N/A transcript:Os01t0102300-01 N/A N/A N/A
317 1 irgsp three_prime_UTR 135254 135439 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-26 N/A N/A transcript:Os01t0102300-01 N/A N/A N/A
318 1 irgsp gene 139826 141555 . 1 . N/A protein_coding N/A Histone-fold domain containing protein. (Os01t0102400-01) N/A N/A N/A Os01g0102400 gene:Os01g0102400 irgspv1.0-20170804-genes HAP5H SUBUNIT OF CCAAT-BOX BINDING COMPLEX N/A N/A N/A N/A
319 1 irgsp mRNA 139826 141555 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102400-01 N/A N/A gene:Os01g0102400 N/A N/A Os01t0102400-01
320 1 irgsp exon 139826 139906 . 1 . N/A N/A 1 N/A -1 -1 Os01t0102400-01.exon1 N/A Os01t0102400-01.exon1 N/A Os01t0102400-01.exon1 transcript:Os01t0102400-01 N/A 1 N/A
321 1 irgsp exon 140120 141555 . 1 . N/A N/A 1 N/A -1 -1 Os01t0102400-01.exon2 N/A Os01t0102400-01.exon2 N/A Os01t0102400-01.exon2 transcript:Os01t0102400-01 N/A 2 N/A
322 1 irgsp CDS 140150 141415 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102400-01 N/A N/A transcript:Os01t0102400-01 Os01t0102400-01 N/A N/A
323 1 irgsp five_prime_UTR 139826 139906 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-27 N/A N/A transcript:Os01t0102400-01 N/A N/A N/A
324 1 irgsp five_prime_UTR 140120 140149 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-28 N/A N/A transcript:Os01t0102400-01 N/A N/A N/A
325 1 irgsp three_prime_UTR 141416 141555 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-27 N/A N/A transcript:Os01t0102400-01 N/A N/A N/A
326 1 irgsp gene 141959 144554 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0102500-01) N/A N/A N/A Os01g0102500 gene:Os01g0102500 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
327 1 irgsp mRNA 141959 144554 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102500-01 N/A N/A gene:Os01g0102500 N/A N/A Os01t0102500-01
328 1 irgsp exon 141959 142631 . 1 . N/A N/A 1 N/A 2 -1 Os01t0102500-01.exon1 N/A Os01t0102500-01.exon1 N/A Os01t0102500-01.exon1 transcript:Os01t0102500-01 N/A 1 N/A
329 1 irgsp exon 143191 143431 . 1 . N/A N/A 1 N/A 0 2 Os01t0102500-01.exon2 N/A Os01t0102500-01.exon2 N/A Os01t0102500-01.exon2 transcript:Os01t0102500-01 N/A 2 N/A
330 1 irgsp exon 143563 143680 . 1 . N/A N/A 1 N/A 1 0 Os01t0102500-01.exon3 N/A Os01t0102500-01.exon3 N/A Os01t0102500-01.exon3 transcript:Os01t0102500-01 N/A 3 N/A
331 1 irgsp exon 143817 144554 . 1 . N/A N/A 1 N/A -1 1 Os01t0102500-01.exon4 N/A Os01t0102500-01.exon4 N/A Os01t0102500-01.exon4 transcript:Os01t0102500-01 N/A 4 N/A
332 1 irgsp CDS 142084 142631 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102500-01 N/A N/A transcript:Os01t0102500-01 Os01t0102500-01 N/A N/A
333 1 irgsp CDS 143191 143431 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102500-01 N/A N/A transcript:Os01t0102500-01 Os01t0102500-01 N/A N/A
334 1 irgsp CDS 143563 143680 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102500-01 N/A N/A transcript:Os01t0102500-01 Os01t0102500-01 N/A N/A
335 1 irgsp CDS 143817 143908 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102500-01 N/A N/A transcript:Os01t0102500-01 Os01t0102500-01 N/A N/A
336 1 irgsp five_prime_UTR 141959 142083 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-29 N/A N/A transcript:Os01t0102500-01 N/A N/A N/A
337 1 irgsp three_prime_UTR 143909 144554 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-28 N/A N/A transcript:Os01t0102500-01 N/A N/A N/A
338 1 irgsp gene 145603 147847 . 1 . N/A protein_coding N/A Shikimate kinase domain containing protein. (Os01t0102600-01);Similar to shikimate kinase family protein. (Os01t0102600-02) N/A N/A N/A Os01g0102600 gene:Os01g0102600 irgspv1.0-20170804-genes Shikimate kinase 4 N/A N/A N/A N/A
339 1 irgsp mRNA 145603 147847 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102600-01 N/A N/A gene:Os01g0102600 N/A N/A Os01t0102600-01
340 1 irgsp exon 145603 145786 . 1 . N/A N/A 0 N/A 1 -1 Os01t0102600-01.exon1 N/A Os01t0102600-01.exon1 N/A Os01t0102600-01.exon1 transcript:Os01t0102600-01 N/A 1 N/A
341 1 irgsp exon 145905 145951 . 1 . N/A N/A 0 N/A 0 1 Os01t0102600-01.exon2 N/A Os01t0102600-01.exon2 N/A Os01t0102600-01.exon2 transcript:Os01t0102600-01 N/A 2 N/A
342 1 irgsp exon 146028 146082 . 1 . N/A N/A 0 N/A 1 0 Os01t0102600-01.exon3 N/A Os01t0102600-01.exon3 N/A Os01t0102600-01.exon3 transcript:Os01t0102600-01 N/A 3 N/A
343 1 irgsp exon 146179 146339 . 1 . N/A N/A 0 N/A 0 1 Os01t0102600-01.exon4 N/A Os01t0102600-01.exon4 N/A Os01t0102600-01.exon4 transcript:Os01t0102600-01 N/A 4 N/A
344 1 irgsp exon 146450 146532 . 1 . N/A N/A 0 N/A 2 0 Os01t0102600-01.exon5 N/A Os01t0102600-01.exon5 N/A Os01t0102600-01.exon5 transcript:Os01t0102600-01 N/A 5 N/A
345 1 irgsp exon 146611 146719 . 1 . N/A N/A 0 N/A 0 2 Os01t0102600-01.exon6 N/A Os01t0102600-01.exon6 N/A Os01t0102600-01.exon6 transcript:Os01t0102600-01 N/A 6 N/A
346 1 irgsp exon 147106 147184 . 1 . N/A N/A 0 N/A 1 0 Os01t0102600-01.exon7 N/A Os01t0102600-01.exon7 N/A Os01t0102600-01.exon7 transcript:Os01t0102600-01 N/A 7 N/A
347 1 irgsp exon 147311 147375 . 1 . N/A N/A 1 N/A 0 1 Os01t0102600-02.exon2 N/A Os01t0102600-02.exon2 N/A Os01t0102600-02.exon2 transcript:Os01t0102600-01 N/A 8 N/A
348 1 irgsp exon 147507 147847 . 1 . N/A N/A 0 N/A -1 0 Os01t0102600-01.exon9 N/A Os01t0102600-01.exon9 N/A Os01t0102600-01.exon9 transcript:Os01t0102600-01 N/A 9 N/A
349 1 irgsp CDS 145645 145786 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
350 1 irgsp CDS 145905 145951 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
351 1 irgsp CDS 146028 146082 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
352 1 irgsp CDS 146179 146339 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
353 1 irgsp CDS 146450 146532 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
354 1 irgsp CDS 146611 146719 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
355 1 irgsp CDS 147106 147184 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
356 1 irgsp CDS 147311 147375 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
357 1 irgsp CDS 147507 147575 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-01 N/A N/A transcript:Os01t0102600-01 Os01t0102600-01 N/A N/A
358 1 irgsp five_prime_UTR 145603 145644 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-30 N/A N/A transcript:Os01t0102600-01 N/A N/A N/A
359 1 irgsp three_prime_UTR 147576 147847 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-29 N/A N/A transcript:Os01t0102600-01 N/A N/A N/A
360 1 irgsp mRNA 147104 147805 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102600-02 N/A N/A gene:Os01g0102600 N/A N/A Os01t0102600-02
361 1 irgsp exon 147104 147184 . 1 . N/A N/A 0 N/A 1 -1 Os01t0102600-02.exon1 N/A Os01t0102600-02.exon1 N/A Os01t0102600-02.exon1 transcript:Os01t0102600-02 N/A 1 N/A
362 1 irgsp exon 147311 147375 . 1 . N/A N/A 1 N/A 0 1 Os01t0102600-02.exon2 N/A agat-exon-4 N/A Os01t0102600-02.exon2 transcript:Os01t0102600-02 N/A 2 N/A
363 1 irgsp exon 147507 147805 . 1 . N/A N/A 0 N/A -1 0 Os01t0102600-02.exon3 N/A Os01t0102600-02.exon3 N/A Os01t0102600-02.exon3 transcript:Os01t0102600-02 N/A 3 N/A
364 1 irgsp CDS 147106 147184 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-02 N/A N/A transcript:Os01t0102600-02 Os01t0102600-02 N/A N/A
365 1 irgsp CDS 147311 147375 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-02 N/A N/A transcript:Os01t0102600-02 Os01t0102600-02 N/A N/A
366 1 irgsp CDS 147507 147575 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102600-02 N/A N/A transcript:Os01t0102600-02 Os01t0102600-02 N/A N/A
367 1 irgsp five_prime_UTR 147104 147105 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-31 N/A N/A transcript:Os01t0102600-02 N/A N/A N/A
368 1 irgsp three_prime_UTR 147576 147805 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-30 N/A N/A transcript:Os01t0102600-02 N/A N/A N/A
369 1 irgsp gene 148085 150568 . 1 . N/A protein_coding N/A Translocon-associated beta family protein. (Os01t0102700-01) N/A N/A N/A Os01g0102700 gene:Os01g0102700 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
370 1 irgsp mRNA 148085 150568 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102700-01 N/A N/A gene:Os01g0102700 N/A N/A Os01t0102700-01
371 1 irgsp exon 148085 148313 . 1 . N/A N/A 1 N/A 2 -1 Os01t0102700-01.exon1 N/A Os01t0102700-01.exon1 N/A Os01t0102700-01.exon1 transcript:Os01t0102700-01 N/A 1 N/A
372 1 irgsp exon 149450 149548 . 1 . N/A N/A 1 N/A 2 2 Os01t0102700-01.exon2 N/A Os01t0102700-01.exon2 N/A Os01t0102700-01.exon2 transcript:Os01t0102700-01 N/A 2 N/A
373 1 irgsp exon 149634 149742 . 1 . N/A N/A 1 N/A 0 2 Os01t0102700-01.exon3 N/A Os01t0102700-01.exon3 N/A Os01t0102700-01.exon3 transcript:Os01t0102700-01 N/A 3 N/A
374 1 irgsp exon 149856 149931 . 1 . N/A N/A 1 N/A 1 0 Os01t0102700-01.exon4 N/A Os01t0102700-01.exon4 N/A Os01t0102700-01.exon4 transcript:Os01t0102700-01 N/A 4 N/A
375 1 irgsp exon 150152 150568 . 1 . N/A N/A 1 N/A -1 1 Os01t0102700-01.exon5 N/A Os01t0102700-01.exon5 N/A Os01t0102700-01.exon5 transcript:Os01t0102700-01 N/A 5 N/A
376 1 irgsp CDS 148147 148313 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
377 1 irgsp CDS 149450 149548 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
378 1 irgsp CDS 149634 149742 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
379 1 irgsp CDS 149856 149931 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
380 1 irgsp CDS 150152 150318 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102700-01 N/A N/A transcript:Os01t0102700-01 Os01t0102700-01 N/A N/A
381 1 irgsp five_prime_UTR 148085 148146 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-32 N/A N/A transcript:Os01t0102700-01 N/A N/A N/A
382 1 irgsp three_prime_UTR 150319 150568 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-31 N/A N/A transcript:Os01t0102700-01 N/A N/A N/A
383 1 irgsp gene 152853 156449 . 1 . N/A protein_coding N/A Similar to chromatin remodeling complex subunit. (Os01t0102800-01) N/A N/A N/A Os01g0102800 gene:Os01g0102800 irgspv1.0-20170804-genes Cockayne syndrome WD-repeat protein N/A N/A N/A N/A
384 1 irgsp mRNA 152853 156449 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102800-01 N/A N/A gene:Os01g0102800 N/A N/A Os01t0102800-01
385 1 irgsp exon 152853 153025 . 1 . N/A N/A 1 N/A 1 -1 Os01t0102800-01.exon1 N/A Os01t0102800-01.exon1 N/A Os01t0102800-01.exon1 transcript:Os01t0102800-01 N/A 1 N/A
386 1 irgsp exon 153178 154646 . 1 . N/A N/A 1 N/A 0 1 Os01t0102800-01.exon2 N/A Os01t0102800-01.exon2 N/A Os01t0102800-01.exon2 transcript:Os01t0102800-01 N/A 2 N/A
387 1 irgsp exon 155010 155450 . 1 . N/A N/A 1 N/A 0 0 Os01t0102800-01.exon3 N/A Os01t0102800-01.exon3 N/A Os01t0102800-01.exon3 transcript:Os01t0102800-01 N/A 3 N/A
388 1 irgsp exon 155543 156449 . 1 . N/A N/A 1 N/A -1 0 Os01t0102800-01.exon4 N/A Os01t0102800-01.exon4 N/A Os01t0102800-01.exon4 transcript:Os01t0102800-01 N/A 4 N/A
389 1 irgsp CDS 152854 153025 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102800-01 N/A N/A transcript:Os01t0102800-01 Os01t0102800-01 N/A N/A
390 1 irgsp CDS 153178 154646 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102800-01 N/A N/A transcript:Os01t0102800-01 Os01t0102800-01 N/A N/A
391 1 irgsp CDS 155010 155450 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102800-01 N/A N/A transcript:Os01t0102800-01 Os01t0102800-01 N/A N/A
392 1 irgsp CDS 155543 156214 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102800-01 N/A N/A transcript:Os01t0102800-01 Os01t0102800-01 N/A N/A
393 1 irgsp five_prime_UTR 152853 152853 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-33 N/A N/A transcript:Os01t0102800-01 N/A N/A N/A
394 1 irgsp three_prime_UTR 156215 156449 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-32 N/A N/A transcript:Os01t0102800-01 N/A N/A N/A
395 1 irgsp gene 164577 168921 . 1 . N/A protein_coding N/A Similar to nitrilase 2. (Os01t0102850-00) N/A N/A N/A Os01g0102850 gene:Os01g0102850 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
396 1 irgsp mRNA 164577 168921 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102850-00 N/A N/A gene:Os01g0102850 N/A N/A Os01t0102850-00
397 1 irgsp exon 164577 164905 . 1 . N/A N/A 1 N/A -1 -1 Os01t0102850-00.exon1 N/A Os01t0102850-00.exon1 N/A Os01t0102850-00.exon1 transcript:Os01t0102850-00 N/A 1 N/A
398 1 irgsp exon 168499 168921 . 1 . N/A N/A 1 N/A 0 -1 Os01t0102850-00.exon2 N/A Os01t0102850-00.exon2 N/A Os01t0102850-00.exon2 transcript:Os01t0102850-00 N/A 2 N/A
399 1 irgsp CDS 168805 168921 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102850-00 N/A N/A transcript:Os01t0102850-00 Os01t0102850-00 N/A N/A
400 1 irgsp five_prime_UTR 164577 164905 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-34 N/A N/A transcript:Os01t0102850-00 N/A N/A N/A
401 1 irgsp five_prime_UTR 168499 168804 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-35 N/A N/A transcript:Os01t0102850-00 N/A N/A N/A
402 1 irgsp gene 169390 170316 . -1 . N/A protein_coding N/A Light-regulated protein, Regulation of light-dependent attachment of LEAF-TYPE FERREDOXIN-NADP+ OXIDOREDUCTASE (LFNR) to the thylakoid membrane (Os01t0102900-01) N/A N/A N/A Os01g0102900 gene:Os01g0102900 irgspv1.0-20170804-genes LIGHT-REGULATED GENE 1 N/A N/A N/A N/A
403 1 irgsp mRNA 169390 170316 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0102900-01 N/A N/A gene:Os01g0102900 N/A N/A Os01t0102900-01
404 1 irgsp exon 169390 169656 . -1 . N/A N/A 1 N/A -1 2 Os01t0102900-01.exon3 N/A Os01t0102900-01.exon3 N/A Os01t0102900-01.exon3 transcript:Os01t0102900-01 N/A 3 N/A
405 1 irgsp exon 169751 169909 . -1 . N/A N/A 1 N/A 2 2 Os01t0102900-01.exon2 N/A Os01t0102900-01.exon2 N/A Os01t0102900-01.exon2 transcript:Os01t0102900-01 N/A 2 N/A
406 1 irgsp exon 170091 170316 . -1 . N/A N/A 1 N/A 2 -1 Os01t0102900-01.exon1 N/A Os01t0102900-01.exon1 N/A Os01t0102900-01.exon1 transcript:Os01t0102900-01 N/A 1 N/A
407 1 irgsp CDS 169599 169656 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102900-01 N/A N/A transcript:Os01t0102900-01 Os01t0102900-01 N/A N/A
408 1 irgsp CDS 169751 169909 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102900-01 N/A N/A transcript:Os01t0102900-01 Os01t0102900-01 N/A N/A
409 1 irgsp CDS 170091 170260 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0102900-01 N/A N/A transcript:Os01t0102900-01 Os01t0102900-01 N/A N/A
410 1 irgsp five_prime_UTR 170261 170316 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-36 N/A N/A transcript:Os01t0102900-01 N/A N/A N/A
411 1 irgsp three_prime_UTR 169390 169598 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-33 N/A N/A transcript:Os01t0102900-01 N/A N/A N/A
412 1 irgsp gene 170798 173144 . -1 . N/A protein_coding N/A Snf7 family protein. (Os01t0103000-01) N/A N/A N/A Os01g0103000 gene:Os01g0103000 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
413 1 irgsp mRNA 170798 173144 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103000-01 N/A N/A gene:Os01g0103000 N/A N/A Os01t0103000-01
414 1 irgsp exon 170798 171095 . -1 . N/A N/A 1 N/A -1 0 Os01t0103000-01.exon7 N/A Os01t0103000-01.exon7 N/A Os01t0103000-01.exon7 transcript:Os01t0103000-01 N/A 7 N/A
415 1 irgsp exon 171406 171554 . -1 . N/A N/A 1 N/A 0 1 Os01t0103000-01.exon6 N/A Os01t0103000-01.exon6 N/A Os01t0103000-01.exon6 transcript:Os01t0103000-01 N/A 6 N/A
416 1 irgsp exon 171764 171875 . -1 . N/A N/A 1 N/A 1 0 Os01t0103000-01.exon5 N/A Os01t0103000-01.exon5 N/A Os01t0103000-01.exon5 transcript:Os01t0103000-01 N/A 5 N/A
417 1 irgsp exon 172398 172469 . -1 . N/A N/A 1 N/A 0 0 Os01t0103000-01.exon4 N/A Os01t0103000-01.exon4 N/A Os01t0103000-01.exon4 transcript:Os01t0103000-01 N/A 4 N/A
418 1 irgsp exon 172578 172671 . -1 . N/A N/A 1 N/A 0 2 Os01t0103000-01.exon3 N/A Os01t0103000-01.exon3 N/A Os01t0103000-01.exon3 transcript:Os01t0103000-01 N/A 3 N/A
419 1 irgsp exon 172770 172921 . -1 . N/A N/A 1 N/A 2 0 Os01t0103000-01.exon2 N/A Os01t0103000-01.exon2 N/A Os01t0103000-01.exon2 transcript:Os01t0103000-01 N/A 2 N/A
420 1 irgsp exon 173004 173144 . -1 . N/A N/A 1 N/A 0 -1 Os01t0103000-01.exon1 N/A Os01t0103000-01.exon1 N/A Os01t0103000-01.exon1 transcript:Os01t0103000-01 N/A 1 N/A
421 1 irgsp CDS 171045 171095 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
422 1 irgsp CDS 171406 171554 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
423 1 irgsp CDS 171764 171875 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
424 1 irgsp CDS 172398 172469 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
425 1 irgsp CDS 172578 172671 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
426 1 irgsp CDS 172770 172921 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
427 1 irgsp CDS 173004 173072 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103000-01 N/A N/A transcript:Os01t0103000-01 Os01t0103000-01 N/A N/A
428 1 irgsp five_prime_UTR 173073 173144 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-37 N/A N/A transcript:Os01t0103000-01 N/A N/A N/A
429 1 irgsp three_prime_UTR 170798 171044 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-34 N/A N/A transcript:Os01t0103000-01 N/A N/A N/A
430 1 irgsp gene 178607 180575 . 1 . N/A protein_coding N/A TGF-beta receptor, type I/II extracellular region family protein. (Os01t0103100-01);Similar to predicted protein. (Os01t0103100-02) N/A N/A N/A Os01g0103100 gene:Os01g0103100 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
431 1 irgsp mRNA 178607 180548 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103100-01 N/A N/A gene:Os01g0103100 N/A N/A Os01t0103100-01
432 1 irgsp exon 178607 180548 . 1 . N/A N/A 0 N/A -1 -1 Os01t0103100-01.exon1 N/A Os01t0103100-01.exon1 N/A Os01t0103100-01.exon1 transcript:Os01t0103100-01 N/A 1 N/A
433 1 irgsp CDS 178642 180462 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103100-01 N/A N/A transcript:Os01t0103100-01 Os01t0103100-01 N/A N/A
434 1 irgsp five_prime_UTR 178607 178641 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-38 N/A N/A transcript:Os01t0103100-01 N/A N/A N/A
435 1 irgsp three_prime_UTR 180463 180548 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-35 N/A N/A transcript:Os01t0103100-01 N/A N/A N/A
436 1 irgsp mRNA 178652 180575 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103100-02 N/A N/A gene:Os01g0103100 N/A N/A Os01t0103100-02
437 1 irgsp exon 178652 180575 . 1 . N/A N/A 0 N/A -1 -1 Os01t0103100-02.exon1 N/A Os01t0103100-02.exon1 N/A Os01t0103100-02.exon1 transcript:Os01t0103100-02 N/A 1 N/A
438 1 irgsp CDS 178678 180462 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103100-02 N/A N/A transcript:Os01t0103100-02 Os01t0103100-02 N/A N/A
439 1 irgsp five_prime_UTR 178652 178677 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-39 N/A N/A transcript:Os01t0103100-02 N/A N/A N/A
440 1 irgsp three_prime_UTR 180463 180575 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-36 N/A N/A transcript:Os01t0103100-02 N/A N/A N/A
441 1 irgsp gene 178815 180433 . -1 . N/A protein_coding N/A Hypothetical protein. (Os01t0103075-00) N/A N/A N/A Os01g0103075 gene:Os01g0103075 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
442 1 irgsp mRNA 178815 180433 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103075-00 N/A N/A gene:Os01g0103075 N/A N/A Os01t0103075-00
443 1 irgsp exon 178815 180433 . -1 . N/A N/A 1 N/A -1 -1 Os01t0103075-00.exon1 N/A Os01t0103075-00.exon1 N/A Os01t0103075-00.exon1 transcript:Os01t0103075-00 N/A 1 N/A
444 1 irgsp CDS 179512 180054 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103075-00 N/A N/A transcript:Os01t0103075-00 Os01t0103075-00 N/A N/A
445 1 irgsp five_prime_UTR 180055 180433 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-40 N/A N/A transcript:Os01t0103075-00 N/A N/A N/A
446 1 irgsp three_prime_UTR 178815 179511 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-37 N/A N/A transcript:Os01t0103075-00 N/A N/A N/A
447 1 Ensembl_Plants ncRNA_gene 182074 182154 . 1 . N/A tRNA N/A tRNA-Leu for anticodon AAG N/A N/A N/A ENSRNA049442722 gene:ENSRNA049442722 trnascan_gene tRNA-Leu N/A N/A N/A N/A
448 1 Ensembl_Plants tRNA 182074 182154 . 1 . N/A tRNA N/A N/A N/A N/A N/A N/A transcript:ENSRNA049442722-T1 N/A N/A gene:ENSRNA049442722 N/A N/A ENSRNA049442722-T1
449 1 Ensembl_Plants exon 182074 182154 . 1 . N/A N/A 1 N/A -1 -1 ENSRNA049442722-E1 N/A ENSRNA049442722-E1 N/A ENSRNA049442722-E1 transcript:ENSRNA049442722-T1 N/A 1 N/A
450 1 irgsp gene 185189 185828 . -1 . N/A protein_coding N/A Hypothetical gene. (Os01t0103400-01) N/A N/A N/A Os01g0103400 gene:Os01g0103400 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
451 1 irgsp mRNA 185189 185828 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103400-01 N/A N/A gene:Os01g0103400 N/A N/A Os01t0103400-01
452 1 irgsp exon 185189 185828 . -1 . N/A N/A 1 N/A -1 -1 Os01t0103400-01.exon1 N/A Os01t0103400-01.exon1 N/A Os01t0103400-01.exon1 transcript:Os01t0103400-01 N/A 1 N/A
453 1 irgsp CDS 185435 185827 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103400-01 N/A N/A transcript:Os01t0103400-01 Os01t0103400-01 N/A N/A
454 1 irgsp five_prime_UTR 185828 185828 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-41 N/A N/A transcript:Os01t0103400-01 N/A N/A N/A
455 1 irgsp three_prime_UTR 185189 185434 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-38 N/A N/A transcript:Os01t0103400-01 N/A N/A N/A
456 1 irgsp repeat_region 186000 186100 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A fakeRepeat2 N/A N/A N/A N/A N/A N/A
457 1 irgsp gene 186250 190904 . -1 . N/A protein_coding N/A Similar to sterol-8,7-isomerase. (Os01t0103600-01);Emopamil-binding family protein. (Os01t0103600-02) N/A N/A N/A Os01g0103600 gene:Os01g0103600 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
458 1 irgsp mRNA 186250 190262 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103600-02 N/A N/A gene:Os01g0103600 N/A N/A Os01t0103600-02
459 1 irgsp exon 186250 186771 . -1 . N/A N/A 0 N/A -1 2 Os01t0103600-02.exon4 N/A Os01t0103600-02.exon4 N/A Os01t0103600-02.exon4 transcript:Os01t0103600-02 N/A 4 N/A
460 1 irgsp exon 189607 189715 . -1 . N/A N/A 0 N/A 2 1 Os01t0103600-02.exon3 N/A Os01t0103600-02.exon3 N/A Os01t0103600-02.exon3 transcript:Os01t0103600-02 N/A 3 N/A
461 1 irgsp exon 189841 189990 . -1 . N/A N/A 1 N/A 1 1 Os01t0103600-02.exon2 N/A Os01t0103600-02.exon2 N/A Os01t0103600-02.exon2 transcript:Os01t0103600-02 N/A 2 N/A
462 1 irgsp exon 190087 190262 . -1 . N/A N/A 0 N/A 1 -1 Os01t0103600-02.exon1 N/A Os01t0103600-02.exon1 N/A Os01t0103600-02.exon1 transcript:Os01t0103600-02 N/A 1 N/A
463 1 irgsp CDS 186516 186771 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-02 N/A N/A transcript:Os01t0103600-02 Os01t0103600-02 N/A N/A
464 1 irgsp CDS 189607 189715 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-02 N/A N/A transcript:Os01t0103600-02 Os01t0103600-02 N/A N/A
465 1 irgsp CDS 189841 189990 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-02 N/A N/A transcript:Os01t0103600-02 Os01t0103600-02 N/A N/A
466 1 irgsp CDS 190087 190231 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-02 N/A N/A transcript:Os01t0103600-02 Os01t0103600-02 N/A N/A
467 1 irgsp five_prime_UTR 190232 190262 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-42 N/A N/A transcript:Os01t0103600-02 N/A N/A N/A
468 1 irgsp three_prime_UTR 186250 186515 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-39 N/A N/A transcript:Os01t0103600-02 N/A N/A N/A
469 1 irgsp mRNA 187345 190904 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103600-01 N/A N/A gene:Os01g0103600 N/A N/A Os01t0103600-01
470 1 irgsp exon 187345 189715 . -1 . N/A N/A 0 N/A -1 1 Os01t0103600-01.exon3 N/A Os01t0103600-01.exon3 N/A Os01t0103600-01.exon3 transcript:Os01t0103600-01 N/A 3 N/A
471 1 irgsp exon 189841 189990 . -1 . N/A N/A 1 N/A 1 1 Os01t0103600-02.exon2 N/A agat-exon-5 N/A Os01t0103600-02.exon2 transcript:Os01t0103600-01 N/A 2 N/A
472 1 irgsp exon 190087 190904 . -1 . N/A N/A 0 N/A 1 -1 Os01t0103600-01.exon1 N/A Os01t0103600-01.exon1 N/A Os01t0103600-01.exon1 transcript:Os01t0103600-01 N/A 1 N/A
473 1 irgsp CDS 189396 189715 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-01 N/A N/A transcript:Os01t0103600-01 Os01t0103600-01 N/A N/A
474 1 irgsp CDS 189841 189990 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-01 N/A N/A transcript:Os01t0103600-01 Os01t0103600-01 N/A N/A
475 1 irgsp CDS 190087 190231 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103600-01 N/A N/A transcript:Os01t0103600-01 Os01t0103600-01 N/A N/A
476 1 irgsp five_prime_UTR 190232 190904 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-43 N/A N/A transcript:Os01t0103600-01 N/A N/A N/A
477 1 irgsp three_prime_UTR 187345 189395 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-40 N/A N/A transcript:Os01t0103600-01 N/A N/A N/A
478 1 irgsp gene 187545 188586 . 1 . N/A protein_coding N/A Hypothetical gene. (Os01t0103650-00) N/A N/A N/A Os01g0103650 gene:Os01g0103650 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
479 1 irgsp mRNA 187545 188586 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103650-00 N/A N/A gene:Os01g0103650 N/A N/A Os01t0103650-00
480 1 irgsp exon 187545 188020 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103650-00.exon1 N/A Os01t0103650-00.exon1 N/A Os01t0103650-00.exon1 transcript:Os01t0103650-00 N/A 1 N/A
481 1 irgsp exon 188060 188385 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103650-00.exon2 N/A Os01t0103650-00.exon2 N/A Os01t0103650-00.exon2 transcript:Os01t0103650-00 N/A 2 N/A
482 1 irgsp exon 188455 188586 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103650-00.exon3 N/A Os01t0103650-00.exon3 N/A Os01t0103650-00.exon3 transcript:Os01t0103650-00 N/A 3 N/A
483 1 irgsp CDS 187547 187768 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103650-00 N/A N/A transcript:Os01t0103650-00 Os01t0103650-00 N/A N/A
484 1 irgsp five_prime_UTR 187545 187546 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-44 N/A N/A transcript:Os01t0103650-00 N/A N/A N/A
485 1 irgsp three_prime_UTR 187769 188020 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-41 N/A N/A transcript:Os01t0103650-00 N/A N/A N/A
486 1 irgsp three_prime_UTR 188060 188385 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-42 N/A N/A transcript:Os01t0103650-00 N/A N/A N/A
487 1 irgsp three_prime_UTR 188455 188586 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-43 N/A N/A transcript:Os01t0103650-00 N/A N/A N/A
488 1 irgsp gene 191037 196287 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0103700-01) N/A N/A N/A Os01g0103700 gene:Os01g0103700 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
489 1 irgsp mRNA 191037 196287 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103700-01 N/A N/A gene:Os01g0103700 N/A N/A Os01t0103700-01
490 1 irgsp exon 191037 191161 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103700-01.exon1 N/A Os01t0103700-01.exon1 N/A Os01t0103700-01.exon1 transcript:Os01t0103700-01 N/A 1 N/A
491 1 irgsp exon 191625 191705 . 1 . N/A N/A 1 N/A 0 -1 Os01t0103700-01.exon2 N/A Os01t0103700-01.exon2 N/A Os01t0103700-01.exon2 transcript:Os01t0103700-01 N/A 2 N/A
492 1 irgsp exon 192399 192506 . 1 . N/A N/A 1 N/A 0 0 Os01t0103700-01.exon3 N/A Os01t0103700-01.exon3 N/A Os01t0103700-01.exon3 transcript:Os01t0103700-01 N/A 3 N/A
493 1 irgsp exon 192958 193161 . 1 . N/A N/A 1 N/A 0 0 Os01t0103700-01.exon4 N/A Os01t0103700-01.exon4 N/A Os01t0103700-01.exon4 transcript:Os01t0103700-01 N/A 4 N/A
494 1 irgsp exon 193248 193356 . 1 . N/A N/A 1 N/A 1 0 Os01t0103700-01.exon5 N/A Os01t0103700-01.exon5 N/A Os01t0103700-01.exon5 transcript:Os01t0103700-01 N/A 5 N/A
495 1 irgsp exon 193434 196287 . 1 . N/A N/A 1 N/A -1 1 Os01t0103700-01.exon6 N/A Os01t0103700-01.exon6 N/A Os01t0103700-01.exon6 transcript:Os01t0103700-01 N/A 6 N/A
496 1 irgsp CDS 191694 191705 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
497 1 irgsp CDS 192399 192506 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
498 1 irgsp CDS 192958 193161 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
499 1 irgsp CDS 193248 193356 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
500 1 irgsp CDS 193434 193507 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103700-01 N/A N/A transcript:Os01t0103700-01 Os01t0103700-01 N/A N/A
501 1 irgsp five_prime_UTR 191037 191161 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-45 N/A N/A transcript:Os01t0103700-01 N/A N/A N/A
502 1 irgsp five_prime_UTR 191625 191693 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-46 N/A N/A transcript:Os01t0103700-01 N/A N/A N/A
503 1 irgsp three_prime_UTR 193508 196287 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-44 N/A N/A transcript:Os01t0103700-01 N/A N/A N/A
504 1 irgsp gene 197647 200803 . 1 . N/A protein_coding N/A Conserved hypothetical protein. (Os01t0103800-01) N/A N/A N/A Os01g0103800 gene:Os01g0103800 irgspv1.0-20170804-genes OsDW1-01g N/A N/A N/A N/A
505 1 irgsp mRNA 197647 200803 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103800-01 N/A N/A gene:Os01g0103800 N/A N/A Os01t0103800-01
506 1 irgsp exon 197647 197838 . 1 . N/A N/A 1 N/A -1 -1 Os01t0103800-01.exon1 N/A Os01t0103800-01.exon1 N/A Os01t0103800-01.exon1 transcript:Os01t0103800-01 N/A 1 N/A
507 1 irgsp exon 198034 198225 . 1 . N/A N/A 1 N/A 0 -1 Os01t0103800-01.exon2 N/A Os01t0103800-01.exon2 N/A Os01t0103800-01.exon2 transcript:Os01t0103800-01 N/A 2 N/A
508 1 irgsp exon 198830 200036 . 1 . N/A N/A 1 N/A 1 0 Os01t0103800-01.exon3 N/A Os01t0103800-01.exon3 N/A Os01t0103800-01.exon3 transcript:Os01t0103800-01 N/A 3 N/A
509 1 irgsp exon 200253 200803 . 1 . N/A N/A 1 N/A -1 1 Os01t0103800-01.exon4 N/A Os01t0103800-01.exon4 N/A Os01t0103800-01.exon4 transcript:Os01t0103800-01 N/A 4 N/A
510 1 irgsp CDS 198130 198225 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103800-01 N/A N/A transcript:Os01t0103800-01 Os01t0103800-01 N/A N/A
511 1 irgsp CDS 198830 200036 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103800-01 N/A N/A transcript:Os01t0103800-01 Os01t0103800-01 N/A N/A
512 1 irgsp CDS 200253 200479 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103800-01 N/A N/A transcript:Os01t0103800-01 Os01t0103800-01 N/A N/A
513 1 irgsp five_prime_UTR 197647 197838 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-47 N/A N/A transcript:Os01t0103800-01 N/A N/A N/A
514 1 irgsp five_prime_UTR 198034 198129 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-48 N/A N/A transcript:Os01t0103800-01 N/A N/A N/A
515 1 irgsp three_prime_UTR 200480 200803 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-45 N/A N/A transcript:Os01t0103800-01 N/A N/A N/A
516 1 irgsp gene 201944 206202 . 1 . N/A protein_coding N/A Polynucleotidyl transferase, Ribonuclease H fold domain containing protein. (Os01t0103900-01) N/A N/A N/A Os01g0103900 gene:Os01g0103900 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
517 1 irgsp mRNA 201944 206202 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0103900-01 N/A N/A gene:Os01g0103900 N/A N/A Os01t0103900-01
518 1 irgsp exon 201944 202110 . 1 . N/A N/A 1 N/A 0 -1 Os01t0103900-01.exon1 N/A Os01t0103900-01.exon1 N/A Os01t0103900-01.exon1 transcript:Os01t0103900-01 N/A 1 N/A
519 1 irgsp exon 202252 202359 . 1 . N/A N/A 1 N/A 0 0 Os01t0103900-01.exon2 N/A Os01t0103900-01.exon2 N/A Os01t0103900-01.exon2 transcript:Os01t0103900-01 N/A 2 N/A
520 1 irgsp exon 203007 203127 . 1 . N/A N/A 1 N/A 1 0 Os01t0103900-01.exon3 N/A Os01t0103900-01.exon3 N/A Os01t0103900-01.exon3 transcript:Os01t0103900-01 N/A 3 N/A
521 1 irgsp exon 203302 203429 . 1 . N/A N/A 1 N/A 0 1 Os01t0103900-01.exon4 N/A Os01t0103900-01.exon4 N/A Os01t0103900-01.exon4 transcript:Os01t0103900-01 N/A 4 N/A
522 1 irgsp exon 203511 203658 . 1 . N/A N/A 1 N/A 1 0 Os01t0103900-01.exon5 N/A Os01t0103900-01.exon5 N/A Os01t0103900-01.exon5 transcript:Os01t0103900-01 N/A 5 N/A
523 1 irgsp exon 203760 203938 . 1 . N/A N/A 1 N/A 0 1 Os01t0103900-01.exon6 N/A Os01t0103900-01.exon6 N/A Os01t0103900-01.exon6 transcript:Os01t0103900-01 N/A 6 N/A
524 1 irgsp exon 204203 204440 . 1 . N/A N/A 1 N/A 1 0 Os01t0103900-01.exon7 N/A Os01t0103900-01.exon7 N/A Os01t0103900-01.exon7 transcript:Os01t0103900-01 N/A 7 N/A
525 1 irgsp exon 204543 204635 . 1 . N/A N/A 1 N/A 1 1 Os01t0103900-01.exon8 N/A Os01t0103900-01.exon8 N/A Os01t0103900-01.exon8 transcript:Os01t0103900-01 N/A 8 N/A
526 1 irgsp exon 204730 204875 . 1 . N/A N/A 1 N/A 0 1 Os01t0103900-01.exon9 N/A Os01t0103900-01.exon9 N/A Os01t0103900-01.exon9 transcript:Os01t0103900-01 N/A 9 N/A
527 1 irgsp exon 205042 205149 . 1 . N/A N/A 1 N/A 0 0 Os01t0103900-01.exon10 N/A Os01t0103900-01.exon10 N/A Os01t0103900-01.exon10 transcript:Os01t0103900-01 N/A 10 N/A
528 1 irgsp exon 205290 205378 . 1 . N/A N/A 1 N/A 2 0 Os01t0103900-01.exon11 N/A Os01t0103900-01.exon11 N/A Os01t0103900-01.exon11 transcript:Os01t0103900-01 N/A 11 N/A
529 1 irgsp exon 205534 206202 . 1 . N/A N/A 1 N/A -1 2 Os01t0103900-01.exon12 N/A Os01t0103900-01.exon12 N/A Os01t0103900-01.exon12 transcript:Os01t0103900-01 N/A 12 N/A
530 1 irgsp CDS 202042 202110 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
531 1 irgsp CDS 202252 202359 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
532 1 irgsp CDS 203007 203127 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
533 1 irgsp CDS 203302 203429 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
534 1 irgsp CDS 203511 203658 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
535 1 irgsp CDS 203760 203938 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
536 1 irgsp CDS 204203 204440 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
537 1 irgsp CDS 204543 204635 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
538 1 irgsp CDS 204730 204875 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
539 1 irgsp CDS 205042 205149 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
540 1 irgsp CDS 205290 205378 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
541 1 irgsp CDS 205534 205543 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0103900-01 N/A N/A transcript:Os01t0103900-01 Os01t0103900-01 N/A N/A
542 1 irgsp five_prime_UTR 201944 202041 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-49 N/A N/A transcript:Os01t0103900-01 N/A N/A N/A
543 1 irgsp three_prime_UTR 205544 206202 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-46 N/A N/A transcript:Os01t0103900-01 N/A N/A N/A
544 1 irgsp gene 206131 209606 . -1 . N/A protein_coding N/A C-type lectin domain containing protein. (Os01t0104000-01);Similar to predicted protein. (Os01t0104000-02) N/A N/A N/A Os01g0104000 gene:Os01g0104000 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
545 1 irgsp mRNA 206131 209581 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104000-02 N/A N/A gene:Os01g0104000 N/A N/A Os01t0104000-02
546 1 irgsp exon 206131 207029 . -1 . N/A N/A 0 N/A -1 2 Os01t0104000-02.exon4 N/A Os01t0104000-02.exon4 N/A Os01t0104000-02.exon4 transcript:Os01t0104000-02 N/A 4 N/A
547 1 irgsp exon 207706 208273 . -1 . N/A N/A 0 N/A 2 1 Os01t0104000-02.exon3 N/A Os01t0104000-02.exon3 N/A Os01t0104000-02.exon3 transcript:Os01t0104000-02 N/A 3 N/A
548 1 irgsp exon 208408 208836 . -1 . N/A N/A 1 N/A 1 1 Os01t0104000-01.exon2 N/A Os01t0104000-01.exon2 N/A Os01t0104000-01.exon2 transcript:Os01t0104000-02 N/A 2 N/A
549 1 irgsp exon 209438 209581 . -1 . N/A N/A 0 N/A 1 -1 Os01t0104000-02.exon1 N/A Os01t0104000-02.exon1 N/A Os01t0104000-02.exon1 transcript:Os01t0104000-02 N/A 1 N/A
550 1 irgsp CDS 206450 207029 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-02 N/A N/A transcript:Os01t0104000-02 Os01t0104000-02 N/A N/A
551 1 irgsp CDS 207706 208273 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-02 N/A N/A transcript:Os01t0104000-02 Os01t0104000-02 N/A N/A
552 1 irgsp CDS 208408 208836 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-02 N/A N/A transcript:Os01t0104000-02 Os01t0104000-02 N/A N/A
553 1 irgsp CDS 209438 209525 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-02 N/A N/A transcript:Os01t0104000-02 Os01t0104000-02 N/A N/A
554 1 irgsp five_prime_UTR 209526 209581 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-50 N/A N/A transcript:Os01t0104000-02 N/A N/A N/A
555 1 irgsp three_prime_UTR 206131 206449 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-47 N/A N/A transcript:Os01t0104000-02 N/A N/A N/A
556 1 irgsp mRNA 206134 209606 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104000-01 N/A N/A gene:Os01g0104000 N/A N/A Os01t0104000-01
557 1 irgsp exon 206134 207029 . -1 . N/A N/A 0 N/A -1 2 Os01t0104000-01.exon4 N/A Os01t0104000-01.exon4 N/A Os01t0104000-01.exon4 transcript:Os01t0104000-01 N/A 4 N/A
558 1 irgsp exon 207706 208276 . -1 . N/A N/A 0 N/A 2 1 Os01t0104000-01.exon3 N/A Os01t0104000-01.exon3 N/A Os01t0104000-01.exon3 transcript:Os01t0104000-01 N/A 3 N/A
559 1 irgsp exon 208408 208836 . -1 . N/A N/A 1 N/A 1 1 Os01t0104000-01.exon2 N/A agat-exon-6 N/A Os01t0104000-01.exon2 transcript:Os01t0104000-01 N/A 2 N/A
560 1 irgsp exon 209438 209606 . -1 . N/A N/A 0 N/A 1 -1 Os01t0104000-01.exon1 N/A Os01t0104000-01.exon1 N/A Os01t0104000-01.exon1 transcript:Os01t0104000-01 N/A 1 N/A
561 1 irgsp CDS 206450 207029 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-01 N/A N/A transcript:Os01t0104000-01 Os01t0104000-01 N/A N/A
562 1 irgsp CDS 207706 208276 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-01 N/A N/A transcript:Os01t0104000-01 Os01t0104000-01 N/A N/A
563 1 irgsp CDS 208408 208836 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-01 N/A N/A transcript:Os01t0104000-01 Os01t0104000-01 N/A N/A
564 1 irgsp CDS 209438 209525 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104000-01 N/A N/A transcript:Os01t0104000-01 Os01t0104000-01 N/A N/A
565 1 irgsp five_prime_UTR 209526 209606 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-51 N/A N/A transcript:Os01t0104000-01 N/A N/A N/A
566 1 irgsp three_prime_UTR 206134 206449 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-48 N/A N/A transcript:Os01t0104000-01 N/A N/A N/A
567 1 irgsp gene 209771 214173 . 1 . N/A protein_coding N/A Similar to protein binding / zinc ion binding. (Os01t0104100-01);Similar to protein binding / zinc ion binding. (Os01t0104100-02) N/A N/A N/A Os01g0104100 gene:Os01g0104100 irgspv1.0-20170804-genes cold-inducible, cold-inducible zinc finger protein N/A N/A N/A N/A
568 1 irgsp mRNA 209771 214173 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104100-01 N/A N/A gene:Os01g0104100 N/A N/A Os01t0104100-01
569 1 irgsp exon 209771 209896 . 1 . N/A N/A 0 N/A 0 0 Os01t0104100-01.exon1 N/A Os01t0104100-01.exon1 N/A Os01t0104100-01.exon1 transcript:Os01t0104100-01 N/A 1 N/A
570 1 irgsp exon 210244 210563 . 1 . N/A N/A 1 N/A 2 0 Os01t0104100-01.exon2 N/A Os01t0104100-01.exon2 N/A Os01t0104100-01.exon2 transcript:Os01t0104100-01 N/A 2 N/A
571 1 irgsp exon 210659 210890 . 1 . N/A N/A 1 N/A 0 2 Os01t0104100-01.exon3 N/A Os01t0104100-01.exon3 N/A Os01t0104100-01.exon3 transcript:Os01t0104100-01 N/A 3 N/A
572 1 irgsp exon 211015 211160 . 1 . N/A N/A 1 N/A 2 0 Os01t0104100-01.exon4 N/A Os01t0104100-01.exon4 N/A Os01t0104100-01.exon4 transcript:Os01t0104100-01 N/A 4 N/A
573 1 irgsp exon 212265 212352 . 1 . N/A N/A 1 N/A 0 2 Os01t0104100-01.exon5 N/A Os01t0104100-01.exon5 N/A Os01t0104100-01.exon5 transcript:Os01t0104100-01 N/A 5 N/A
574 1 irgsp exon 212433 212579 . 1 . N/A N/A 1 N/A 0 0 Os01t0104100-01.exon6 N/A Os01t0104100-01.exon6 N/A Os01t0104100-01.exon6 transcript:Os01t0104100-01 N/A 6 N/A
575 1 irgsp exon 213490 213639 . 1 . N/A N/A 1 N/A 0 0 Os01t0104100-01.exon7 N/A Os01t0104100-01.exon7 N/A Os01t0104100-01.exon7 transcript:Os01t0104100-01 N/A 7 N/A
576 1 irgsp exon 213741 214173 . 1 . N/A N/A 0 N/A -1 0 Os01t0104100-01.exon8 N/A Os01t0104100-01.exon8 N/A Os01t0104100-01.exon8 transcript:Os01t0104100-01 N/A 8 N/A
577 1 irgsp CDS 209771 209896 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
578 1 irgsp CDS 210244 210563 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
579 1 irgsp CDS 210659 210890 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
580 1 irgsp CDS 211015 211160 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
581 1 irgsp CDS 212265 212352 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
582 1 irgsp CDS 212433 212579 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
583 1 irgsp CDS 213490 213639 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
584 1 irgsp CDS 213741 213788 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-01 N/A N/A transcript:Os01t0104100-01 Os01t0104100-01 N/A N/A
585 1 irgsp three_prime_UTR 213789 214173 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-49 N/A N/A transcript:Os01t0104100-01 N/A N/A N/A
586 1 irgsp mRNA 209794 214147 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104100-02 N/A N/A gene:Os01g0104100 N/A N/A Os01t0104100-02
587 1 irgsp exon 209794 209896 . 1 . N/A N/A 0 N/A 0 -1 Os01t0104100-02.exon1 N/A Os01t0104100-02.exon1 N/A Os01t0104100-02.exon1 transcript:Os01t0104100-02 N/A 1 N/A
588 1 irgsp exon 210244 210563 . 1 . N/A N/A 1 N/A 2 0 Os01t0104100-01.exon2 N/A agat-exon-7 N/A Os01t0104100-01.exon2 transcript:Os01t0104100-02 N/A 2 N/A
589 1 irgsp exon 210659 210890 . 1 . N/A N/A 1 N/A 0 2 Os01t0104100-01.exon3 N/A agat-exon-8 N/A Os01t0104100-01.exon3 transcript:Os01t0104100-02 N/A 3 N/A
590 1 irgsp exon 211015 211160 . 1 . N/A N/A 1 N/A 2 0 Os01t0104100-01.exon4 N/A agat-exon-9 N/A Os01t0104100-01.exon4 transcript:Os01t0104100-02 N/A 4 N/A
591 1 irgsp exon 212265 212352 . 1 . N/A N/A 1 N/A 0 2 Os01t0104100-01.exon5 N/A agat-exon-10 N/A Os01t0104100-01.exon5 transcript:Os01t0104100-02 N/A 5 N/A
592 1 irgsp exon 212433 212579 . 1 . N/A N/A 1 N/A 0 0 Os01t0104100-01.exon6 N/A agat-exon-11 N/A Os01t0104100-01.exon6 transcript:Os01t0104100-02 N/A 6 N/A
593 1 irgsp exon 213490 213639 . 1 . N/A N/A 1 N/A 0 0 Os01t0104100-01.exon7 N/A agat-exon-12 N/A Os01t0104100-01.exon7 transcript:Os01t0104100-02 N/A 7 N/A
594 1 irgsp exon 213741 214147 . 1 . N/A N/A 0 N/A -1 0 Os01t0104100-02.exon8 N/A Os01t0104100-02.exon8 N/A Os01t0104100-02.exon8 transcript:Os01t0104100-02 N/A 8 N/A
595 1 irgsp CDS 209795 209896 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
596 1 irgsp CDS 210244 210563 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
597 1 irgsp CDS 210659 210890 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
598 1 irgsp CDS 211015 211160 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
599 1 irgsp CDS 212265 212352 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
600 1 irgsp CDS 212433 212579 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
601 1 irgsp CDS 213490 213639 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
602 1 irgsp CDS 213741 213788 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104100-02 N/A N/A transcript:Os01t0104100-02 Os01t0104100-02 N/A N/A
603 1 irgsp five_prime_UTR 209794 209794 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-52 N/A N/A transcript:Os01t0104100-02 N/A N/A N/A
604 1 irgsp three_prime_UTR 213789 214147 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-50 N/A N/A transcript:Os01t0104100-02 N/A N/A N/A
605 1 irgsp gene 216212 217345 . 1 . N/A protein_coding N/A No apical meristem (NAM) protein domain containing protein. (Os01t0104200-00) N/A N/A N/A Os01g0104200 gene:Os01g0104200 irgspv1.0-20170804-genes NAC DOMAIN-CONTAINING PROTEIN 16 N/A N/A N/A N/A
606 1 irgsp mRNA 216212 217345 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104200-00 N/A N/A gene:Os01g0104200 N/A N/A Os01t0104200-00
607 1 irgsp exon 216212 216769 . 1 . N/A N/A 1 N/A 0 0 Os01t0104200-00.exon1 N/A Os01t0104200-00.exon1 N/A Os01t0104200-00.exon1 transcript:Os01t0104200-00 N/A 1 N/A
608 1 irgsp exon 216884 217345 . 1 . N/A N/A 1 N/A 0 0 Os01t0104200-00.exon2 N/A Os01t0104200-00.exon2 N/A Os01t0104200-00.exon2 transcript:Os01t0104200-00 N/A 2 N/A
609 1 irgsp CDS 216212 216769 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104200-00 N/A N/A transcript:Os01t0104200-00 Os01t0104200-00 N/A N/A
610 1 irgsp CDS 216884 217345 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104200-00 N/A N/A transcript:Os01t0104200-00 Os01t0104200-00 N/A N/A
611 1 irgsp gene 226897 229301 . 1 . N/A protein_coding N/A Ricin B-related lectin domain containing protein. (Os01t0104400-01);Ricin B-related lectin domain containing protein. (Os01t0104400-02);Ricin B-related lectin domain containing protein. (Os01t0104400-03) N/A N/A N/A Os01g0104400 gene:Os01g0104400 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
612 1 irgsp mRNA 226897 229229 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104400-01 N/A N/A gene:Os01g0104400 N/A N/A Os01t0104400-01
613 1 irgsp exon 226897 227634 . 1 . N/A N/A 0 N/A 0 -1 Os01t0104400-01.exon1 N/A Os01t0104400-01.exon1 N/A Os01t0104400-01.exon1 transcript:Os01t0104400-01 N/A 1 N/A
614 1 irgsp exon 227742 227864 . 1 . N/A N/A 1 N/A 0 0 Os01t0104400-03.exon2 N/A Os01t0104400-03.exon2 N/A Os01t0104400-03.exon2 transcript:Os01t0104400-01 N/A 2 N/A
615 1 irgsp exon 228557 228785 . 1 . N/A N/A 1 N/A 1 0 Os01t0104400-03.exon3 N/A Os01t0104400-03.exon3 N/A Os01t0104400-03.exon3 transcript:Os01t0104400-01 N/A 3 N/A
616 1 irgsp exon 228930 229229 . 1 . N/A N/A 0 N/A -1 1 Os01t0104400-01.exon4 N/A Os01t0104400-01.exon4 N/A Os01t0104400-01.exon4 transcript:Os01t0104400-01 N/A 4 N/A
617 1 irgsp CDS 227182 227634 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-01 N/A N/A transcript:Os01t0104400-01 Os01t0104400-01 N/A N/A
618 1 irgsp CDS 227742 227864 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-01 N/A N/A transcript:Os01t0104400-01 Os01t0104400-01 N/A N/A
619 1 irgsp CDS 228557 228785 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-01 N/A N/A transcript:Os01t0104400-01 Os01t0104400-01 N/A N/A
620 1 irgsp CDS 228930 228931 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-01 N/A N/A transcript:Os01t0104400-01 Os01t0104400-01 N/A N/A
621 1 irgsp five_prime_UTR 226897 227181 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-53 N/A N/A transcript:Os01t0104400-01 N/A N/A N/A
622 1 irgsp three_prime_UTR 228932 229229 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-51 N/A N/A transcript:Os01t0104400-01 N/A N/A N/A
623 1 irgsp mRNA 227139 229301 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104400-02 N/A N/A gene:Os01g0104400 N/A N/A Os01t0104400-02
624 1 irgsp exon 227139 227634 . 1 . N/A N/A 0 N/A 0 -1 Os01t0104400-02.exon1 N/A Os01t0104400-02.exon1 N/A Os01t0104400-02.exon1 transcript:Os01t0104400-02 N/A 1 N/A
625 1 irgsp exon 227742 227864 . 1 . N/A N/A 1 N/A 0 0 Os01t0104400-03.exon2 N/A agat-exon-13 N/A Os01t0104400-03.exon2 transcript:Os01t0104400-02 N/A 2 N/A
626 1 irgsp exon 228557 228785 . 1 . N/A N/A 1 N/A 1 0 Os01t0104400-03.exon3 N/A agat-exon-14 N/A Os01t0104400-03.exon3 transcript:Os01t0104400-02 N/A 3 N/A
627 1 irgsp exon 228930 229301 . 1 . N/A N/A 0 N/A -1 1 Os01t0104400-02.exon4 N/A Os01t0104400-02.exon4 N/A Os01t0104400-02.exon4 transcript:Os01t0104400-02 N/A 4 N/A
628 1 irgsp CDS 227182 227634 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-02 N/A N/A transcript:Os01t0104400-02 Os01t0104400-02 N/A N/A
629 1 irgsp CDS 227742 227864 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-02 N/A N/A transcript:Os01t0104400-02 Os01t0104400-02 N/A N/A
630 1 irgsp CDS 228557 228785 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-02 N/A N/A transcript:Os01t0104400-02 Os01t0104400-02 N/A N/A
631 1 irgsp CDS 228930 228931 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-02 N/A N/A transcript:Os01t0104400-02 Os01t0104400-02 N/A N/A
632 1 irgsp five_prime_UTR 227139 227181 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-54 N/A N/A transcript:Os01t0104400-02 N/A N/A N/A
633 1 irgsp three_prime_UTR 228932 229301 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-52 N/A N/A transcript:Os01t0104400-02 N/A N/A N/A
634 1 irgsp mRNA 227179 229214 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104400-03 N/A N/A gene:Os01g0104400 N/A N/A Os01t0104400-03
635 1 irgsp exon 227179 227634 . 1 . N/A N/A 0 N/A 0 -1 Os01t0104400-03.exon1 N/A Os01t0104400-03.exon1 N/A Os01t0104400-03.exon1 transcript:Os01t0104400-03 N/A 1 N/A
636 1 irgsp exon 227742 227864 . 1 . N/A N/A 1 N/A 0 0 Os01t0104400-03.exon2 N/A agat-exon-15 N/A Os01t0104400-03.exon2 transcript:Os01t0104400-03 N/A 2 N/A
637 1 irgsp exon 228557 228785 . 1 . N/A N/A 1 N/A 1 0 Os01t0104400-03.exon3 N/A agat-exon-16 N/A Os01t0104400-03.exon3 transcript:Os01t0104400-03 N/A 3 N/A
638 1 irgsp exon 228930 229214 . 1 . N/A N/A 0 N/A -1 1 Os01t0104400-03.exon4 N/A Os01t0104400-03.exon4 N/A Os01t0104400-03.exon4 transcript:Os01t0104400-03 N/A 4 N/A
639 1 irgsp CDS 227182 227634 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-03 N/A N/A transcript:Os01t0104400-03 Os01t0104400-03 N/A N/A
640 1 irgsp CDS 227742 227864 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-03 N/A N/A transcript:Os01t0104400-03 Os01t0104400-03 N/A N/A
641 1 irgsp CDS 228557 228785 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-03 N/A N/A transcript:Os01t0104400-03 Os01t0104400-03 N/A N/A
642 1 irgsp CDS 228930 228931 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104400-03 N/A N/A transcript:Os01t0104400-03 Os01t0104400-03 N/A N/A
643 1 irgsp five_prime_UTR 227179 227181 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-55 N/A N/A transcript:Os01t0104400-03 N/A N/A N/A
644 1 irgsp three_prime_UTR 228932 229214 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-53 N/A N/A transcript:Os01t0104400-03 N/A N/A N/A
645 1 irgsp gene 241680 243440 . 1 . N/A protein_coding N/A No apical meristem (NAM) protein domain containing protein. (Os01t0104500-01) N/A N/A N/A Os01g0104500 gene:Os01g0104500 irgspv1.0-20170804-genes NAC DOMAIN-CONTAINING PROTEIN 20 N/A N/A N/A N/A
646 1 irgsp mRNA 241680 243440 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104500-01 N/A N/A gene:Os01g0104500 N/A N/A Os01t0104500-01
647 1 irgsp exon 241680 241702 . 1 . N/A N/A 1 N/A -1 -1 Os01t0104500-01.exon1 N/A Os01t0104500-01.exon1 N/A Os01t0104500-01.exon1 transcript:Os01t0104500-01 N/A 1 N/A
648 1 irgsp exon 241866 242091 . 1 . N/A N/A 1 N/A 1 -1 Os01t0104500-01.exon2 N/A Os01t0104500-01.exon2 N/A Os01t0104500-01.exon2 transcript:Os01t0104500-01 N/A 2 N/A
649 1 irgsp exon 242199 243440 . 1 . N/A N/A 1 N/A -1 1 Os01t0104500-01.exon3 N/A Os01t0104500-01.exon3 N/A Os01t0104500-01.exon3 transcript:Os01t0104500-01 N/A 3 N/A
650 1 irgsp CDS 241908 242091 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104500-01 N/A N/A transcript:Os01t0104500-01 Os01t0104500-01 N/A N/A
651 1 irgsp CDS 242199 242977 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104500-01 N/A N/A transcript:Os01t0104500-01 Os01t0104500-01 N/A N/A
652 1 irgsp five_prime_UTR 241680 241702 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-56 N/A N/A transcript:Os01t0104500-01 N/A N/A N/A
653 1 irgsp five_prime_UTR 241866 241907 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-57 N/A N/A transcript:Os01t0104500-01 N/A N/A N/A
654 1 irgsp three_prime_UTR 242978 243440 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-54 N/A N/A transcript:Os01t0104500-01 N/A N/A N/A
655 1 irgsp gene 248828 256872 . -1 . N/A protein_coding N/A Homolog of Arabidopsis DE-ETIOLATED1 (DET1), Modulation of the ABA signaling pathway and ABA biosynthesis, Regulation of chlorophyll content (Os01t0104600-01);Similar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). (Os01t0104600-02) N/A N/A N/A Os01g0104600 gene:Os01g0104600 irgspv1.0-20170804-genes DE-ETIOLATED1 N/A N/A N/A N/A
656 1 irgsp mRNA 248828 256571 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104600-02 N/A N/A gene:Os01g0104600 N/A N/A Os01t0104600-02
657 1 irgsp exon 248828 249107 . -1 . N/A N/A 1 N/A -1 1 Os01t0104600-01.exon11 N/A Os01t0104600-01.exon11 N/A Os01t0104600-01.exon11 transcript:Os01t0104600-02 N/A 11 N/A
658 1 irgsp exon 249369 249468 . -1 . N/A N/A 1 N/A 1 0 Os01t0104600-01.exon10 N/A Os01t0104600-01.exon10 N/A Os01t0104600-01.exon10 transcript:Os01t0104600-02 N/A 10 N/A
659 1 irgsp exon 249861 249956 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon9 N/A Os01t0104600-01.exon9 N/A Os01t0104600-01.exon9 transcript:Os01t0104600-02 N/A 9 N/A
660 1 irgsp exon 250617 250781 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon8 N/A Os01t0104600-01.exon8 N/A Os01t0104600-01.exon8 transcript:Os01t0104600-02 N/A 8 N/A
661 1 irgsp exon 250860 250940 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon7 N/A Os01t0104600-01.exon7 N/A Os01t0104600-01.exon7 transcript:Os01t0104600-02 N/A 7 N/A
662 1 irgsp exon 251026 251082 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon6 N/A Os01t0104600-01.exon6 N/A Os01t0104600-01.exon6 transcript:Os01t0104600-02 N/A 6 N/A
663 1 irgsp exon 251316 251384 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon5 N/A Os01t0104600-01.exon5 N/A Os01t0104600-01.exon5 transcript:Os01t0104600-02 N/A 5 N/A
664 1 irgsp exon 251695 251790 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon4 N/A Os01t0104600-01.exon4 N/A Os01t0104600-01.exon4 transcript:Os01t0104600-02 N/A 4 N/A
665 1 irgsp exon 255325 255553 . -1 . N/A N/A 1 N/A 0 2 Os01t0104600-01.exon3 N/A Os01t0104600-01.exon3 N/A Os01t0104600-01.exon3 transcript:Os01t0104600-02 N/A 3 N/A
666 1 irgsp exon 255674 256098 . -1 . N/A N/A 1 N/A 2 0 Os01t0104600-01.exon2 N/A Os01t0104600-01.exon2 N/A Os01t0104600-01.exon2 transcript:Os01t0104600-02 N/A 2 N/A
667 1 irgsp exon 256361 256571 . -1 . N/A N/A 0 N/A 0 -1 Os01t0104600-02.exon1 N/A Os01t0104600-02.exon1 N/A Os01t0104600-02.exon1 transcript:Os01t0104600-02 N/A 1 N/A
668 1 irgsp CDS 248971 249107 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
669 1 irgsp CDS 249369 249468 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
670 1 irgsp CDS 249861 249956 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
671 1 irgsp CDS 250617 250781 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
672 1 irgsp CDS 250860 250940 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
673 1 irgsp CDS 251026 251082 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
674 1 irgsp CDS 251316 251384 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
675 1 irgsp CDS 251695 251790 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
676 1 irgsp CDS 255325 255553 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
677 1 irgsp CDS 255674 256098 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
678 1 irgsp CDS 256361 256441 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-02 N/A N/A transcript:Os01t0104600-02 Os01t0104600-02 N/A N/A
679 1 irgsp five_prime_UTR 256442 256571 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-58 N/A N/A transcript:Os01t0104600-02 N/A N/A N/A
680 1 irgsp three_prime_UTR 248828 248970 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-55 N/A N/A transcript:Os01t0104600-02 N/A N/A N/A
681 1 irgsp mRNA 248828 256872 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104600-01 N/A N/A gene:Os01g0104600 N/A N/A Os01t0104600-01
682 1 irgsp exon 248828 249107 . -1 . N/A N/A 1 N/A -1 1 Os01t0104600-01.exon11 N/A agat-exon-17 N/A Os01t0104600-01.exon11 transcript:Os01t0104600-01 N/A 11 N/A
683 1 irgsp exon 249369 249468 . -1 . N/A N/A 1 N/A 1 0 Os01t0104600-01.exon10 N/A agat-exon-18 N/A Os01t0104600-01.exon10 transcript:Os01t0104600-01 N/A 10 N/A
684 1 irgsp exon 249861 249956 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon9 N/A agat-exon-19 N/A Os01t0104600-01.exon9 transcript:Os01t0104600-01 N/A 9 N/A
685 1 irgsp exon 250617 250781 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon8 N/A agat-exon-20 N/A Os01t0104600-01.exon8 transcript:Os01t0104600-01 N/A 8 N/A
686 1 irgsp exon 250860 250940 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon7 N/A agat-exon-21 N/A Os01t0104600-01.exon7 transcript:Os01t0104600-01 N/A 7 N/A
687 1 irgsp exon 251026 251082 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon6 N/A agat-exon-22 N/A Os01t0104600-01.exon6 transcript:Os01t0104600-01 N/A 6 N/A
688 1 irgsp exon 251316 251384 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon5 N/A agat-exon-23 N/A Os01t0104600-01.exon5 transcript:Os01t0104600-01 N/A 5 N/A
689 1 irgsp exon 251695 251790 . -1 . N/A N/A 1 N/A 0 0 Os01t0104600-01.exon4 N/A agat-exon-24 N/A Os01t0104600-01.exon4 transcript:Os01t0104600-01 N/A 4 N/A
690 1 irgsp exon 255325 255553 . -1 . N/A N/A 1 N/A 0 2 Os01t0104600-01.exon3 N/A agat-exon-25 N/A Os01t0104600-01.exon3 transcript:Os01t0104600-01 N/A 3 N/A
691 1 irgsp exon 255674 256098 . -1 . N/A N/A 1 N/A 2 0 Os01t0104600-01.exon2 N/A agat-exon-26 N/A Os01t0104600-01.exon2 transcript:Os01t0104600-01 N/A 2 N/A
692 1 irgsp exon 256361 256872 . -1 . N/A N/A 0 N/A 0 -1 Os01t0104600-01.exon1 N/A Os01t0104600-01.exon1 N/A Os01t0104600-01.exon1 transcript:Os01t0104600-01 N/A 1 N/A
693 1 irgsp CDS 248971 249107 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
694 1 irgsp CDS 249369 249468 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
695 1 irgsp CDS 249861 249956 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
696 1 irgsp CDS 250617 250781 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
697 1 irgsp CDS 250860 250940 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
698 1 irgsp CDS 251026 251082 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
699 1 irgsp CDS 251316 251384 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
700 1 irgsp CDS 251695 251790 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
701 1 irgsp CDS 255325 255553 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
702 1 irgsp CDS 255674 256098 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
703 1 irgsp CDS 256361 256441 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104600-01 N/A N/A transcript:Os01t0104600-01 Os01t0104600-01 N/A N/A
704 1 irgsp five_prime_UTR 256442 256872 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-59 N/A N/A transcript:Os01t0104600-01 N/A N/A N/A
705 1 irgsp three_prime_UTR 248828 248970 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-56 N/A N/A transcript:Os01t0104600-01 N/A N/A N/A
706 1 irgsp gene 261530 268145 . 1 . N/A protein_coding N/A Sas10/Utp3 family protein. (Os01t0104800-01);Hypothetical conserved gene. (Os01t0104800-02) N/A N/A N/A Os01g0104800 gene:Os01g0104800 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
707 1 irgsp mRNA 261530 268145 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104800-01 N/A N/A gene:Os01g0104800 N/A N/A Os01t0104800-01
708 1 irgsp exon 261530 261661 . 1 . N/A N/A 0 N/A 1 -1 Os01t0104800-01.exon1 N/A Os01t0104800-01.exon1 N/A Os01t0104800-01.exon1 transcript:Os01t0104800-01 N/A 1 N/A
709 1 irgsp exon 261767 261805 . 1 . N/A N/A 0 N/A 1 1 Os01t0104800-01.exon2 N/A Os01t0104800-01.exon2 N/A Os01t0104800-01.exon2 transcript:Os01t0104800-01 N/A 2 N/A
710 1 irgsp exon 261895 261941 . 1 . N/A N/A 0 N/A 0 1 Os01t0104800-01.exon3 N/A Os01t0104800-01.exon3 N/A Os01t0104800-01.exon3 transcript:Os01t0104800-01 N/A 3 N/A
711 1 irgsp exon 262582 262681 . 1 . N/A N/A 0 N/A 1 0 Os01t0104800-01.exon4 N/A Os01t0104800-01.exon4 N/A Os01t0104800-01.exon4 transcript:Os01t0104800-01 N/A 4 N/A
712 1 irgsp exon 262925 263181 . 1 . N/A N/A 0 N/A 0 1 Os01t0104800-01.exon5 N/A Os01t0104800-01.exon5 N/A Os01t0104800-01.exon5 transcript:Os01t0104800-01 N/A 5 N/A
713 1 irgsp exon 263525 263640 . 1 . N/A N/A 0 N/A 2 0 Os01t0104800-01.exon6 N/A Os01t0104800-01.exon6 N/A Os01t0104800-01.exon6 transcript:Os01t0104800-01 N/A 6 N/A
714 1 irgsp exon 264014 264098 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon7 N/A Os01t0104800-01.exon7 N/A Os01t0104800-01.exon7 transcript:Os01t0104800-01 N/A 7 N/A
715 1 irgsp exon 265236 265415 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon8 N/A Os01t0104800-01.exon8 N/A Os01t0104800-01.exon8 transcript:Os01t0104800-01 N/A 8 N/A
716 1 irgsp exon 265506 265649 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon9 N/A Os01t0104800-01.exon9 N/A Os01t0104800-01.exon9 transcript:Os01t0104800-01 N/A 9 N/A
717 1 irgsp exon 265740 265817 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon10 N/A Os01t0104800-01.exon10 N/A Os01t0104800-01.exon10 transcript:Os01t0104800-01 N/A 10 N/A
718 1 irgsp exon 265909 266045 . 1 . N/A N/A 1 N/A 2 0 Os01t0104800-01.exon11 N/A Os01t0104800-01.exon11 N/A Os01t0104800-01.exon11 transcript:Os01t0104800-01 N/A 11 N/A
719 1 irgsp exon 266138 266246 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon12 N/A Os01t0104800-01.exon12 N/A Os01t0104800-01.exon12 transcript:Os01t0104800-01 N/A 12 N/A
720 1 irgsp exon 267237 267514 . 1 . N/A N/A 1 N/A 2 0 Os01t0104800-01.exon13 N/A Os01t0104800-01.exon13 N/A Os01t0104800-01.exon13 transcript:Os01t0104800-01 N/A 13 N/A
721 1 irgsp exon 267591 267657 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon14 N/A Os01t0104800-01.exon14 N/A Os01t0104800-01.exon14 transcript:Os01t0104800-01 N/A 14 N/A
722 1 irgsp exon 267734 267802 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon15 N/A Os01t0104800-01.exon15 N/A Os01t0104800-01.exon15 transcript:Os01t0104800-01 N/A 15 N/A
723 1 irgsp exon 267880 268145 . 1 . N/A N/A 0 N/A -1 0 Os01t0104800-01.exon16 N/A Os01t0104800-01.exon16 N/A Os01t0104800-01.exon16 transcript:Os01t0104800-01 N/A 16 N/A
724 1 irgsp CDS 261562 261661 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
725 1 irgsp CDS 261767 261805 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
726 1 irgsp CDS 261895 261941 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
727 1 irgsp CDS 262582 262681 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
728 1 irgsp CDS 262925 263181 . 1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
729 1 irgsp CDS 263525 263640 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
730 1 irgsp CDS 264014 264098 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
731 1 irgsp CDS 265236 265415 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
732 1 irgsp CDS 265506 265649 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
733 1 irgsp CDS 265740 265817 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
734 1 irgsp CDS 265909 266045 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
735 1 irgsp CDS 266138 266246 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
736 1 irgsp CDS 267237 267514 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
737 1 irgsp CDS 267591 267657 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
738 1 irgsp CDS 267734 267802 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
739 1 irgsp CDS 267880 268011 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-01 N/A N/A transcript:Os01t0104800-01 Os01t0104800-01 N/A N/A
740 1 irgsp five_prime_UTR 261530 261561 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-60 N/A N/A transcript:Os01t0104800-01 N/A N/A N/A
741 1 irgsp three_prime_UTR 268012 268145 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-57 N/A N/A transcript:Os01t0104800-01 N/A N/A N/A
742 1 irgsp mRNA 263523 268120 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104800-02 N/A N/A gene:Os01g0104800 N/A N/A Os01t0104800-02
743 1 irgsp exon 263523 263640 . 1 . N/A N/A 0 N/A 2 -1 Os01t0104800-02.exon1 N/A Os01t0104800-02.exon1 N/A Os01t0104800-02.exon1 transcript:Os01t0104800-02 N/A 1 N/A
744 1 irgsp exon 264014 264098 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon7 N/A agat-exon-27 N/A Os01t0104800-01.exon7 transcript:Os01t0104800-02 N/A 2 N/A
745 1 irgsp exon 265236 265415 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon8 N/A agat-exon-28 N/A Os01t0104800-01.exon8 transcript:Os01t0104800-02 N/A 3 N/A
746 1 irgsp exon 265506 265649 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon9 N/A agat-exon-29 N/A Os01t0104800-01.exon9 transcript:Os01t0104800-02 N/A 4 N/A
747 1 irgsp exon 265740 265817 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon10 N/A agat-exon-30 N/A Os01t0104800-01.exon10 transcript:Os01t0104800-02 N/A 5 N/A
748 1 irgsp exon 265909 266045 . 1 . N/A N/A 1 N/A 2 0 Os01t0104800-01.exon11 N/A agat-exon-31 N/A Os01t0104800-01.exon11 transcript:Os01t0104800-02 N/A 6 N/A
749 1 irgsp exon 266138 266246 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon12 N/A agat-exon-32 N/A Os01t0104800-01.exon12 transcript:Os01t0104800-02 N/A 7 N/A
750 1 irgsp exon 267237 267514 . 1 . N/A N/A 1 N/A 2 0 Os01t0104800-01.exon13 N/A agat-exon-33 N/A Os01t0104800-01.exon13 transcript:Os01t0104800-02 N/A 8 N/A
751 1 irgsp exon 267591 267657 . 1 . N/A N/A 1 N/A 0 2 Os01t0104800-01.exon14 N/A agat-exon-34 N/A Os01t0104800-01.exon14 transcript:Os01t0104800-02 N/A 9 N/A
752 1 irgsp exon 267734 267802 . 1 . N/A N/A 1 N/A 0 0 Os01t0104800-01.exon15 N/A agat-exon-35 N/A Os01t0104800-01.exon15 transcript:Os01t0104800-02 N/A 10 N/A
753 1 irgsp exon 267880 268120 . 1 . N/A N/A 0 N/A -1 0 Os01t0104800-02.exon11 N/A Os01t0104800-02.exon11 N/A Os01t0104800-02.exon11 transcript:Os01t0104800-02 N/A 11 N/A
754 1 irgsp CDS 263525 263640 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
755 1 irgsp CDS 264014 264098 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
756 1 irgsp CDS 265236 265415 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
757 1 irgsp CDS 265506 265649 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
758 1 irgsp CDS 265740 265817 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
759 1 irgsp CDS 265909 266045 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
760 1 irgsp CDS 266138 266246 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
761 1 irgsp CDS 267237 267514 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
762 1 irgsp CDS 267591 267657 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
763 1 irgsp CDS 267734 267802 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
764 1 irgsp CDS 267880 268011 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104800-02 N/A N/A transcript:Os01t0104800-02 Os01t0104800-02 N/A N/A
765 1 irgsp five_prime_UTR 263523 263524 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-61 N/A N/A transcript:Os01t0104800-02 N/A N/A N/A
766 1 irgsp three_prime_UTR 268012 268120 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-58 N/A N/A transcript:Os01t0104800-02 N/A N/A N/A
767 1 irgsp gene 270179 275084 . -1 . N/A protein_coding N/A Transferase family protein. (Os01t0104900-01);Hypothetical conserved gene. (Os01t0104900-02) N/A N/A N/A Os01g0104900 gene:Os01g0104900 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
768 1 irgsp mRNA 270179 275084 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104900-01 N/A N/A gene:Os01g0104900 N/A N/A Os01t0104900-01
769 1 irgsp exon 270179 271333 . -1 . N/A N/A 0 N/A -1 0 Os01t0104900-01.exon2 N/A Os01t0104900-01.exon2 N/A Os01t0104900-01.exon2 transcript:Os01t0104900-01 N/A 2 N/A
770 1 irgsp exon 274529 275084 . -1 . N/A N/A 0 N/A 0 -1 Os01t0104900-01.exon1 N/A Os01t0104900-01.exon1 N/A Os01t0104900-01.exon1 transcript:Os01t0104900-01 N/A 1 N/A
771 1 irgsp CDS 270356 271333 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104900-01 N/A N/A transcript:Os01t0104900-01 Os01t0104900-01 N/A N/A
772 1 irgsp CDS 274529 274957 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104900-01 N/A N/A transcript:Os01t0104900-01 Os01t0104900-01 N/A N/A
773 1 irgsp five_prime_UTR 274958 275084 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-62 N/A N/A transcript:Os01t0104900-01 N/A N/A N/A
774 1 irgsp three_prime_UTR 270179 270355 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-59 N/A N/A transcript:Os01t0104900-01 N/A N/A N/A
775 1 irgsp mRNA 270250 271518 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0104900-02 N/A N/A gene:Os01g0104900 N/A N/A Os01t0104900-02
776 1 irgsp exon 270250 271333 . -1 . N/A N/A 0 N/A -1 -1 Os01t0104900-02.exon2 N/A Os01t0104900-02.exon2 N/A Os01t0104900-02.exon2 transcript:Os01t0104900-02 N/A 2 N/A
777 1 irgsp exon 271457 271518 . -1 . N/A N/A 0 N/A -1 -1 Os01t0104900-02.exon1 N/A Os01t0104900-02.exon1 N/A Os01t0104900-02.exon1 transcript:Os01t0104900-02 N/A 1 N/A
778 1 irgsp CDS 270356 271309 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0104900-02 N/A N/A transcript:Os01t0104900-02 Os01t0104900-02 N/A N/A
779 1 irgsp five_prime_UTR 271310 271333 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-63 N/A N/A transcript:Os01t0104900-02 N/A N/A N/A
780 1 irgsp five_prime_UTR 271457 271518 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-64 N/A N/A transcript:Os01t0104900-02 N/A N/A N/A
781 1 irgsp three_prime_UTR 270250 270355 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-60 N/A N/A transcript:Os01t0104900-02 N/A N/A N/A
782 1 irgsp gene 284762 291892 . -1 . N/A protein_coding N/A Similar to HAT family dimerisation domain containing protein, expressed. (Os01t0105300-01) N/A N/A N/A Os01g0105300 gene:Os01g0105300 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
783 1 irgsp mRNA 284762 291892 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105300-01 N/A N/A gene:Os01g0105300 N/A N/A Os01t0105300-01
784 1 irgsp exon 284762 287047 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon5 N/A Os01t0105300-01.exon5 N/A Os01t0105300-01.exon5 transcript:Os01t0105300-01 N/A 5 N/A
785 1 irgsp exon 291398 291436 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon4 N/A Os01t0105300-01.exon4 N/A Os01t0105300-01.exon4 transcript:Os01t0105300-01 N/A 4 N/A
786 1 irgsp exon 291520 291534 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon3 N/A Os01t0105300-01.exon3 N/A Os01t0105300-01.exon3 transcript:Os01t0105300-01 N/A 3 N/A
787 1 irgsp exon 291678 291738 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon2 N/A Os01t0105300-01.exon2 N/A Os01t0105300-01.exon2 transcript:Os01t0105300-01 N/A 2 N/A
788 1 irgsp exon 291838 291892 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105300-01.exon1 N/A Os01t0105300-01.exon1 N/A Os01t0105300-01.exon1 transcript:Os01t0105300-01 N/A 1 N/A
789 1 irgsp CDS 284931 285020 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105300-01 N/A N/A transcript:Os01t0105300-01 Os01t0105300-01 N/A N/A
790 1 irgsp five_prime_UTR 285021 287047 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-65 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
791 1 irgsp five_prime_UTR 291398 291436 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-66 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
792 1 irgsp five_prime_UTR 291520 291534 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-67 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
793 1 irgsp five_prime_UTR 291678 291738 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-68 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
794 1 irgsp five_prime_UTR 291838 291892 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-69 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
795 1 irgsp three_prime_UTR 284762 284930 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-61 N/A N/A transcript:Os01t0105300-01 N/A N/A N/A
796 1 irgsp gene 288372 292296 . 1 . N/A protein_coding N/A Similar to Kinesin heavy chain. (Os01t0105400-01) N/A N/A N/A Os01g0105400 gene:Os01g0105400 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
797 1 irgsp mRNA 288372 292296 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105400-01 N/A N/A gene:Os01g0105400 N/A N/A Os01t0105400-01
798 1 irgsp exon 288372 288846 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon1 N/A Os01t0105400-01.exon1 N/A Os01t0105400-01.exon1 transcript:Os01t0105400-01 N/A 1 N/A
799 1 irgsp exon 288950 289116 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon2 N/A Os01t0105400-01.exon2 N/A Os01t0105400-01.exon2 transcript:Os01t0105400-01 N/A 2 N/A
800 1 irgsp exon 289202 289572 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon3 N/A Os01t0105400-01.exon3 N/A Os01t0105400-01.exon3 transcript:Os01t0105400-01 N/A 3 N/A
801 1 irgsp exon 289661 289830 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon4 N/A Os01t0105400-01.exon4 N/A Os01t0105400-01.exon4 transcript:Os01t0105400-01 N/A 4 N/A
802 1 irgsp exon 290395 290512 . 1 . N/A N/A 1 N/A 2 -1 Os01t0105400-01.exon5 N/A Os01t0105400-01.exon5 N/A Os01t0105400-01.exon5 transcript:Os01t0105400-01 N/A 5 N/A
803 1 irgsp exon 291372 291574 . 1 . N/A N/A 1 N/A -1 2 Os01t0105400-01.exon6 N/A Os01t0105400-01.exon6 N/A Os01t0105400-01.exon6 transcript:Os01t0105400-01 N/A 6 N/A
804 1 irgsp exon 291648 291779 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon7 N/A Os01t0105400-01.exon7 N/A Os01t0105400-01.exon7 transcript:Os01t0105400-01 N/A 7 N/A
805 1 irgsp exon 291859 291948 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon8 N/A Os01t0105400-01.exon8 N/A Os01t0105400-01.exon8 transcript:Os01t0105400-01 N/A 8 N/A
806 1 irgsp exon 292073 292296 . 1 . N/A N/A 1 N/A -1 -1 Os01t0105400-01.exon9 N/A Os01t0105400-01.exon9 N/A Os01t0105400-01.exon9 transcript:Os01t0105400-01 N/A 9 N/A
807 1 irgsp CDS 290433 290512 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105400-01 N/A N/A transcript:Os01t0105400-01 Os01t0105400-01 N/A N/A
808 1 irgsp CDS 291372 291558 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105400-01 N/A N/A transcript:Os01t0105400-01 Os01t0105400-01 N/A N/A
809 1 irgsp five_prime_UTR 288372 288846 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-70 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
810 1 irgsp five_prime_UTR 288950 289116 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-71 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
811 1 irgsp five_prime_UTR 289202 289572 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-72 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
812 1 irgsp five_prime_UTR 289661 289830 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-73 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
813 1 irgsp five_prime_UTR 290395 290432 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-74 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
814 1 irgsp three_prime_UTR 291559 291574 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-62 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
815 1 irgsp three_prime_UTR 291648 291779 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-63 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
816 1 irgsp three_prime_UTR 291859 291948 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-64 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
817 1 irgsp three_prime_UTR 292073 292296 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-65 N/A N/A transcript:Os01t0105400-01 N/A N/A N/A
818 1 irgsp gene 303233 306736 . 1 . N/A protein_coding N/A Basic helix-loop-helix dimerisation region bHLH domain containing protein. (Os01t0105700-01) N/A N/A N/A Os01g0105700 gene:Os01g0105700 irgspv1.0-20170804-genes basic helix-loop-helix protein 071 N/A N/A N/A N/A
819 1 irgsp mRNA 303233 306736 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105700-01 N/A N/A gene:Os01g0105700 N/A N/A Os01t0105700-01
820 1 irgsp exon 303233 303471 . 1 . N/A N/A 1 N/A 2 -1 Os01t0105700-01.exon1 N/A Os01t0105700-01.exon1 N/A Os01t0105700-01.exon1 transcript:Os01t0105700-01 N/A 1 N/A
821 1 irgsp exon 303981 304509 . 1 . N/A N/A 1 N/A 0 2 Os01t0105700-01.exon2 N/A Os01t0105700-01.exon2 N/A Os01t0105700-01.exon2 transcript:Os01t0105700-01 N/A 2 N/A
822 1 irgsp exon 305572 305718 . 1 . N/A N/A 1 N/A 0 0 Os01t0105700-01.exon3 N/A Os01t0105700-01.exon3 N/A Os01t0105700-01.exon3 transcript:Os01t0105700-01 N/A 3 N/A
823 1 irgsp exon 305834 305899 . 1 . N/A N/A 1 N/A 0 0 Os01t0105700-01.exon4 N/A Os01t0105700-01.exon4 N/A Os01t0105700-01.exon4 transcript:Os01t0105700-01 N/A 4 N/A
824 1 irgsp exon 305993 306058 . 1 . N/A N/A 1 N/A 0 0 Os01t0105700-01.exon5 N/A Os01t0105700-01.exon5 N/A Os01t0105700-01.exon5 transcript:Os01t0105700-01 N/A 5 N/A
825 1 irgsp exon 306171 306245 . 1 . N/A N/A 1 N/A 0 0 Os01t0105700-01.exon6 N/A Os01t0105700-01.exon6 N/A Os01t0105700-01.exon6 transcript:Os01t0105700-01 N/A 6 N/A
826 1 irgsp exon 306353 306736 . 1 . N/A N/A 1 N/A -1 0 Os01t0105700-01.exon7 N/A Os01t0105700-01.exon7 N/A Os01t0105700-01.exon7 transcript:Os01t0105700-01 N/A 7 N/A
827 1 irgsp CDS 303329 303471 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
828 1 irgsp CDS 303981 304509 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
829 1 irgsp CDS 305572 305718 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
830 1 irgsp CDS 305834 305899 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
831 1 irgsp CDS 305993 306058 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
832 1 irgsp CDS 306171 306245 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
833 1 irgsp CDS 306353 306493 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105700-01 N/A N/A transcript:Os01t0105700-01 Os01t0105700-01 N/A N/A
834 1 irgsp five_prime_UTR 303233 303328 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-75 N/A N/A transcript:Os01t0105700-01 N/A N/A N/A
835 1 irgsp three_prime_UTR 306494 306736 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-66 N/A N/A transcript:Os01t0105700-01 N/A N/A N/A
836 1 irgsp gene 306871 308842 . -1 . N/A protein_coding N/A Similar to Iron sulfur assembly protein 1. (Os01t0105800-01) N/A N/A N/A Os01g0105800 gene:Os01g0105800 irgspv1.0-20170804-genes IRON-SULFUR CLUSTER PROTEIN 9 N/A N/A N/A N/A
837 1 irgsp mRNA 306871 308842 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105800-01 N/A N/A gene:Os01g0105800 N/A N/A Os01t0105800-01
838 1 irgsp exon 306871 307217 . -1 . N/A N/A 1 N/A -1 2 Os01t0105800-01.exon4 N/A Os01t0105800-01.exon4 N/A Os01t0105800-01.exon4 transcript:Os01t0105800-01 N/A 4 N/A
839 1 irgsp exon 307296 307413 . -1 . N/A N/A 1 N/A 2 1 Os01t0105800-01.exon3 N/A Os01t0105800-01.exon3 N/A Os01t0105800-01.exon3 transcript:Os01t0105800-01 N/A 3 N/A
840 1 irgsp exon 308397 308626 . -1 . N/A N/A 1 N/A 1 -1 Os01t0105800-01.exon2 N/A Os01t0105800-01.exon2 N/A Os01t0105800-01.exon2 transcript:Os01t0105800-01 N/A 2 N/A
841 1 irgsp exon 308703 308842 . -1 . N/A N/A 1 N/A -1 -1 Os01t0105800-01.exon1 N/A Os01t0105800-01.exon1 N/A Os01t0105800-01.exon1 transcript:Os01t0105800-01 N/A 1 N/A
842 1 irgsp CDS 307124 307217 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105800-01 N/A N/A transcript:Os01t0105800-01 Os01t0105800-01 N/A N/A
843 1 irgsp CDS 307296 307413 . -1 2 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105800-01 N/A N/A transcript:Os01t0105800-01 Os01t0105800-01 N/A N/A
844 1 irgsp CDS 308397 308601 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105800-01 N/A N/A transcript:Os01t0105800-01 Os01t0105800-01 N/A N/A
845 1 irgsp five_prime_UTR 308602 308626 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-76 N/A N/A transcript:Os01t0105800-01 N/A N/A N/A
846 1 irgsp five_prime_UTR 308703 308842 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-77 N/A N/A transcript:Os01t0105800-01 N/A N/A N/A
847 1 irgsp three_prime_UTR 306871 307123 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-67 N/A N/A transcript:Os01t0105800-01 N/A N/A N/A
848 1 irgsp gene 309520 313170 . -1 . N/A protein_coding N/A Carbohydrate/purine kinase domain containing protein. (Os01t0105900-01) N/A N/A N/A Os01g0105900 gene:Os01g0105900 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
849 1 irgsp mRNA 309520 313170 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0105900-01 N/A N/A gene:Os01g0105900 N/A N/A Os01t0105900-01
850 1 irgsp exon 309520 310070 . -1 . N/A N/A 1 N/A -1 0 Os01t0105900-01.exon8 N/A Os01t0105900-01.exon8 N/A Os01t0105900-01.exon8 transcript:Os01t0105900-01 N/A 8 N/A
851 1 irgsp exon 310256 310367 . -1 . N/A N/A 1 N/A 0 2 Os01t0105900-01.exon7 N/A Os01t0105900-01.exon7 N/A Os01t0105900-01.exon7 transcript:Os01t0105900-01 N/A 7 N/A
852 1 irgsp exon 310455 310552 . -1 . N/A N/A 1 N/A 2 0 Os01t0105900-01.exon6 N/A Os01t0105900-01.exon6 N/A Os01t0105900-01.exon6 transcript:Os01t0105900-01 N/A 6 N/A
853 1 irgsp exon 310632 310739 . -1 . N/A N/A 1 N/A 0 0 Os01t0105900-01.exon5 N/A Os01t0105900-01.exon5 N/A Os01t0105900-01.exon5 transcript:Os01t0105900-01 N/A 5 N/A
854 1 irgsp exon 310880 310918 . -1 . N/A N/A 1 N/A 0 0 Os01t0105900-01.exon4 N/A Os01t0105900-01.exon4 N/A Os01t0105900-01.exon4 transcript:Os01t0105900-01 N/A 4 N/A
855 1 irgsp exon 311002 311073 . -1 . N/A N/A 1 N/A 0 0 Os01t0105900-01.exon3 N/A Os01t0105900-01.exon3 N/A Os01t0105900-01.exon3 transcript:Os01t0105900-01 N/A 3 N/A
856 1 irgsp exon 311163 311426 . -1 . N/A N/A 1 N/A 0 0 Os01t0105900-01.exon2 N/A Os01t0105900-01.exon2 N/A Os01t0105900-01.exon2 transcript:Os01t0105900-01 N/A 2 N/A
857 1 irgsp exon 312867 313170 . -1 . N/A N/A 1 N/A 0 -1 Os01t0105900-01.exon1 N/A Os01t0105900-01.exon1 N/A Os01t0105900-01.exon1 transcript:Os01t0105900-01 N/A 1 N/A
858 1 irgsp CDS 309822 310070 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
859 1 irgsp CDS 310256 310367 . -1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
860 1 irgsp CDS 310455 310552 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
861 1 irgsp CDS 310632 310739 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
862 1 irgsp CDS 310880 310918 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
863 1 irgsp CDS 311002 311073 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
864 1 irgsp CDS 311163 311426 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
865 1 irgsp CDS 312867 313064 . -1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0105900-01 N/A N/A transcript:Os01t0105900-01 Os01t0105900-01 N/A N/A
866 1 irgsp five_prime_UTR 313065 313170 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-78 N/A N/A transcript:Os01t0105900-01 N/A N/A N/A
867 1 irgsp three_prime_UTR 309520 309821 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-68 N/A N/A transcript:Os01t0105900-01 N/A N/A N/A
868 1 irgsp gene 319754 322205 . 1 . N/A protein_coding N/A Similar to RER1A protein (AtRER1A). (Os01t0106200-01) N/A N/A N/A Os01g0106200 gene:Os01g0106200 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
869 1 irgsp mRNA 319754 322205 . 1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0106200-01 N/A N/A gene:Os01g0106200 N/A N/A Os01t0106200-01
870 1 irgsp exon 319754 320236 . 1 . N/A N/A 1 N/A 2 -1 Os01t0106200-01.exon1 N/A Os01t0106200-01.exon1 N/A Os01t0106200-01.exon1 transcript:Os01t0106200-01 N/A 1 N/A
871 1 irgsp exon 321468 321648 . 1 . N/A N/A 1 N/A 0 2 Os01t0106200-01.exon2 N/A Os01t0106200-01.exon2 N/A Os01t0106200-01.exon2 transcript:Os01t0106200-01 N/A 2 N/A
872 1 irgsp exon 321928 322205 . 1 . N/A N/A 1 N/A -1 0 Os01t0106200-01.exon3 N/A Os01t0106200-01.exon3 N/A Os01t0106200-01.exon3 transcript:Os01t0106200-01 N/A 3 N/A
873 1 irgsp CDS 319875 320236 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0106200-01 N/A N/A transcript:Os01t0106200-01 Os01t0106200-01 N/A N/A
874 1 irgsp CDS 321468 321648 . 1 1 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0106200-01 N/A N/A transcript:Os01t0106200-01 Os01t0106200-01 N/A N/A
875 1 irgsp CDS 321928 321975 . 1 0 N/A N/A N/A N/A N/A N/A N/A N/A CDS:Os01t0106200-01 N/A N/A transcript:Os01t0106200-01 Os01t0106200-01 N/A N/A
876 1 irgsp five_prime_UTR 319754 319874 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-five_prime_utr-79 N/A N/A transcript:Os01t0106200-01 N/A N/A N/A
877 1 irgsp three_prime_UTR 321976 322205 . 1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-69 N/A N/A transcript:Os01t0106200-01 N/A N/A N/A
878 1 irgsp gene 322591 323923 . -1 . N/A protein_coding N/A Similar to Isoflavone reductase homolog IRL (EC 1.3.1.-). (Os01t0106300-01) N/A N/A N/A Os01g0106300 gene:Os01g0106300 irgspv1.0-20170804-genes N/A N/A N/A N/A N/A
879 1 irgsp mRNA 322591 323923 . -1 . N/A protein_coding N/A N/A N/A N/A N/A N/A transcript:Os01t0106300-01 N/A N/A gene:Os01g0106300 N/A N/A Os01t0106300-01
880 1 irgsp exon 322591 323923 . -1 . N/A N/A 1 N/A -1 1 Os01t0106300-01.exon2 N/A Os01t0106300-01.exon2 N/A Os01t0106300-01.exon2 transcript:Os01t0106300-01 N/A 2 N/A
881 1 irgsp three_prime_UTR 322591 322809 . -1 . N/A N/A N/A N/A N/A N/A N/A N/A agat-three_prime_utr-70 N/A N/A transcript:Os01t0106300-01 N/A N/A N/A

10
src/agat/agat_convert_sp_gff2tsv/test_data/script.sh Executable file
View File

@@ -0,0 +1,10 @@
#!/bin/bash
# clone repo
if [ ! -d /tmp/agat_source ]; then
git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
fi
# copy test data
cp -r /tmp/agat_source/t/scripts_output/out/agat_convert_sp_gff2tsv_1.tsv src/agat/agat_convert_sp_gff2tsv/test_data
cp -r /tmp/agat_source/t/scripts_output/in/1.gff src/agat/agat_convert_sp_gff2tsv/test_data

75
src/agat/agat_convert_sp_gxf2gxf/config.vsh.yaml Normal file
View File

@@ -0,0 +1,75 @@
name: agat_convert_sp_gxf2gxf
namespace: agat
description: |
This script fixes and/or standardizes any GTF/GFF file into full sorted
GTF/GFF file. It AGAT parser removes duplicate features, fixes
duplicated IDs, adds missing ID and/or Parent attributes, deflates
factorized attributes (attributes with several parents are duplicated
with uniq ID), add missing features when possible (e.g. add exon if only
CDS described, add UTR if CDS and exon described), fix feature locations
(e.g. check exon is embedded in the parent features mRNA, gene), etc...
All AGAT's scripts with the _sp_ prefix use the AGAT parser, before to
perform any supplementary task. So, it is not necessary to run this
script prior the use of any other _sp_ script.
keywords: [gene annotations, GFF conversion]
links:
homepage: https://github.com/NBISweden/AGAT
documentation: https://agat.readthedocs.io/en/latest/tools/agat_convert_sp_gxf2gxf.html
issue_tracker: https://github.com/NBISweden/AGAT/issues
repository: https://github.com/NBISweden/AGAT
references:
doi: 10.5281/zenodo.3552717
license: GPL-3.0
authors:
- __merge__: /src/_authors/leila_paquay.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --gxf
alternatives: [-g, --gtf, --gff]
description: |
String - Input GTF/GFF file. Compressed file with .gz extension is accepted.
type: file
required: true
direction: input
example: input.gff
- name: Outputs
arguments:
- name: --output
alternatives: [-o]
description: |
String - Output GFF file. If no output file is specified, the output will be written to STDOUT.
type: file
direction: output
required: true
example: output.gff
- name: Arguments
arguments:
- name: --config
alternatives: [-c]
description: |
String - Input agat config file. By default AGAT takes as input agat_config.yaml file from the working directory if any, otherwise it takes the original agat_config.yaml shipped with AGAT. To get the agat_config.yaml locally type: "agat config --expose". The --config option gives you the possibility to use your own AGAT config file (located elsewhere or named differently).
type: file
required: false
example: custom_agat_config.yaml
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
- type: file
path: test_data
engines:
- type: docker
image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
setup:
- type: docker
run: |
agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

73
src/agat/agat_convert_sp_gxf2gxf/help.txt Normal file
View File

@@ -0,0 +1,73 @@
```sh
agat_convert_sp_gxf2gxf.pl --help
```
------------------------------------------------------------------------------
| Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0 |
| https://github.com/NBISweden/AGAT |
| National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se |
------------------------------------------------------------------------------
Name:
agat_convert_sp_gxf2gxf.pl
Description:
This script fixes and/or standardizes any GTF/GFF file into full sorted
GTF/GFF file. It AGAT parser removes duplicate features, fixes
duplicated IDs, adds missing ID and/or Parent attributes, deflates
factorized attributes (attributes with several parents are duplicated
with uniq ID), add missing features when possible (e.g. add exon if only
CDS described, add UTR if CDS and exon described), fix feature locations
(e.g. check exon is embedded in the parent features mRNA, gene), etc...
All AGAT's scripts with the _sp_ prefix use the AGAT parser, before to
perform any supplementary task. So, it is not necessary to run this
script prior the use of any other _sp_ script.
Usage:
agat_convert_sp_gxf2gxf.pl -g infile.gff [ -o outfile ]
agat_convert_sp_gxf2gxf.pl --help
Options:
-g, --gtf, --gff or --gxf
String - Input GTF/GFF file. Compressed file with .gz extension
is accepted.
-o or --output
String - Output GFF file. If no output file is specified, the
output will be written to STDOUT.
-c or --config
String - Input agat config file. By default AGAT takes as input
agat_config.yaml file from the working directory if any,
otherwise it takes the orignal agat_config.yaml shipped with
AGAT. To get the agat_config.yaml locally type: "agat config
--expose". The --config option gives you the possibility to use
your own AGAT config file (located elsewhere or named
differently).
-h or --help
Boolean - Display this helpful text.
Feedback:
Did you find a bug?:
Do not hesitate to report bugs to help us keep track of the bugs and
their resolution. Please use the GitHub issue tracking system available
at this address:
https://github.com/NBISweden/AGAT/issues
Ensure that the bug was not already reported by searching under Issues.
If you're unable to find an (open) issue addressing the problem, open a new one.
Try as much as possible to include in the issue when relevant:
- a clear description,
- as much relevant information as possible,
- the command used,
- a data sample,
- an explanation of the expected behaviour that is not occurring.
Do you want to contribute?:
You are very welcome, visit this address for the Contributing
guidelines:
https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md

9
src/agat/agat_convert_sp_gxf2gxf/script.sh Normal file
View File

@@ -0,0 +1,9 @@
#!/bin/bash
## VIASH START
## VIASH END
agat_convert_sp_gxf2gxf.pl \
-g "$par_gxf" \
-o "$par_output" \
${par_config:+--config "${par_config}"}

28
src/agat/agat_convert_sp_gxf2gxf/test.sh Normal file
View File

@@ -0,0 +1,28 @@
#!/bin/bash
## VIASH START
## VIASH END
test_dir="${meta_resources_dir}/test_data"
out_dir="${meta_resources_dir}/out_data"
echo "> Run $meta_name with test data"
"$meta_executable" \
--gxf "$test_dir/0_test.gff" \
--output "$out_dir/output.gff"
echo ">> Checking output"
[ ! -f "$out_dir/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
echo ">> Check if output is empty"
[ ! -s "$out_dir/output.gff" ] && echo "Output file output.gff is empty" && exit 1
echo ">> Check if output matches expected output"
diff "$out_dir/output.gff" "$test_dir/0_correct_output.gff"
if [ $? -ne 0 ]; then
echo "Output file output.gff does not match expected output"
exit 1
fi
echo "> Test successful"

36
src/agat/agat_convert_sp_gxf2gxf/test_data/0_correct_output.gff Normal file
View File

@@ -0,0 +1,36 @@
##gff-version 3
scaffold625 maker gene 337818 343277 . + . ID=CLUHARG00000005458;Name=TUBB3_2
scaffold625 maker mRNA 337818 343277 . + . ID=CLUHART00000008717;Parent=CLUHARG00000005458
scaffold625 maker exon 337818 337971 . + . ID=CLUHART00000008717:exon:1404;Parent=CLUHART00000008717
scaffold625 maker exon 340733 340841 . + . ID=CLUHART00000008717:exon:1405;Parent=CLUHART00000008717
scaffold625 maker exon 341518 341628 . + . ID=CLUHART00000008717:exon:1406;Parent=CLUHART00000008717
scaffold625 maker exon 341964 343277 . + . ID=CLUHART00000008717:exon:1407;Parent=CLUHART00000008717
scaffold625 maker CDS 337915 337971 . + 0 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker CDS 340733 340841 . + 0 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker CDS 341518 341628 . + 2 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker CDS 341964 343033 . + 2 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker five_prime_UTR 337818 337914 . + . ID=CLUHART00000008717:five_prime_utr;Parent=CLUHART00000008717
scaffold625 maker three_prime_UTR 343034 343277 . + . ID=CLUHART00000008717:three_prime_utr;Parent=CLUHART00000008717
scaffold789 maker gene 558184 564780 . + . ID=CLUHARG00000003852;Name=PF11_0240
scaffold789 maker mRNA 558184 564780 . + . ID=CLUHART00000006146;Parent=CLUHARG00000003852
scaffold789 maker exon 558184 560123 . + . ID=CLUHART00000006146:exon:995;Parent=CLUHART00000006146
scaffold789 maker exon 561401 561519 . + . ID=CLUHART00000006146:exon:996;Parent=CLUHART00000006146
scaffold789 maker exon 564171 564235 . + . ID=CLUHART00000006146:exon:997;Parent=CLUHART00000006146
scaffold789 maker exon 564372 564780 . + . ID=CLUHART00000006146:exon:998;Parent=CLUHART00000006146
scaffold789 maker CDS 558191 560123 . + 0 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker CDS 561401 561519 . + 2 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker CDS 564171 564235 . + 0 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker CDS 564372 564588 . + 1 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker five_prime_UTR 558184 558190 . + . ID=CLUHART00000006146:five_prime_utr;Parent=CLUHART00000006146
scaffold789 maker three_prime_UTR 564589 564780 . + . ID=CLUHART00000006146:three_prime_utr;Parent=CLUHART00000006146
scaffold789 maker mRNA 558184 564780 . + . ID=CLUHART00000006147;Parent=CLUHARG00000003852
scaffold789 maker exon 558184 560123 . + . ID=CLUHART00000006147:exon:997;Parent=CLUHART00000006147
scaffold789 maker exon 561401 561519 . + . ID=CLUHART00000006147:exon:998;Parent=CLUHART00000006147
scaffold789 maker exon 562057 562121 . + . ID=CLUHART00000006147:exon:999;Parent=CLUHART00000006147
scaffold789 maker exon 564372 564780 . + . ID=CLUHART00000006147:exon:1000;Parent=CLUHART00000006147
scaffold789 maker CDS 558191 560123 . + 0 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker CDS 561401 561519 . + 2 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker CDS 562057 562121 . + 0 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker CDS 564372 564588 . + 1 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker five_prime_UTR 558184 558190 . + . ID=CLUHART00000006147:five_prime_utr;Parent=CLUHART00000006147
scaffold789 maker three_prime_UTR 564589 564780 . + . ID=CLUHART00000006147:three_prime_utr;Parent=CLUHART00000006147

36
src/agat/agat_convert_sp_gxf2gxf/test_data/0_test.gff Normal file
View File

@@ -0,0 +1,36 @@
##gff-version 3
scaffold625 maker gene 337818 343277 . + . ID=CLUHARG00000005458;Name=TUBB3_2
scaffold625 maker mRNA 337818 343277 . + . ID=CLUHART00000008717;Parent=CLUHARG00000005458
scaffold625 maker exon 337818 337971 . + . ID=CLUHART00000008717:exon:1404;Parent=CLUHART00000008717
scaffold625 maker exon 340733 340841 . + . ID=CLUHART00000008717:exon:1405;Parent=CLUHART00000008717
scaffold625 maker exon 341518 341628 . + . ID=CLUHART00000008717:exon:1406;Parent=CLUHART00000008717
scaffold625 maker exon 341964 343277 . + . ID=CLUHART00000008717:exon:1407;Parent=CLUHART00000008717
scaffold625 maker CDS 337915 337971 . + 0 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker CDS 340733 340841 . + 0 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker CDS 341518 341628 . + 2 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker CDS 341964 343033 . + 2 ID=CLUHART00000008717:cds;Parent=CLUHART00000008717
scaffold625 maker five_prime_UTR 337818 337914 . + . ID=CLUHART00000008717:five_prime_utr;Parent=CLUHART00000008717
scaffold625 maker three_prime_UTR 343034 343277 . + . ID=CLUHART00000008717:three_prime_utr;Parent=CLUHART00000008717
scaffold789 maker gene 558184 564780 . + . ID=CLUHARG00000003852;Name=PF11_0240
scaffold789 maker mRNA 558184 564780 . + . ID=CLUHART00000006146;Parent=CLUHARG00000003852
scaffold789 maker exon 558184 560123 . + . ID=CLUHART00000006146:exon:995;Parent=CLUHART00000006146
scaffold789 maker exon 561401 561519 . + . ID=CLUHART00000006146:exon:996;Parent=CLUHART00000006146
scaffold789 maker exon 564171 564235 . + . ID=CLUHART00000006146:exon:997;Parent=CLUHART00000006146
scaffold789 maker exon 564372 564780 . + . ID=CLUHART00000006146:exon:998;Parent=CLUHART00000006146
scaffold789 maker CDS 558191 560123 . + 0 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker CDS 561401 561519 . + 2 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker CDS 564171 564235 . + 0 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker CDS 564372 564588 . + 1 ID=CLUHART00000006146:cds;Parent=CLUHART00000006146
scaffold789 maker five_prime_UTR 558184 558190 . + . ID=CLUHART00000006146:five_prime_utr;Parent=CLUHART00000006146
scaffold789 maker three_prime_UTR 564589 564780 . + . ID=CLUHART00000006146:three_prime_utr;Parent=CLUHART00000006146
scaffold789 maker mRNA 558184 564780 . + . ID=CLUHART00000006147;Parent=CLUHARG00000003852
scaffold789 maker exon 558184 560123 . + . ID=CLUHART00000006147:exon:997;Parent=CLUHART00000006147
scaffold789 maker exon 561401 561519 . + . ID=CLUHART00000006147:exon:998;Parent=CLUHART00000006147
scaffold789 maker exon 562057 562121 . + . ID=CLUHART00000006147:exon:999;Parent=CLUHART00000006147
scaffold789 maker exon 564372 564780 . + . ID=CLUHART00000006147:exon:1000;Parent=CLUHART00000006147
scaffold789 maker CDS 558191 560123 . + 0 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker CDS 561401 561519 . + 2 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker CDS 562057 562121 . + 0 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker CDS 564372 564588 . + 1 ID=CLUHART00000006147:cds;Parent=CLUHART00000006147
scaffold789 maker five_prime_UTR 558184 558190 . + . ID=CLUHART00000006147:five_prime_utr;Parent=CLUHART00000006147
scaffold789 maker three_prime_UTR 564589 564780 . + . ID=CLUHART00000006147:three_prime_utr;Parent=CLUHART00000006147

10
src/agat/agat_convert_sp_gxf2gxf/test_data/script.sh Executable file
View File

@@ -0,0 +1,10 @@
#!/bin/bash
# clone repo
if [ ! -d /tmp/agat_source ]; then
git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
fi
# copy test data
cp -r /tmp/agat_source/t/gff_syntax/in/0_test.gff src/agat/agat_convert_sp_gxf2gxf/test_data
cp -r /tmp/agat_source/t/gff_syntax/out/0_correct_output.gff src/agat/agat_convert_sp_gxf2gxf/test_data

388
src/arriba/config.vsh.yaml Normal file
View File

@@ -0,0 +1,388 @@
name: arriba
description: Detect gene fusions from RNA-Seq data
keywords: [Gene fusion, RNA-Seq]
links:
homepage: https://arriba.readthedocs.io/en/latest/
documentation: https://arriba.readthedocs.io/en/latest/
repository: https://github.com/suhrig/arriba
references:
doi: 10.1101/gr.257246.119
license: MIT
requirements:
cpus: 1
commands: [ arriba ]
authors:
- __merge__: /src/_authors/robrecht_cannoodt.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --bam
alternatives: -x
type: file
description: |
File in SAM/BAM/CRAM format with main alignments as generated by STAR
(Aligned.out.sam). Arriba extracts candidate reads from this file.
required: true
example: Aligned.out.bam
- name: --genome
alternatives: -a
type: file
description: |
FastA file with genome sequence (assembly). The file may be gzip-compressed. An
index with the file extension .fai must exist only if CRAM files are processed.
required: true
example: assembly.fa
- name: --gene_annotation
alternatives: -g
type: file
description: |
GTF file with gene annotation. The file may be gzip-compressed.
required: true
example: annotation.gtf
- name: --known_fusions
alternatives: -k
type: file
description: |
File containing known/recurrent fusions. Some cancer entities are often
characterized by fusions between the same pair of genes. In order to boost
sensitivity, a list of known fusions can be supplied using this parameter. The list
must contain two columns with the names of the fused genes, separated by tabs.
required: false
example: known_fusions.tsv
- name: --blacklist
alternatives: -b
type: file
description: |
File containing blacklisted events (recurrent artifacts and transcripts
observed in healthy tissue).
required: false
example: blacklist.tsv
- name: --structural_variants
alternatives: -d
type: file
description: |
Tab-separated file with coordinates of structural variants found using
whole-genome sequencing data. These coordinates serve to increase sensitivity
towards weakly expressed fusions and to eliminate fusions with low evidence.
required: false
example: structural_variants_from_WGS.tsv
- name: --tags
alternatives: -t
type: file
description: |
Tab-separated file containing fusions to annotate with tags in the 'tags' column.
The first two columns specify the genes; the third column specifies the tag. The
file may be gzip-compressed.
required: false
example: tags.tsv
- name: --protein_domains
alternatives: -p
type: file
description: |
File in GFF3 format containing coordinates of the protein domains of genes. The
protein domains retained in a fusion are listed in the column
'retained_protein_domains'. The file may be gzip-compressed.
required: false
example: protein_domains.gff3
- name: Outputs
arguments:
- name: --fusions
alternatives: -o
type: file
direction: output
description: |
Output file with fusions that have passed all filters.
required: true
example: fusions.tsv
- name: --fusions_discarded
alternatives: -O
type: file
direction: output
description: |
Output file with fusions that were discarded due to filtering.
required: false
example: fusions.discarded.tsv
- name: Arguments
arguments:
- name: --max_genomic_breakpoint_distance
alternatives: -D
type: long
description: |
When a file with genomic breakpoints obtained via
whole-genome sequencing is supplied via the --structural_variants
parameter, this parameter determines how far a
genomic breakpoint may be away from a
transcriptomic breakpoint to consider it as a
related event. For events inside genes, the
distance is added to the end of the gene; for
intergenic events, the distance threshold is
applied as is. Default: 100000.
required: false
- name: --strandedness
alternatives: -s
type: string
description: |
Whether a strand-specific protocol was used for library preparation,
and if so, the type of strandedness (auto/yes/no/reverse). When
unstranded data is processed, the strand can sometimes be inferred from
splice-patterns. But in unclear situations, stranded data helps
resolve ambiguities. Default: auto
choices: ["auto", "yes", "no", "reverse"]
required: false
- name: --interesting_contigs
alternatives: -i
type: string
description: |
List of interesting contigs. Fusions between genes
on other contigs are ignored. Contigs can be specified with or without the
prefix "chr". Asterisks (*) are treated as wild-cards.
Default: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y AC_* NC_*
required: false
multiple: true
example: ["1", "2", "AC_*", "NC_*"]
- name: --viral_contigs
alternatives: -v
type: string
description: |
List of viral contigs. Asterisks (*) are treated as
wild-cards.
Default: AC_* NC_*
required: false
multiple: true
example: ["AC_*", "NC_*"]
- name: --disable_filters
alternatives: -f
type: string
description: |
List of filters to disable. By default all filters are
enabled.
choices: [ homologs, low_entropy, isoforms,
top_expressed_viral_contigs, viral_contigs, uninteresting_contigs,
non_coding_neighbors, mismatches, duplicates, no_genomic_support,
genomic_support, intronic, end_to_end, relative_support,
low_coverage_viral_contigs, merge_adjacent, mismappers, multimappers,
same_gene, long_gap, internal_tandem_duplication, small_insert_size,
read_through, inconsistently_clipped, intragenic_exonic,
marginal_read_through, spliced, hairpin, blacklist, min_support,
select_best, in_vitro, short_anchor, known_fusions, no_coverage,
homopolymer, many_spliced ]
required: false
multiple: true
- name: --max_e_value
alternatives: -E
type: double
description: |
Arriba estimates the number of fusions with a given number of supporting
reads which one would expect to see by random chance. If the expected number
of fusions (e-value) is higher than this threshold, the fusion is
discarded by the 'relative_support' filter. Note: Increasing this
threshold can dramatically increase the number of false positives and may
increase the runtime of resource-intensive steps. Fractional values are
possible. Default: 0.300000
required: false
- name: --min_supporting_reads
alternatives: -S
type: integer
description: |
The 'min_support' filter discards all fusions with fewer than
this many supporting reads (split reads and discordant mates
combined). Default: 2
required: false
example: 2
- name: --max_mismappers
alternatives: -m
type: double
description: |
When more than this fraction of supporting reads turns out to be
mismappers, the 'mismappers' filter discards the fusion. Default:
0.800000
required: false
example: 0.8
- name: --max_homolog_identity
alternatives: -L
type: double
description: |
Genes with more than the given fraction of sequence identity are
considered homologs and removed by the 'homologs' filter.
Default: 0.300000
required: false
example: 0.3
- name: --homopolymer_length
alternatives: -H
type: integer
description: |
The 'homopolymer' filter removes breakpoints adjacent to
homopolymers of the given length or more. Default: 6
required: false
example: 6
- name: --read_through_distance
alternatives: -R
type: integer
description: |
The 'read_through' filter removes read-through fusions
where the breakpoints are less than the given distance away
from each other. Default: 10000
required: false
example: 10000
- name : --min_anchor_length
alternatives: -A
type: integer
description: |
Alignment artifacts are often characterized by split reads coming
from only one gene and no discordant mates. Moreover, the split
reads only align to a short stretch in one of the genes. The
'short_anchor' filter removes these fusions. This parameter sets
the threshold in bp for what the filter considers short. Default: 23
required: false
example: 23
- name: --many_spliced_events
alternatives: -M
type: integer
description: |
The 'many_spliced' filter recovers fusions between genes that
have at least this many spliced breakpoints. Default: 4
required: false
example: 4
- name: --max_kmer_content
alternatives: -K
type: double
description: |
The 'low_entropy' filter removes reads with repetitive 3-mers. If
the 3-mers make up more than the given fraction of the sequence, then
the read is discarded. Default: 0.600000
required: false
example: 0.6
- name: --max_mismatch_pvalue
alternatives: -V
type: double
description: |
The 'mismatches' filter uses a binomial model to calculate a
p-value for observing a given number of mismatches in a read. If
the number of mismatches is too high, the read is discarded.
Default: 0.010000
required: false
example: 0.05
- name: --fragment_length
alternatives: -F
type: integer
description: |
When paired-end data is given, the fragment length is estimated
automatically and this parameter has no effect. But when single-end
data is given, the mean fragment length should be specified to
effectively filter fusions that arise from hairpin structures.
Default: 200
required: false
example: 200
- name: --max_reads
alternatives: -U
type: integer
description: |
Subsample fusions with more than the given number of supporting reads. This
improves performance without compromising sensitivity, as long as the
threshold is high. Counting of supporting reads beyond the threshold is
inaccurate, obviously. Default: 300
required: false
example: 300
- name: --quantile
alternatives: -Q
type: double
description: |
Highly expressed genes are prone to produce artifacts during library
preparation. Genes with an expression above the given quantile are eligible
for filtering by the 'in_vitro' filter. Default: 0.998000
required: false
example: 0.998
- name: --exonic_fraction
alternatives: -e
type: double
description: |
The breakpoints of false-positive predictions of intragenic events
are often both in exons. True predictions are more likely to have at
least one breakpoint in an intron, because introns are larger. If the
fraction of exonic sequence between two breakpoints is smaller than
the given fraction, the 'intragenic_exonic' filter discards the
event. Default: 0.330000
required: false
example: 0.33
- name: --top_n
alternatives: -T
type: integer
description: |
Only report viral integration sites of the top N most highly expressed viral
contigs. Default: 5
required: false
example: 5
- name: --covered_fraction
alternatives: -C
type: double
description: |
Ignore virally associated events if the virus is not fully
expressed, i.e., less than the given fraction of the viral contig is
transcribed. Default: 0.050000
required: false
example: 0.05
- name: --max_itd_length
alternatives: -l
type: integer
description: |
Maximum length of internal tandem duplications. Note: Increasing
this value beyond the default can impair performance and lead to many
false positives. Default: 100
required: false
example: 100
- name: --min_itd_allele_fraction
alternatives: -z
type: double
description: |
Required fraction of supporting reads to report an internal
tandem duplication. Default: 0.070000
required: false
example: 0.07
- name: --min_itd_supporting_reads
alternatives: -Z
type: integer
description: |
Required absolute number of supporting reads to report an
internal tandem duplication. Default: 10
required: false
example: 10
- name: --skip_duplicate_marking
alternatives: -u
type: boolean_true
description: |
Instead of performing duplicate marking itself, Arriba relies on duplicate marking by a
preceding program using the BAM_FDUP flag. This makes sense when unique molecular
identifiers (UMI) are used.
- name: --extra_information
alternatives: -X
type: boolean_true
description: |
To reduce the runtime and file size, by default, the columns 'fusion_transcript',
'peptide_sequence', and 'read_identifiers' are left empty in the file containing
discarded fusion candidates (see parameter -O). When this flag is set, this extra
information is reported in the discarded fusions file.
- name: --fill_gaps
alternatives: -I
type: boolean_true
description: |
If assembly of the fusion transcript sequence from the supporting reads is incomplete
(denoted as '...'), fill the gaps using the assembly sequence wherever possible.
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
- type: file
path: test_data
engines:
- type: docker
image: quay.io/biocontainers/arriba:2.4.0--h0033a41_2
setup:
- type: docker
run: |
arriba -h | grep 'Version:' 2>&1 | sed 's/Version:\s\(.*\)/arriba: "\1"/' > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

198
src/arriba/help.txt Normal file
View File

@@ -0,0 +1,198 @@
```bash
arriba -h
```
Arriba gene fusion detector
---------------------------
Version: 2.4.0
Arriba is a fast tool to search for aberrant transcripts such as gene fusions.
It is based on chimeric alignments found by the STAR RNA-Seq aligner.
Usage: arriba [-c Chimeric.out.sam] -x Aligned.out.bam \
-g annotation.gtf -a assembly.fa [-b blacklists.tsv] [-k known_fusions.tsv] \
[-t tags.tsv] [-p protein_domains.gff3] [-d structural_variants_from_WGS.tsv] \
-o fusions.tsv [-O fusions.discarded.tsv] \
[OPTIONS]
-c FILE File in SAM/BAM/CRAM format with chimeric alignments as generated by STAR
(Chimeric.out.sam). This parameter is only required, if STAR was run with the
parameter '--chimOutType SeparateSAMold'. When STAR was run with the parameter
'--chimOutType WithinBAM', it suffices to pass the parameter -x to Arriba and -c
can be omitted.
-x FILE File in SAM/BAM/CRAM format with main alignments as generated by STAR
(Aligned.out.sam). Arriba extracts candidate reads from this file.
-g FILE GTF file with gene annotation. The file may be gzip-compressed.
-G GTF_FEATURES Comma-/space-separated list of names of GTF features.
Default: gene_name=gene_name|gene_id gene_id=gene_id
transcript_id=transcript_id feature_exon=exon feature_CDS=CDS
-a FILE FastA file with genome sequence (assembly). The file may be gzip-compressed. An
index with the file extension .fai must exist only if CRAM files are processed.
-b FILE File containing blacklisted events (recurrent artifacts and transcripts
observed in healthy tissue).
-k FILE File containing known/recurrent fusions. Some cancer entities are often
characterized by fusions between the same pair of genes. In order to boost
sensitivity, a list of known fusions can be supplied using this parameter. The list
must contain two columns with the names of the fused genes, separated by tabs.
-o FILE Output file with fusions that have passed all filters.
-O FILE Output file with fusions that were discarded due to filtering.
-t FILE Tab-separated file containing fusions to annotate with tags in the 'tags' column.
The first two columns specify the genes; the third column specifies the tag. The
file may be gzip-compressed.
-p FILE File in GFF3 format containing coordinates of the protein domains of genes. The
protein domains retained in a fusion are listed in the column
'retained_protein_domains'. The file may be gzip-compressed.
-d FILE Tab-separated file with coordinates of structural variants found using
whole-genome sequencing data. These coordinates serve to increase sensitivity
towards weakly expressed fusions and to eliminate fusions with low evidence.
-D MAX_GENOMIC_BREAKPOINT_DISTANCE When a file with genomic breakpoints obtained via
whole-genome sequencing is supplied via the -d
parameter, this parameter determines how far a
genomic breakpoint may be away from a
transcriptomic breakpoint to consider it as a
related event. For events inside genes, the
distance is added to the end of the gene; for
intergenic events, the distance threshold is
applied as is. Default: 100000
-s STRANDEDNESS Whether a strand-specific protocol was used for library preparation,
and if so, the type of strandedness (auto/yes/no/reverse). When
unstranded data is processed, the strand can sometimes be inferred from
splice-patterns. But in unclear situations, stranded data helps
resolve ambiguities. Default: auto
-i CONTIGS Comma-/space-separated list of interesting contigs. Fusions between genes
on other contigs are ignored. Cfontigs can be specified with or without the
prefix "chr". Asterisks (*) are treated as wild-cards.
Default: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y AC_* NC_*
-v CONTIGS Comma-/space-separated list of viral contigs. Asterisks (*) are treated as
wild-cards.
Default: AC_* NC_*
-f FILTERS Comma-/space-separated list of filters to disable. By default all filters are
enabled. Valid values: homologs, low_entropy, isoforms,
top_expressed_viral_contigs, viral_contigs, uninteresting_contigs,
non_coding_neighbors, mismatches, duplicates, no_genomic_support,
genomic_support, intronic, end_to_end, relative_support,
low_coverage_viral_contigs, merge_adjacent, mismappers, multimappers,
same_gene, long_gap, internal_tandem_duplication, small_insert_size,
read_through, inconsistently_clipped, intragenic_exonic,
marginal_read_through, spliced, hairpin, blacklist, min_support,
select_best, in_vitro, short_anchor, known_fusions, no_coverage,
homopolymer, many_spliced
-E MAX_E-VALUE Arriba estimates the number of fusions with a given number of supporting
reads which one would expect to see by random chance. If the expected number
of fusions (e-value) is higher than this threshold, the fusion is
discarded by the 'relative_support' filter. Note: Increasing this
threshold can dramatically increase the number of false positives and may
increase the runtime of resource-intensive steps. Fractional values are
possible. Default: 0.300000
-S MIN_SUPPORTING_READS The 'min_support' filter discards all fusions with fewer than
this many supporting reads (split reads and discordant mates
combined). Default: 2
-m MAX_MISMAPPERS When more than this fraction of supporting reads turns out to be
mismappers, the 'mismappers' filter discards the fusion. Default:
0.800000
-L MAX_HOMOLOG_IDENTITY Genes with more than the given fraction of sequence identity are
considered homologs and removed by the 'homologs' filter.
Default: 0.300000
-H HOMOPOLYMER_LENGTH The 'homopolymer' filter removes breakpoints adjacent to
homopolymers of the given length or more. Default: 6
-R READ_THROUGH_DISTANCE The 'read_through' filter removes read-through fusions
where the breakpoints are less than the given distance away
from each other. Default: 10000
-A MIN_ANCHOR_LENGTH Alignment artifacts are often characterized by split reads coming
from only one gene and no discordant mates. Moreover, the split
reads only align to a short stretch in one of the genes. The
'short_anchor' filter removes these fusions. This parameter sets
the threshold in bp for what the filter considers short. Default: 23
-M MANY_SPLICED_EVENTS The 'many_spliced' filter recovers fusions between genes that
have at least this many spliced breakpoints. Default: 4
-K MAX_KMER_CONTENT The 'low_entropy' filter removes reads with repetitive 3-mers. If
the 3-mers make up more than the given fraction of the sequence, then
the read is discarded. Default: 0.600000
-V MAX_MISMATCH_PVALUE The 'mismatches' filter uses a binomial model to calculate a
p-value for observing a given number of mismatches in a read. If
the number of mismatches is too high, the read is discarded.
Default: 0.010000
-F FRAGMENT_LENGTH When paired-end data is given, the fragment length is estimated
automatically and this parameter has no effect. But when single-end
data is given, the mean fragment length should be specified to
effectively filter fusions that arise from hairpin structures.
Default: 200
-U MAX_READS Subsample fusions with more than the given number of supporting reads. This
improves performance without compromising sensitivity, as long as the
threshold is high. Counting of supporting reads beyond the threshold is
inaccurate, obviously. Default: 300
-Q QUANTILE Highly expressed genes are prone to produce artifacts during library
preparation. Genes with an expression above the given quantile are eligible
for filtering by the 'in_vitro' filter. Default: 0.998000
-e EXONIC_FRACTION The breakpoints of false-positive predictions of intragenic events
are often both in exons. True predictions are more likely to have at
least one breakpoint in an intron, because introns are larger. If the
fraction of exonic sequence between two breakpoints is smaller than
the given fraction, the 'intragenic_exonic' filter discards the
event. Default: 0.330000
-T TOP_N Only report viral integration sites of the top N most highly expressed viral
contigs. Default: 5
-C COVERED_FRACTION Ignore virally associated events if the virus is not fully
expressed, i.e., less than the given fraction of the viral contig is
transcribed. Default: 0.050000
-l MAX_ITD_LENGTH Maximum length of internal tandem duplications. Note: Increasing
this value beyond the default can impair performance and lead to many
false positives. Default: 100
-z MIN_ITD_ALLELE_FRACTION Required fraction of supporting reads to report an internal
tandem duplication. Default: 0.070000
-Z MIN_ITD_SUPPORTING_READS Required absolute number of supporting reads to report an
internal tandem duplication. Default: 10
-u Instead of performing duplicate marking itself, Arriba relies on duplicate marking by a
preceding program using the BAM_FDUP flag. This makes sense when unique molecular
identifiers (UMI) are used.
-X To reduce the runtime and file size, by default, the columns 'fusion_transcript',
'peptide_sequence', and 'read_identifiers' are left empty in the file containing
discarded fusion candidates (see parameter -O). When this flag is set, this extra
information is reported in the discarded fusions file.
-I If assembly of the fusion transcript sequence from the supporting reads is incomplete
(denoted as '...'), fill the gaps using the assembly sequence wherever possible.
-h Print help and exit.
Code repository: https://github.com/suhrig/arriba
Get help/report bugs: https://github.com/suhrig/arriba/issues
User manual: https://arriba.readthedocs.io/
Please cite: https://doi.org/10.1101/gr.257246.119

54
src/arriba/script.sh Normal file
View File

@@ -0,0 +1,54 @@
#!/bin/bash
## VIASH START
## VIASH END
# unset flags
[[ "$par_skip_duplicate_marking" == "false" ]] && unset par_skip_duplicate_marking
[[ "$par_extra_information" == "false" ]] && unset par_extra_information
[[ "$par_fill_gaps" == "false" ]] && unset par_fill_gaps
# replace ';' with ','
par_interesting_contigs=$(echo $par_interesting_contigs | tr ';' ',')
par_viral_contigs=$(echo $par_viral_contigs | tr ';' ',')
par_disable_filters=$(echo $par_disable_filters | tr ';' ',')
# run arriba
arriba \
-x "$par_bam" \
-a "$par_genome" \
-g "$par_gene_annotation" \
-o "$par_fusions" \
${par_known_fusions:+-k "${par_known_fusions}"} \
${par_blacklist:+-b "${par_blacklist}"} \
${par_structural_variants:+-d "${par_structural_variants}"} \
${par_tags:+-t "${par_tags}"} \
${par_protein_domains:+-p "${par_protein_domains}"} \
${par_fusions_discarded:+-O "${par_fusions_discarded}"} \
${par_max_genomic_breakpoint_distance:+-D "${par_max_genomic_breakpoint_distance}"} \
${par_strandedness:+-s "${par_strandedness}"} \
${par_interesting_contigs:+-i "${par_interesting_contigs}"} \
${par_viral_contigs:+-v "${par_viral_contigs}"} \
${par_disable_filters:+-f "${par_disable_filters}"} \
${par_max_e_value:+-E "${par_max_e_value}"} \
${par_min_supporting_reads:+-S "${par_min_supporting_reads}"} \
${par_max_mismappers:+-m "${par_max_mismappers}"} \
${par_max_homolog_identity:+-L "${par_max_homolog_identity}"} \
${par_homopolymer_length:+-H "${par_homopolymer_length}"} \
${par_read_through_distance:+-R "${par_read_through_distance}"} \
${par_min_anchor_length:+-A "${par_min_anchor_length}"} \
${par_many_spliced_events:+-M "${par_many_spliced_events}"} \
${par_max_kmer_content:+-K "${par_max_kmer_content}"} \
${par_max_mismatch_pvalue:+-V "${par_max_mismatch_pvalue}"} \
${par_fragment_length:+-F "${par_fragment_length}"} \
${par_max_reads:+-U "${par_max_reads}"} \
${par_quantile:+-Q "${par_quantile}"} \
${par_exonic_fraction:+-e "${par_exonic_fraction}"} \
${par_top_n:+-T "${par_top_n}"} \
${par_covered_fraction:+-C "${par_covered_fraction}"} \
${par_max_itd_length:+-l "${par_max_itd_length}"} \
${par_min_itd_allele_fraction:+-z "${par_min_itd_allele_fraction}"} \
${par_min_itd_supporting_reads:+-Z "${par_min_itd_supporting_reads}"} \
${par_skip_duplicate_marking:+-u} \
${par_extra_information:+-X} \
${par_fill_gaps:+-I}

45
src/arriba/test.sh Normal file
View File

@@ -0,0 +1,45 @@
#!/bin/bash
set -e
dir_in="$meta_resources_dir/test_data"
echo "> Run arriba with blacklist"
"$meta_executable" \
--bam "$dir_in/A.bam" \
--genome "$dir_in/genome.fasta" \
--gene_annotation "$dir_in/annotation.gtf" \
--blacklist "$dir_in/blacklist.tsv" \
--fusions "fusions.tsv" \
--fusions_discarded "fusions_discarded.tsv" \
--interesting_contigs "1,2"
echo ">> Checking output"
[ ! -f "fusions.tsv" ] && echo "Output file fusions.tsv does not exist" && exit 1
[ ! -f "fusions_discarded.tsv" ] && echo "Output file fusions_discarded.tsv does not exist" && exit 1
echo ">> Check if output is empty"
[ ! -s "fusions.tsv" ] && echo "Output file fusions.tsv is empty" && exit 1
[ ! -s "fusions_discarded.tsv" ] && echo "Output file fusions_discarded.tsv is empty" && exit 1
rm fusions.tsv fusions_discarded.tsv
echo "> Run arriba without blacklist"
"$meta_executable" \
--bam "$dir_in/A.bam" \
--genome "$dir_in/genome.fasta" \
--gene_annotation "$dir_in/annotation.gtf" \
--fusions "fusions.tsv" \
--fusions_discarded "fusions_discarded.tsv" \
--interesting_contigs "1,2" \
--disable_filters blacklist
echo ">> Checking output"
[ ! -f "fusions.tsv" ] && echo "Output file fusions.tsv does not exist" && exit 1
[ ! -f "fusions_discarded.tsv" ] && echo "Output file fusions_discarded.tsv does not exist" && exit 1
echo ">> Check if output is empty"
[ ! -s "fusions.tsv" ] && echo "Output file fusions.tsv is empty" && exit 1
[ ! -s "fusions_discarded.tsv" ] && echo "Output file fusions_discarded.tsv is empty" && exit 1
echo "> Test successful"

BIN
src/arriba/test_data/A.bam Normal file
View File

Binary file not shown.

6
src/arriba/test_data/annotation.gtf Normal file
View File

@@ -0,0 +1,6 @@
1 havana gene 1 80 . + . gene_id "ENSG00000000000"; gene_version "5"; gene_name "A"; gene_source "havana"; gene_biotype "gene";
1 havana transcript 1 80 . + . gene_id "ENSG00000000000"; gene_version "5"; transcript_id "ENST00000000000"; transcript_version "2"; gene_name "A"; gene_source "havana"; gene_biotype "gene"; transcript_name "A-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; tag "basic"; transcript_support_level "1";
1 havana exon 1 80 . + . gene_id "ENSG00000000000"; gene_version "5"; transcript_id "ENST00000000000"; transcript_version "2"; exon_number "1"; gene_name "A"; gene_source "havana"; gene_biotype "gene"; transcript_name "A-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00000000000"; exon_version "1"; tag "basic"; transcript_support_level "1";
2 havana gene 1 80 . + . gene_id "ENSG00000000001"; gene_version "5"; gene_name "B"; gene_source "havana"; gene_biotype "gene";
2 havana transcript 1 80 . + . gene_id "ENSG00000000001"; gene_version "5"; transcript_id "ENST00000000001"; transcript_version "2"; gene_name "B"; gene_source "havana"; gene_biotype "gene"; transcript_name "B-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; tag "basic"; transcript_support_level "1";
2 havana exon 1 80 . + . gene_id "ENSG00000000001"; gene_version "5"; transcript_id "ENST00000000001"; transcript_version "2"; exon_number "1"; gene_name "B"; gene_source "havana"; gene_biotype "gene"; transcript_name "B-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00000000001"; exon_version "1"; tag "basic"; transcript_support_level "1";

0
src/arriba/test_data/blacklist.tsv Normal file
View File

4
src/arriba/test_data/genome.fasta Normal file
View File

@@ -0,0 +1,4 @@
>1
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
>2
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

10
src/arriba/test_data/script.sh Executable file
View File

@@ -0,0 +1,10 @@
# arriba test data
# Test data was obtained from https://github.com/snakemake/snakemake-wrappers/tree/master/bio/arriba/test
if [ ! -d /tmp/snakemake-wrappers ]; then
git clone --depth 1 --single-branch --branch master https://github.com/snakemake/snakemake-wrappers /tmp/snakemake-wrappers
fi
cp -r /tmp/snakemake-wrappers/bio/arriba/test/* src/arriba/test_data

170
src/bcl_convert/config.vsh.yaml Normal file
View File

@@ -0,0 +1,170 @@
name: bcl_convert
description: |
Convert bcl files to fastq files using bcl-convert.
Information about upgrading from bcl2fastq via
[Upgrading from bcl2fastq to BCL Convert](https://emea.support.illumina.com/bulletins/2020/10/upgrading-from-bcl2fastq-to-bcl-convert.html)
and [BCL Convert Compatible Products](https://support.illumina.com/sequencing/sequencing_software/bcl-convert/compatibility.html)
keywords: [demultiplex, fastq, bcl, illumina]
links:
homepage: https://support.illumina.com/sequencing/sequencing_software/bcl-convert.html
documentation: https://support.illumina.com/downloads/bcl-convert-user-guide.html
license: Proprietary
authors:
- __merge__: /src/_authors/toni_verbeiren.yaml
roles: [ author, maintainer ]
- __merge__: /src/_authors/dorien_roosen.yaml
roles: [ author ]
argument_groups:
- name: Input arguments
arguments:
- name: "--bcl_input_directory"
alternatives: ["-i"]
type: file
required: true
description: Input run directory
example: bcl_dir
- name: "--sample_sheet"
alternatives: ["-s"]
type: file
description: Path to SampleSheet.csv file (default searched for in --bcl_input_directory)
example: bcl_dir/sample_sheet.csv
- name: --run_info
type: file
description: Path to RunInfo.xml file (default root of BCL input directory)
example: bcl_dir/RunInfo.xml
- name: Lane and tile settings
arguments:
- name: "--bcl_only_lane"
type: integer
description: Convert only specified lane number (default all lanes)
example: 1
- name: --first_tile_only
type: boolean
description: Only convert first tile of input (for testing & debugging)
example: true
- name: --tiles
type: string
description: Process only a subset of tiles by a regular expression
example: "s_[0-9]+_1"
- name: --exclude_tiles
type: string
description: Exclude set of tiles by a regular expression
example: "s_[0-9]+_1"
- name: Resource arguments
arguments:
- name: --shared_thread_odirect_output
type: boolean
description: Use linux native asynchronous io (io_submit) for file output (Default=false)
example: true
- name: --bcl_num_parallel_tiles
type: integer
description: "\\# of tiles to process in parallel (default 1)"
example: 1
- name: --bcl_num_conversion_threads
type: integer
description: "\\# of threads for conversion (per tile, default # cpu threads)"
example: 1
- name: --bcl_num_compression_threads
type: integer
description: "\\# of threads for fastq.gz output compression (per tile, default # cpu threads, or HW+12)"
example: 1
- name: --bcl_num_decompression_threads
type: integer
description:
"\\# of threads for bcl/cbcl input decompression (per tile, default half # cpu threads, or HW+8).
Only applies when preloading files"
example: 1
- name: Run arguments
arguments:
- name: --bcl_only_matched_reads
type: boolean
description: For pure BCL conversion, do not output files for 'Undetermined' [unmatched] reads (output by default)
example: true
- name: --no_lane_splitting
type: boolean
description: Do not split FASTQ file by lane (false by default)
example: true
- name: --num_unknown_barcodes_reported
type: integer
description: "\\# of Top Unknown Barcodes to output (1000 by default)"
example: 1000
- name: --bcl_validate_sample_sheet_only
type: boolean
description: Only validate RunInfo.xml & SampleSheet files (produce no FASTQ files)
example: true
- name: --strict_mode
type: boolean
description: Abort if any files are missing (false by default)
example: true
- name: --sample_name_column_enabled
type: boolean
description: Use sample sheet 'Sample_Name' column when naming fastq files & subdirectories
example: true
- name: Output arguments
arguments:
- name: "--output_directory"
alternatives: ["-o"]
type: file
direction: output
required: true
description: Output directory containig fastq files
example: fastq_dir
- name: --bcl_sampleproject_subdirectories
type: boolean
description: Output to subdirectories based upon sample sheet 'Sample_Project' column
example: true
- name: --fastq_gzip_compression_level
type: integer
description: Set fastq output compression level 0-9 (default 1)
example: 1
- name: "--reports"
type: file
direction: output
required: false
description: Reports directory
example: reports_dir
- name: "--logs"
type: file
direction: output
required: false
description: Reports directory
example: logs_dir
# bcl-convert arguments not taken into account
# --force
# --output-legacy-stats arg Also output stats in legacy (bcl2fastq2) format (false by default)
# --no-sample-sheet arg Enable legacy no-sample-sheet operation (No demux or trimming. No settings
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: debian:trixie-slim
# https://support.illumina.com/sequencing/sequencing_software/bcl-convert/downloads.html
setup:
- type: apt
packages: [wget, gdb, which, hostname, alien, procps]
- type: docker
run: |
wget https://s3.amazonaws.com/webdata.illumina.com/downloads/software/bcl-convert/bcl-convert-4.2.7-2.el8.x86_64.rpm -O /tmp/bcl-convert.rpm && \
alien -i /tmp/bcl-convert.rpm && \
rm -rf /var/lib/apt/lists/* && \
rm /tmp/bcl-convert.rpm
- type: docker
run: |
echo "bcl-convert: \"$(bcl-convert -V 2>&1 >/dev/null | sed -n '/Version/ s/^bcl-convert\ Version //p')\"" > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

38
src/bcl_convert/help.txt Normal file
View File

@@ -0,0 +1,38 @@
bcl-convert Version 00.000.000.4.2.7
Copyright (c) 2014-2022 Illumina, Inc.
Run BCL Conversion (BCL directory to *.fastq.gz)
bcl-convert --bcl-input-directory <BCL_ROOT_DIR> --output-directory <PATH> [options]
Options:
-h [ --help ] Print this help message
-V [ --version ] Print the version and exit
--output-directory arg Output BCL directory for BCL conversion (must be specified)
-f [ --force ] Force: allow destination diretory to already exist
--bcl-input-directory arg Input BCL directory for BCL conversion (must be specified)
--sample-sheet arg Path to SampleSheet.csv file (default searched for in --bcl-input-directory)
--bcl-only-lane arg Convert only specified lane number (default all lanes)
--strict-mode arg Abort if any files are missing (false by default)
--first-tile-only arg Only convert first tile of input (for testing & debugging)
--tiles arg Process only a subset of tiles by a regular expression
--exclude-tiles arg Exclude set of tiles by a regular expression
--bcl-sampleproject-subdirectories arg Output to subdirectories based upon sample sheet 'Sample_Project' column
--sample-name-column-enabled arg Use sample sheet 'Sample_Name' column when naming fastq files & subdirectories
--fastq-gzip-compression-level arg Set fastq output compression level 0-9 (default 1)
--shared-thread-odirect-output arg Use linux native asynchronous io (io_submit) for file output (Default=false)
--bcl-num-parallel-tiles arg # of tiles to process in parallel (default 1)
--bcl-num-conversion-threads arg # of threads for conversion (per tile, default # cpu threads)
--bcl-num-compression-threads arg # of threads for fastq.gz output compression (per tile, default # cpu threads,
or HW+12)
--bcl-num-decompression-threads arg # of threads for bcl/cbcl input decompression (per tile, default half # cpu
threads, or HW+8. Only applies when preloading files)
--bcl-only-matched-reads arg For pure BCL conversion, do not output files for 'Undetermined' [unmatched]
reads (output by default)
--run-info arg Path to RunInfo.xml file (default root of BCL input directory)
--no-lane-splitting arg Do not split FASTQ file by lane (false by default)
--num-unknown-barcodes-reported arg # of Top Unknown Barcodes to output (1000 by default)
--bcl-validate-sample-sheet-only arg Only validate RunInfo.xml & SampleSheet files (produce no FASTQ files)
--output-legacy-stats arg Also output stats in legacy (bcl2fastq2) format (false by default)
--no-sample-sheet arg Enable legacy no-sample-sheet operation (No demux or trimming. No settings
supported. False by default, not recommended

40
src/bcl_convert/script.sh Normal file
View File

@@ -0,0 +1,40 @@
#!/bin/bash
set -eo pipefail
$(which bcl-convert) \
--bcl-input-directory "$par_bcl_input_directory" \
--output-directory "$par_output_directory" \
${par_sample_sheet:+ --sample-sheet "$par_sample_sheet"} \
${par_run_info:+ --run-info "$par_run_info"} \
${par_bcl_only_lane:+ --bcl-only-lane "$par_bcl_only_lane"} \
${par_first_tile_only:+ --first-tile-only "$par_first_tile_only"} \
${par_tiles:+ --tiles "$par_tiles"} \
${par_exclude_tiles:+ --exclude-tiles "$par_exclude_tiles"} \
${par_shared_thread_odirect_output:+ --shared-thread-odirect-output "$par_shared_thread_odirect_output"} \
${par_bcl_num_parallel_tiles:+ --bcl-num-parallel-tiles "$par_bcl_num_parallel_tiles"} \
${par_bcl_num_conversion_threads:+ --bcl-num-conversion-threads "$par_bcl_num_conversion_threads"} \
${par_bcl_num_compression_threads:+ --bcl-num-compression-threads "$par_bcl_num_compression_threads"} \
${par_bcl_num_decompression_threads:+ --bcl-num-decompression-threads "$par_bcl_num_decompression_threads"} \
${par_bcl_only_matched_reads:+ --bcl-only-matched-reads "$par_bcl_only_matched_reads"} \
${par_no_lane_splitting:+ --no-lane-splitting "$par_no_lane_splitting"} \
${par_num_unknown_barcodes_reported:+ --num-unknown-barcodes-reported "$par_num_unknown_barcodes_reported"} \
${par_bcl_validate_sample_sheet_only:+ --bcl-validate-sample-sheet-only "$par_bcl_validate_sample_sheet_only"} \
${par_strict_mode:+ --strict-mode "$par_strict_mode"} \
${par_sample_name_column_enabled:+ --sample-name-column-enabled "$par_sample_name_column_enabled"} \
${par_bcl_sampleproject_subdirectories:+ --bcl-sampleproject-subdirectories "$par_bcl_sampleproject_subdirectories"} \
${par_fastq_gzip_compression_level:+ --fastq-gzip-compression-level "$par_fastq_gzip_compression_level"}
if [ ! -z "$par_reports" ]; then
echo "Moving reports to their own location"
mv "${par_output_directory}/Reports" "$par_reports"
else
echo "Leaving reports alone"
fi
if [ ! -z "$par_logs" ]; then
echo "Moving logs to their own location"
mv "${par_output_directory}/Logs" "$par_logs"
else
echo "Leaving logs alone"
fi

70
src/bcl_convert/test.sh Normal file
View File

@@ -0,0 +1,70 @@
#!/bin/bash
# Tests are sourced from:
# https://www.10xgenomics.com/support/software/cell-ranger/latest/analysis/inputs/cr-direct-demultiplexing-bcl-convert
# Test input files are fetched from:
# https://cf.10xgenomics.com/supp/spatial-exp/demultiplexing/iseq-DI.tar.gz
# https://cf.10xgenomics.com/supp/spatial-exp/demultiplexing/bcl_convert_samplesheet.csv
set -eo pipefail
echo ">> Fetching and preparing test data"
data_src="https://cf.10xgenomics.com/supp/spatial-exp/demultiplexing/iseq-DI.tar.gz"
sample_sheet_src="https://cf.10xgenomics.com/supp/spatial-exp/demultiplexing/bcl_convert_samplesheet.csv"
test_data_dir="test_data"
mkdir $test_data_dir
wget -q $data_src -O $test_data_dir/data.tar.gz
wget -q $sample_sheet_src -O $test_data_dir/sample_sheet.csv
tar xzf $test_data_dir/data.tar.gz -C $test_data_dir
rm $test_data_dir/data.tar.gz
echo ">> Execute and verify output"
$meta_executable \
--bcl_input_directory "$test_data_dir/iseq-DI" \
--sample_sheet "$test_data_dir/sample_sheet.csv" \
--output_directory fastq \
--reports reports \
--logs logs
echo ">>> Checking whether the output dir exists"
[[ ! -d fastq ]] && echo "Output dir could not be found!" && exit 1
echo ">>> Checking whether output fastq files are created"
[[ ! -f fastq/Undetermined_S0_L001_R1_001.fastq.gz ]] && echo "Output fastq files could not be found!" && exit 1
[[ ! -f fastq/iseq-DI_S1_L001_R1_001.fastq.gz ]] && echo "Output fastq files could not be found!" && exit 1
echo ">>> Checking whether the report dir exists"
[[ ! -d reports ]] && echo "Reports dir could not be found!" && exit 1
echo ">>> Checking whether the log dir exists"
[[ ! -d logs ]] && echo "Logs dir could not be found!" && exit 1
# print final message
echo ">>> Test finished successfully"
echo ">> Execute with additional arguments and verify output"
$meta_executable \
--bcl_input_directory "$test_data_dir/iseq-DI" \
--sample_sheet "$test_data_dir/sample_sheet.csv" \
--output_directory fastq1 \
--bcl_only_matched_reads true \
--bcl_num_compression_threads 1 \
--no_lane_splitting false \
--fastq_gzip_compression_level 9
echo ">> Checking whether the output dir exists"
[[ ! -d fastq1 ]] && echo "Output dir could not be found!" && exit 1
echo ">> Checking whether output fastq files are created"
[[ -f fastq1/Undetermined_S0_L001_R1_001.fastq.gz ]] && echo "Undetermined should not be generated!" && exit 1
[[ ! -f fastq1/iseq-DI_S1_L001_R1_001.fastq.gz ]] && echo "Output fastq files could not be found!" && exit 1
# print final message
echo ">> Test finished successfully"
# do not remove this
# as otherwise your test might exit with a different exit code
exit 0

143
src/bd_rhapsody/bd_rhapsody_make_reference/config.vsh.yaml Normal file
View File

@@ -0,0 +1,143 @@
name: bd_rhapsody_make_reference
namespace: bd_rhapsody
description: |
The Reference Files Generator creates an archive containing Genome Index
and Transcriptome annotation files needed for the BD Rhapsody Sequencing
Analysis Pipeline. The app takes as input one or more FASTA and GTF files
and produces a compressed archive in the form of a tar.gz file. The
archive contains:
- STAR index
- Filtered GTF file
keywords: [genome, reference, index, align]
links:
repository: https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1/Extra_Utilities/
documentation: https://bd-rhapsody-bioinfo-docs.genomics.bd.com/resources/extra_utilities.html#make-rhapsody-reference
license: Unknown
authors:
- __merge__: /src/_authors/robrecht_cannoodt.yaml
roles: [ author, maintainer ]
- __merge__: /src/_authors/weiwei_schultz.yaml
roles: [ contributor ]
argument_groups:
- name: Inputs
arguments:
- type: file
name: --genome_fasta
required: true
description: Reference genome file in FASTA or FASTA.GZ format. The BD Rhapsody Sequencing Analysis Pipeline uses GRCh38 for Human and GRCm39 for Mouse.
example: genome_sequence.fa.gz
multiple: true
info:
config_key: Genome_fasta
- type: file
name: --gtf
required: true
description: |
File path to the transcript annotation files in GTF or GTF.GZ format. The Sequence Analysis Pipeline requires the 'gene_name' or
'gene_id' attribute to be set on each gene and exon feature. Gene and exon feature lines must have the same attribute, and exons
must have a corresponding gene with the same value. For TCR/BCR assays, the TCR or BCR gene segments must have the 'gene_type' or
'gene_biotype' attribute set, and the value should begin with 'TR' or 'IG', respectively.
example: transcriptome_annotation.gtf.gz
multiple: true
info:
config_key: Gtf
- type: file
name: --extra_sequences
description: |
File path to additional sequences in FASTA format to use when building the STAR index. (e.g. transgenes or CRISPR guide barcodes).
GTF lines for these sequences will be automatically generated and combined with the main GTF.
required: false
multiple: true
info:
config_key: Extra_sequences
- name: Outputs
arguments:
- type: file
name: --reference_archive
direction: output
required: true
description: |
A Compressed archive containing the Reference Genome Index and annotation GTF files. This archive is meant to be used as an
input in the BD Rhapsody Sequencing Analysis Pipeline.
example: star_index.tar.gz
- name: Arguments
arguments:
- type: string
name: --mitochondrial_contigs
description: |
Names of the Mitochondrial contigs in the provided Reference Genome. Fragments originating from contigs other than these are
identified as 'nuclear fragments' in the ATACseq analysis pipeline.
required: false
multiple: true
default: [chrM, chrMT, M, MT]
info:
config_key: Mitochondrial_contigs
- type: boolean_true
name: --filtering_off
description: |
By default the input Transcript Annotation files are filtered based on the gene_type/gene_biotype attribute. Only features
having the following attribute values are kept:
- protein_coding
- lncRNA (lincRNA and antisense for Gencode < v31/M22/Ensembl97)
- IG_LV_gene
- IG_V_gene
- IG_V_pseudogene
- IG_D_gene
- IG_J_gene
- IG_J_pseudogene
- IG_C_gene
- IG_C_pseudogene
- TR_V_gene
- TR_V_pseudogene
- TR_D_gene
- TR_J_gene
- TR_J_pseudogene
- TR_C_gene
If you have already pre-filtered the input Annotation files and/or wish to turn-off the filtering, please set this option to True.
info:
config_key: Filtering_off
- type: boolean_true
name: --wta_only_index
description: Build a WTA only index, otherwise builds a WTA + ATAC index.
info:
config_key: Wta_Only
- type: string
name: --extra_star_params
description: Additional parameters to pass to STAR when building the genome index. Specify exactly like how you would on the command line.
example: --limitGenomeGenerateRAM 48000 --genomeSAindexNbases 11
required: false
info:
config_key: Extra_STAR_params
resources:
- type: python_script
path: script.py
- path: make_rhap_reference_2.2.1_nodocker.cwl
test_resources:
- type: bash_script
path: test.sh
- path: test_data
requirements:
commands: [ "cwl-runner" ]
engines:
- type: docker
image: bdgenomics/rhapsody:2.2.1
setup:
- type: apt
packages: [procps]
- type: python
packages: [cwlref-runner, cwl-runner]
- type: docker
run: |
echo "bdgenomics/rhapsody: 2.2.1" > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

66
src/bd_rhapsody/bd_rhapsody_make_reference/help.txt Normal file
View File

@@ -0,0 +1,66 @@
```bash
cwl-runner src/bd_rhapsody/bd_rhapsody_make_reference/make_rhap_reference_2.2.1_nodocker.cwl --help
```
usage: src/bd_rhapsody/bd_rhapsody_make_reference/make_rhap_reference_2.2.1_nodocker.cwl
[-h] [--Archive_prefix ARCHIVE_PREFIX]
[--Extra_STAR_params EXTRA_STAR_PARAMS]
[--Extra_sequences EXTRA_SEQUENCES] [--Filtering_off] --Genome_fasta
GENOME_FASTA --Gtf GTF [--Maximum_threads MAXIMUM_THREADS]
[--Mitochondrial_Contigs MITOCHONDRIAL_CONTIGS] [--WTA_Only]
[job_order]
The Reference Files Generator creates an archive containing Genome Index and
Transcriptome annotation files needed for the BD Rhapsodyâ„¢ Sequencing
Analysis Pipeline. The app takes as input one or more FASTA and GTF files and
produces a compressed archive in the form of a tar.gz file. The archive
contains:\n - STAR index\n - Filtered GTF file
positional arguments:
job_order Job input json file
options:
-h, --help show this help message and exit
--Archive_prefix ARCHIVE_PREFIX
A prefix for naming the compressed archive file
containing the Reference genome index and annotation
files. The default value is constructed based on the
input Reference files.
--Extra_STAR_params EXTRA_STAR_PARAMS
Additional parameters to pass to STAR when building
the genome index. Specify exactly like how you would
on the command line. Example: --limitGenomeGenerateRAM
48000 --genomeSAindexNbases 11
--Extra_sequences EXTRA_SEQUENCES
Additional sequences in FASTA format to use when
building the STAR index. (E.g. phiX genome)
--Filtering_off By default the input Transcript Annotation files are
filtered based on the gene_type/gene_biotype
attribute. Only features having the following
attribute values are are kept: - protein_coding -
lncRNA (lincRNA and antisense for Gencode <
v31/M22/Ensembl97) - IG_LV_gene - IG_V_gene -
IG_V_pseudogene - IG_D_gene - IG_J_gene -
IG_J_pseudogene - IG_C_gene - IG_C_pseudogene -
TR_V_gene - TR_V_pseudogene - TR_D_gene - TR_J_gene -
TR_J_pseudogene - TR_C_gene If you have already pre-
filtered the input Annotation files and/or wish to
turn-off the filtering, please set this option to
True.
--Genome_fasta GENOME_FASTA
Reference genome file in FASTA format. The BD
Rhapsodyâ„¢ Sequencing Analysis Pipeline uses GRCh38
for Human and GRCm39 for Mouse.
--Gtf GTF Transcript annotation files in GTF format. The BD
Rhapsodyâ„¢ Sequencing Analysis Pipeline uses Gencode
v42 for Human and M31 for Mouse.
--Maximum_threads MAXIMUM_THREADS
The maximum number of threads to use in the pipeline.
By default, all available cores are used.
--Mitochondrial_Contigs MITOCHONDRIAL_CONTIGS
Names of the Mitochondrial contigs in the provided
Reference Genome. Fragments originating from contigs
other than these are identified as 'nuclear fragments'
in the ATACseq analysis pipeline.
--WTA_Only Build a WTA only index, otherwise builds a WTA + ATAC
index.

115
src/bd_rhapsody/bd_rhapsody_make_reference/make_rhap_reference_2.2.1_nodocker.cwl Normal file
View File

@@ -0,0 +1,115 @@
requirements:
InlineJavascriptRequirement: {}
class: CommandLineTool
label: Reference Files Generator for BD Rhapsodyâ„¢ Sequencing Analysis Pipeline
cwlVersion: v1.2
doc: >-
The Reference Files Generator creates an archive containing Genome Index and Transcriptome annotation files needed for the BD Rhapsodyâ„¢ Sequencing Analysis Pipeline. The app takes as input one or more FASTA and GTF files and produces a compressed archive in the form of a tar.gz file. The archive contains:\n - STAR index\n - Filtered GTF file
baseCommand: run_reference_generator.sh
inputs:
Genome_fasta:
type: File[]
label: Reference Genome
doc: |-
Reference genome file in FASTA format. The BD Rhapsodyâ„¢ Sequencing Analysis Pipeline uses GRCh38 for Human and GRCm39 for Mouse.
inputBinding:
prefix: --reference-genome
shellQuote: false
Gtf:
type: File[]
label: Transcript Annotations
doc: |-
Transcript annotation files in GTF format. The BD Rhapsodyâ„¢ Sequencing Analysis Pipeline uses Gencode v42 for Human and M31 for Mouse.
inputBinding:
prefix: --gtf
shellQuote: false
Extra_sequences:
type: File[]?
label: Extra Sequences
doc: |-
Additional sequences in FASTA format to use when building the STAR index. (E.g. phiX genome)
inputBinding:
prefix: --extra-sequences
shellQuote: false
Mitochondrial_Contigs:
type: string[]?
default: ["chrM", "chrMT", "M", "MT"]
label: Mitochondrial Contig Names
doc: |-
Names of the Mitochondrial contigs in the provided Reference Genome. Fragments originating from contigs other than these are identified as 'nuclear fragments' in the ATACseq analysis pipeline.
inputBinding:
prefix: --mitochondrial-contigs
shellQuote: false
Filtering_off:
type: boolean?
label: Turn off filtering
doc: |-
By default the input Transcript Annotation files are filtered based on the gene_type/gene_biotype attribute. Only features having the following attribute values are are kept:
- protein_coding
- lncRNA (lincRNA and antisense for Gencode < v31/M22/Ensembl97)
- IG_LV_gene
- IG_V_gene
- IG_V_pseudogene
- IG_D_gene
- IG_J_gene
- IG_J_pseudogene
- IG_C_gene
- IG_C_pseudogene
- TR_V_gene
- TR_V_pseudogene
- TR_D_gene
- TR_J_gene
- TR_J_pseudogene
- TR_C_gene
If you have already pre-filtered the input Annotation files and/or wish to turn-off the filtering, please set this option to True.
inputBinding:
prefix: --filtering-off
shellQuote: false
WTA_Only:
type: boolean?
label: WTA only index
doc: Build a WTA only index, otherwise builds a WTA + ATAC index.
inputBinding:
prefix: --wta-only-index
shellQuote: false
Archive_prefix:
type: string?
label: Archive Prefix
doc: |-
A prefix for naming the compressed archive file containing the Reference genome index and annotation files. The default value is constructed based on the input Reference files.
inputBinding:
prefix: --archive-prefix
shellQuote: false
Extra_STAR_params:
type: string?
label: Extra STAR Params
doc: |-
Additional parameters to pass to STAR when building the genome index. Specify exactly like how you would on the command line.
Example:
--limitGenomeGenerateRAM 48000 --genomeSAindexNbases 11
inputBinding:
prefix: --extra-star-params
shellQuote: true
Maximum_threads:
type: int?
label: Maximum Number of Threads
doc: |-
The maximum number of threads to use in the pipeline. By default, all available cores are used.
inputBinding:
prefix: --maximum-threads
shellQuote: false
outputs:
Archive:
type: File
doc: |-
A Compressed archive containing the Reference Genome Index and annotation GTF files. This archive is meant to be used as an input in the BD Rhapsodyâ„¢ Sequencing Analysis Pipeline.
id: Reference_Archive
label: Reference Files Archive
outputBinding:
glob: '*.tar.gz'

161
src/bd_rhapsody/bd_rhapsody_make_reference/script.py Normal file
View File

@@ -0,0 +1,161 @@
import os
import re
import subprocess
import tempfile
from typing import Any
import yaml
import shutil
## VIASH START
par = {
"genome_fasta": [],
"gtf": [],
"extra_sequences": [],
"mitochondrial_contigs": ["chrM", "chrMT", "M", "MT"],
"filtering_off": False,
"wta_only_index": False,
"extra_star_params": None,
"reference_archive": "output.tar.gz",
}
meta = {
"config": "target/nextflow/reference/build_bdrhap_2_reference/.config.vsh.yaml",
"resources_dir": os.path.abspath("src/reference/build_bdrhap_2_reference"),
"temp_dir": os.getenv("VIASH_TEMP"),
"memory_mb": None,
"cpus": None
}
## VIASH END
def clean_arg(argument):
argument["clean_name"] = re.sub("^-*", "", argument["name"])
return argument
def read_config(path: str) -> dict[str, Any]:
with open(path, "r") as f:
config = yaml.safe_load(f)
config["all_arguments"] = [
clean_arg(arg)
for grp in config["argument_groups"]
for arg in grp["arguments"]
]
return config
def strip_margin(text: str) -> str:
return re.sub("(\n?)[ \t]*\|", "\\1", text)
def process_params(par: dict[str, Any], config) -> str:
# check input parameters
assert par["genome_fasta"], "Pass at least one set of inputs to --genome_fasta."
assert par["gtf"], "Pass at least one set of inputs to --gtf."
assert par["reference_archive"].endswith(".tar.gz"), "Output reference_archive must end with .tar.gz."
# make paths absolute
for argument in config["all_arguments"]:
if par[argument["clean_name"]] and argument["type"] == "file":
if isinstance(par[argument["clean_name"]], list):
par[argument["clean_name"]] = [ os.path.abspath(f) for f in par[argument["clean_name"]] ]
else:
par[argument["clean_name"]] = os.path.abspath(par[argument["clean_name"]])
return par
def generate_config(par: dict[str, Any], meta, config) -> str:
content_list = [strip_margin(f"""\
|#!/usr/bin/env cwl-runner
|
|""")]
config_key_value_pairs = []
for argument in config["all_arguments"]:
config_key = (argument.get("info") or {}).get("config_key")
arg_type = argument["type"]
par_value = par[argument["clean_name"]]
if par_value and config_key:
config_key_value_pairs.append((config_key, arg_type, par_value))
if meta["cpus"]:
config_key_value_pairs.append(("Maximum_threads", "integer", meta["cpus"]))
# print(config_key_value_pairs)
for config_key, arg_type, par_value in config_key_value_pairs:
if arg_type == "file":
str = strip_margin(f"""\
|{config_key}:
|""")
if isinstance(par_value, list):
for file in par_value:
str += strip_margin(f"""\
| - class: File
| location: "{file}"
|""")
else:
str += strip_margin(f"""\
| class: File
| location: "{par_value}"
|""")
content_list.append(str)
else:
content_list.append(strip_margin(f"""\
|{config_key}: {par_value}
|"""))
## Write config to file
return "".join(content_list)
def get_cwl_file(meta: dict[str, Any]) -> str:
# create cwl file (if need be)
cwl_file=os.path.join(meta["resources_dir"], "make_rhap_reference_2.2.1_nodocker.cwl")
return cwl_file
def main(par: dict[str, Any], meta: dict[str, Any]):
config = read_config(meta["config"])
# Preprocess params
par = process_params(par, config)
# fetch cwl file
cwl_file = get_cwl_file(meta)
# Create output dir if not exists
outdir = os.path.dirname(par["reference_archive"])
if not os.path.exists(outdir):
os.makedirs(outdir)
## Run pipeline
with tempfile.TemporaryDirectory(prefix="cwl-bd_rhapsody_wta-", dir=meta["temp_dir"]) as temp_dir:
# Create params file
config_file = os.path.join(temp_dir, "config.yml")
config_content = generate_config(par, meta, config)
with open(config_file, "w") as f:
f.write(config_content)
cmd = [
"cwl-runner",
"--no-container",
"--preserve-entire-environment",
"--outdir",
temp_dir,
cwl_file,
config_file
]
env = dict(os.environ)
env["TMPDIR"] = temp_dir
print("> " + " ".join(cmd), flush=True)
_ = subprocess.check_call(
cmd,
cwd=os.path.dirname(config_file),
env=env
)
shutil.move(os.path.join(temp_dir, "Rhap_reference.tar.gz"), par["reference_archive"])
if __name__ == "__main__":
main(par, meta)

65
src/bd_rhapsody/bd_rhapsody_make_reference/test.sh Normal file
View File

@@ -0,0 +1,65 @@
#!/bin/bash
set -e
#############################################
# helper functions
assert_file_exists() {
[ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
}
assert_file_doesnt_exist() {
[ ! -f "$1" ] || { echo "File '$1' exists but shouldn't" && exit 1; }
}
assert_file_empty() {
[ ! -s "$1" ] || { echo "File '$1' is not empty but should be" && exit 1; }
}
assert_file_not_empty() {
[ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
}
assert_file_contains() {
grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
}
assert_file_not_contains() {
grep -q "$2" "$1" && { echo "File '$1' contains '$2' but shouldn't" && exit 1; }
}
#############################################
in_fa="$meta_resources_dir/test_data/reference_small.fa"
in_gtf="$meta_resources_dir/test_data/reference_small.gtf"
echo "#############################################"
echo "> Simple run"
mkdir simple_run
cd simple_run
out_tar="myreference.tar.gz"
echo "> Running $meta_name."
$meta_executable \
--genome_fasta "$in_fa" \
--gtf "$in_gtf" \
--reference_archive "$out_tar" \
--extra_star_params "--genomeSAindexNbases 6" \
---cpus 2
exit_code=$?
[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
assert_file_exists "$out_tar"
assert_file_not_empty "$out_tar"
echo ">> Checking whether output contains the expected files"
tar -xvf "$out_tar" > /dev/null
assert_file_exists "BD_Rhapsody_Reference_Files/star_index/genomeParameters.txt"
assert_file_exists "BD_Rhapsody_Reference_Files/bwa-mem2_index/reference_small.ann"
assert_file_exists "BD_Rhapsody_Reference_Files/reference_small-processed.gtf"
assert_file_exists "BD_Rhapsody_Reference_Files/mitochondrial_contigs.txt"
assert_file_contains "BD_Rhapsody_Reference_Files/reference_small-processed.gtf" "chr1.*HAVANA.*ENSG00000243485"
assert_file_contains "BD_Rhapsody_Reference_Files/mitochondrial_contigs.txt" 'chrMT'
cd ..
echo "#############################################"
echo "> Tests succeeded!"

27
src/bd_rhapsody/bd_rhapsody_make_reference/test_data/reference_small.fa Normal file
View File

@@ -0,0 +1,27 @@
>chr1 1
TGGGGAAGCAAGGCGGAGTTGGGCAGCTCGTGTTCAATGGGTAGAGTTTCAGGCTGGGGT
GATGGAAGGGTGCTGGAAATGAGTGGTAGTGATGGCGGCACAACAGTGTGAATCTACTTA
ATCCCACTGAACTGTATGCTGAAAAATGGTTTAGACGGTGAATTTTAGGTTATGTATGTT
TTACCACAATTTTTAAAAAGCTAGTGAAAAGCTGGTAAAAAGAAAGAAAAGAGGCTTTTT
TAAAAAGTTAAATATATAAAAAGAGCATCATCAGTCCAAAGTCCAGCAGTTGTCCCTCCT
GGAATCCGTTGGCTTGCCTCCGGCATTTTTGGCCCTTGCCTTTTAGGGTTGCCAGATTAA
AAGACAGGATGCCCAGCTAGTTTGAATTTTAGATAAACAACGAATAATTTCGTAGCATAA
ATATGTCCCAAGCTTAGTTTGGGACATACTTATGCTAAAAAACATTATTGGTTGTTTATC
TGAGATTCAGAATTAAGCATTTTATATTTTATTTGCTGCCTCTGGCCACCCTACTCTCTT
CCTAACACTCTCTCCCTCTCCCAGTTTTGTCCGCCTTCCCTGCCTCCTCTTCTGGGGGAG
TTAGATCGAGTTGTAACAAGAACATGCCACTGTCTCGCTGGCTGCAGCGTGTGGTCCCCT
TACCAGAGGTAAAGAAGAGATGGATCTCCACTCATGTTGTAGACAGAATGTTTATGTCCT
CTCCAAATGCTTATGTTGAAACCCTAACCCCTAATGTGATGGTATGTGGAGATGGGCCTT
TGGTAGGTAATTACGGTTAGATGAGGTCATGGGGTGGGGCCCTCATTATAGATCTGGTAA
GAAAAGAGAGCATTGTCTCTGTGTCTCCCTCTCTCTCTCTCTCTCTCTCTCTCATTTCTC
TCTATCTCATTTCTCTCTCTCTCGCTATCTCATTTTTCTCTCTCTCTCTTTCTCTCCTCT
GTCTTTTCCCACCAAGTGAGGATGCGAAGAGAAGGTGGCTGTCTGCAAACCAGGAAGAGA
GCCCTCACCGGGAACCCGTCCAGCTGCCACCTTGAACTTGGACTTCCAAGCCTCCAGAAC
TGTGAGGGATAAATGTATGATTTTAAAGTCGCCCAGTGTGTGGTATTTTGTTTTGACTAA
TACAACCTGAAAACATTTTCCCCTCACTCCACCTGAGCAATATCTGAGTGGCTTAAGGTA
CTCAGGACACAACAAAGGAGAAATGTCCCATGCACAAGGTGCACCCATGCCTGGGTAAAG
CAGCCTGGCACAGAGGGAAGCACACAGGCTCAGGGATCTGCTATTCATTCTTTGTGTGAC
CCTGGGCAAGCCATGAATGGAGCTTCAGTCACCCCATTTGTAATGGGATTTAATTGTGCT
TGCCCTGCCTCCTTTTGAGGGCTGTAGAGAAAAGATGTCAAAGTATTTTGTAATCTGGCT
GGGCGTGGTGGCTCATGCCTGTAATCCTAGCACTTTGGTAGGCTGACGCGAGAGGACTGC
T

8
src/bd_rhapsody/bd_rhapsody_make_reference/test_data/reference_small.gtf Normal file
View File

@@ -0,0 +1,8 @@
chr1 HAVANA exon 565 668 . + . gene_id "ENSG00000243485.5"; transcript_id "ENST00000473358.1"; gene_type "lncRNA"; gene_name "MIR1302-2HG"; transcript_type "lncRNA"; transcript_name "MIR1302-2HG-202"; exon_number 2; exon_id "ENSE00001922571.1"; level 2; transcript_support_level "5"; hgnc_id "HGNC:52482"; tag "not_best_in_genome_evidence"; tag "dotter_confirmed"; tag "basic"; tag "Ensembl_canonical"; havana_gene "OTTHUMG00000000959.2"; havana_transcript "OTTHUMT00000002840.1";
chr1 HAVANA exon 977 1098 . + . gene_id "ENSG00000243485.5"; transcript_id "ENST00000473358.1"; gene_type "lncRNA"; gene_name "MIR1302-2HG"; transcript_type "lncRNA"; transcript_name "MIR1302-2HG-202"; exon_number 3; exon_id "ENSE00001827679.1"; level 2; transcript_support_level "5"; hgnc_id "HGNC:52482"; tag "not_best_in_genome_evidence"; tag "dotter_confirmed"; tag "basic"; tag "Ensembl_canonical"; havana_gene "OTTHUMG00000000959.2"; havana_transcript "OTTHUMT00000002840.1";
chr1 HAVANA transcript 268 1110 . + . gene_id "ENSG00000243485.5"; transcript_id "ENST00000469289.1"; gene_type "lncRNA"; gene_name "MIR1302-2HG"; transcript_type "lncRNA"; transcript_name "MIR1302-2HG-201"; level 2; transcript_support_level "5"; hgnc_id "HGNC:52482"; tag "not_best_in_genome_evidence"; tag "basic"; havana_gene "OTTHUMG00000000959.2"; havana_transcript "OTTHUMT00000002841.2";
chr1 HAVANA exon 268 668 . + . gene_id "ENSG00000243485.5"; transcript_id "ENST00000469289.1"; gene_type "lncRNA"; gene_name "MIR1302-2HG"; transcript_type "lncRNA"; transcript_name "MIR1302-2HG-201"; exon_number 1; exon_id "ENSE00001841699.1"; level 2; transcript_support_level "5"; hgnc_id "HGNC:52482"; tag "not_best_in_genome_evidence"; tag "basic"; havana_gene "OTTHUMG00000000959.2"; havana_transcript "OTTHUMT00000002841.2";
chr1 HAVANA exon 977 1110 . + . gene_id "ENSG00000243485.5"; transcript_id "ENST00000469289.1"; gene_type "lncRNA"; gene_name "MIR1302-2HG"; transcript_type "lncRNA"; transcript_name "MIR1302-2HG-201"; exon_number 2; exon_id "ENSE00001890064.1"; level 2; transcript_support_level "5"; hgnc_id "HGNC:52482"; tag "not_best_in_genome_evidence"; tag "basic"; havana_gene "OTTHUMG00000000959.2"; havana_transcript "OTTHUMT00000002841.2";
chr1 ENSEMBL gene 367 504 . + . gene_id "ENSG00000284332.1"; gene_type "miRNA"; gene_name "MIR1302-2"; level 3; hgnc_id "HGNC:35294";
chr1 ENSEMBL transcript 367 504 . + . gene_id "ENSG00000284332.1"; transcript_id "ENST00000607096.1"; gene_type "miRNA"; gene_name "MIR1302-2"; transcript_type "miRNA"; transcript_name "MIR1302-2-201"; level 3; transcript_support_level "NA"; hgnc_id "HGNC:35294"; tag "basic"; tag "Ensembl_canonical";
chr1 ENSEMBL exon 367 504 . + . gene_id "ENSG00000284332.1"; transcript_id "ENST00000607096.1"; gene_type "miRNA"; gene_name "MIR1302-2"; transcript_type "miRNA"; transcript_name "MIR1302-2-201"; exon_number 1; exon_id "ENSE00003695741.1"; level 3; transcript_support_level "NA"; hgnc_id "HGNC:35294"; tag "basic"; tag "Ensembl_canonical";

47
src/bd_rhapsody/bd_rhapsody_make_reference/test_data/script.sh Normal file
View File

@@ -0,0 +1,47 @@
#!/bin/bash
TMP_DIR=/tmp/bd_rhapsody_make_reference
OUT_DIR=src/bd_rhapsody/bd_rhapsody_make_reference/test_data
# check if seqkit is installed
if ! command -v seqkit &> /dev/null; then
echo "seqkit could not be found"
exit 1
fi
# create temporary directory and clean up on exit
mkdir -p $TMP_DIR
function clean_up {
rm -rf "$TMP_DIR"
}
trap clean_up EXIT
# fetch reference
ORIG_FA=$TMP_DIR/reference.fa.gz
if [ ! -f $ORIG_FA ]; then
wget https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_41/GRCh38.primary_assembly.genome.fa.gz \
-O $ORIG_FA
fi
ORIG_GTF=$TMP_DIR/reference.gtf.gz
if [ ! -f $ORIG_GTF ]; then
wget https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_41/gencode.v41.annotation.gtf.gz \
-O $ORIG_GTF
fi
# create small reference
START=30000
END=31500
CHR=chr1
# subset to small region
seqkit grep -r -p "^$CHR\$" "$ORIG_FA" | \
seqkit subseq -r "$START:$END" > $OUT_DIR/reference_small.fa
zcat "$ORIG_GTF" | \
awk -v FS='\t' -v OFS='\t' "
\$1 == \"$CHR\" && \$4 >= $START && \$5 <= $END {
\$4 = \$4 - $START + 1;
\$5 = \$5 - $START + 1;
print;
}" > $OUT_DIR/reference_small.gtf

74
src/bedtools/bedtools_bamtofastq/config.vsh.yaml Normal file
View File

@@ -0,0 +1,74 @@
name: bedtools_bamtofastq
namespace: bedtools
description: |
Conversion tool for extracting FASTQ records from sequence alignments in BAM format.
keywords: [Conversion ,BAM, FASTQ]
links:
documentation: https://bedtools.readthedocs.io/en/latest/content/tools/bamtofastq.html
repository: https://github.com/arq5x/bedtools2
homepage: https://bedtools.readthedocs.io/en/latest/#
issue_tracker: https://github.com/arq5x/bedtools2/issues
references:
doi: 10.1093/bioinformatics/btq033
license: MIT
requirements:
commands: [bedtools]
authors:
- __merge__: /src/_authors/theodoro_gasperin.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --input
alternatives: -i
type: file
description: Input BAM file to be converted to FASTQ.
required: true
- name: Outputs
arguments:
- name: --fastq
alternatives: -fq
direction: output
type: file
description: Output FASTQ file.
required: true
- name: --fastq2
alternatives: -fq2
type: file
direction: output
description: |
FASTQ for second end. Used if BAM contains paired-end data.
BAM should be sorted by query name is creating paired FASTQ.
- name: Options
arguments:
- name: --tags
type: boolean_true
description: |
Create FASTQ based on the mate info in the BAM R2 and Q2 tags.
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
- path: test_data
engines:
- type: docker
image: debian:stable-slim
setup:
- type: apt
packages: [bedtools, procps]
- type: docker
run: |
echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

25
src/bedtools/bedtools_bamtofastq/help.txt Normal file
View File

@@ -0,0 +1,25 @@
```bash
bedtools bamtofastq
```
Tool: bedtools bamtofastq (aka bamToFastq)
Version: v2.30.0
Summary: Convert BAM alignments to FASTQ files.
Usage: bamToFastq [OPTIONS] -i <BAM> -fq <FQ>
Options:
-fq2 FASTQ for second end. Used if BAM contains paired-end data.
BAM should be sorted by query name is creating paired FASTQ.
-tags Create FASTQ based on the mate info
in the BAM R2 and Q2 tags.
Tips:
If you want to create a single, interleaved FASTQ file
for paired-end data, you can just write both to /dev/stdout:
bedtools bamtofastq -i x.bam -fq /dev/stdout -fq2 /dev/stdout > x.ilv.fq
Also, the samtools fastq command has more fucntionality and is a useful alternative.

19
src/bedtools/bedtools_bamtofastq/script.sh Normal file
View File

@@ -0,0 +1,19 @@
#!/bin/bash
## VIASH START
## VIASH END
# Exit on error
set -eo pipefail
# Unset parameters
[[ "$par_tags" == "false" ]] && unset par_tags
# Execute bedtools bamtofastq with the provided arguments
bedtools bamtofastq \
${par_tags:+-tags} \
${par_fastq2:+-fq2 "$par_fastq2"} \
-i "$par_input" \
-fq "$par_fastq"

84
src/bedtools/bedtools_bamtofastq/test.sh Normal file
View File

@@ -0,0 +1,84 @@
#!/bin/bash
# exit on error
set -eo pipefail
test_data="$meta_resources_dir/test_data"
#############################################
# helper functions
assert_file_exists() {
[ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
}
assert_file_not_empty() {
[ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
}
assert_file_contains() {
grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
}
assert_identical_content() {
diff -a "$2" "$1" \
|| (echo "Files are not identical!" && exit 1)
}
#############################################
# Test 1: normal conversion
mkdir test1
cd test1
echo "> Run bedtools bamtofastq on BAM file"
"$meta_executable" \
--input "$test_data/example.bam" \
--fastq "output.fastq"
# checks
assert_file_exists "output.fastq"
assert_file_not_empty "output.fastq"
assert_identical_content "output.fastq" "$test_data/expected.fastq"
echo "- test1 succeeded -"
cd ..
# Test 2: with tags
mkdir test2
cd test2
echo "> Run bedtools bamtofastq on BAM file with tags"
"$meta_executable" \
--input "$test_data/example.bam" \
--fastq "output.fastq" \
--tags
# checks
assert_file_exists "output.fastq"
assert_file_not_empty "output.fastq"
assert_identical_content "output.fastq" "$test_data/expected.fastq"
echo "- test2 succeeded -"
cd ..
# Test 3: with option fq2
mkdir test3
cd test3
echo "> Run bedtools bamtofastq on BAM file with output_fq2"
"$meta_executable" \
--input "$test_data/example.bam" \
--fastq "output1.fastq" \
--fastq2 "output2.fastq"
# checks
assert_file_exists "output1.fastq"
assert_file_not_empty "output1.fastq"
assert_identical_content "output1.fastq" "$test_data/expected_1.fastq"
assert_file_exists "output2.fastq"
assert_file_not_empty "output2.fastq"
assert_identical_content "output2.fastq" "$test_data/expected_2.fastq"
echo "- test3 succeeded -"
cd ..
echo "All tests succeeded"
exit 0

BIN
src/bedtools/bedtools_bamtofastq/test_data/example.bam Normal file
View File

Binary file not shown.

3
src/bedtools/bedtools_bamtofastq/test_data/example.sam Normal file
View File

@@ -0,0 +1,3 @@
@SQ SN:chr2:172936693-172938111 LN:1418
my_read 99 chr2:172936693-172938111 129 60 100M = 429 400 CTAACTAGCCTGGGAAAAAAGGATAGTGTCTCTCTGTTCTTTCATAGGAAATGTTGAATCAGACCCCTACTGGGAAAAGAAATTTAATGCATATCTCACT * XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:100
my_read 147 chr2:172936693-172938111 429 60 100M = 129 -400 TCGAGCTCTGCATTCATGGCTGTGTCTAAAGGGCATGTCAGCCTTTGATTCTCTCTGAGAGGTAATTATCCTTTTCCTGTCACGGAACAACAAATGATAG * XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:100

16
src/bedtools/bedtools_bamtofastq/test_data/expected.fastq Normal file
View File

@@ -0,0 +1,16 @@
@my_read
CTAACTAGCCTGGGAAAAAAGGATAGTGTCTCTCTGTTCTTTCATAGGAAATGTTGAATCAGACCCCTACTGGGAAAAGAAATTTAATGCATATCTCACT
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
@my_read
CTAACTAGCCTGGGAAAAAAGGATAGTGTCTCTCTGTTCTTTCATAGGAAATGTTGAATCAGACCCCTACTGGGAAAAGAAATTTAATGCATATCTCACT
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
@my_read
CTATCATTTGTTGTTCCGTGACAGGAAAAGGATAATTACCTCTCAGAGAGAATCAAAGGCTGACATGCCCTTTAGACACAGCCATGAATGCAGAGCTCGA
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
@my_read
CTATCATTTGTTGTTCCGTGACAGGAAAAGGATAATTACCTCTCAGAGAGAATCAAAGGCTGACATGCCCTTTAGACACAGCCATGAATGCAGAGCTCGA
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

4
src/bedtools/bedtools_bamtofastq/test_data/expected_1.fastq Normal file
View File

@@ -0,0 +1,4 @@
@my_read/1
CTAACTAGCCTGGGAAAAAAGGATAGTGTCTCTCTGTTCTTTCATAGGAAATGTTGAATCAGACCCCTACTGGGAAAAGAAATTTAATGCATATCTCACT
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

4
src/bedtools/bedtools_bamtofastq/test_data/expected_2.fastq Normal file
View File

@@ -0,0 +1,4 @@
@my_read/2
CTATCATTTGTTGTTCCGTGACAGGAAAAGGATAATTACCTCTCAGAGAGAATCAAAGGCTGACATGCCCTTTAGACACAGCCATGAATGCAGAGCTCGA
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

13
src/bedtools/bedtools_bamtofastq/test_data/script.sh Executable file
View File

@@ -0,0 +1,13 @@
#!/bin/bash
# create sam file
printf "@SQ\tSN:chr2:172936693-172938111\tLN:1418\n" > example.sam
printf "my_read\t99\tchr2:172936693-172938111\t129\t60\t100M\t=\t429\t400\tCTAACTAGCCTGGGAAAAAAGGATAGTGTCTCTCTGTTCTTTCATAGGAAATGTTGAATCAGACCCCTACTGGGAAAAGAAATTTAATGCATATCTCACT\t*\tXT:A:U\tNM:i:0\tSM:i:37\tAM:i:37\tX0:i:1\tX1:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tMD:Z:100\n" >> example.sam
printf "my_read\t147\tchr2:172936693-172938111\t429\t60\t100M\t=\t129\t-400\tTCGAGCTCTGCATTCATGGCTGTGTCTAAAGGGCATGTCAGCCTTTGATTCTCTCTGAGAGGTAATTATCCTTTTCCTGTCACGGAACAACAAATGATAG\t*\tXT:A:U\tNM:i:0\tSM:i:37\tAM:i:37\tX0:i:1\tX1:i:0\tXM:i:0\tXO:i:0\tXG:i:0\tMD:Z:100\n" >> example.sam
# create bam file
# samtools view -b example.sam > example.bam
# create fastq files
# bedtools bamtofastq -i example.bam -fq expected.fastq
# bedtools bamtofastq -i example.bam -fq expected_1.fastq -fq2 expected_2.fastq

91
src/bedtools/bedtools_bedtobam/config.vsh.yaml Normal file
View File

@@ -0,0 +1,91 @@
name: bedtools_bedtobam
namespace: bedtools
description: Converts feature records (bed/gff/vcf) to BAM format.
keywords: [Converts, BED, GFF, VCF, BAM]
links:
documentation: https://bedtools.readthedocs.io/en/latest/content/tools/bedtobam.html
repository: https://github.com/arq5x/bedtools2
homepage: https://bedtools.readthedocs.io/en/latest/#
issue_tracker: https://github.com/arq5x/bedtools2/issues
references:
doi: 10.1093/bioinformatics/btq033
license: MIT
requirements:
commands: [bedtools]
authors:
- __merge__: /src/_authors/theodoro_gasperin.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --input
alternatives: -i
type: file
description: Input file (bed/gff/vcf).
required: true
- name: --genome
alternatives: -g
type: file
description: |
Input genome file.
NOTE: This is not a fasta file. This is a two-column tab-delimited file
where the first column is the chromosome name and the second their sizes.
required: true
- name: Outputs
arguments:
- name: --output
alternatives: -o
type: file
direction: output
description: Output BAM file to be written.
- name: Options
arguments:
- name: --map_quality
alternatives: -mapq
type: integer
description: |
Set the mappinq quality for the BAM records.
min: 0
max: 255
default: 255
- name: --bed12
type: boolean_true
description: |
The BED file is in BED12 format. The BAM CIGAR
string will reflect BED "blocks".
- name: --uncompress_bam
alternatives: -ubam
type: boolean_true
description: |
Write uncompressed BAM output. Default writes compressed BAM.
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: debian:stable-slim
setup:
- type: apt
packages: [bedtools, procps]
- type: docker
run: |
echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
test_setup:
- type: apt
packages: [samtools]
runners:
- type: executable
- type: nextflow

21
src/bedtools/bedtools_bedtobam/help.txt Normal file
View File

@@ -0,0 +1,21 @@
```bash
bedtools bedtobam
```
Tool: bedtools bedtobam (aka bedToBam)
Version: v2.30.0
Summary: Converts feature records to BAM format.
Usage: bedtools bedtobam [OPTIONS] -i <bed/gff/vcf> -g <genome>
Options:
-mapq Set the mappinq quality for the BAM records.
(INT) Default: 255
-bed12 The BED file is in BED12 format. The BAM CIGAR
string will reflect BED "blocks".
-ubam Write uncompressed BAM output. Default writes compressed BAM.
Notes:
(1) BED files must be at least BED4 to create BAM (needs name field).

19
src/bedtools/bedtools_bedtobam/script.sh Normal file
View File

@@ -0,0 +1,19 @@
#!/bin/bash
## VIASH START
## VIASH END
set -eo pipefail
# Unset parameters
[[ "$par_bed12" == "false" ]] && unset par_bed12
[[ "$par_uncompress_bam" == "false" ]] && unset par_uncompress_bam
# Execute bedtools bed to bam
bedtools bedtobam \
${par_bed12:+-bed12} \
${par_uncompress_bam:+-ubam} \
${par_map_quality:+-mapq "$par_map_quality"} \
-i "$par_input" \
-g "$par_genome" \
> "$par_output"

188
src/bedtools/bedtools_bedtobam/test.sh Normal file
View File

@@ -0,0 +1,188 @@
#!/bin/bash
# exit on error
set -eo pipefail
#############################################
# helper functions
assert_file_exists() {
[ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
}
assert_file_not_empty() {
[ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
}
assert_file_contains() {
grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
}
assert_identical_content() {
diff -a "$2" "$1" \
|| (echo "Files are not identical!" && exit 1)
}
#############################################
# Create directories for tests
echo "Creating Test Data..."
TMPDIR=$(mktemp -d "$meta_temp_dir/XXXXXX")
function clean_up {
[[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
}
trap clean_up EXIT
# Create and populate input files
printf "chr1\t248956422\nchr3\t242193529\nchr2\t198295559\n" > "$TMPDIR/genome.txt"
printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t37\t+\nchr2:172936693-172938111\t428\t528\tmy_read/2\t37\t-\n" > "$TMPDIR/example.bed"
printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t60\t+\t128\t228\t255,0,0\t1\t100\t0\nchr2:172936693-172938111\t428\t528\tmy_read/2\t60\t-\t428\t528\t255,0,0\t1\t100\t0\n" > "$TMPDIR/example.bed12"
# Create and populate example.gff file
printf "##gff-version 3\n" > "$TMPDIR/example.gff"
printf "chr1\t.\tgene\t1000\t2000\t.\t+\t.\tID=gene1;Name=Gene1\n" >> "$TMPDIR/example.gff"
printf "chr3\t.\tmRNA\t1000\t2000\t.\t+\t.\tID=transcript1;Parent=gene1\n" >> "$TMPDIR/example.gff"
printf "chr1\t.\texon\t1000\t1200\t.\t+\t.\tID=exon1;Parent=transcript1\n" >> "$TMPDIR/example.gff"
printf "chr2\t.\texon\t1500\t1700\t.\t+\t.\tID=exon2;Parent=transcript1\n" >> "$TMPDIR/example.gff"
printf "chr1\t.\tCDS\t1000\t1200\t.\t+\t0\tID=cds1;Parent=transcript1\n" >> "$TMPDIR/example.gff"
printf "chr1\t.\tCDS\t1500\t1700\t.\t+\t2\tID=cds2;Parent=transcript1\n" >> "$TMPDIR/example.gff"
# Expected output sam files for each test
cat <<EOF > "$TMPDIR/expected.sam"
@HD VN:1.0 SO:unsorted
@PG ID:BEDTools_bedToBam VN:Vv2.30.0
@PG ID:samtools PN:samtools PP:BEDTools_bedToBam VN:1.16.1 CL:samtools view -h output.bam
@SQ SN:chr1 AS:../genome.txt LN:248956422
@SQ SN:chr3 AS:../genome.txt LN:242193529
@SQ SN:chr2 AS:../genome.txt LN:198295559
my_read/1 0 chr1 129 255 100M * 0 0 * *
my_read/2 16 chr1 429 255 100M * 0 0 * *
EOF
cat <<EOF > "$TMPDIR/expected12.sam"
@HD VN:1.0 SO:unsorted
@PG ID:BEDTools_bedToBam VN:Vv2.30.0
@PG ID:samtools PN:samtools PP:BEDTools_bedToBam VN:1.16.1 CL:samtools view -h output.bam
@SQ SN:chr1 AS:../genome.txt LN:248956422
@SQ SN:chr3 AS:../genome.txt LN:242193529
@SQ SN:chr2 AS:../genome.txt LN:198295559
my_read/1 0 chr1 129 255 100M * 0 0 * *
my_read/2 16 chr1 429 255 100M * 0 0 * *
EOF
cat <<EOF > "$TMPDIR/expected_mapquality.sam"
@HD VN:1.0 SO:unsorted
@PG ID:BEDTools_bedToBam VN:Vv2.30.0
@PG ID:samtools PN:samtools PP:BEDTools_bedToBam VN:1.16.1 CL:samtools view -h output.bam
@SQ SN:chr1 AS:../genome.txt LN:248956422
@SQ SN:chr3 AS:../genome.txt LN:242193529
@SQ SN:chr2 AS:../genome.txt LN:198295559
my_read/1 0 chr1 129 10 100M * 0 0 * *
my_read/2 16 chr1 429 10 100M * 0 0 * *
EOF
cat <<EOF > "$TMPDIR/expected_gff.sam"
@HD VN:1.0 SO:unsorted
@PG ID:BEDTools_bedToBam VN:Vv2.30.0
@PG ID:samtools PN:samtools PP:BEDTools_bedToBam VN:1.16.1 CL:samtools view -h output.bam
@SQ SN:chr1 AS:../genome.txt LN:248956422
@SQ SN:chr3 AS:../genome.txt LN:242193529
@SQ SN:chr2 AS:../genome.txt LN:198295559
gene 0 chr1 1000 255 1001M * 0 0 * *
mRNA 0 chr3 1000 255 1001M * 0 0 * *
exon 0 chr1 1000 255 201M * 0 0 * *
exon 0 chr2 1500 255 201M * 0 0 * *
CDS 0 chr1 1000 255 201M * 0 0 * *
CDS 0 chr1 1500 255 201M * 0 0 * *
EOF
# Test 1: Default conversion BED to BAM
mkdir "$TMPDIR/test1" && pushd "$TMPDIR/test1" > /dev/null
echo "> Run bedtools_bedtobam on BED file"
"$meta_executable" \
--input "../example.bed" \
--genome "../genome.txt" \
--output "output.bam"
samtools view -h output.bam > output.sam
# checks
assert_file_exists "output.bam"
assert_file_not_empty "output.bam"
assert_identical_content "output.sam" "../expected.sam"
echo "- test1 succeeded -"
popd > /dev/null
# Test 2: BED12 file
mkdir "$TMPDIR/test2" && pushd "$TMPDIR/test2" > /dev/null
echo "> Run bedtools_bedtobam on BED12 file"
"$meta_executable" \
--input "../example.bed12" \
--genome "../genome.txt" \
--output "output.bam" \
--bed12 \
samtools view -h output.bam > output.sam
# checks
assert_file_exists "output.bam"
assert_file_not_empty "output.bam"
assert_identical_content "output.sam" "../expected12.sam"
echo "- test2 succeeded -"
popd > /dev/null
# Test 3: Uncompressed BAM file
mkdir "$TMPDIR/test3" && pushd "$TMPDIR/test3" > /dev/null
echo "> Run bedtools_bedtobam on BED file with uncompressed BAM output"
"$meta_executable" \
--input "../example.bed" \
--genome "../genome.txt" \
--output "output.bam" \
--uncompress_bam
# checks
assert_file_exists "output.bam"
assert_file_not_empty "output.bam"
# Cannot assert_identical_content because umcompress option does not work on this version of bedtools.
echo "- test3 succeeded -"
popd > /dev/null
# Test 4: Map quality
mkdir "$TMPDIR/test4" && pushd "$TMPDIR/test4" > /dev/null
echo "> Run bedtools_bedtobam on BED file with map quality"
"$meta_executable" \
--input "../example.bed" \
--genome "../genome.txt" \
--output "output.bam" \
--map_quality 10 \
samtools view -h output.bam > output.sam
# checks
assert_file_exists "output.bam"
assert_file_not_empty "output.bam"
assert_identical_content "output.sam" "../expected_mapquality.sam"
echo "- test4 succeeded -"
popd > /dev/null
# Test 5: gff to bam conversion
mkdir "$TMPDIR/test5" && pushd "$TMPDIR/test5" > /dev/null
echo "> Run bedtools_bedtobam on GFF file"
"$meta_executable" \
--input "../example.gff" \
--genome "../genome.txt" \
--output "output.bam"
samtools view -h output.bam > output.sam
# checks
assert_file_exists "output.bam"
assert_file_not_empty "output.bam"
assert_identical_content "output.sam" "../expected_gff.sam"
echo "- test5 succeeded -"
popd > /dev/null
echo "---- All tests succeeded! ----"
exit 0

106
src/bedtools/bedtools_getfasta/config.vsh.yaml Normal file
View File

@@ -0,0 +1,106 @@
name: bedtools_getfasta
namespace: bedtools
description: Extract sequences from a FASTA file for each of the intervals defined in a BED/GFF/VCF file.
keywords: [sequencing, fasta, BED, GFF, VCF]
links:
documentation: https://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html
repository: https://github.com/arq5x/bedtools2
references:
doi: 10.1093/bioinformatics/btq033
license: GPL-2.0
requirements:
commands: [bedtools]
authors:
- __merge__: /src/_authors/dries_schaumont.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Input arguments
arguments:
- name: --input_fasta
type: file
description: |
FASTA file containing sequences for each interval specified in the input BED file.
The headers in the input FASTA file must exactly match the chromosome column in the BED file.
- name: "--input_bed"
type: file
description: |
BED file containing intervals to extract from the FASTA file.
BED files containing a single region require a newline character
at the end of the line, otherwise a blank output file is produced.
- name: --rna
type: boolean_true
description: |
The FASTA is RNA not DNA. Reverse complementation handled accordingly.
- name: Run arguments
arguments:
- name: "--strandedness"
type: boolean_true
alternatives: ["-s"]
description: |
Force strandedness. If the feature occupies the antisense strand, the output sequence will
be reverse complemented. By default strandedness is not taken into account.
- name: Output arguments
arguments:
- name: --output
alternatives: [-o]
required: true
type: file
direction: output
description: |
Output file where the output from the 'bedtools getfasta' commend will
be written to.
- name: --tab
type: boolean_true
description: |
Report extract sequences in a tab-delimited format instead of in FASTA format.
- name: --bed_out
type: boolean_true
description: |
Report extract sequences in a tab-delimited BED format instead of in FASTA format.
- name: "--name"
type: boolean_true
description: |
Set the FASTA header for each extracted sequence to be the "name" and coordinate columns from the BED feature.
- name: "--name_only"
type: boolean_true
description: |
Set the FASTA header for each extracted sequence to be the "name" columns from the BED feature.
- name: "--split"
type: boolean_true
description: |
When --input is in BED12 format, create a separate fasta entry for each block in a BED12 record,
blocks being described in the 11th and 12th column of the BED.
- name: "--full_header"
type: boolean_true
description: |
Use full fasta header. By default, only the word before the first space or tab is used.
# Arguments not taken into account:
#
# -fo [Specify an output file name. By default, output goes to stdout.
#
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: debian:stable-slim
setup:
- type: apt
packages: [bedtools, procps]
- type: docker
run: |
echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

22
src/bedtools/bedtools_getfasta/script.sh Normal file
View File

@@ -0,0 +1,22 @@
#!/usr/bin/env bash
set -eo pipefail
unset_if_false=( par_rna par_strandedness par_tab par_bed_out par_name par_name_only par_split par_full_header )
for par in ${unset_if_false[@]}; do
test_val="${!par}"
[[ "$test_val" == "false" ]] && unset $par
done
bedtools getfasta \
-fi "$par_input_fasta" \
-bed "$par_input_bed" \
${par_rna:+-rna} \
${par_name:+-name} \
${par_name_only:+-nameOnly} \
${par_tab:+-tab} \
${par_bed_out:+-bedOut} \
${par_strandedness:+-s} \
${par_split:+-split} \
${par_full_header:+-fullHeader} > "$par_output"

119
src/bedtools/bedtools_getfasta/test.sh Normal file
View File

@@ -0,0 +1,119 @@
#!/usr/bin/env bash
set -eo pipefail
TMPDIR=$(mktemp -d)
function clean_up {
[[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
}
trap clean_up EXIT
# Create dummy test fasta file
cat > "$TMPDIR/test.fa" <<EOF
>chr1
AAAAAAAACCCCCCCCCCCCCGCTACTGGGGGGGGGGGGGGGGGG
EOF
TAB="$(printf '\t')"
# Create dummy bed file
cat > "$TMPDIR/test.bed" <<EOF
chr1${TAB}5${TAB}10${TAB}myseq
EOF
# Create expected bed file
cat > "$TMPDIR/expected.fasta" <<EOF
>chr1:5-10
AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--output "$TMPDIR/output.fasta"
cmp --silent "$TMPDIR/output.fasta" "$TMPDIR/expected.fasta" || { echo "files are different:"; exit 1; }
# Create expected bed file for --name
cat > "$TMPDIR/expected_with_name.fasta" <<EOF
>myseq::chr1:5-10
AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--name \
--output "$TMPDIR/output_with_name.fasta"
cmp --silent "$TMPDIR/output_with_name.fasta" "$TMPDIR/expected_with_name.fasta" || { echo "Files when using --name are different."; exit 1; }
# Create expected bed file for --name_only
cat > "$TMPDIR/expected_with_name_only.fasta" <<EOF
>myseq
AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--name_only \
--output "$TMPDIR/output_with_name_only.fasta"
cmp --silent "$TMPDIR/output_with_name_only.fasta" "$TMPDIR/expected_with_name_only.fasta" || { echo "Files when using --name_only are different."; exit 1; }
# Create expected tab-delimited file for --tab
cat > "$TMPDIR/expected_tab.out" <<EOF
myseq${TAB}AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--name_only \
--tab \
--output "$TMPDIR/tab.out"
cmp --silent "$TMPDIR/expected_tab.out" "$TMPDIR/tab.out" || { echo "Files when using --tab are different."; exit 1; }
# Create expected tab-delimited file for --bed_out
cat > "$TMPDIR/expected.bed" <<EOF
chr1${TAB}5${TAB}10${TAB}myseq${TAB}AAACC
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test.bed" \
--input_fasta "$TMPDIR/test.fa" \
--bed_out \
--output "$TMPDIR/output.bed"
cmp --silent "$TMPDIR/expected.bed" "$TMPDIR/output.bed" || { echo "Files when using --bed_out are different."; exit 1; }
# Create dummy bed file for strandedness
cat > "$TMPDIR/test_strandedness.bed" <<EOF
chr1${TAB}20${TAB}25${TAB}forward${TAB}1${TAB}+
chr1${TAB}20${TAB}25${TAB}reverse${TAB}1${TAB}-
EOF
# Create expected tab-delimited file for --bed_out
cat > "$TMPDIR/expected_strandedness.fasta" <<EOF
>forward(+)
CGCTA
>reverse(-)
TAGCG
EOF
"$meta_executable" \
--input_bed "$TMPDIR/test_strandedness.bed" \
--input_fasta "$TMPDIR/test.fa" \
-s \
--name_only \
--output "$TMPDIR/output_strandedness.fasta"
cmp --silent "$TMPDIR/expected_strandedness.fasta" "$TMPDIR/output_strandedness.fasta" || { echo "Files when using -s are different."; exit 1; }

255
src/bedtools/bedtools_intersect/config.vsh.yaml Normal file
View File

@@ -0,0 +1,255 @@
name: bedtools_intersect
namespace: bedtools
description: |
bedtools intersect allows one to screen for overlaps between two sets of genomic features.
Moreover, it allows one to have fine control as to how the intersections are reported.
bedtools intersect works with both BED/GFF/VCF and BAM files as input.
keywords: [feature intersection, BAM, BED, GFF, VCF]
links:
documentation: https://bedtools.readthedocs.io/en/latest/content/tools/intersect.html
repository: https://github.com/arq5x/bedtools2
references:
doi: 10.1093/bioinformatics/btq033
license: GPL-2.0, MIT
requirements:
commands: [bedtools]
authors:
- __merge__: /src/_authors/theodoro_gasperin.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --input_a
alternatives: -a
type: file
direction: input
description: |
The input file (BED/GFF/VCF/BAM) to be used as the -a file.
required: true
example: input_a.bed
- name: --input_b
alternatives: -b
type: file
direction: input
multiple: true
description: |
The input file(s) (BED/GFF/VCF/BAM) to be used as the -b file(s).
required: true
example: input_b.bed
- name: Outputs
arguments:
- name: --output
type: file
direction: output
description: |
The output BED file.
required: true
example: output.bed
- name: Options
arguments:
- name: --write_a
alternatives: -wa
type: boolean_true
description: Write the original A entry for each overlap.
- name: --write_b
alternatives: -wb
type: boolean_true
description: |
Write the original B entry for each overlap.
Useful for knowing _what_ A overlaps. Restricted by -f and -r.
- name: --left_outer_join
alternatives: -loj
type: boolean_true
description: |
Perform a "left outer join". That is, for each feature in A report each overlap with B.
If no overlaps are found, report a NULL feature for B.
- name: --write_overlap
alternatives: -wo
type: boolean_true
description: |
Write the original A and B entries plus the number of base pairs of overlap between the two features.
- Overlaps restricted by -f and -r.
Only A features with overlap are reported.
- name: --write_overlap_plus
alternatives: -wao
type: boolean_true
description: |
Write the original A and B entries plus the number of base pairs of overlap between the two features.
- Overlaps restricted by -f and -r.
However, A features w/o overlap are also reported with a NULL B feature and overlap = 0.
- name: --report_A_if_no_overlap
alternatives: -u
type: boolean_true
description: |
Write the original A entry _if_ no overlap is found.
- In other words, just report the fact >=1 hit was found.
- Overlaps restricted by -f and -r.
- name: --number_of_overlaps_A
alternatives: -c
type: boolean_true
description: |
For each entry in A, report the number of overlaps with B.
- Reports 0 for A entries that have no overlap with B.
- Overlaps restricted by -f and -r.
- name: --report_no_overlaps_A
alternatives: -v
type: boolean_true
description: |
Only report those entries in A that have _no overlaps_ with B.
- Similar to "grep -v" (an homage).
- name: --uncompressed_bam
alternatives: -ubam
type: boolean_true
description: Write uncompressed BAM output. Default writes compressed BAM.
- name: --same_strand
alternatives: -s
type: boolean_true
description: |
Require same strandedness. That is, only report hits in B.
that overlap A on the _same_ strand.
- By default, overlaps are reported without respect to strand.
- name: --opposite_strand
alternatives: -S
type: boolean_true
description: |
Require different strandedness. That is, only report hits in B
that overlap A on the _opposite_ strand.
- By default, overlaps are reported without respect to strand.
- name: --min_overlap_A
alternatives: -f
type: double
description: |
Minimum overlap required as a fraction of A.
- Default is 1E-9 (i.e., 1bp).
- FLOAT (e.g. 0.50)
example: 0.50
- name: --min_overlap_B
alternatives: -F
type: double
description: |
Minimum overlap required as a fraction of B.
- Default is 1E-9 (i.e., 1bp).
- FLOAT (e.g. 0.50)
example: 0.50
- name: --reciprocal_overlap
alternatives: -r
type: boolean_true
description: |
Require that the fraction overlap be reciprocal for A AND B.
- In other words, if -f is 0.90 and -r is used, this requires
that B overlap 90% of A and A _also_ overlaps 90% of B.
- name: --either_overlap
alternatives: -e
type: boolean_true
description: |
Require that the minimum fraction be satisfied for A OR B.
- In other words, if -e is used with -f 0.90 and -F 0.10 this requires
that either 90% of A is covered OR 10% of B is covered.
Without -e, both fractions would have to be satisfied.
- name: --split
type: boolean_true
description: Treat "split" BAM or BED12 entries as distinct BED intervals.
- name: --genome
alternatives: -g
type: file
description: |
Provide a genome file to enforce consistent chromosome
sort order across input files. Only applies when used
with -sorted option.
example: genome.txt
- name: --nonamecheck
type: boolean_true
description: |
For sorted data, don't throw an error if the file
has different naming conventions for the same chromosome
(e.g., "chr1" vs "chr01").
- name: --sorted
type: boolean_true
description: |
Use the "chromsweep" algorithm for sorted (-k1,1 -k2,2n) input.
- name: --names
type: string
description: |
When using multiple databases, provide an alias
for each that will appear instead of a fileId when
also printing the DB record.
- name: --filenames
type: boolean_true
description: When using multiple databases, show each complete filename instead of a fileId when also printing the DB record.
- name: --sortout
type: boolean_true
description: When using multiple databases, sort the output DB hits for each record.
- name: --bed
type: boolean_true
description: If using BAM input, write output as BED.
- name: --header
type: boolean_true
description: Print the header from the A file prior to results.
- name: --no_buffer_output
alternatives: --nobuf
type: boolean_true
description: |
Disable buffered output. Using this option will cause each line
of output to be printed as it is generated, rather than saved
in a buffer. This will make printing large output files
noticeably slower, but can be useful in conjunction with
other software tools and scripts that need to process one
line of bedtools output at a time.
- name: --io_buffer_size
alternatives: --iobuf
type: integer
description: |
Specify amount of memory to use for input buffer.
Takes an integer argument. Optional suffixes K/M/G supported.
Note: currently has no effect with compressed files.
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: debian:stable-slim
setup:
- type: apt
packages: [bedtools, procps]
- type: docker
run: |
echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

119
src/bedtools/bedtools_intersect/help.txt Normal file
View File

@@ -0,0 +1,119 @@
```bash
bedtools intersect
```
Tool: bedtools intersect (aka intersectBed)
Version: v2.30.0
Summary: Report overlaps between two feature files.
Usage: bedtools intersect [OPTIONS] -a <bed/gff/vcf/bam> -b <bed/gff/vcf/bam>
Note: -b may be followed with multiple databases and/or
wildcard (*) character(s).
Options:
-wa Write the original entry in A for each overlap.
-wb Write the original entry in B for each overlap.
- Useful for knowing _what_ A overlaps. Restricted by -f and -r.
-loj Perform a "left outer join". That is, for each feature in A
report each overlap with B. If no overlaps are found,
report a NULL feature for B.
-wo Write the original A and B entries plus the number of base
pairs of overlap between the two features.
- Overlaps restricted by -f and -r.
Only A features with overlap are reported.
-wao Write the original A and B entries plus the number of base
pairs of overlap between the two features.
- Overlapping features restricted by -f and -r.
However, A features w/o overlap are also reported
with a NULL B feature and overlap = 0.
-u Write the original A entry _once_ if _any_ overlaps found in B.
- In other words, just report the fact >=1 hit was found.
- Overlaps restricted by -f and -r.
-c For each entry in A, report the number of overlaps with B.
- Reports 0 for A entries that have no overlap with B.
- Overlaps restricted by -f, -F, -r, and -s.
-C For each entry in A, separately report the number of
- overlaps with each B file on a distinct line.
- Reports 0 for A entries that have no overlap with B.
- Overlaps restricted by -f, -F, -r, and -s.
-v Only report those entries in A that have _no overlaps_ with B.
- Similar to "grep -v" (an homage).
-ubam Write uncompressed BAM output. Default writes compressed BAM.
-s Require same strandedness. That is, only report hits in B
that overlap A on the _same_ strand.
- By default, overlaps are reported without respect to strand.
-S Require different strandedness. That is, only report hits in B
that overlap A on the _opposite_ strand.
- By default, overlaps are reported without respect to strand.
-f Minimum overlap required as a fraction of A.
- Default is 1E-9 (i.e., 1bp).
- FLOAT (e.g. 0.50)
-F Minimum overlap required as a fraction of B.
- Default is 1E-9 (i.e., 1bp).
- FLOAT (e.g. 0.50)
-r Require that the fraction overlap be reciprocal for A AND B.
- In other words, if -f is 0.90 and -r is used, this requires
that B overlap 90% of A and A _also_ overlaps 90% of B.
-e Require that the minimum fraction be satisfied for A OR B.
- In other words, if -e is used with -f 0.90 and -F 0.10 this requires
that either 90% of A is covered OR 10% of B is covered.
Without -e, both fractions would have to be satisfied.
-split Treat "split" BAM or BED12 entries as distinct BED intervals.
-g Provide a genome file to enforce consistent chromosome sort order
across input files. Only applies when used with -sorted option.
-nonamecheck For sorted data, don't throw an error if the file has different naming conventions
for the same chromosome. ex. "chr1" vs "chr01".
-sorted Use the "chromsweep" algorithm for sorted (-k1,1 -k2,2n) input.
-names When using multiple databases, provide an alias for each that
will appear instead of a fileId when also printing the DB record.
-filenames When using multiple databases, show each complete filename
instead of a fileId when also printing the DB record.
-sortout When using multiple databases, sort the output DB hits
for each record.
-bed If using BAM input, write output as BED.
-header Print the header from the A file prior to results.
-nobuf Disable buffered output. Using this option will cause each line
of output to be printed as it is generated, rather than saved
in a buffer. This will make printing large output files
noticeably slower, but can be useful in conjunction with
other software tools and scripts that need to process one
line of bedtools output at a time.
-iobuf Specify amount of memory to use for input buffer.
Takes an integer argument. Optional suffixes K/M/G supported.
Note: currently has no effect with compressed files.
Notes:
(1) When a BAM file is used for the A file, the alignment is retained if overlaps exist,
and excluded if an overlap cannot be found. If multiple overlaps exist, they are not
reported, as we are only testing for one or more overlaps.
***** ERROR: No input file given. Exiting. *****

69
src/bedtools/bedtools_intersect/script.sh Normal file
View File

@@ -0,0 +1,69 @@
#!/bin/bash
## VIASH START
## VIASH END
unset_if_false=(
par_write_a
par_write_b
par_left_outer_join
par_write_overlap
par_write_overlap_plus
par_report_A_if_no_overlap
par_number_of_overlaps_A
par_report_no_overlaps_A
par_uncompressed_bam
par_same_strand
par_opposite_strand
par_reciprocal_overlap
par_either_overlap
par_split
par_nonamecheck
par_sorted
par_filenames
par_sortout
par_bed
par_no_buffer_output
par_header
)
for par in ${unset_if_false[@]}; do
test_val="${!par}"
[[ "$test_val" == "false" ]] && unset $par
done
# Create input array
IFS=";" read -ra input <<< $par_input_b
bedtools intersect \
${par_write_a:+-wa} \
${par_write_b:+-wb} \
${par_left_outer_join:+-loj} \
${par_write_overlap:+-wo} \
${par_write_overlap_plus:+-wao} \
${par_report_A_if_no_overlap:+-u} \
${par_number_of_overlaps_A:+-c} \
${par_report_no_overlaps_A:+-v} \
${par_uncompressed_bam:+-ubam} \
${par_same_strand:+-s} \
${par_opposite_strand:+-S} \
${par_min_overlap_A:+-f "$par_min_overlap_A"} \
${par_min_overlap_B:+-F "$par_min_overlap_B"} \
${par_reciprocal_overlap:+-r} \
${par_either_overlap:+-e} \
${par_split:+-split} \
${par_genome:+-g "$par_genome"} \
${par_nonamecheck:+-nonamecheck} \
${par_sorted:+-sorted} \
${par_names:+-names "$par_names"} \
${par_filenames:+-filenames} \
${par_sortout:+-sortout} \
${par_bed:+-bed} \
${par_header:+-header} \
${par_no_buffer_output:+-nobuf} \
${par_io_buffer_size:+-iobuf "$par_io_buffer_size"} \
-a "$par_input_a" \
${par_input_b:+ -b ${input[*]}} \
> "$par_output"

340
src/bedtools/bedtools_intersect/test.sh Normal file
View File

@@ -0,0 +1,340 @@
#!/bin/bash
# exit on error
set -e
## VIASH START
meta_executable="target/executable/bedtools/bedtools_intersect/bedtools_intersect"
meta_resources_dir="src/bedtools/bedtools_intersect"
## VIASH END
#############################################
# helper functions
assert_file_exists() {
[ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
}
assert_file_not_empty() {
[ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
}
assert_file_contains() {
grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
}
assert_identical_content() {
diff -a "$2" "$1" \
|| (echo "Files are not identical!" && exit 1)
}
#############################################
# Create directories for tests
echo "Creating Test Data..."
mkdir -p test_data
# Create and populate featuresA.bed
printf "chr1\t100\t200\nchr1\t150\t250\nchr1\t300\t400\n" > "test_data/featuresA.bed"
# Create and populate featuresB.bed
printf "chr1\t180\t280\nchr1\t290\t390\nchr1\t500\t600\n" > "test_data/featuresB.bed"
# Create and populate featuresC.bed
printf "chr1\t120\t220\nchr1\t250\t350\nchr1\t500\t580\n" > "test_data/featuresC.bed"
# Create and populate examples gff files
# example1.gff
printf "##gff-version 3\n" > "test_data/example1.gff"
printf "chr1\t.\tgene\t1000\t2000\t.\t+\t.\tID=gene1;Name=Gene1\n" >> "test_data/example1.gff"
printf "chr1\t.\tmRNA\t1000\t2000\t.\t+\t.\tID=transcript1;Parent=gene1\n" >> "test_data/example1.gff"
printf "chr1\t.\texon\t1000\t1200\t.\t+\t.\tID=exon1;Parent=transcript1\n" >> "test_data/example1.gff"
printf "chr1\t.\texon\t1500\t1700\t.\t+\t.\tID=exon2;Parent=transcript1\n" >> "test_data/example1.gff"
printf "chr1\t.\tCDS\t1000\t1200\t.\t+\t0\tID=cds1;Parent=transcript1\n" >> "test_data/example1.gff"
printf "chr1\t.\tCDS\t1500\t1700\t.\t+\t2\tID=cds2;Parent=transcript1\n" >> "test_data/example1.gff"
# example2.gff
printf "##gff-version 3\n" > "test_data/example2.gff"
printf "chr1\t.\tgene\t1200\t1800\t.\t-\t.\tID=gene2;Name=Gene2\n" >> "test_data/example2.gff"
printf "chr1\t.\tmRNA\t1400\t2000\t.\t-\t.\tID=transcript2;Parent=gene2\n" >> "test_data/example2.gff"
printf "chr1\t.\texon\t1400\t2000\t.\t-\t.\tID=exon3;Parent=transcript2\n" >> "test_data/example2.gff"
printf "chr1\t.\texon\t1600\t2000\t.\t-\t.\tID=exon4;Parent=transcript2\n" >> "test_data/example2.gff"
printf "chr1\t.\tCDS\t3000\t3200\t.\t-\t1\tID=cds3;Parent=transcript2\n" >> "test_data/example2.gff"
printf "chr1\t.\tCDS\t3500\t3700\t.\t-\t0\tID=cds4;Parent=transcript2\n" >> "test_data/example2.gff"
# Create and populate expected output files for different tests
printf "chr1\t180\t200\nchr1\t180\t250\nchr1\t300\t390\n" > "test_data/expected_default.bed"
printf "chr1\t100\t200\nchr1\t150\t250\nchr1\t300\t400\n" > "test_data/expected_wa.bed"
printf "chr1\t180\t200\tchr1\t180\t280\nchr1\t180\t250\tchr1\t180\t280\nchr1\t300\t390\tchr1\t290\t390\n" > "test_data/expected_wb.bed"
printf "chr1\t100\t200\tchr1\t180\t280\nchr1\t150\t250\tchr1\t180\t280\nchr1\t300\t400\tchr1\t290\t390\n" > "test_data/expected_loj.bed"
printf "chr1\t100\t200\tchr1\t180\t280\t20\nchr1\t150\t250\tchr1\t180\t280\t70\nchr1\t300\t400\tchr1\t290\t390\t90\n" > "test_data/expected_wo.bed"
printf "chr1\t100\t200\nchr1\t150\t250\nchr1\t300\t400\n" > "test_data/expected_u.bed"
printf "chr1\t100\t200\t1\nchr1\t150\t250\t1\nchr1\t300\t400\t1\n" > "test_data/expected_c.bed"
printf "chr1\t180\t250\nchr1\t300\t390\n" > "test_data/expected_f50.bed"
printf "chr1\t180\t250\nchr1\t300\t390\n" > "test_data/expected_f30.bed"
printf "chr1\t180\t200\nchr1\t180\t250\nchr1\t300\t390\n" > "test_data/expected_f10.bed"
printf "chr1\t180\t200\nchr1\t180\t250\nchr1\t300\t390\n" > "test_data/expected_r.bed"
printf "chr1\t180\t200\nchr1\t120\t200\nchr1\t180\t250\nchr1\t150\t220\nchr1\t300\t390\nchr1\t300\t350\n" > "test_data/expected_multiple.bed"
# expected gff file
printf "chr1\t.\tgene\t1200\t1800\t.\t+\t.\tID=gene1;Name=Gene1\n" >> "test_data/expected.gff"
printf "chr1\t.\tgene\t1400\t2000\t.\t+\t.\tID=gene1;Name=Gene1\n" >> "test_data/expected.gff"
printf "chr1\t.\tgene\t1400\t2000\t.\t+\t.\tID=gene1;Name=Gene1\n" >> "test_data/expected.gff"
printf "chr1\t.\tgene\t1600\t2000\t.\t+\t.\tID=gene1;Name=Gene1\n" >> "test_data/expected.gff"
printf "chr1\t.\tmRNA\t1200\t1800\t.\t+\t.\tID=transcript1;Parent=gene1\n" >> "test_data/expected.gff"
printf "chr1\t.\tmRNA\t1400\t2000\t.\t+\t.\tID=transcript1;Parent=gene1\n" >> "test_data/expected.gff"
printf "chr1\t.\tmRNA\t1400\t2000\t.\t+\t.\tID=transcript1;Parent=gene1\n" >> "test_data/expected.gff"
printf "chr1\t.\tmRNA\t1600\t2000\t.\t+\t.\tID=transcript1;Parent=gene1\n" >> "test_data/expected.gff"
printf "chr1\t.\texon\t1200\t1200\t.\t+\t.\tID=exon1;Parent=transcript1\n" >> "test_data/expected.gff"
printf "chr1\t.\texon\t1500\t1700\t.\t+\t.\tID=exon2;Parent=transcript1\n" >> "test_data/expected.gff"
printf "chr1\t.\texon\t1500\t1700\t.\t+\t.\tID=exon2;Parent=transcript1\n" >> "test_data/expected.gff"
printf "chr1\t.\texon\t1500\t1700\t.\t+\t.\tID=exon2;Parent=transcript1\n" >> "test_data/expected.gff"
printf "chr1\t.\texon\t1600\t1700\t.\t+\t.\tID=exon2;Parent=transcript1\n" >> "test_data/expected.gff"
printf "chr1\t.\tCDS\t1200\t1200\t.\t+\t0\tID=cds1;Parent=transcript1\n" >> "test_data/expected.gff"
printf "chr1\t.\tCDS\t1500\t1700\t.\t+\t2\tID=cds2;Parent=transcript1\n" >> "test_data/expected.gff"
printf "chr1\t.\tCDS\t1500\t1700\t.\t+\t2\tID=cds2;Parent=transcript1\n" >> "test_data/expected.gff"
printf "chr1\t.\tCDS\t1500\t1700\t.\t+\t2\tID=cds2;Parent=transcript1\n" >> "test_data/expected.gff"
printf "chr1\t.\tCDS\t1600\t1700\t.\t+\t2\tID=cds2;Parent=transcript1\n" >> "test_data/expected.gff"
# Test 1: Default intersect
mkdir test1
cd test1
echo "> Run bedtools_intersect on BED files with default intersect"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed"
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_default.bed"
echo "- test1 succeeded -"
cd ..
# Test 2: Write A option
mkdir test2
cd test2
echo "> Run bedtools_intersect on BED files with -wa option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--write_a
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_wa.bed"
echo "- test2 succeeded -"
cd ..
# Test 3: -wb option
mkdir test3
cd test3
echo "> Run bedtools_intersect on BED files with -wb option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--write_b
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_wb.bed"
echo "- test3 succeeded -"
cd ..
# Test 4: -loj option
mkdir test4
cd test4
echo "> Run bedtools_intersect on BED files with -loj option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--left_outer_join
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_loj.bed"
echo "- test4 succeeded -"
cd ..
# Test 5: -wo option
mkdir test5
cd test5
echo "> Run bedtools_intersect on BED files with -wo option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--write_overlap
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_wo.bed"
echo "- test5 succeeded -"
cd ..
# Test 6: -u option
mkdir test6
cd test6
echo "> Run bedtools_intersect on BED files with -u option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--report_A_if_no_overlap true
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_u.bed"
echo "- test6 succeeded -"
cd ..
# Test 7: -c option
mkdir test7
cd test7
echo "> Run bedtools_intersect on BED files with -c option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--number_of_overlaps_A true
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_c.bed"
echo "- test7 succeeded -"
cd ..
# Test 8: -f 0.50 option
mkdir test8
cd test8
echo "> Run bedtools_intersect on BED files with -f 0.50 option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--min_overlap_A 0.50
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_f50.bed"
echo "- test8 succeeded -"
cd ..
# Test 9: -f 0.30 option
mkdir test9
cd test9
echo "> Run bedtools_intersect on BED files with -f 0.30 option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--min_overlap_A 0.30
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_f30.bed"
echo "- test9 succeeded -"
cd ..
# Test 10: -f 0.10 option
mkdir test10
cd test10
echo "> Run bedtools_intersect on BED files with -f 0.10 option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--min_overlap_A 0.10
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_f10.bed"
echo "- test10 succeeded -"
cd ..
# Test 11: -r option
mkdir test11
cd test11
echo "> Run bedtools_intersect on BED files with -r option"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--output "output.bed" \
--reciprocal_overlap true
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_r.bed"
echo "- test11 succeeded -"
cd ..
# Test 12: Multiple files
mkdir test12
cd test12
echo "> Run bedtools_intersect on multiple BED files"
"$meta_executable" \
--input_a "../test_data/featuresA.bed" \
--input_b "../test_data/featuresB.bed" \
--input_b "../test_data/featuresC.bed" \
--output "output.bed"
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected_multiple.bed"
echo "- test12 succeeded -"
cd ..
# Test 13: VCF file format
mkdir test13
cd test13
echo "> Run bedtools_intersect on GFF files"
"$meta_executable" \
--input_a "../test_data/example1.gff" \
--input_b "../test_data/example2.gff" \
--output "output.bed"
# checks
assert_file_exists "output.bed"
assert_file_not_empty "output.bed"
assert_identical_content "output.bed" "../test_data/expected.gff"
echo "- test13 succeeded -"
cd ..
echo "---- All tests succeeded! ----"
exit 0

93
src/bedtools/bedtools_sort/config.vsh.yaml Normal file
View File

@@ -0,0 +1,93 @@
name: bedtools_sort
namespace: bedtools
description: Sorts a feature file (bed/gff/vcf) by chromosome and other criteria.
keywords: [sort, BED, GFF, VCF]
links:
documentation: https://bedtools.readthedocs.io/en/latest/content/tools/sort.html
repository: https://github.com/arq5x/bedtools2
references:
doi: 10.1093/bioinformatics/btq033
license: GPL-2.0, MIT
requirements:
commands: [bedtools]
authors:
- __merge__: /src/_authors/theodoro_gasperin.yaml
roles: [ author, maintainer ]
argument_groups:
- name: Inputs
arguments:
- name: --input
alternatives: -i
type: file
description: Input file (bed/gff/vcf) to be sorted.
required: true
- name: Outputs
arguments:
- name: --output
alternatives: -o
type: file
direction: output
description: Output sorted file (bed/gff/vcf) to be written.
- name: Options
arguments:
- name: --sizeA
type: boolean_true
description: Sort by feature size in ascending order.
- name: --sizeD
type: boolean_true
description: Sort by feature size in descending order.
- name: --chrThenSizeA
type: boolean_true
description: Sort by chrom (asc), then feature size (asc).
- name: --chrThenSizeD
type: boolean_true
description: Sort by chrom (asc), then feature size (desc).
- name: --chrThenScoreA
type: boolean_true
description: Sort by chrom (asc), then score (asc).
- name: --chrThenScoreD
type: boolean_true
description: Sort by chrom (asc), then score (desc).
- name: --genome
alternatives: -g
type: file
description: Sort according to the chromosomes declared in "genome.txt"
- name: --faidx
type: file
description: Sort according to the chromosomes declared in "names.txt"
- name: --header
type: boolean_true
description: Print the header from the A file prior to results.
resources:
- type: bash_script
path: script.sh
test_resources:
- type: bash_script
path: test.sh
engines:
- type: docker
image: debian:stable-slim
setup:
- type: apt
packages: [bedtools, procps]
- type: docker
run: |
echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
runners:
- type: executable
- type: nextflow

21
src/bedtools/bedtools_sort/help.txt Normal file
View File

@@ -0,0 +1,21 @@
```bash
bedtools sort
```
Tool: bedtools sort (aka sortBed)
Version: v2.30.0
Summary: Sorts a feature file in various and useful ways.
Usage: bedtools sort [OPTIONS] -i <bed/gff/vcf>
Options:
-sizeA Sort by feature size in ascending order.
-sizeD Sort by feature size in descending order.
-chrThenSizeA Sort by chrom (asc), then feature size (asc).
-chrThenSizeD Sort by chrom (asc), then feature size (desc).
-chrThenScoreA Sort by chrom (asc), then score (asc).
-chrThenScoreD Sort by chrom (asc), then score (desc).
-g (names.txt) Sort according to the chromosomes declared in "genome.txt"
-faidx (names.txt) Sort according to the chromosomes declared in "names.txt"
-header Print the header from the A file prior to results.

34
src/bedtools/bedtools_sort/script.sh Normal file
View File

@@ -0,0 +1,34 @@
#!/bin/bash
## VIASH START
## VIASH END
# Unset parameters
unset_if_false=(
par_sizeA
par_sizeD
par_chrThenSizeA
par_chrThenSizeD
par_chrThenScoreA
par_chrThenScoreD
par_header
)
for par in ${unset_if_false[@]}; do
test_val="${!par}"
[[ "$test_val" == "false" ]] && unset $par
done
# Execute bedtools sort with the provided arguments
bedtools sort \
${par_sizeA:+-sizeA} \
${par_sizeD:+-sizeD} \
${par_chrThenSizeA:+-chrThenSizeA} \
${par_chrThenSizeD:+-chrThenSizeD} \
${par_chrThenScoreA:+-chrThenScoreA} \
${par_chrThenScoreD:+-chrThenScoreD} \
${par_genome:+-g "$par_genome"} \
${par_faidx:+-faidx "$par_faidx"} \
${par_header:+-header} \
-i "$par_input" \
> "$par_output"

Some files were not shown because too many files have changed in this diff Show More