Build branch main with version main (aa43543)

Build pipeline: viash-hub.biobox.main-2k68h Source commit: aa43543e1f Source message: Rseqc innerdistance (#159) * initial commit dedup * Revert "initial commit dedup" This reverts commit 38f586bec0ac9e4312b016e29c3aa0bd53f292b2. * full component with two tests * fix default values * adjust argument names and container image --------- Co-authored-by: Robrecht Cannoodt <rcannood@gmail.com>
2024-10-26 19:02:37 +00:00
parent 35f315e911
commit a7b0d33a32
366 changed files with 37009 additions and 780 deletions
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -4,26 +4,30 @@

 * `agat`:
  - `agat/agat_convert_genscan2gff`: convert a genscan file into a GFF file (PR #100).
-  - `agat_sp_statistics`: provides exhaustive statistics of a gft/gff file (PR #107).
-
+  - `agat/agat_sp_add_introns`: add intron features to gtf/gff file without intron features (PR #104).
+  - `agat/agat_sp_filter_feature_from_kill_list`: remove features in a GFF file based on a kill list (PR #105).
+  - `agat/agat_sp_merge_annotations`: merge different gff annotation files in one (PR #106).
+  - `agat/agat_sp_statistics`: provides exhaustive statistics of a gft/gff file (PR #107).

 * `bd_rhapsody/bd_rhapsody_sequence_analysis`: BD Rhapsody Sequence Analysis CWL pipeline (PR #96).

+* `bedtools`:
+   - `bedtools/bedtools_bamtobed`: Converts BAM alignments to BED6 or BEDPE format (PR #109).
+
 * `rsem/rsem_calculate_expression`: Calculate expression levels (PR #93).

+* `rseqc`:
+  - `rseqc/rseqc_inner_distance`: Calculate inner distance between read pairs (PR #159).
+  - `rseqc/rseqc_inferexperiment`: Infer strandedness from sequencing reads (PR #158).
+  - `rseqc/bam_stat`: Generate statistics from a bam file (PR #155).
+
 * `nanoplot`: Plotting tool for long read sequencing data and alignments (PR #95).

-* `agat`:
-  - `agat/agat_sp_add_introns`: add intron features to gtf/gff file without intron features (PR #104).
-
-
-## BREAKING CHANGES
+## BUG FIXES

 * `falco`: Fix a typo in the `--reverse_complement` argument (PR #157).

-## BUG FIXES
-
-* `cutadapt`: fix the the non-functional `action` parameter (PR #161).
+* `cutadapt`: Fix the the non-functional `action` parameter (PR #161).

 ## MINOR CHANGES

--- a/src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml
@@ -0,0 +1,105 @@
+name: agat_sp_filter_feature_from_kill_list
+namespace: agat
+description: |
+  Remove features based on a kill list. The default behaviour is to look at the features's ID. 
+  If the feature has an ID (case insensitive) listed among the kill list it will be removed.
+  Removing a level1 or level2 feature will automatically remove all linked subfeatures, and 
+  removing all children of a feature will automatically remove this feature too.
+keywords: [gene annotations, filtering, gff]
+links:
+  homepage: https://github.com/NBISweden/AGAT
+  documentation: https://agat.readthedocs.io/en/latest/tools/agat_sp_filter_feature_from_kill_list.html
+  issue_tracker: https://github.com/NBISweden/AGAT/issues
+  repository: https://github.com/NBISweden/AGAT
+references: 
+  doi: 10.5281/zenodo.3552717
+license: GPL-3.0
+requirements:
+  - commands: [agat]
+authors:
+  - __merge__: /src/_authors/leila_paquay.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --gff
+        alternatives: [-f, --ref, --reffile]
+        description: Input GFF3 file that will be read.
+        type: file
+        required: true
+      - name: --kill_list
+        alternatives: [--kl]
+        description: Text file containing the kill list. One value per line.
+        type: file
+        required: true
+        example: kill_list.txt
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: [-o, --out]
+        description: |
+          Path to the output GFF file that contains filtered features. 
+        type: file
+        direction: output
+        required: true
+  - name: Arguments
+    arguments:
+      - name: --type
+        alternatives: [-p, -l]
+        description: |
+          Primary tag option, case insensitive, list. Allow to specify the feature types that 
+          will be handled. 
+  
+          You can specify a specific feature by giving its primary tag name (column 3) as: 
+
+            * cds
+            * Gene
+            * mRNA
+            
+          You can specify directly all the feature of a particular
+          level: 
+
+            * level2=mRNA,ncRNA,tRNA,etc 
+            * level3=CDS,exon,UTR,etc. 
+          
+          By default all features are taken into account. Fill the option with the value "all" will 
+          have the same behaviour.
+        type: string
+        multiple: true
+      - name: --attribute
+        alternatives: [-a]
+        description: |
+          Attribute tag to specify the attribute to analyse. Case sensitive. Default: ID
+        type: string
+        example: ID
+      - name: --config
+        alternatives: [-c]
+        description: |
+          AGAT config file. By default AGAT takes the original agat_config.yaml shipped with AGAT.
+          The `--config` option gives you the possibility to use your own AGAT config file (located 
+          elsewhere or named differently).
+        type: file
+        example: custom_agat_config.yaml
+      - name: --verbose
+        alternatives: [-v]
+        description: Verbose option for debugging purpose.
+        type: boolean_true
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+engines:
+  - type: docker
+    image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
+    setup:
+      - type: docker
+        run: |
+          agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
+runners:
+  - type: executable
+  - type: nextflow
--- a/src/agat/agat_sp_filter_feature_from_kill_list/help.txt
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/help.txt
@@ -0,0 +1,85 @@
+```sh
+agat_sp_filter_feature_from_kill_list.pl --help
+```
+
+ ------------------------------------------------------------------------------
+|   Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0                      |
+|   https://github.com/NBISweden/AGAT                                          |
+|   National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se         |
+ ------------------------------------------------------------------------------
+
+
+Name:
+    agat_sp_filter_feature_from_kill_list.pl
+
+Description:
+    The script aims to remove features based on a kill list. The default
+    behaviour is to look at the features's ID. If the feature has an ID
+    (case insensitive) listed among the kill list it will be removed. /!\
+    Removing a level1 or level2 feature will automatically remove all linked
+    subfeatures, and removing all children of a feature will automatically
+    remove this feature too.
+
+Usage:
+        agat_sp_filter_feature_from_kill_list.pl --gff infile.gff --kill_list file.txt  [ --output outfile ]
+        agat_sp_filter_feature_from_kill_list.pl --help
+
+Options:
+    -f, --reffile, --gff or -ref
+            Input GFF3 file that will be read
+
+    -p, --type or -l
+            primary tag option, case insensitive, list. Allow to specied the
+            feature types that will be handled. You can specified a specific
+            feature by given its primary tag name (column 3) as: cds, Gene,
+            MrNa You can specify directly all the feature of a particular
+            level: level2=mRNA,ncRNA,tRNA,etc level3=CDS,exon,UTR,etc By
+            default all feature are taking into account. fill the option by
+            the value "all" will have the same behaviour.
+
+    --kl or --kill_list
+            Kill list. One value per line.
+
+    -a or --attribute
+            Attribute tag to specify the attribute to analyse. Case
+            sensitive. Default: ID
+
+    -o or --output
+            Output GFF file. If no output file is specified, the output will
+            be written to STDOUT.
+
+    -v      Verbose option for debugging purpose.
+
+    -c or --config
+            String - Input agat config file. By default AGAT takes as input
+            agat_config.yaml file from the working directory if any,
+            otherwise it takes the orignal agat_config.yaml shipped with
+            AGAT. To get the agat_config.yaml locally type: "agat config
+            --expose". The --config option gives you the possibility to use
+            your own AGAT config file (located elsewhere or named
+            differently).
+
+    -h or --help
+            Display this helpful text.
+
+Feedback:
+  Did you find a bug?:
+    Do not hesitate to report bugs to help us keep track of the bugs and
+    their resolution. Please use the GitHub issue tracking system available
+    at this address:
+
+                https://github.com/NBISweden/AGAT/issues
+
+     Ensure that the bug was not already reported by searching under Issues.
+     If you're unable to find an (open) issue addressing the problem, open a new one.
+     Try as much as possible to include in the issue when relevant:
+     - a clear description,
+     - as much relevant information as possible,
+     - the command used,
+     - a data sample,
+     - an explanation of the expected behaviour that is not occurring.
+
+  Do you want to contribute?:
+    You are very welcome, visit this address for the Contributing
+    guidelines:
+    https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md
--- a/src/agat/agat_sp_filter_feature_from_kill_list/script.sh
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/script.sh
@@ -0,0 +1,22 @@
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+## VIASH END
+
+# unset flags
+[[ "$par_verbose" == "false" ]] && unset par_verbose
+
+# convert par_type to comma separated list
+par_type=$(echo $par_type | tr ';' ',')
+
+# run agat_sp_filter_feature_from_kill_list
+agat_sp_filter_feature_from_kill_list.pl \
+  --gff "$par_gff" \
+  --kill_list "$par_kill_list" \
+  --output "$par_output" \
+  ${par_type:+--type "${par_type}"} \
+  ${par_attribute:+--attribute "${par_attribute}"} \
+  ${par_config:+--config "${par_config}"} \
+  ${par_verbose:+-v}
--- a/src/agat/agat_sp_filter_feature_from_kill_list/test.sh
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test.sh
@@ -0,0 +1,36 @@
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+## VIASH END
+
+test_dir="${meta_resources_dir}/test_data"
+
+# create temporary directory and clean up on exit
+TMPDIR=$(mktemp -d "$meta_temp_dir/$meta_functionality_name-XXXXXX")
+function clean_up {
+ [[ -d "$TMPDIR" ]] && rm -rf "$TMPDIR"
+}
+#trap clean_up EXIT
+
+echo "> Run $meta_name with test data"
+"$meta_executable" \
+  --gff "$test_dir/1_truncated.gff" \
+  --kill_list "$test_dir/kill_list.txt" \
+  --output "$TMPDIR/output.gff" 
+
+echo ">> Checking output"
+[ ! -f "$TMPDIR/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
+
+echo ">> Check if output is empty"
+[ ! -s "$TMPDIR/output.gff" ] && echo "Output file output.gff is empty" && exit 1
+
+echo ">> Check if output matches expected output"
+diff "$TMPDIR/output.gff" "$test_dir/test_output.gff"
+if [ $? -ne 0 ]; then
+  echo "Output file output.gff does not match expected output"
+  exit 1
+fi
+
+echo "> Test successful"
--- a/src/agat/agat_sp_filter_feature_from_kill_list/test_data/1_truncated.gff
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/1_truncated.gff
@@ -0,0 +1,123 @@
+##gff-version 3
+##sequence-region   1 1 43270923
+#!genome-build RAP-DB IRGSP-1.0
+#!genome-version IRGSP-1.0
+#!genome-date 2015-10
+#!genome-build-accession GCA_001433935.1
+1	RAP-DB	chromosome	1	43270923	.	.	.	ID=chromosome:1;Alias=Chr1,AP014957.1,NC_029256.1
+###
+1	irgsp	repeat_region	2000	2100	.	+	.	ID=fakeRepeat1
+###
+1	irgsp	gene	2983	10815	.	+	.	ID=gene:Os01g0100100;biotype=protein_coding;description=RabGAP/TBC domain containing protein. (Os01t0100100-01);gene_id=Os01g0100100;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	2983	10815	.	+	.	ID=transcript:Os01t0100100-01;Parent=gene:Os01g0100100;biotype=protein_coding;transcript_id=Os01t0100100-01
+1	irgsp	exon	2983	3268	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon1;rank=1
+1	irgsp	five_prime_UTR	2983	3268	.	+	.	Parent=transcript:Os01t0100100-01
+1	irgsp	five_prime_UTR	3354	3448	.	+	.	Parent=transcript:Os01t0100100-01
+1	irgsp	exon	3354	3616	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100100-01.exon2;rank=2
+1	irgsp	CDS	3449	3616	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	4357	4455	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon3;rank=3
+1	irgsp	CDS	4357	4455	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	5457	5560	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100100-01.exon4;rank=4
+1	irgsp	CDS	5457	5560	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	7136	7944	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100100-01.exon5;rank=5
+1	irgsp	CDS	7136	7944	.	+	1	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	8028	8150	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon6;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100100-01.exon6;rank=6
+1	irgsp	CDS	8028	8150	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	8232	8320	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon7;rank=7
+1	irgsp	CDS	8232	8320	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	8408	8608	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon8;rank=8
+1	irgsp	CDS	8408	8608	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	9210	9615	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon9;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100100-01.exon9;rank=9
+1	irgsp	CDS	9210	9615	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	10102	10187	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon10;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon10;rank=10
+1	irgsp	CDS	10102	10187	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	10274	10297	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	exon	10274	10430	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon11;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100100-01.exon11;rank=11
+1	irgsp	three_prime_UTR	10298	10430	.	+	.	Parent=transcript:Os01t0100100-01
+1	irgsp	exon	10504	10815	.	+	.	Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon12;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon12;rank=12
+1	irgsp	three_prime_UTR	10504	10815	.	+	.	Parent=transcript:Os01t0100100-01
+###
+1	irgsp	gene	11218	12435	.	+	.	ID=gene:Os01g0100200;biotype=protein_coding;description=Conserved hypothetical protein. (Os01t0100200-01);gene_id=Os01g0100200;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	11218	12435	.	+	.	ID=transcript:Os01t0100200-01;Parent=gene:Os01g0100200;biotype=protein_coding;transcript_id=Os01t0100200-01
+1	irgsp	five_prime_UTR	11218	11797	.	+	.	Parent=transcript:Os01t0100200-01
+1	irgsp	exon	11218	12060	.	+	.	Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100200-01.exon1;rank=1
+1	irgsp	CDS	11798	12060	.	+	0	ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
+1	irgsp	CDS	12152	12317	.	+	1	ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
+1	irgsp	exon	12152	12435	.	+	.	Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100200-01.exon2;rank=2
+1	irgsp	three_prime_UTR	12318	12435	.	+	.	Parent=transcript:Os01t0100200-01
+###
+1	irgsp	gene	11372	12284	.	-	.	ID=gene:Os01g0100300;biotype=protein_coding;description=Cytochrome P450 domain containing protein. (Os01t0100300-00);gene_id=Os01g0100300;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	11372	12284	.	-	.	ID=transcript:Os01t0100300-00;Parent=gene:Os01g0100300;biotype=protein_coding;transcript_id=Os01t0100300-00
+1	irgsp	exon	11372	12042	.	-	.	Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100300-00.exon2;rank=2
+1	irgsp	CDS	11372	12042	.	-	2	ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
+1	irgsp	exon	12146	12284	.	-	.	Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon1;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100300-00.exon1;rank=1
+1	irgsp	CDS	12146	12284	.	-	0	ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
+###
+1	irgsp	gene	12721	15685	.	+	.	ID=gene:Os01g0100400;biotype=protein_coding;description=Similar to Pectinesterase-like protein. (Os01t0100400-01);gene_id=Os01g0100400;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	12721	15685	.	+	.	ID=transcript:Os01t0100400-01;Parent=gene:Os01g0100400;biotype=protein_coding;transcript_id=Os01t0100400-01
+1	irgsp	five_prime_UTR	12721	12773	.	+	.	Parent=transcript:Os01t0100400-01
+1	irgsp	exon	12721	13813	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100400-01.exon1;rank=1
+1	irgsp	CDS	12774	13813	.	+	0	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	exon	13906	14271	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100400-01.exon2;rank=2
+1	irgsp	CDS	13906	14271	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	exon	14359	14437	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0100400-01.exon3;rank=3
+1	irgsp	CDS	14359	14437	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	exon	14969	15171	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100400-01.exon4;rank=4
+1	irgsp	CDS	14969	15171	.	+	0	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	15266	15359	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	exon	15266	15685	.	+	.	Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon5;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100400-01.exon5;rank=5
+1	irgsp	three_prime_UTR	15360	15685	.	+	.	Parent=transcript:Os01t0100400-01
+###
+1	irgsp	gene	12808	13978	.	-	.	ID=gene:Os01g0100466;biotype=protein_coding;description=Hypothetical protein. (Os01t0100466-00);gene_id=Os01g0100466;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	12808	13978	.	-	.	ID=transcript:Os01t0100466-00;Parent=gene:Os01g0100466;biotype=protein_coding;transcript_id=Os01t0100466-00
+1	irgsp	three_prime_UTR	12808	12868	.	-	.	Parent=transcript:Os01t0100466-00
+1	irgsp	exon	12808	13782	.	-	.	Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon2;rank=2
+1	irgsp	CDS	12869	13102	.	-	0	ID=CDS:Os01t0100466-00;Parent=transcript:Os01t0100466-00;protein_id=Os01t0100466-00
+1	irgsp	five_prime_UTR	13103	13782	.	-	.	Parent=transcript:Os01t0100466-00
+1	irgsp	exon	13880	13978	.	-	.	Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon1;rank=1
+1	irgsp	five_prime_UTR	13880	13978	.	-	.	Parent=transcript:Os01t0100466-00
+###
+1	irgsp	gene	16399	20144	.	+	.	ID=gene:Os01g0100500;biotype=protein_coding;description=Immunoglobulin-like domain containing protein. (Os01t0100500-01);gene_id=Os01g0100500;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	16399	20144	.	+	.	ID=transcript:Os01t0100500-01;Parent=gene:Os01g0100500;biotype=protein_coding;transcript_id=Os01t0100500-01
+1	irgsp	five_prime_UTR	16399	16598	.	+	.	Parent=transcript:Os01t0100500-01
+1	irgsp	exon	16399	16976	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100500-01.exon1;rank=1
+1	irgsp	CDS	16599	16976	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	17383	17474	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100500-01.exon2;rank=2
+1	irgsp	CDS	17383	17474	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	17558	18258	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100500-01.exon3;rank=3
+1	irgsp	CDS	17558	18258	.	+	1	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	18501	18571	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100500-01.exon4;rank=4
+1	irgsp	CDS	18501	18571	.	+	2	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	18968	19057	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon5;rank=5
+1	irgsp	CDS	18968	19057	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	19142	19321	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon6;rank=6
+1	irgsp	CDS	19142	19321	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	19531	19593	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	exon	19531	19629	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100500-01.exon7;rank=7
+1	irgsp	three_prime_UTR	19594	19629	.	+	.	Parent=transcript:Os01t0100500-01
+1	irgsp	exon	19734	20144	.	+	.	Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon8;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100500-01.exon8;rank=8
+1	irgsp	three_prime_UTR	19734	20144	.	+	.	Parent=transcript:Os01t0100500-01
+###
+1	irgsp	gene	22841	26892	.	+	.	ID=gene:Os01g0100600;biotype=protein_coding;description=Single-stranded nucleic acid binding R3H domain containing protein. (Os01t0100600-01);gene_id=Os01g0100600;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	22841	26892	.	+	.	ID=transcript:Os01t0100600-01;Parent=gene:Os01g0100600;biotype=protein_coding;transcript_id=Os01t0100600-01
+1	irgsp	five_prime_UTR	22841	23231	.	+	.	Parent=transcript:Os01t0100600-01
+1	irgsp	exon	22841	23281	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100600-01.exon1;rank=1
+1	irgsp	CDS	23232	23281	.	+	0	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	23572	23847	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon2;rank=2
+1	irgsp	CDS	23572	23847	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	23962	24033	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon3;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon3;rank=3
+1	irgsp	CDS	23962	24033	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	24492	24577	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon4;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100600-01.exon4;rank=4
+1	irgsp	CDS	24492	24577	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	25445	25519	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100600-01.exon5;rank=5
+1	irgsp	CDS	25445	25519	.	+	2	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	25883	26391	.	+	2	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	exon	25883	26892	.	+	.	Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon6;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0100600-01.exon6;rank=6
+1	irgsp	three_prime_UTR	26392	26892	.	+	.	Parent=transcript:Os01t0100600-01
+###
+1	irgsp	gene	25861	26424	.	-	.	ID=gene:Os01g0100650;biotype=protein_coding;description=Hypothetical gene. (Os01t0100650-00);gene_id=Os01g0100650;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	25861	26424	.	-	.	ID=transcript:Os01t0100650-00;Parent=gene:Os01g0100650;biotype=protein_coding;transcript_id=Os01t0100650-00
+1	irgsp	three_prime_UTR	25861	26039	.	-	.	Parent=transcript:Os01t0100650-00
+1	irgsp	exon	25861	26424	.	-	.	Parent=transcript:Os01t0100650-00;Name=Os01t0100650-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100650-00.exon1;rank=1
+1	irgsp	CDS	26040	26423	.	-	0	ID=CDS:Os01t0100650-00;Parent=transcript:Os01t0100650-00;protein_id=Os01t0100650-00
+1	irgsp	five_prime_UTR	26424	26424	.	-	.	Parent=transcript:Os01t0100650-00
--- a/src/agat/agat_sp_filter_feature_from_kill_list/test_data/kill_list.txt
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/kill_list.txt
@@ -0,0 +1,3 @@
+gene:Os01g0100700
+CDS:Os01t0100650-00
+transcript:Os01t0102700-01
--- a/src/agat/agat_sp_filter_feature_from_kill_list/test_data/script.sh
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/script.sh
@@ -0,0 +1,13 @@
+#!/bin/bash
+
+# clone repo
+if [ ! -d /tmp/agat_source ]; then
+  git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
+fi
+
+# copy test data
+cp -r /tmp/agat_source/t/scripts_output/in/1.gff src/agat/agat_sp_filter_feature_from_kill_list/test_data
+cp -r /tmp/agat_source/t/scripts_output/out/agat_sp_filter_feature_from_kill_list_1.gff src/agat/agat_sp_filter_feature_from_kill_list/test_data
+cp -r /tmp/agat_source/t/scripts_output/in/kill_list.txt src/agat/agat_sp_filter_feature_from_kill_list/test_data
+
+head -n 123 src/agat/agat_sp_filter_feature_from_kill_list/test_data/1.gff > src/agat/agat_sp_filter_feature_from_kill_list/test_data/1_truncated.gff
--- a/src/agat/agat_sp_filter_feature_from_kill_list/test_data/test_output.gff
+++ b/src/agat/agat_sp_filter_feature_from_kill_list/test_data/test_output.gff
@@ -0,0 +1,113 @@
+##gff-version 3
+##sequence-region   1 1 43270923
+#!genome-build RAP-DB IRGSP-1.0
+#!genome-version IRGSP-1.0
+#!genome-date 2015-10
+#!genome-build-accession GCA_001433935.1
+1	RAP-DB	chromosome	1	43270923	.	.	.	ID=chromosome:1;Alias=Chr1,AP014957.1,NC_029256.1
+1	irgsp	repeat_region	2000	2100	.	+	.	ID=fakeRepeat1
+1	irgsp	gene	2983	10815	.	+	.	ID=gene:Os01g0100100;biotype=protein_coding;description=RabGAP/TBC domain containing protein. (Os01t0100100-01);gene_id=Os01g0100100;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	2983	10815	.	+	.	ID=transcript:Os01t0100100-01;Parent=gene:Os01g0100100;biotype=protein_coding;transcript_id=Os01t0100100-01
+1	irgsp	exon	2983	3268	.	+	.	ID=Os01t0100100-01.exon1;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon1;rank=1
+1	irgsp	exon	3354	3616	.	+	.	ID=Os01t0100100-01.exon2;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100100-01.exon2;rank=2
+1	irgsp	exon	4357	4455	.	+	.	ID=Os01t0100100-01.exon3;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon3;rank=3
+1	irgsp	exon	5457	5560	.	+	.	ID=Os01t0100100-01.exon4;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100100-01.exon4;rank=4
+1	irgsp	exon	7136	7944	.	+	.	ID=Os01t0100100-01.exon5;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100100-01.exon5;rank=5
+1	irgsp	exon	8028	8150	.	+	.	ID=Os01t0100100-01.exon6;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon6;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100100-01.exon6;rank=6
+1	irgsp	exon	8232	8320	.	+	.	ID=Os01t0100100-01.exon7;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon7;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon7;rank=7
+1	irgsp	exon	8408	8608	.	+	.	ID=Os01t0100100-01.exon8;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon8;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100100-01.exon8;rank=8
+1	irgsp	exon	9210	9615	.	+	.	ID=Os01t0100100-01.exon9;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon9;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100100-01.exon9;rank=9
+1	irgsp	exon	10102	10187	.	+	.	ID=Os01t0100100-01.exon10;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon10;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100100-01.exon10;rank=10
+1	irgsp	exon	10274	10430	.	+	.	ID=Os01t0100100-01.exon11;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon11;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100100-01.exon11;rank=11
+1	irgsp	exon	10504	10815	.	+	.	ID=Os01t0100100-01.exon12;Parent=transcript:Os01t0100100-01;Name=Os01t0100100-01.exon12;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100100-01.exon12;rank=12
+1	irgsp	CDS	3449	3616	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	4357	4455	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	5457	5560	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	7136	7944	.	+	1	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	8028	8150	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	8232	8320	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	8408	8608	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	9210	9615	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	10102	10187	.	+	2	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	CDS	10274	10297	.	+	0	ID=CDS:Os01t0100100-01;Parent=transcript:Os01t0100100-01;protein_id=Os01t0100100-01
+1	irgsp	five_prime_UTR	2983	3268	.	+	.	ID=agat-five_prime_utr-1;Parent=transcript:Os01t0100100-01
+1	irgsp	five_prime_UTR	3354	3448	.	+	.	ID=agat-five_prime_utr-2;Parent=transcript:Os01t0100100-01
+1	irgsp	three_prime_UTR	10298	10430	.	+	.	ID=agat-three_prime_utr-1;Parent=transcript:Os01t0100100-01
+1	irgsp	three_prime_UTR	10504	10815	.	+	.	ID=agat-three_prime_utr-2;Parent=transcript:Os01t0100100-01
+1	irgsp	gene	11218	12435	.	+	.	ID=gene:Os01g0100200;biotype=protein_coding;description=Conserved hypothetical protein. (Os01t0100200-01);gene_id=Os01g0100200;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	11218	12435	.	+	.	ID=transcript:Os01t0100200-01;Parent=gene:Os01g0100200;biotype=protein_coding;transcript_id=Os01t0100200-01
+1	irgsp	exon	11218	12060	.	+	.	ID=Os01t0100200-01.exon1;Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100200-01.exon1;rank=1
+1	irgsp	exon	12152	12435	.	+	.	ID=Os01t0100200-01.exon2;Parent=transcript:Os01t0100200-01;Name=Os01t0100200-01.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100200-01.exon2;rank=2
+1	irgsp	CDS	11798	12060	.	+	0	ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
+1	irgsp	CDS	12152	12317	.	+	1	ID=CDS:Os01t0100200-01;Parent=transcript:Os01t0100200-01;protein_id=Os01t0100200-01
+1	irgsp	five_prime_UTR	11218	11797	.	+	.	ID=agat-five_prime_utr-3;Parent=transcript:Os01t0100200-01
+1	irgsp	three_prime_UTR	12318	12435	.	+	.	ID=agat-three_prime_utr-3;Parent=transcript:Os01t0100200-01
+1	irgsp	gene	11372	12284	.	-	.	ID=gene:Os01g0100300;biotype=protein_coding;description=Cytochrome P450 domain containing protein. (Os01t0100300-00);gene_id=Os01g0100300;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	11372	12284	.	-	.	ID=transcript:Os01t0100300-00;Parent=gene:Os01g0100300;biotype=protein_coding;transcript_id=Os01t0100300-00
+1	irgsp	exon	11372	12042	.	-	.	ID=Os01t0100300-00.exon2;Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon2;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100300-00.exon2;rank=2
+1	irgsp	exon	12146	12284	.	-	.	ID=Os01t0100300-00.exon1;Parent=transcript:Os01t0100300-00;Name=Os01t0100300-00.exon1;constitutive=1;ensembl_end_phase=1;ensembl_phase=0;exon_id=Os01t0100300-00.exon1;rank=1
+1	irgsp	CDS	11372	12042	.	-	2	ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
+1	irgsp	CDS	12146	12284	.	-	0	ID=CDS:Os01t0100300-00;Parent=transcript:Os01t0100300-00;protein_id=Os01t0100300-00
+1	irgsp	gene	12721	15685	.	+	.	ID=gene:Os01g0100400;biotype=protein_coding;description=Similar to Pectinesterase-like protein. (Os01t0100400-01);gene_id=Os01g0100400;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	12721	15685	.	+	.	ID=transcript:Os01t0100400-01;Parent=gene:Os01g0100400;biotype=protein_coding;transcript_id=Os01t0100400-01
+1	irgsp	exon	12721	13813	.	+	.	ID=Os01t0100400-01.exon1;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100400-01.exon1;rank=1
+1	irgsp	exon	13906	14271	.	+	.	ID=Os01t0100400-01.exon2;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100400-01.exon2;rank=2
+1	irgsp	exon	14359	14437	.	+	.	ID=Os01t0100400-01.exon3;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon3;constitutive=1;ensembl_end_phase=0;ensembl_phase=2;exon_id=Os01t0100400-01.exon3;rank=3
+1	irgsp	exon	14969	15171	.	+	.	ID=Os01t0100400-01.exon4;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon4;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100400-01.exon4;rank=4
+1	irgsp	exon	15266	15685	.	+	.	ID=Os01t0100400-01.exon5;Parent=transcript:Os01t0100400-01;Name=Os01t0100400-01.exon5;constitutive=1;ensembl_end_phase=-1;ensembl_phase=2;exon_id=Os01t0100400-01.exon5;rank=5
+1	irgsp	CDS	12774	13813	.	+	0	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	13906	14271	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	14359	14437	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	14969	15171	.	+	0	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	CDS	15266	15359	.	+	1	ID=CDS:Os01t0100400-01;Parent=transcript:Os01t0100400-01;protein_id=Os01t0100400-01
+1	irgsp	five_prime_UTR	12721	12773	.	+	.	ID=agat-five_prime_utr-4;Parent=transcript:Os01t0100400-01
+1	irgsp	three_prime_UTR	15360	15685	.	+	.	ID=agat-three_prime_utr-4;Parent=transcript:Os01t0100400-01
+1	irgsp	gene	12808	13978	.	-	.	ID=gene:Os01g0100466;biotype=protein_coding;description=Hypothetical protein. (Os01t0100466-00);gene_id=Os01g0100466;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	12808	13978	.	-	.	ID=transcript:Os01t0100466-00;Parent=gene:Os01g0100466;biotype=protein_coding;transcript_id=Os01t0100466-00
+1	irgsp	exon	12808	13782	.	-	.	ID=Os01t0100466-00.exon2;Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon2;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon2;rank=2
+1	irgsp	exon	13880	13978	.	-	.	ID=Os01t0100466-00.exon1;Parent=transcript:Os01t0100466-00;Name=Os01t0100466-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100466-00.exon1;rank=1
+1	irgsp	CDS	12869	13102	.	-	0	ID=CDS:Os01t0100466-00;Parent=transcript:Os01t0100466-00;protein_id=Os01t0100466-00
+1	irgsp	five_prime_UTR	13103	13782	.	-	.	ID=agat-five_prime_utr-5;Parent=transcript:Os01t0100466-00
+1	irgsp	five_prime_UTR	13880	13978	.	-	.	ID=agat-five_prime_utr-6;Parent=transcript:Os01t0100466-00
+1	irgsp	three_prime_UTR	12808	12868	.	-	.	ID=agat-three_prime_utr-5;Parent=transcript:Os01t0100466-00
+1	irgsp	gene	16399	20144	.	+	.	ID=gene:Os01g0100500;biotype=protein_coding;description=Immunoglobulin-like domain containing protein. (Os01t0100500-01);gene_id=Os01g0100500;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	16399	20144	.	+	.	ID=transcript:Os01t0100500-01;Parent=gene:Os01g0100500;biotype=protein_coding;transcript_id=Os01t0100500-01
+1	irgsp	exon	16399	16976	.	+	.	ID=Os01t0100500-01.exon1;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon1;constitutive=1;ensembl_end_phase=0;ensembl_phase=-1;exon_id=Os01t0100500-01.exon1;rank=1
+1	irgsp	exon	17383	17474	.	+	.	ID=Os01t0100500-01.exon2;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=0;exon_id=Os01t0100500-01.exon2;rank=2
+1	irgsp	exon	17558	18258	.	+	.	ID=Os01t0100500-01.exon3;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon3;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100500-01.exon3;rank=3
+1	irgsp	exon	18501	18571	.	+	.	ID=Os01t0100500-01.exon4;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon4;constitutive=1;ensembl_end_phase=0;ensembl_phase=1;exon_id=Os01t0100500-01.exon4;rank=4
+1	irgsp	exon	18968	19057	.	+	.	ID=Os01t0100500-01.exon5;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon5;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon5;rank=5
+1	irgsp	exon	19142	19321	.	+	.	ID=Os01t0100500-01.exon6;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon6;constitutive=1;ensembl_end_phase=0;ensembl_phase=0;exon_id=Os01t0100500-01.exon6;rank=6
+1	irgsp	exon	19531	19629	.	+	.	ID=Os01t0100500-01.exon7;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon7;constitutive=1;ensembl_end_phase=-1;ensembl_phase=0;exon_id=Os01t0100500-01.exon7;rank=7
+1	irgsp	exon	19734	20144	.	+	.	ID=Os01t0100500-01.exon8;Parent=transcript:Os01t0100500-01;Name=Os01t0100500-01.exon8;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100500-01.exon8;rank=8
+1	irgsp	CDS	16599	16976	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	17383	17474	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	17558	18258	.	+	1	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	18501	18571	.	+	2	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	18968	19057	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	19142	19321	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	CDS	19531	19593	.	+	0	ID=CDS:Os01t0100500-01;Parent=transcript:Os01t0100500-01;protein_id=Os01t0100500-01
+1	irgsp	five_prime_UTR	16399	16598	.	+	.	ID=agat-five_prime_utr-7;Parent=transcript:Os01t0100500-01
+1	irgsp	three_prime_UTR	19594	19629	.	+	.	ID=agat-three_prime_utr-6;Parent=transcript:Os01t0100500-01
+1	irgsp	three_prime_UTR	19734	20144	.	+	.	ID=agat-three_prime_utr-7;Parent=transcript:Os01t0100500-01
+1	irgsp	gene	22841	26892	.	+	.	ID=gene:Os01g0100600;biotype=protein_coding;description=Single-stranded nucleic acid binding R3H domain containing protein. (Os01t0100600-01);gene_id=Os01g0100600;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	22841	26892	.	+	.	ID=transcript:Os01t0100600-01;Parent=gene:Os01g0100600;biotype=protein_coding;transcript_id=Os01t0100600-01
+1	irgsp	exon	22841	23281	.	+	.	ID=Os01t0100600-01.exon1;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon1;constitutive=1;ensembl_end_phase=2;ensembl_phase=-1;exon_id=Os01t0100600-01.exon1;rank=1
+1	irgsp	exon	23572	23847	.	+	.	ID=Os01t0100600-01.exon2;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon2;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon2;rank=2
+1	irgsp	exon	23962	24033	.	+	.	ID=Os01t0100600-01.exon3;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon3;constitutive=1;ensembl_end_phase=2;ensembl_phase=2;exon_id=Os01t0100600-01.exon3;rank=3
+1	irgsp	exon	24492	24577	.	+	.	ID=Os01t0100600-01.exon4;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon4;constitutive=1;ensembl_end_phase=1;ensembl_phase=2;exon_id=Os01t0100600-01.exon4;rank=4
+1	irgsp	exon	25445	25519	.	+	.	ID=Os01t0100600-01.exon5;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon5;constitutive=1;ensembl_end_phase=1;ensembl_phase=1;exon_id=Os01t0100600-01.exon5;rank=5
+1	irgsp	exon	25883	26892	.	+	.	ID=Os01t0100600-01.exon6;Parent=transcript:Os01t0100600-01;Name=Os01t0100600-01.exon6;constitutive=1;ensembl_end_phase=-1;ensembl_phase=1;exon_id=Os01t0100600-01.exon6;rank=6
+1	irgsp	CDS	23232	23281	.	+	0	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	23572	23847	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	23962	24033	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	24492	24577	.	+	1	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	25445	25519	.	+	2	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	CDS	25883	26391	.	+	2	ID=CDS:Os01t0100600-01;Parent=transcript:Os01t0100600-01;protein_id=Os01t0100600-01
+1	irgsp	five_prime_UTR	22841	23231	.	+	.	ID=agat-five_prime_utr-8;Parent=transcript:Os01t0100600-01
+1	irgsp	three_prime_UTR	26392	26892	.	+	.	ID=agat-three_prime_utr-8;Parent=transcript:Os01t0100600-01
+1	irgsp	gene	25861	26424	.	-	.	ID=gene:Os01g0100650;biotype=protein_coding;description=Hypothetical gene. (Os01t0100650-00);gene_id=Os01g0100650;logic_name=irgspv1.0-20170804-genes
+1	irgsp	mRNA	25861	26424	.	-	.	ID=transcript:Os01t0100650-00;Parent=gene:Os01g0100650;biotype=protein_coding;transcript_id=Os01t0100650-00
+1	irgsp	exon	25861	26424	.	-	.	ID=Os01t0100650-00.exon1;Parent=transcript:Os01t0100650-00;Name=Os01t0100650-00.exon1;constitutive=1;ensembl_end_phase=-1;ensembl_phase=-1;exon_id=Os01t0100650-00.exon1;rank=1
+1	irgsp	five_prime_UTR	26424	26424	.	-	.	ID=agat-five_prime_utr-9;Parent=transcript:Os01t0100650-00
+1	irgsp	three_prime_UTR	25861	26039	.	-	.	ID=agat-three_prime_utr-9;Parent=transcript:Os01t0100650-00
--- a/src/agat/agat_sp_merge_annotations/config.vsh.yaml
+++ b/src/agat/agat_sp_merge_annotations/config.vsh.yaml
@@ -0,0 +1,67 @@
+name: agat_sp_merge_annotations
+namespace: agat
+description: |
+  Merge different gff annotation files into one. It uses the AGAT parser that takes care of
+  duplicated names and fixes other oddities met in those files.
+keywords: [gene annotations, merge, gff]
+links:
+  homepage: https://github.com/NBISweden/AGAT
+  documentation: https://agat.readthedocs.io/en/latest/tools/agat_sp_merge_annotations.html
+  issue_tracker: https://github.com/NBISweden/AGAT/issues
+  repository: https://github.com/NBISweden/AGAT
+references: 
+  doi: 10.5281/zenodo.3552717
+license: GPL-3.0
+requirements:
+  commands: [agat]
+authors:
+  - __merge__: /src/_authors/leila_paquay.yaml
+    roles: [ author, maintainer ]
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --gff
+        alternatives: [-f]
+        description: |
+          Input GTF/GFF file(s).
+        type: file
+        multiple: true
+        required: true
+        example: input1.gff;input2.gff
+  - name: Outputs
+    arguments:       
+      - name: --output
+        alternatives: [-o, --out]
+        description: Output gff3 file where the gene incriminated will be writen.
+        type: file
+        direction: output
+        required: true
+        example: output.gff
+  - name: Arguments
+    arguments:
+      - name: --config
+        alternatives: [-c]
+        description: |
+          AGAT config file. By default AGAT takes the original agat_config.yaml shipped with AGAT. 
+          The `--config` option gives you the possibility to use your own AGAT config file (located
+          elsewhere or named differently).
+        type: file
+        example: custom_agat_config.yaml
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+engines:
+  - type: docker
+    image: quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0
+    setup:
+      - type: docker
+        run: |
+          agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.txt
+runners:
+  - type: executable
+  - type: nextflow
--- a/src/agat/agat_sp_merge_annotations/help.txt
+++ b/src/agat/agat_sp_merge_annotations/help.txt
@@ -0,0 +1,64 @@
+```sh
+agat_sp_merge_annotations.pl --help
+```
+ 
+  ------------------------------------------------------------------------------
+|   Another GFF Analysis Toolkit (AGAT) - Version: v1.4.0                      |
+|   https://github.com/NBISweden/AGAT                                          |
+|   National Bioinformatics Infrastructure Sweden (NBIS) - www.nbis.se         |
+ ------------------------------------------------------------------------------
+
+
+Name:
+    agat_sp_merge_annotations.pl
+
+Description:
+    This script merge different gff annotation files in one. It uses the
+    AGAT parser that takes care of duplicated names and fixes other oddities
+    met in those files.
+
+Usage:
+        agat_sp_merge_annotations.pl --gff infile1 --gff infile2 --out outFile
+        agat_sp_merge_annotations.pl --help
+
+Options:
+    --gff or -f
+            Input GTF/GFF file(s). You can specify as much file you want
+            like so: -f file1 -f file2 -f file3
+
+    --out, --output or -o
+            Output gff3 file where the gene incriminated will be write.
+
+    -c or --config
+            String - Input agat config file. By default AGAT takes as input
+            agat_config.yaml file from the working directory if any,
+            otherwise it takes the orignal agat_config.yaml shipped with
+            AGAT. To get the agat_config.yaml locally type: "agat config
+            --expose". The --config option gives you the possibility to use
+            your own AGAT config file (located elsewhere or named
+            differently).
+
+    --help or -h
+            Display this helpful text.
+
+Feedback:
+  Did you find a bug?:
+    Do not hesitate to report bugs to help us keep track of the bugs and
+    their resolution. Please use the GitHub issue tracking system available
+    at this address:
+
+                https://github.com/NBISweden/AGAT/issues
+
+     Ensure that the bug was not already reported by searching under Issues.
+     If you're unable to find an (open) issue addressing the problem, open a new one.
+     Try as much as possible to include in the issue when relevant:
+     - a clear description,
+     - as much relevant information as possible,
+     - the command used,
+     - a data sample,
+     - an explanation of the expected behaviour that is not occurring.
+
+  Do you want to contribute?:
+    You are very welcome, visit this address for the Contributing
+    guidelines:
+    https://github.com/NBISweden/AGAT/blob/master/CONTRIBUTING.md
--- a/src/agat/agat_sp_merge_annotations/script.sh
+++ b/src/agat/agat_sp_merge_annotations/script.sh
@@ -0,0 +1,19 @@
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+## VIASH END
+
+# Convert a list of file names to multiple -gff arguments
+input_files=""
+IFS=";" read -ra file_names <<< "$par_gff"
+for file in "${file_names[@]}"; do
+    input_files+="--gff $file "
+done
+
+# run agat_sp_merge_annotations
+agat_sp_merge_annotations.pl \
+  $input_files \
+  -o "$par_output" \
+  ${par_config:+--config "${par_config}"}
--- a/src/agat/agat_sp_merge_annotations/test.sh
+++ b/src/agat/agat_sp_merge_annotations/test.sh
@@ -0,0 +1,56 @@
+#!/bin/bash
+
+set -eo pipefail
+
+## VIASH START
+## VIASH END
+
+test_dir="${meta_resources_dir}/test_data"
+
+# create temporary directory and clean up on exit
+TMPDIR=$(mktemp -d "$meta_temp_dir/$meta_functionality_name-XXXXXX")
+function clean_up {
+ [[ -d "$TMPDIR" ]] && rm -rf "$TMPDIR"
+}
+trap clean_up EXIT
+
+echo "> Run $meta_name with test data 1"
+"$meta_executable" \
+  --gff "$test_dir/file1.gff;$test_dir/file2.gff" \
+  --output "$TMPDIR/output.gff"
+
+echo ">> Checking output"
+[ ! -f "$TMPDIR/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
+
+echo ">> Check if output is empty"
+[ ! -s "$TMPDIR/output.gff" ] && echo "Output file output.gff is empty" && exit 1
+
+echo ">> Check if output matches expected output"
+diff "$TMPDIR/output.gff" "$test_dir/agat_sp_merge_annotations_1.gff"
+if [ $? -ne 0 ]; then
+  echo "Output file output.gff does not match expected output"
+  exit 1
+fi
+
+echo ">> cleanup"
+rm -rf "$TMPDIR/output.gff"
+
+echo "> Run $meta_name with test data 2"
+"$meta_executable" \
+  --gff "$test_dir/fileA.gff;$test_dir/fileB.gff" \
+  --output "$TMPDIR/output.gff"
+
+echo ">> Checking output"
+[ ! -f "$TMPDIR/output.gff" ] && echo "Output file output.gff does not exist" && exit 1
+
+echo ">> Check if output is empty"
+[ ! -s "$TMPDIR/output.gff" ] && echo "Output file output.gff is empty" && exit 1
+
+echo ">> Check if output matches expected output"
+diff "$TMPDIR/output.gff" "$test_dir/agat_sp_merge_annotations_2.gff"
+if [ $? -ne 0 ]; then
+  echo "Output file output.gff does not match expected output"
+  exit 1
+fi
+
+echo "> Test successful"
--- a/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_1.gff
+++ b/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_1.gff
@@ -0,0 +1,13 @@
+##gff-version 3
+chr10	BestRefSeq	gene	123237824	123357992	.	-	.	ID=gene-FGFR2;ontology=G0222
+chr10	BestRefSeq	mRNA	123237824	123357992	.	-	.	ID=rna-NM_022970.3;Parent=gene-FGFR2;ontology=G0222;merged_ID=IDmodified-mrna-1;merged_Ontology=G0333;merged_Parent=IDmodified-gene-1
+chr10	BestRefSeq	exon	123237824	123239535	.	-	.	ID=exon-NM_022970.3-18;Parent=rna-NM_022970.3
+chr10	BestRefSeq	exon	123243212	123243317	.	-	.	ID=exon-NM_022970.3-17;Parent=rna-NM_022970.3
+chr10	BestRefSeq	exon	123353223	123353481	.	-	.	ID=exon-NM_022970.3-2;Parent=rna-NM_022970.3
+chr10	BestRefSeq	exon	123357476	123357992	.	-	.	ID=exon-NM_022970.3-1;Parent=rna-NM_022970.3
+chr10	BestRefSeq	CDS	123239371	123239535	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3
+chr10	BestRefSeq	CDS	123243212	123243317	.	-	1	ID=cds-NP_075259.4;Parent=rna-NM_022970.3
+chr10	BestRefSeq	CDS	123353223	123353331	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3
+chr10	BestRefSeq	five_prime_UTR	123353332	123353481	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3
+chr10	BestRefSeq	five_prime_UTR	123357476	123357992	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3
+chr10	BestRefSeq	three_prime_UTR	123237824	123239370	.	-	.	ID=agat-three_prime_utr-54427;Parent=rna-NM_022970.3
--- a/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_2.gff
+++ b/src/agat/agat_sp_merge_annotations/test_data/agat_sp_merge_annotations_2.gff
@@ -0,0 +1,3 @@
+##gff-version 3
+chr1	AUGUSTUS	gene	1000424	1039237	.	+	.	ID=A
+chr1	AUGUSTUS	mRNA	1000424	1039237	.	+	.	ID=A.t1;Parent=A;merged_ID=B.t1;merged_Parent=B
--- a/src/agat/agat_sp_merge_annotations/test_data/file1.gff
+++ b/src/agat/agat_sp_merge_annotations/test_data/file1.gff
@@ -0,0 +1,14 @@
+chr10	BestRefSeq	gene	123237824	123357992	.	-	.	ID=gene-FGFR2;Ontology=G0222;
+chr10	BestRefSeq	mRNA	123237824	123357992	.	-	.	ID=rna-NM_022970.3;Parent=gene-FGFR2;Ontology=G0222;
+chr10	BestRefSeq	exon	123237824	123239535	.	-	.	ID=exon-NM_022970.3-18;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123243212	123243317	.	-	.	ID=exon-NM_022970.3-17;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123353223	123353481	.	-	.	ID=exon-NM_022970.3-2;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123357476	123357992	.	-	.	ID=exon-NM_022970.3-1;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123239371	123239535	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123243212	123243317	.	-	1	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123353223	123353331	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	five_prime_UTR	123353332	123353481	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	five_prime_UTR	123357476	123357992	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	three_prime_UTR	123237824	123239370	.	-	.	ID=agat-three_prime_utr-54427;Parent=rna-NM_022970.3;
+
+	
--- a/src/agat/agat_sp_merge_annotations/test_data/file2.gff
+++ b/src/agat/agat_sp_merge_annotations/test_data/file2.gff
@@ -0,0 +1,12 @@
+chr10	BestRefSeq	gene	123237824	123357992	.	-	.	ID=gene-FGFR2;Ontology=G0222;
+chr10	BestRefSeq	mRNA	123237824	123357992	.	-	.	ID=rna-NM_022970.3;Parent=gene-FGFR2;Ontology=G0333;
+chr10	BestRefSeq	exon	123237824	123239535	.	-	.	ID=exon-NM_022970.3-18;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123243212	123243317	.	-	.	ID=exon-NM_022970.3-17;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123353223	123353481	.	-	.	ID=exon-NM_022970.3-2;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	exon	123357476	123357992	.	-	.	ID=exon-NM_022970.3-1;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123239371	123239535	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123243212	123243317	.	-	1	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	CDS	123353223	123353331	.	-	0	ID=cds-NP_075259.4;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	five_prime_UTR	123353332	123353481	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	five_prime_UTR	123357476	123357992	.	-	.	ID=agat-five_prime_utr-54403;Parent=rna-NM_022970.3;
+chr10	BestRefSeq	three_prime_UTR	123237824	123239370	.	-	.	ID=agat-three_prime_utr-54427;Parent=rna-NM_022970.3;
--- a/src/agat/agat_sp_merge_annotations/test_data/fileA.gff
+++ b/src/agat/agat_sp_merge_annotations/test_data/fileA.gff
@@ -0,0 +1,2 @@
+chr1	AUGUSTUS	gene	1000424	1039237	.	+	.	ID=A;
+chr1	AUGUSTUS	mRNA	1000424	1039237	.	+	.	ID=A.t1;Parent=A;
--- a/src/agat/agat_sp_merge_annotations/test_data/fileB.gff
+++ b/src/agat/agat_sp_merge_annotations/test_data/fileB.gff
@@ -0,0 +1,2 @@
+chr1	AUGUSTUS	gene	1000424	1039237	.	+	.	ID=B;
+chr1	AUGUSTUS	mRNA	1000424	1039237	.	+	.	ID=B.t1;Parent=B;
--- a/src/agat/agat_sp_merge_annotations/test_data/script.sh
+++ b/src/agat/agat_sp_merge_annotations/test_data/script.sh
@@ -0,0 +1,15 @@
+#!/bin/bash
+
+# clone repo
+if [ ! -d /tmp/agat_source ]; then
+  git clone --depth 1 --single-branch --branch master https://github.com/NBISweden/AGAT /tmp/agat_source
+fi
+
+# copy test data
+cp -r /tmp/agat_source/t/scripts_output/in/agat_sp_merge_annotations/file1.gff src/agat/agat_sp_merge_annotations/test_data
+cp -r /tmp/agat_source/t/scripts_output/in/agat_sp_merge_annotations/file2.gff src/agat/agat_sp_merge_annotations/test_data
+cp -r /tmp/agat_source/t/scripts_output/out/agat_sp_merge_annotations_1.gff src/agat/agat_sp_merge_annotations/test_data
+
+cp -r /tmp/agat_source/t/scripts_output/in/agat_sp_merge_annotations/fileA.gff src/agat/agat_sp_merge_annotations/test_data
+cp -r /tmp/agat_source/t/scripts_output/in/agat_sp_merge_annotations/fileB.gff src/agat/agat_sp_merge_annotations/test_data
+cp -r /tmp/agat_source/t/scripts_output/out/agat_sp_merge_annotations_2.gff src/agat/agat_sp_merge_annotations/test_data
--- a/src/bedtools/bedtools_bamtobed/config.vsh.yaml
+++ b/src/bedtools/bedtools_bamtobed/config.vsh.yaml
@@ -0,0 +1,118 @@
+name: bedtools_bamtobed
+namespace: bedtools
+description: Converts BAM alignments to BED6 or BEDPE format.
+keywords: [Converts, BAM, BED, BED6, BEDPE]
+links:
+  documentation: https://bedtools.readthedocs.io/en/latest/content/tools/bamtobed.html
+  repository: https://github.com/arq5x/bedtools2
+  homepage: https://bedtools.readthedocs.io/en/latest/#
+  issue_tracker: https://github.com/arq5x/bedtools2/issues
+references:
+  doi: 10.1093/bioinformatics/btq033
+license: MIT
+requirements:
+  commands: [bedtools]
+authors:
+  - __merge__: /src/_authors/theodoro_gasperin.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+  - name: Inputs
+    arguments:
+      - name: --input
+        alternatives: -i
+        type: file
+        description: Input BAM file.
+        required: true
+    
+  - name: Outputs
+    arguments:
+      - name: --output
+        alternatives: -o
+        required: true
+        type: file
+        direction: output
+        description: Output BED file.
+
+  - name: Options
+    arguments:
+      - name: --bedpe
+        type: boolean_true
+        description: | 
+          Write BEDPE format. Requires BAM to be grouped or sorted by query.
+      
+      - name: --mate1
+        type: boolean_true
+        description: | 
+          When writing BEDPE (-bedpe) format, always report mate one as the first BEDPE "block".
+      
+      - name: --bed12
+        type: boolean_true
+        description: | 
+          Write "blocked" BED format (aka "BED12"). Forces -split.
+          See http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1
+
+      - name: --split
+        type: boolean_true
+        description: | 
+          Report "split" BAM alignments as separate BED entries.
+          Splits only on N CIGAR operations.
+
+      - name: --splitD
+        type: boolean_true
+        description: | 
+          Split alignments based on N and D CIGAR operators.
+          Forces -split.
+
+      - name: --edit_distance
+        alternatives: -ed
+        type: boolean_true
+        description: | 
+          Use BAM edit distance (NM tag) for BED score.
+          - Default for BED is to use mapping quality.
+          - Default for BEDPE is to use the minimum of
+            the two mapping qualities for the pair.
+          - When -ed is used with -bedpe, the total edit
+            distance from the two mates is reported.
+
+      - name: --tag
+        type: string
+        description: | 
+          Use other NUMERIC BAM alignment tag for BED score.
+          Default for BED is to use mapping quality. Disallowed with BEDPE output.
+        example: "SM"
+      
+      - name: --color
+        type: string
+        description: | 
+          An R,G,B string for the color used with BED12 format.
+          Default is (255,0,0).
+        example: "250,250,250"
+
+      - name: --cigar
+        type: boolean_true
+        description: | 
+          Add the CIGAR string to the BED entry as a 7th column.
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - path: test_data
+
+engines:
+  - type: docker
+    image: debian:stable-slim
+    setup:
+      - type: apt
+        packages: [bedtools, procps]
+      - type: docker
+        run: |
+          echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var/software_versions.txt
+
+runners:
+  - type: executable
+  - type: nextflow
--- a/src/bedtools/bedtools_bamtobed/help.txt
+++ b/src/bedtools/bedtools_bamtobed/help.txt
@@ -0,0 +1,43 @@
+```bash
+bedtools bamtobed
+```
+
+Tool:    bedtools bamtobed (aka bamToBed)
+Version: v2.30.0
+Summary: Converts BAM alignments to BED6 or BEDPE format.
+
+Usage:   bedtools bamtobed [OPTIONS] -i <bam> 
+
+Options: 
+	-bedpe	Write BEDPE format.
+		- Requires BAM to be grouped or sorted by query.
+
+	-mate1	When writing BEDPE (-bedpe) format, 
+		always report mate one as the first BEDPE "block".
+
+	-bed12	Write "blocked" BED format (aka "BED12"). Forces -split.
+
+		http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1
+
+	-split	Report "split" BAM alignments as separate BED entries.
+		Splits only on N CIGAR operations.
+
+	-splitD	Split alignments based on N and D CIGAR operators.
+		Forces -split.
+
+	-ed	Use BAM edit distance (NM tag) for BED score.
+		- Default for BED is to use mapping quality.
+		- Default for BEDPE is to use the minimum of
+		  the two mapping qualities for the pair.
+		- When -ed is used with -bedpe, the total edit
+		  distance from the two mates is reported.
+
+	-tag	Use other NUMERIC BAM alignment tag for BED score.
+		- Default for BED is to use mapping quality.
+		  Disallowed with BEDPE output.
+
+	-color	An R,G,B string for the color used with BED12 format.
+		Default is (255,0,0).
+
+	-cigar	Add the CIGAR string to the BED entry as a 7th column.
+
--- a/src/bedtools/bedtools_bamtobed/script.sh
+++ b/src/bedtools/bedtools_bamtobed/script.sh
@@ -0,0 +1,39 @@
+#!/bin/bash
+
+## VIASH START
+## VIASH END
+
+set -eo pipefail
+
+# Unset parameters
+unset_if_false=( 
+  par_bedpe
+  par_mate1
+  par_bed12
+  par_split
+  par_splitD
+  par_edit_distance
+  par_tag
+  par_color
+  par_cigar
+)
+
+for par in ${unset_if_false[@]}; do
+    test_val="${!par}"
+    [[ "$test_val" == "false" ]] && unset $par
+done
+
+# Execute bedtools sort with the provided arguments
+bedtools bamtobed \
+    ${par_bedpe:+-bedpe} \
+    ${par_mate1:+-mate1} \
+    ${par_bed12:+-bed12} \
+    ${par_split:+-split} \
+    ${par_splitD:+-splitD} \
+    ${par_edit_distance:+-ed} \
+    ${par_tag:+-tag "$par_tag"} \
+    ${par_cigar:+-cigar} \
+    ${par_color:+-color "$par_color"} \
+    -i "$par_input" \
+    > "$par_output"
+
--- a/src/bedtools/bedtools_bamtobed/test.sh
+++ b/src/bedtools/bedtools_bamtobed/test.sh
@@ -0,0 +1,183 @@
+#!/bin/bash
+
+# exit on error
+set -eo pipefail
+
+# directory of the bam file
+test_data="$meta_resources_dir/test_data"
+
+#############################################
+# helper functions
+assert_file_exists() {
+  [ -f "$1" ] || { echo "File '$1' does not exist" && exit 1; }
+}
+assert_file_not_empty() {
+  [ -s "$1" ] || { echo "File '$1' is empty but shouldn't be" && exit 1; }
+}
+assert_file_contains() {
+  grep -q "$2" "$1" || { echo "File '$1' does not contain '$2'" && exit 1; }
+}
+assert_identical_content() {
+  diff -a "$2" "$1" \
+    || (echo "Files are not identical!" && exit 1)
+}
+#############################################
+
+echo "Creating Test Data..."
+TMPDIR=$(mktemp -d "$meta_temp_dir/XXXXXX")
+function clean_up {
+  [[ -d "$TMPDIR" ]] && rm -r "$TMPDIR"
+}
+trap clean_up EXIT
+
+# Generate expected files for comparison
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t60\t+\nchr2:172936693-172938111\t428\t528\tmy_read/2\t60\t-\n" > "$TMPDIR/expected.bed"
+printf "chr2:172936693-172938111\t128\t228\tchr2:172936693-172938111\t428\t528\tmy_read\t60\t+\t-\n" > "$TMPDIR/expected.bedpe"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t60\t+\t128\t228\t255,0,0\t1\t100\t0\nchr2:172936693-172938111\t428\t528\tmy_read/2\t60\t-\t428\t528\t255,0,0\t1\t100\t0\n" > "$TMPDIR/expected.bed12"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t0\t+\nchr2:172936693-172938111\t428\t528\tmy_read/2\t0\t-\n" > "$TMPDIR/expected_ed.bed"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t60\t+\t128\t228\t250,250,250\t1\t100\t0\nchr2:172936693-172938111\t428\t528\tmy_read/2\t60\t-\t428\t528\t250,250,250\t1\t100\t0\n" > "$TMPDIR/expected_color.bed12"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t60\t+\t100M\nchr2:172936693-172938111\t428\t528\tmy_read/2\t60\t-\t100M\n" > "$TMPDIR/expected_cigar.bed"
+printf "chr2:172936693-172938111\t128\t228\tmy_read/1\t85\t+\nchr2:172936693-172938111\t428\t528\tmy_read/2\t85\t-\n" > "$TMPDIR/expected_tag.bed"
+
+
+# Test 1: 
+mkdir "$TMPDIR/test1" && pushd "$TMPDIR/test1" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output.bed" \
+
+# checks
+assert_file_exists "output.bed"
+assert_file_not_empty "output.bed"
+assert_identical_content "output.bed" "../expected.bed"
+echo "- test1 succeeded -"
+
+popd > /dev/null
+
+# Test 2:
+mkdir "$TMPDIR/test2" && pushd "$TMPDIR/test2" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -bedpe"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output.bedpe" \
+  --bedpe
+
+# checks
+assert_file_exists "output.bedpe"
+assert_file_not_empty "output.bedpe"
+assert_identical_content "output.bedpe" "../expected.bedpe"
+echo "- test2 succeeded -"
+
+popd > /dev/null
+
+# Test 3:
+mkdir "$TMPDIR/test3" && pushd "$TMPDIR/test3" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -bed12"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output.bed12" \
+  --bed12
+
+# checks
+assert_file_exists "output.bed12"
+assert_file_not_empty "output.bed12"
+assert_identical_content "output.bed12" "../expected.bed12"
+echo "- test3 succeeded -"
+
+popd > /dev/null
+
+# Test 4:
+mkdir "$TMPDIR/test4" && pushd "$TMPDIR/test4" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -ed"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output_ed.bed" \
+  --edit_distance
+
+# checks
+assert_file_exists "output_ed.bed"
+assert_file_not_empty "output_ed.bed"
+assert_identical_content "output_ed.bed" "../expected_ed.bed"
+echo "- test4 succeeded -"
+
+popd > /dev/null
+
+# Test 5:
+mkdir "$TMPDIR/test5" && pushd "$TMPDIR/test5" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -color"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output_color.bed12" \
+  --bed12 \
+  --color "250,250,250" \
+  
+# checks
+assert_file_exists "output_color.bed12"
+assert_file_not_empty "output_color.bed12"
+assert_identical_content "output_color.bed12" "../expected_color.bed12"
+echo "- test5 succeeded -"
+
+popd > /dev/null
+
+# Test 6:
+mkdir "$TMPDIR/test6" && pushd "$TMPDIR/test6" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -cigar"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output_cigar.bed" \
+  --cigar
+
+# checks
+assert_file_exists "output_cigar.bed"
+assert_file_not_empty "output_cigar.bed"
+assert_identical_content "output_cigar.bed" "../expected_cigar.bed"
+echo "- test6 succeeded -"
+
+popd > /dev/null
+
+# Test 7:
+mkdir "$TMPDIR/test7" && pushd "$TMPDIR/test7" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with -tag"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output_tag.bed" \
+  --tag "XT"
+
+# checks
+assert_file_exists "output_tag.bed"
+assert_file_not_empty "output_tag.bed"
+assert_identical_content "output_tag.bed" "../expected_tag.bed"
+echo "- test7 succeeded -"
+
+popd > /dev/null
+
+# Test 8: 
+mkdir "$TMPDIR/test8" && pushd "$TMPDIR/test8" > /dev/null
+
+echo "> Run bedtools bamtobed on BAM file with other options"
+"$meta_executable" \
+  --input "$test_data/example.bam" \
+  --output "output.bed" \
+  --bedpe \
+  --mate1 \
+  --split \
+  --splitD \
+
+# checks
+assert_file_exists "output.bed"
+assert_file_not_empty "output.bed"
+assert_identical_content "output.bed" "../expected.bedpe"
+echo "- test8 succeeded -"
+
+popd > /dev/null
+
+echo "---- All tests succeeded! ----"
+exit 0
--- a/src/bedtools/bedtools_bamtobed/test_data/example.bam
+++ b/src/bedtools/bedtools_bamtobed/test_data/example.bam
--- a/src/bedtools/bedtools_bamtobed/test_data/example.sam
+++ b/src/bedtools/bedtools_bamtobed/test_data/example.sam
@@ -0,0 +1,3 @@
+@SQ	SN:chr2:172936693-172938111	LN:1418
+my_read	99	chr2:172936693-172938111	129	60	100M	=	429	400	CTAACTAGCCTGGGAAAAAAGGATAGTGTCTCTCTGTTCTTTCATAGGAAATGTTGAATCAGACCCCTACTGGGAAAAGAAATTTAATGCATATCTCACT	*	XT:A:U	NM:i:0	SM:i:37	AM:i:37	X0:i:1	X1:i:0	XM:i:0	XO:i:0	XG:i:0	MD:Z:100
+my_read	147	chr2:172936693-172938111	429	60	100M	=	129	-400	TCGAGCTCTGCATTCATGGCTGTGTCTAAAGGGCATGTCAGCCTTTGATTCTCTCTGAGAGGTAATTATCCTTTTCCTGTCACGGAACAACAAATGATAG	*	XT:A:U	NM:i:0	SM:i:37	AM:i:37	X0:i:1	X1:i:0	XM:i:0	XO:i:0	XG:i:0	MD:Z:100
--- a/src/rseqc/rseqc_bamstat/config.vsh.yaml
+++ b/src/rseqc/rseqc_bamstat/config.vsh.yaml
@@ -0,0 +1,59 @@
+name: rseqc_bamstat
+namespace: rseqc
+keywords: [ rnaseq, genomics ]
+description: Generate statistics from a bam file.
+links:
+  homepage: https://rseqc.sourceforge.net/
+  documentation: https://rseqc.sourceforge.net/#bam-stat-py
+  issue_tracker: https://github.com/MonashBioinformaticsPlatform/RSeQC/issues
+  repository: https://github.com/MonashBioinformaticsPlatform/RSeQC
+references:
+  doi: 10.1093/bioinformatics/bts356
+license: GPL-3.0
+authors:
+  - __merge__: /src/_authors/emma_rousseau.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+- name: "Input"
+  arguments: 
+  - name: "--input_file"
+    alternatives: -i
+    type: file 
+    required: true
+    description: Input alignment file in BAM or SAM format.
+  - name: "--mapq"
+    alternatives: -q
+    type: integer
+    example: 30 
+    description: |
+      Minimum mapping quality (phred scaled) to determine uniquely mapped reads. Default: '30'.
+    
+- name: "Output"
+  arguments: 
+  - name: "--output"
+    type: file
+    direction: output
+    description: Output file (txt) with mapping quality statistics.
+
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - type: file
+    path: test_data
+  
+engines:
+- type: docker
+  image: python:3.10
+  setup:
+    - type: python
+      packages: [ RSeQC ]
+    - type: docker
+      run: |
+        echo "RSeQC bam_stat.py: $(bam_stat.py --version | cut -d' ' -f2-)" > /var/software_versions.txt
+runners: 
+- type: executable
+- type: nextflow
--- a/src/rseqc/rseqc_bamstat/help.txt
+++ b/src/rseqc/rseqc_bamstat/help.txt
@@ -0,0 +1,18 @@
+```
+bam_stat.py -h
+```
+
+Usage: bam_stat.py [options]
+
+Summarizing mapping statistics of a BAM or SAM file. 
+
+
+
+Options:
+  --version             show program's version number and exit
+  -h, --help            show this help message and exit
+  -i INPUT_FILE, --input-file=INPUT_FILE
+                        Alignment file in BAM or SAM format.
+  -q MAP_QUAL, --mapq=MAP_QUAL
+                        Minimum mapping quality (phred scaled) to determine
+                        "uniquely mapped" reads. default=30
--- a/src/rseqc/rseqc_bamstat/script.sh
+++ b/src/rseqc/rseqc_bamstat/script.sh
@@ -0,0 +1,9 @@
+#!/bin/bash
+
+
+set -eo pipefail 
+
+bam_stat.py \
+    --input-file "${par_input_file}" \
+    ${par_mapq:+--mapq "${par_mapq}"} \
+> $par_output
--- a/src/rseqc/rseqc_bamstat/test.sh
+++ b/src/rseqc/rseqc_bamstat/test.sh
@@ -0,0 +1,49 @@
+#!/bin/bash
+
+# define input and output for script
+
+input_bam="sample.bam"
+output_summary="mapping_quality.txt"
+
+# run executable and tests
+echo "> Running $meta_functionality_name."
+
+"$meta_executable" \
+    --input_file "$meta_resources_dir/test_data/$input_bam" \
+    --output "$output_summary"
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Checking whether output is present"
+[ ! -f "$output_summary" ] && echo "$output_summary file missing" && exit 1
+[ ! -s "$output_summary" ] && echo "$output_summary file is empty" && exit 1
+
+echo ">> Checking whether output is correct"
+diff "$meta_resources_dir/test_data/ref_output.txt" "$meta_resources_dir/$output_summary" || { echo "Output is not correct"; exit 1; }
+
+#############################################################################
+
+echo ">>> Test 2: Test with non-default mapping quality threshold"
+
+output_summary="mapping_quality_mapq_50.txt"
+
+# run executable and tests
+echo "> Running $meta_functionality_name."
+
+"$meta_executable" \
+    --input_file "$meta_resources_dir/test_data/$input_bam" \
+    --output "$output_summary" \
+    --mapq 50
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Checking whether output is present"
+[ ! -f "$output_summary" ] && echo "$output_summary file missing" && exit 1
+[ ! -s "$output_summary" ] && echo "$output_summary file is empty" && exit 1
+
+echo ">> Checking whether output is correct"
+diff "$meta_resources_dir/test_data/ref_output_mapq.txt" "$meta_resources_dir/$output_summary" || { echo "Output is not correct"; exit 1; }
+
+exit 0
--- a/src/rseqc/rseqc_bamstat/test_data/ref_output.txt
+++ b/src/rseqc/rseqc_bamstat/test_data/ref_output.txt
@@ -0,0 +1,22 @@
+
+#==================================================
+#All numbers are READ count
+#==================================================
+
+Total records:                          90
+
+QC failed:                              0
+Optical/PCR duplicate:                  0
+Non primary hits                        0
+Unmapped reads:                         1
+mapq < mapq_cut (non-unique):           0
+
+mapq >= mapq_cut (unique):              89
+Read-1:                                 45
+Read-2:                                 44
+Reads map to '+':                       44
+Reads map to '-':                       45
+Non-splice reads:                       89
+Splice reads:                           0
+Reads mapped in proper pairs:           88
+Proper-paired reads map to different chrom:0
--- a/src/rseqc/rseqc_bamstat/test_data/ref_output_mapq.txt
+++ b/src/rseqc/rseqc_bamstat/test_data/ref_output_mapq.txt
@@ -0,0 +1,22 @@
+
+#==================================================
+#All numbers are READ count
+#==================================================
+
+Total records:                          90
+
+QC failed:                              0
+Optical/PCR duplicate:                  0
+Non primary hits                        0
+Unmapped reads:                         1
+mapq < mapq_cut (non-unique):           6
+
+mapq >= mapq_cut (unique):              83
+Read-1:                                 42
+Read-2:                                 41
+Reads map to '+':                       44
+Reads map to '-':                       39
+Non-splice reads:                       83
+Splice reads:                           0
+Reads mapped in proper pairs:           83
+Proper-paired reads map to different chrom:0
--- a/src/rseqc/rseqc_bamstat/test_data/sample.bam
+++ b/src/rseqc/rseqc_bamstat/test_data/sample.bam
--- a/src/rseqc/rseqc_inferexperiment/config.vsh.yaml
+++ b/src/rseqc/rseqc_inferexperiment/config.vsh.yaml
@@ -0,0 +1,76 @@
+name: "rseqc_inferexperiment"
+namespace: "rseqc"
+description: |
+  Infer strandedness from sequencing reads
+links:
+  homepage: https://rseqc.sourceforge.net/
+  documentation: https://rseqc.sourceforge.net/#infer-experiment-py
+  issue_tracker: https://github.com/MonashBioinformaticsPlatform/RSeQC/issues
+  repository: https://github.com/MonashBioinformaticsPlatform/RSeQC
+references:
+  doi: 10.1093/bioinformatics/bts356
+license: GPL-3.0
+authors:
+  - __merge__: /src/_authors/emma_rousseau.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+- name: "Input"
+  arguments: 
+  - name: "--input_file"
+    alternatives: ["-i"]
+    type: file 
+    required: true
+    description: input alignment file in BAM or SAM format
+  - name: "--refgene"
+    alternatives: ["-r"]
+    type: file 
+    required: true
+    description: Reference gene model in bed format
+  
+- name: "Output"
+  arguments: 
+  - name: "--output"
+    type: file
+    direction: output
+    required: true
+    description: Output file (txt) of strandness report.
+    example: $id.strandedness.txt
+
+- name: "Options"
+  arguments:
+    - name: "--sample_size"
+      alternatives: ["-s"]
+      type: integer
+      description: |
+        Number of reads sampled from SAM/BAM file. Default: 200000
+      example: 200000
+    - name: "--mapq"
+      alternatives: ["-q"]
+      type: integer
+      description: |
+        Minimum mapping quality (phred scaled) to determine uniquely mapped reads. Default: 30
+      example: 30
+
+resources:
+  - type: bash_script
+    path: script.sh
+
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - path: test_data
+
+engines:
+- type: docker
+  image: python:3.10
+  setup:
+    - type: python
+      packages: [ RSeQC ]
+    - type: docker
+      run: |
+        echo "RSeQC - infer_experiment.py: $(infer_experiment.py --version | cut -d' ' -f2)" > /var/software_versions.txt
+        
+runners: 
+- type: executable
+- type: nextflow
--- a/src/rseqc/rseqc_inferexperiment/help.txt
+++ b/src/rseqc/rseqc_inferexperiment/help.txt
@@ -0,0 +1,21 @@
+```
+infer_eperiment.py --help
+```
+
+Usage: infer_experiment.py [options]
+
+
+Options:
+  --version             show program's version number and exit
+  -h, --help            show this help message and exit
+  -i INPUT_FILE, --input-file=INPUT_FILE
+                        Input alignment file in SAM or BAM format
+  -r REFGENE_BED, --refgene=REFGENE_BED
+                        Reference gene model in bed fomat.
+  -s SAMPLE_SIZE, --sample-size=SAMPLE_SIZE
+                        Number of reads sampled from SAM/BAM file.
+                        default=200000
+  -q MAP_QUAL, --mapq=MAP_QUAL
+                        Minimum mapping quality (phred scaled) for an
+                        alignment to be considered as "uniquely mapped".
+                        default=30
--- a/src/rseqc/rseqc_inferexperiment/script.sh
+++ b/src/rseqc/rseqc_inferexperiment/script.sh
@@ -0,0 +1,10 @@
+#!/bin/bash
+
+set -eo pipefail 
+
+infer_experiment.py \
+    -i $par_input_file \
+    -r $par_refgene \
+    ${par_sample_size:+-s "${par_sample_size}"} \
+    ${par_mapq:+-q "${par_mapq}"} \
+> $par_output
--- a/src/rseqc/rseqc_inferexperiment/test.sh
+++ b/src/rseqc/rseqc_inferexperiment/test.sh
@@ -0,0 +1,72 @@
+#!/bin/bash
+
+# define input and output for script
+input_bam="$meta_resources_dir/test_data/sample.bam"
+input_bed="$meta_resources_dir/test_data/test.bed12"
+output="strandedness.txt"
+
+echo ">>> Prepare test output data"
+
+cat > "$meta_resources_dir/test_data/strandedness.txt" <<EOF
+
+
+This is PairEnd Data
+Fraction of reads failed to determine: 0.0000
+Fraction of reads explained by "1++,1--,2+-,2-+": 1.0000
+Fraction of reads explained by "1+-,1-+,2++,2--": 0.0000
+EOF
+
+cat > "$meta_resources_dir/test_data/strandedness2.txt" <<EOF
+Unknown Data type
+EOF
+
+################################################################################
+# run executable and tests
+
+echo ">>> Test 1: Test with default parameters"
+
+"$meta_executable" \
+    --input_file "$input_bam" \
+    --refgene "$input_bed" \
+    --output "$output"
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Checking whether output can be found and has content"
+
+[ ! -f "$output" ] && echo "$output is missing" && exit 1
+[ ! -s "$output" ] && echo "$output is empty" && exit 1
+
+
+echo ">> Checking whether output is correct"
+diff "$output" "$meta_resources_dir/test_data/strandedness.txt" || { echo "Output is not correct"; exit 1; }
+
+rm "$output"
+
+################################################################################
+
+echo ">>> Test 2: Test with non-default sample size and map quality"
+
+"$meta_executable" \
+    --input_file "$input_bam" \
+    --refgene "$input_bed" \
+    --output "$output" \
+    --sample_size 150000 \
+    --mapq 90
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Checking whether output can be found and has content"
+
+[ ! -f "$output" ] && echo "$output is missing" && exit 1
+[ ! -s "$output" ] && echo "$output is empty" && exit 1
+
+echo ">> Checking whether output is correct"
+diff "$output" "$meta_resources_dir/test_data/strandedness2.txt" || { echo "Output is not correct"; exit 1; }
+
+
+echo "All tests passed"
+
+exit 0
--- a/src/rseqc/rseqc_inferexperiment/test_data/sample.bam
+++ b/src/rseqc/rseqc_inferexperiment/test_data/sample.bam
--- a/src/rseqc/rseqc_inferexperiment/test_data/test.bed12
+++ b/src/rseqc/rseqc_inferexperiment/test_data/test.bed12
@@ -0,0 +1,4 @@
+MT192765.1	1242	1264	nCoV-2019_5_LEFT	1	+	1242	1264	0	2	10,12,	0,10,
+MT192765.1	1573	1595	nCoV-2019_6_LEFT	2	+	1573	1595	0	2	7,15,	0,7,
+MT192765.1	1623	1651	nCoV-2019_5_RIGHT	1	-	1623	1651	0	2	14,14,	0,14,
+MT192765.1	1942	1964	nCoV-2019_6_RIGHT	2	-	1942	1964	0	2	11,11	0,11,
--- a/src/rseqc/rseqc_inferexperiment/test_data/test.paired_end.sorted.bam
+++ b/src/rseqc/rseqc_inferexperiment/test_data/test.paired_end.sorted.bam
--- a/src/rseqc/rseqc_inner_distance/config.vsh.yaml
+++ b/src/rseqc/rseqc_inner_distance/config.vsh.yaml
@@ -0,0 +1,116 @@
+name: "rseqc_inner_distance"
+namespace: "rseqc"
+description: |
+  Calculate inner distance between read pairs.
+links:
+  homepage: https://rseqc.sourceforge.net/
+  documentation: https://rseqc.sourceforge.net/#inner-distance-py
+  issue_tracker: https://github.com/MonashBioinformaticsPlatform/RSeQC/issues
+  repository: https://github.com/MonashBioinformaticsPlatform/RSeQC
+references:
+  doi: 10.1093/bioinformatics/bts356
+license: GPL-3.0
+authors:
+  - __merge__: /src/_authors/emma_rousseau.yaml
+    roles: [ author, maintainer ]
+
+argument_groups:
+- name: "Input"
+  arguments: 
+  - name: "--input_file"
+    alternatives: ["-i"]
+    type: file 
+    required: true
+    description: input alignment file in BAM or SAM format
+
+  - name: "--refgene"
+    alternatives: ["-r"]
+    type: file 
+    required: true
+    description: Reference gene model in bed format
+
+  - name: "--sample_size"
+    alternatives: ["-k"]
+    type: integer
+    example: 1000000
+    description: Numer of reads sampled from SAM/BAM file, default = 1000000.
+  
+  - name: "--mapq"
+    alternatives: ["-q"]
+    type: integer
+    example: 30 
+    description: Minimum mapping quality (phred scaled) to determine uniquely mapped reads, default=30.
+
+  - name: "--lower_bound"
+    alternatives: ["-l"]
+    type: integer
+    example: -250 
+    description: Lower bound of inner distance (bp). This option is used for ploting histograme, default=-250.
+
+  - name: "--upper_bound"
+    alternatives: ["-u"]
+    type: integer
+    example: 250 
+    description: Upper bound of inner distance (bp). This option is used for ploting histograme, default=250.
+
+  - name: "--step"
+    alternatives: ["-s"]
+    type: integer
+    example: 5 
+    description: Step size (bp) of histograme. This option is used for plotting histogram, default=5.
+
+- name: "Output"
+  arguments: 
+  - name: "--output_prefix"
+    alternatives: ["-o"]
+    type: string
+    required: true
+    description: Rrefix of output files.
+
+  - name: "--output_stats"
+    type: file
+    direction: output
+    description: output file (txt) with summary statistics of inner distances of paired reads
+
+  - name: "--output_dist"
+    type: file
+    direction: output
+    description: output file (txt) with inner distances of all paired reads
+
+  - name: "--output_freq"
+    type: file
+    direction: output
+    description: output file (txt) with frequencies of inner distances of all paired reads
+
+  - name: "--output_plot"
+    type: file
+    direction: output
+    description: output file (pdf) with histogram plot of of inner distances of all paired reads
+
+  - name: "--output_plot_r"
+    type: file
+    direction: output
+    description: output file (R) with script of histogram plot of of inner distances of all paired reads
+    
+resources:
+  - type: bash_script
+    path: script.sh
+test_resources:
+  - type: bash_script
+    path: test.sh
+  - path: test_data
+  
+engines:
+- type: docker
+  image: python:3.10
+  setup:   
+    - type: apt
+      packages: [r-base]
+    - type: python
+      packages: [ RSeQC ]
+    - type: docker
+      run: |
+        echo "RSeQC - inner_distance.py: $(inner_distance.py --version | cut -d' ' -f2)" > /var/software_versions.txt
+runners: 
+- type: executable
+- type: nextflow
--- a/src/rseqc/rseqc_inner_distance/help.txt
+++ b/src/rseqc/rseqc_inner_distance/help.txt
@@ -0,0 +1,43 @@
+```
+inner_distance.py --help
+```
+
+Usage: inner_distance.py [options]
+
+Calculate the inner distance (insert size)  of RNA-seq fragments. 
+
+               RNA fragment
+ _________________||_________________
+|                                    |
+|                                    |
+||||||||||------------------||||||||||
+  read_1      insert_size     read_2
+
+fragment size = read_1 + insert_size + read_2
+
+
+
+Options:
+  --version             show program's version number and exit
+  -h, --help            show this help message and exit
+  -i INPUT_FILE, --input-file=INPUT_FILE
+                        Alignment file in BAM or SAM format.
+  -o OUTPUT_PREFIX, --out-prefix=OUTPUT_PREFIX
+                        Prefix of output files(s)
+  -r REF_GENE, --refgene=REF_GENE
+                        Reference gene model in BED format.
+  -k SAMPLESIZE, --sample-size=SAMPLESIZE
+                        Number of read-pairs used to estimate inner distance.
+                        default=1000000
+  -l LOWER_BOUND_SIZE, --lower-bound=LOWER_BOUND_SIZE
+                        Lower bound of inner distance (bp). This option is
+                        used for ploting histograme. default=-250
+  -u UPPER_BOUND_SIZE, --upper-bound=UPPER_BOUND_SIZE
+                        Upper bound of inner distance (bp). This option is
+                        used for plotting histogram. default=250
+  -s STEP_SIZE, --step=STEP_SIZE
+                        Step size (bp) of histograme. This option is used for
+                        plotting histogram. default=5
+  -q MAP_QUAL, --mapq=MAP_QUAL
+                        Minimum mapping quality (phred scaled) for an
+                        alignment to be called "uniquely mapped". default=30
--- a/src/rseqc/rseqc_inner_distance/script.sh
+++ b/src/rseqc/rseqc_inner_distance/script.sh
@@ -0,0 +1,25 @@
+#!/bin/bash
+
+set -exo pipefail 
+
+
+inner_distance.py \
+    -i $par_input_file \
+    -r $par_refgene \
+    -o $par_output_prefix \
+    ${par_sample_size:+-k "${par_sample_size}"} \
+    ${par_lower_bound:+-l "${par_lower_bound}"} \
+    ${par_upper_bound:+-u "${par_upper_bound}"} \
+    ${par_step:+-s "${par_step}"} \
+    ${par_mapq:+-q "${par_mapq}"} \
+> stdout.txt
+
+if [[ -n $par_output_stats ]]; then head -n 2 stdout.txt > $par_output_stats; fi
+
+
+[[ -n "$par_output_dist" && -f "$par_output_prefix.inner_distance.txt" ]] && mv $par_output_prefix.inner_distance.txt $par_output_dist
+[[ -n "$par_output_plot" && -f "$par_output_prefix.inner_distance_plot.pdf" ]] && mv $par_output_prefix.inner_distance_plot.pdf $par_output_plot
+[[ -n "$par_output_plot_r" && -f "$par_output_prefix.inner_distance_plot.r" ]] && mv $par_output_prefix.inner_distance_plot.r $par_output_plot_r
+[[ -n "$par_output_freq" && -f "$par_output_prefix.inner_distance_freq.txt" ]] && mv $par_output_prefix.inner_distance_freq.txt $par_output_freq
+
+exit 0
--- a/src/rseqc/rseqc_inner_distance/test.sh
+++ b/src/rseqc/rseqc_inner_distance/test.sh
@@ -0,0 +1,77 @@
+#!/bin/bash
+
+
+# define input and output for script
+input_bam="$meta_resources_dir/test_data/test.paired_end.sorted.bam"
+input_bed="$meta_resources_dir/test_data/test.bed12"
+
+output_stats="inner_distance_stats.txt"
+output_dist="inner_distance.txt"
+output_plot="inner_distance_plot.pdf"
+output_plot_r="inner_distance_plot.r"
+output_freq="inner_distance_freq.txt"
+
+# Run executable
+echo "> Running $meta_functionality_name"
+
+"$meta_executable" \
+    --input_file $input_bam \
+    --refgene $input_bed \
+    --output_prefix "test" \
+    --output_stats $output_stats \
+    --output_dist $output_dist \
+    --output_plot $output_plot \
+    --output_plot_r $output_plot_r \
+    --output_freq $output_freq
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Check whether output is present and not empty"
+
+[[ -f "$output_stats" ]] || { echo "$output_stats was not created"; exit 1; }
+[[ -s "$output_stats" ]] || { echo "$output_stats is empty"; exit 1; }
+[[ -f "$output_dist" ]] || { echo "$output_dist was not created"; exit 1; }
+[[ -s "$output_dist" ]] || { echo "$output_dist is empty"; exit 1; }
+[[ -f "$output_plot" ]] || { echo "$output_plot was not created"; exit 1; }
+[[ -s "$output_plot" ]] || { echo "$output_plot is empty"; exit 1; }
+[[ -f "$output_plot_r" ]] || { echo "$output_plot_r was not created"; exit 1; }
+[[ -s "$output_plot_r" ]] || { echo "$output_plot_r is empty"; exit 1; }
+[[ -f "$output_freq" ]] || { echo "$output_freq was created"; exit 1; }
+[[ -s "$output_freq" ]] || { echo "$output_freq is empty"; exit 1; }
+
+echo ">> Check whether output is correct"
+diff "$output_freq" "$meta_resources_dir/test_data/test1.inner_distance_freq.txt" || { echo "Output is not correct"; exit 1; }
+diff "$output_dist" "$meta_resources_dir/test_data/test1.inner_distance.txt" || { echo "Output is not correct"; exit 1; }
+
+# clean up
+rm "$output_stats" "$output_dist" "$output_plot" "$output_plot_r" "$output_freq"
+################################################################################
+
+echo "> Running $meta_functionality_name with non-default parameters and default output file names"
+"$meta_executable" \
+    --input_file $input_bam \
+    --refgene $input_bed \
+    --output_prefix "test" \
+    --sample_size 4 \
+    --mapq 10
+
+exit_code=$?
+[[ $exit_code != 0 ]] && echo "Non zero exit code: $exit_code" && exit 1
+
+echo ">> Check whether output is present and not empty"
+
+[[ -f "test.inner_distance.txt" ]] || { echo "test.inner_distance.txt was not created"; exit 1; }
+[[ -s "test.inner_distance.txt" ]] || { echo "test.inner_distance.txt is empty"; exit 1; }
+[[ -f "test.inner_distance_plot.pdf" ]] || { echo "test.inner_distance_plot.pdf was not created"; exit 1; }
+[[ -s "test.inner_distance_plot.pdf" ]] || { echo "test.inner_distance_plot.pdf is empty"; exit 1; }
+[[ -f "test.inner_distance_plot.r" ]] || { echo "test.inner_distance_plot.r was not created"; exit 1; }
+[[ -s "test.inner_distance_plot.r" ]] || { echo "test.inner_distance_plot.r is empty"; exit 1; }
+[[ -f "test.inner_distance_freq.txt" ]] || { echo "test.inner_distance_freq.txt was created"; exit 1; }
+[[ -s "test.inner_distance_freq.txt" ]] || { echo "test.inner_distance_freq.txt is empty"; exit 1; }
+
+echo ">> Check whether output is correct"
+diff "test.inner_distance_freq.txt" "$meta_resources_dir/test_data/test2.inner_distance_freq.txt" || { echo "Output is not correct"; exit 1; }
+diff "test.inner_distance.txt" "$meta_resources_dir/test_data/test2.inner_distance.txt" || { echo "Output is not correct"; exit 1; }
+
+exit 0
--- a/src/rseqc/rseqc_inner_distance/test_data/test.bed12
+++ b/src/rseqc/rseqc_inner_distance/test_data/test.bed12
@@ -0,0 +1,4 @@
+MT192765.1	1242	1264	nCoV-2019_5_LEFT	1	+	1242	1264	0	2	10,12,	0,10,
+MT192765.1	1573	1595	nCoV-2019_6_LEFT	2	+	1573	1595	0	2	7,15,	0,7,
+MT192765.1	1623	1651	nCoV-2019_5_RIGHT	1	-	1623	1651	0	2	14,14,	0,14,
+MT192765.1	1942	1964	nCoV-2019_6_RIGHT	2	-	1942	1964	0	2	11,11	0,11,
--- a/src/rseqc/rseqc_inner_distance/test_data/test.paired_end.sorted.bam
+++ b/src/rseqc/rseqc_inner_distance/test_data/test.paired_end.sorted.bam
--- a/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance.txt
+++ b/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance.txt
@@ -0,0 +1,49 @@
+ERR5069949.29668	-4	sameTranscript=No,dist=genomic
+ERR5069949.114870	-45	sameTranscript=No,dist=genomic
+ERR5069949.147998	94	sameTranscript=No,dist=genomic
+ERR5069949.155944	-105	sameTranscript=No,dist=genomic
+ERR5069949.184542	49	sameTranscript=No,dist=genomic
+ERR5069949.169513	-92	sameTranscript=No,dist=genomic
+ERR5069949.257821	-139	sameTranscript=No,dist=genomic
+ERR5069949.309410	13	sameTranscript=No,dist=genomic
+ERR5069949.376959	-66	sameTranscript=No,dist=genomic
+ERR5069949.366975	-106	sameTranscript=No,dist=genomic
+ERR5069949.465452	-19	sameTranscript=No,dist=genomic
+ERR5069949.479807	5	sameTranscript=No,dist=genomic
+ERR5069949.501486	-82	sameTranscript=No,dist=genomic
+ERR5069949.532979	-96	sameTranscript=No,dist=genomic
+ERR5069949.540529	-61	sameTranscript=No,dist=genomic
+ERR5069949.573706	-63	sameTranscript=No,dist=genomic
+ERR5069949.576388	-77	sameTranscript=No,dist=genomic
+ERR5069949.611123	-125	sameTranscript=No,dist=genomic
+ERR5069949.651338	-33	sameTranscript=No,dist=genomic
+ERR5069949.686090	-29	sameTranscript=No,dist=genomic
+ERR5069949.786562	42	sameTranscript=No,dist=genomic
+ERR5069949.870926	-22	sameTranscript=No,dist=genomic
+ERR5069949.856527	-69	sameTranscript=No,dist=genomic
+ERR5069949.885966	-32	sameTranscript=No,dist=genomic
+ERR5069949.937422	18	sameTranscript=No,dist=genomic
+ERR5069949.919671	-116	sameTranscript=No,dist=genomic
+ERR5069949.973930	-79	sameTranscript=No,dist=genomic
+ERR5069949.986441	-22	sameTranscript=No,dist=genomic
+ERR5069949.1014693	-150	sameTranscript=No,dist=genomic
+ERR5069949.1020777	-122	sameTranscript=No,dist=genomic
+ERR5069949.1066259	-4	sameTranscript=No,dist=genomic
+ERR5069949.1062611	-124	sameTranscript=No,dist=genomic
+ERR5069949.1067032	-103	sameTranscript=No,dist=genomic
+ERR5069949.1088785	-101	sameTranscript=No,dist=genomic
+ERR5069949.1132353	-142	sameTranscript=No,dist=genomic
+ERR5069949.1151736	-55	sameTranscript=No,dist=genomic
+ERR5069949.1258508	62	sameTranscript=No,dist=genomic
+ERR5069949.1189252	-98	sameTranscript=No,dist=genomic
+ERR5069949.1261808	-88	sameTranscript=No,dist=genomic
+ERR5069949.1246538	-122	sameTranscript=No,dist=genomic
+ERR5069949.1328186	-64	sameTranscript=No,dist=genomic
+ERR5069949.1331889	-132	sameTranscript=No,dist=genomic
+ERR5069949.1372331	-29	sameTranscript=No,dist=genomic
+ERR5069949.1340552	-140	sameTranscript=No,dist=genomic
+ERR5069949.1412839	-117	sameTranscript=No,dist=genomic
+ERR5069949.1476386	-98	sameTranscript=No,dist=genomic
+ERR5069949.1538968	-133	sameTranscript=No,dist=genomic
+ERR5069949.1552198	-67	sameTranscript=No,dist=genomic
+ERR5069949.1561137	-59	sameTranscript=No,dist=genomic
--- a/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance_freq.txt
+++ b/src/rseqc/rseqc_inner_distance/test_data/test1.inner_distance_freq.txt
@@ -0,0 +1,100 @@
+-250	-245	0
+-245	-240	0
+-240	-235	0
+-235	-230	0
+-230	-225	0
+-225	-220	0
+-220	-215	0
+-215	-210	0
+-210	-205	0
+-205	-200	0
+-200	-195	0
+-195	-190	0
+-190	-185	0
+-185	-180	0
+-180	-175	0
+-175	-170	0
+-170	-165	0
+-165	-160	0
+-160	-155	0
+-155	-150	1
+-150	-145	0
+-145	-140	2
+-140	-135	1
+-135	-130	2
+-130	-125	1
+-125	-120	3
+-120	-115	2
+-115	-110	0
+-110	-105	2
+-105	-100	2
+-100	-95	3
+-95	-90	1
+-90	-85	1
+-85	-80	1
+-80	-75	2
+-75	-70	0
+-70	-65	3
+-65	-60	3
+-60	-55	2
+-55	-50	0
+-50	-45	1
+-45	-40	0
+-40	-35	0
+-35	-30	2
+-30	-25	2
+-25	-20	2
+-20	-15	1
+-15	-10	0
+-10	-5	0
+-5	0	2
+0	5	1
+5	10	0
+10	15	1
+15	20	1
+20	25	0
+25	30	0
+30	35	0
+35	40	0
+40	45	1
+45	50	1
+50	55	0
+55	60	0
+60	65	1
+65	70	0
+70	75	0
+75	80	0
+80	85	0
+85	90	0
+90	95	1
+95	100	0
+100	105	0
+105	110	0
+110	115	0
+115	120	0
+120	125	0
+125	130	0
+130	135	0
+135	140	0
+140	145	0
+145	150	0
+150	155	0
+155	160	0
+160	165	0
+165	170	0
+170	175	0
+175	180	0
+180	185	0
+185	190	0
+190	195	0
+195	200	0
+200	205	0
+205	210	0
+210	215	0
+215	220	0
+220	225	0
+225	230	0
+230	235	0
+235	240	0
+240	245	0
+245	250	0
--- a/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance.txt
+++ b/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance.txt
@@ -0,0 +1,4 @@
+ERR5069949.29668	-4	sameTranscript=No,dist=genomic
+ERR5069949.114870	-45	sameTranscript=No,dist=genomic
+ERR5069949.147998	94	sameTranscript=No,dist=genomic
+ERR5069949.155944	-105	sameTranscript=No,dist=genomic
--- a/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance_freq.txt
+++ b/src/rseqc/rseqc_inner_distance/test_data/test2.inner_distance_freq.txt
@@ -0,0 +1,100 @@
+-250	-245	0
+-245	-240	0
+-240	-235	0
+-235	-230	0
+-230	-225	0
+-225	-220	0
+-220	-215	0
+-215	-210	0
+-210	-205	0
+-205	-200	0
+-200	-195	0
+-195	-190	0
+-190	-185	0
+-185	-180	0
+-180	-175	0
+-175	-170	0
+-170	-165	0
+-165	-160	0
+-160	-155	0
+-155	-150	0
+-150	-145	0
+-145	-140	0
+-140	-135	0
+-135	-130	0
+-130	-125	0
+-125	-120	0
+-120	-115	0
+-115	-110	0
+-110	-105	1
+-105	-100	0
+-100	-95	0
+-95	-90	0
+-90	-85	0
+-85	-80	0
+-80	-75	0
+-75	-70	0
+-70	-65	0
+-65	-60	0
+-60	-55	0
+-55	-50	0
+-50	-45	1
+-45	-40	0
+-40	-35	0
+-35	-30	0
+-30	-25	0
+-25	-20	0
+-20	-15	0
+-15	-10	0
+-10	-5	0
+-5	0	1
+0	5	0
+5	10	0
+10	15	0
+15	20	0
+20	25	0
+25	30	0
+30	35	0
+35	40	0
+40	45	0
+45	50	0
+50	55	0
+55	60	0
+60	65	0
+65	70	0
+70	75	0
+75	80	0
+80	85	0
+85	90	0
+90	95	1
+95	100	0
+100	105	0
+105	110	0
+110	115	0
+115	120	0
+120	125	0
+125	130	0
+130	135	0
+135	140	0
+140	145	0
+145	150	0
+150	155	0
+155	160	0
+160	165	0
+165	170	0
+170	175	0
+175	180	0
+180	185	0
+185	190	0
+190	195	0
+195	200	0
+200	205	0
+205	210	0
+210	215	0
+215	220	0
+220	225	0
+225	230	0
+230	235	0
+235	240	0
+240	245	0
+245	250	0
--- a/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_bed2gff/.config.vsh.yaml
@@ -235,9 +235,9 @@ build_info:
  output: "target/executable/agat/agat_convert_bed2gff"
  executable: "target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff
+++ b/target/executable/agat/agat_convert_bed2gff/agat_convert_bed2gff
@@ -515,9 +515,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t

 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_bed2gff"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:10Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_embl2gff/.config.vsh.yaml
@@ -225,9 +225,9 @@ build_info:
  output: "target/executable/agat/agat_convert_embl2gff"
  executable: "target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff
+++ b/target/executable/agat/agat_convert_embl2gff/agat_convert_embl2gff
@@ -505,9 +505,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t

 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_embl2gff"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_genscan2gff/.config.vsh.yaml
@@ -230,9 +230,9 @@ build_info:
  output: "target/executable/agat/agat_convert_genscan2gff"
  executable: "target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff
+++ b/target/executable/agat/agat_convert_genscan2gff/agat_convert_genscan2gff
@@ -514,9 +514,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t

 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_genscan2gff"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:19Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_sp_gff2gtf/.config.vsh.yaml
@@ -228,9 +228,9 @@ build_info:
  output: "target/executable/agat/agat_convert_sp_gff2gtf"
  executable: "target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf
+++ b/target/executable/agat/agat_convert_sp_gff2gtf/agat_convert_sp_gff2gtf
@@ -519,9 +519,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t

 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2gtf"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_sp_gff2tsv/.config.vsh.yaml
@@ -188,9 +188,9 @@ build_info:
  output: "target/executable/agat/agat_convert_sp_gff2tsv"
  executable: "target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv
+++ b/target/executable/agat/agat_convert_sp_gff2tsv/agat_convert_sp_gff2tsv
@@ -484,9 +484,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t

 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gff2tsv"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml
+++ b/target/executable/agat/agat_convert_sp_gxf2gxf/.config.vsh.yaml
@@ -195,9 +195,9 @@ build_info:
  output: "target/executable/agat/agat_convert_sp_gxf2gxf"
  executable: "target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf
+++ b/target/executable/agat/agat_convert_sp_gxf2gxf/agat_convert_sp_gxf2gxf
@@ -493,9 +493,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t

 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_convert_sp_gxf2gxf"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:19Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml
+++ b/target/executable/agat/agat_sp_add_introns/.config.vsh.yaml
@@ -186,9 +186,9 @@ build_info:
  output: "target/executable/agat/agat_sp_add_introns"
  executable: "target/executable/agat/agat_sp_add_introns/agat_sp_add_introns"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns
+++ b/target/executable/agat/agat_sp_add_introns/agat_sp_add_introns
@@ -479,9 +479,9 @@ RUN agat --version | sed 's/AGAT\s\(.*\)/agat: "\1"/' > /var/software_versions.t

 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_add_introns"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml
+++ b/target/executable/agat/agat_sp_filter_feature_from_kill_list/.config.vsh.yaml
@@ -0,0 +1,263 @@
+name: "agat_sp_filter_feature_from_kill_list"
+namespace: "agat"
+version: "main"
+authors:
+- name: "Leïla Paquay"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "leila@data-intuitive.com"
+      github: "Leila011"
+      linkedin: "leilapaquay"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Software Developer"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--gff"
+    alternatives:
+    - "-f"
+    - "--ref"
+    - "--reffile"
+    description: "Input GFF3 file that will be read."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--kill_list"
+    alternatives:
+    - "--kl"
+    description: "Text file containing the kill list. One value per line."
+    info: null
+    example:
+    - "kill_list.txt"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    - "--out"
+    description: "Path to the output GFF file that contains filtered features. \n"
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Arguments"
+  arguments:
+  - type: "string"
+    name: "--type"
+    alternatives:
+    - "-p"
+    - "-l"
+    description: "Primary tag option, case insensitive, list. Allow to specify the\
+      \ feature types that \nwill be handled. \n\nYou can specify a specific feature\
+      \ by giving its primary tag name (column 3) as: \n\n  * cds\n  * Gene\n  * mRNA\n\
+      \  \nYou can specify directly all the feature of a particular\nlevel: \n\n \
+      \ * level2=mRNA,ncRNA,tRNA,etc \n  * level3=CDS,exon,UTR,etc. \n\nBy default\
+      \ all features are taken into account. Fill the option with the value \"all\"\
+      \ will \nhave the same behaviour.\n"
+    info: null
+    required: false
+    direction: "input"
+    multiple: true
+    multiple_sep: ";"
+  - type: "string"
+    name: "--attribute"
+    alternatives:
+    - "-a"
+    description: "Attribute tag to specify the attribute to analyse. Case sensitive.\
+      \ Default: ID\n"
+    info: null
+    example:
+    - "ID"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "file"
+    name: "--config"
+    alternatives:
+    - "-c"
+    description: "AGAT config file. By default AGAT takes the original agat_config.yaml\
+      \ shipped with AGAT.\nThe `--config` option gives you the possibility to use\
+      \ your own AGAT config file (located \nelsewhere or named differently).\n"
+    info: null
+    example:
+    - "custom_agat_config.yaml"
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--verbose"
+    alternatives:
+    - "-v"
+    description: "Verbose option for debugging purpose."
+    info: null
+    direction: "input"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Remove features based on a kill list. The default behaviour is to look\
+  \ at the features's ID. \nIf the feature has an ID (case insensitive) listed among\
+  \ the kill list it will be removed.\nRemoving a level1 or level2 feature will automatically\
+  \ remove all linked subfeatures, and \nremoving all children of a feature will automatically\
+  \ remove this feature too.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "gene annotations"
+- "filtering"
+- "gff"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.5281/zenodo.3552717"
+links:
+  repository: "https://github.com/NBISweden/AGAT"
+  homepage: "https://github.com/NBISweden/AGAT"
+  documentation: "https://agat.readthedocs.io/en/latest/tools/agat_sp_filter_feature_from_kill_list.html"
+  issue_tracker: "https://github.com/NBISweden/AGAT/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "docker"
+    run:
+    - "agat --version | sed 's/AGAT\\s\\(.*\\)/agat: \"\\1\"/' > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/agat/agat_sp_filter_feature_from_kill_list/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/agat/agat_sp_filter_feature_from_kill_list"
+  executable: "target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
--- a/target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list
+++ b/target/executable/agat/agat_sp_filter_feature_from_kill_list/agat_sp_filter_feature_from_kill_list
--- a/target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml
+++ b/target/executable/agat/agat_sp_merge_annotations/.config.vsh.yaml
@@ -0,0 +1,211 @@
+name: "agat_sp_merge_annotations"
+namespace: "agat"
+version: "main"
+authors:
+- name: "Leïla Paquay"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "leila@data-intuitive.com"
+      github: "Leila011"
+      linkedin: "leilapaquay"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Software Developer"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--gff"
+    alternatives:
+    - "-f"
+    description: "Input GTF/GFF file(s).\n"
+    info: null
+    example:
+    - "input1.gff;input2.gff"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: true
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    - "--out"
+    description: "Output gff3 file where the gene incriminated will be writen."
+    info: null
+    example:
+    - "output.gff"
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Arguments"
+  arguments:
+  - type: "file"
+    name: "--config"
+    alternatives:
+    - "-c"
+    description: "AGAT config file. By default AGAT takes the original agat_config.yaml\
+      \ shipped with AGAT. \nThe `--config` option gives you the possibility to use\
+      \ your own AGAT config file (located\nelsewhere or named differently).\n"
+    info: null
+    example:
+    - "custom_agat_config.yaml"
+    must_exist: true
+    create_parent: true
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Merge different gff annotation files into one. It uses the AGAT parser\
+  \ that takes care of\nduplicated names and fixes other oddities met in those files.\n"
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "gene annotations"
+- "merge"
+- "gff"
+license: "GPL-3.0"
+references:
+  doi:
+  - "10.5281/zenodo.3552717"
+links:
+  repository: "https://github.com/NBISweden/AGAT"
+  homepage: "https://github.com/NBISweden/AGAT"
+  documentation: "https://agat.readthedocs.io/en/latest/tools/agat_sp_merge_annotations.html"
+  issue_tracker: "https://github.com/NBISweden/AGAT/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "quay.io/biocontainers/agat:1.4.0--pl5321hdfd78af_0"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "docker"
+    run:
+    - "agat --version | sed 's/AGAT\\s\\(.*\\)/agat: \"\\1\"/' > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/agat/agat_sp_merge_annotations/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/agat/agat_sp_merge_annotations"
+  executable: "target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
--- a/target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations
+++ b/target/executable/agat/agat_sp_merge_annotations/agat_sp_merge_annotations
--- a/target/executable/agat/agat_sp_statistics/.config.vsh.yaml
+++ b/target/executable/agat/agat_sp_statistics/.config.vsh.yaml
@@ -231,9 +231,9 @@ build_info:
  output: "target/executable/agat/agat_sp_statistics"
  executable: "target/executable/agat/agat_sp_statistics/agat_sp_statistics"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/agat/agat_sp_statistics/agat_sp_statistics
+++ b/target/executable/agat/agat_sp_statistics/agat_sp_statistics
@@ -507,9 +507,9 @@ RUN agat --version | sed 's/.*v\.//; s/\s.*//' | sed 's/^/AGAT: /' > /var/softwa

 LABEL org.opencontainers.image.authors="Leïla Paquay"
 LABEL org.opencontainers.image.description="Companion container for running component agat agat_sp_statistics"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/NBISweden/AGAT"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/arriba/.config.vsh.yaml
+++ b/target/executable/arriba/.config.vsh.yaml
@@ -706,9 +706,9 @@ build_info:
  output: "target/executable/arriba"
  executable: "target/executable/arriba/arriba"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/arriba/arriba
+++ b/target/executable/arriba/arriba
@@ -754,9 +754,9 @@ RUN arriba -h | grep 'Version:' 2>&1 |  sed 's/Version:\s\(.*\)/arriba: "\1"/' >

 LABEL org.opencontainers.image.authors="Robrecht Cannoodt"
 LABEL org.opencontainers.image.description="Companion container for running component arriba"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:10Z"
 LABEL org.opencontainers.image.source="https://github.com/suhrig/arriba"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml
+++ b/target/executable/bbmap/bbmap_bbsplit/.config.vsh.yaml
@@ -359,9 +359,9 @@ build_info:
  output: "target/executable/bbmap/bbmap_bbsplit"
  executable: "target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit
+++ b/target/executable/bbmap/bbmap_bbsplit/bbmap_bbsplit
@@ -600,9 +600,9 @@ cp -r bbmap/* /usr/local/bin
 RUN bbsplit.sh --version 2>&1 | awk '/BBMap version/{print "BBMAP:", $NF}' > /var/software_versions.txt

 LABEL org.opencontainers.image.description="Companion container for running component bbmap bbmap_bbsplit"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:24Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:12Z"
 LABEL org.opencontainers.image.source="https://github.com/BioInfoTools/BBMap/blob/master/sh/bbsplit.sh"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_annotate/.config.vsh.yaml
@@ -469,9 +469,9 @@ build_info:
  output: "target/executable/bcftools/bcftools_annotate"
  executable: "target/executable/bcftools/bcftools_annotate/bcftools_annotate"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bcftools/bcftools_annotate/bcftools_annotate
+++ b/target/executable/bcftools/bcftools_annotate/bcftools_annotate
@@ -650,9 +650,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo

 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_annotate"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:12Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:00Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bcftools/bcftools_concat/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_concat/.config.vsh.yaml
@@ -335,9 +335,9 @@ build_info:
  output: "target/executable/bcftools/bcftools_concat"
  executable: "target/executable/bcftools/bcftools_concat/bcftools_concat"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bcftools/bcftools_concat/bcftools_concat
+++ b/target/executable/bcftools/bcftools_concat/bcftools_concat
@@ -566,9 +566,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo

 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_concat"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:13Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:01Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bcftools/bcftools_norm/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_norm/.config.vsh.yaml
@@ -416,9 +416,9 @@ build_info:
  output: "target/executable/bcftools/bcftools_norm"
  executable: "target/executable/bcftools/bcftools_norm/bcftools_norm"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bcftools/bcftools_norm/bcftools_norm
+++ b/target/executable/bcftools/bcftools_norm/bcftools_norm
@@ -589,9 +589,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo

 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_norm"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:14Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:02Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bcftools/bcftools_sort/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_sort/.config.vsh.yaml
@@ -185,9 +185,9 @@ build_info:
  output: "target/executable/bcftools/bcftools_sort"
  executable: "target/executable/bcftools/bcftools_sort/bcftools_sort"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bcftools/bcftools_sort/bcftools_sort
+++ b/target/executable/bcftools/bcftools_sort/bcftools_sort
@@ -483,9 +483,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo

 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_sort"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:14Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:02Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bcftools/bcftools_stats/.config.vsh.yaml
+++ b/target/executable/bcftools/bcftools_stats/.config.vsh.yaml
@@ -458,9 +458,9 @@ build_info:
  output: "target/executable/bcftools/bcftools_stats"
  executable: "target/executable/bcftools/bcftools_stats/bcftools_stats"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bcftools/bcftools_stats/bcftools_stats
+++ b/target/executable/bcftools/bcftools_stats/bcftools_stats
@@ -626,9 +626,9 @@ RUN echo "bcftools: \"$(bcftools --version | grep 'bcftools' | sed -n 's/^bcftoo

 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bcftools bcftools_stats"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:13Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:01Z"
 LABEL org.opencontainers.image.source="https://github.com/samtools/bcftools"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bcl_convert/.config.vsh.yaml
+++ b/target/executable/bcl_convert/.config.vsh.yaml
@@ -418,9 +418,9 @@ build_info:
  output: "target/executable/bcl_convert"
  executable: "target/executable/bcl_convert/bcl_convert"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bcl_convert/bcl_convert
+++ b/target/executable/bcl_convert/bcl_convert
@@ -599,9 +599,9 @@ RUN echo "bcl-convert: \"$(bcl-convert -V 2>&1 >/dev/null | sed -n '/Version/ s/

 LABEL org.opencontainers.image.authors="Toni Verbeiren, Dorien Roosen"
 LABEL org.opencontainers.image.description="Companion container for running component bcl_convert"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:19Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/viash-hub/biobox"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml
+++ b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/.config.vsh.yaml
@@ -274,9 +274,9 @@ build_info:
  output: "target/executable/bd_rhapsody/bd_rhapsody_make_reference"
  executable: "target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference
+++ b/target/executable/bd_rhapsody/bd_rhapsody_make_reference/bd_rhapsody_make_reference
@@ -554,9 +554,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1)
 RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt
 LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz"
 LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_make_reference"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:16Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:03Z"
 LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1/Extra_Utilities/"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml
+++ b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/.config.vsh.yaml
@@ -1115,9 +1115,9 @@ build_info:
  output: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis"
  executable: "target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis
+++ b/target/executable/bd_rhapsody/bd_rhapsody_sequence_analysis/bd_rhapsody_sequence_analysis
@@ -954,9 +954,9 @@ RUN VERSION=$(ls -v /var/bd_rhapsody_cwl | grep '^v' | sed 's#v##' | tail -1)
 RUN echo "bdgenomics/rhapsody: \"$VERSION\"" > /var/software_versions.txt
 LABEL org.opencontainers.image.authors="Robrecht Cannoodt, Weiwei Schultz"
 LABEL org.opencontainers.image.description="Companion container for running component bd_rhapsody bd_rhapsody_sequence_analysis"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:16Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:03Z"
 LABEL org.opencontainers.image.source="https://bitbucket.org/CRSwDev/cwl/src/master/v2.2.1"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_bamtobed/.config.vsh.yaml
@@ -0,0 +1,262 @@
+name: "bedtools_bamtobed"
+namespace: "bedtools"
+version: "main"
+authors:
+- name: "Theodoro Gasperin Terra Camargo"
+  roles:
+  - "author"
+  - "maintainer"
+  info:
+    links:
+      email: "theodorogtc@gmail.com"
+      github: "tgaspe"
+      linkedin: "theodoro-gasperin-terra-camargo"
+    organizations:
+    - name: "Data Intuitive"
+      href: "https://www.data-intuitive.com"
+      role: "Bioinformatician"
+argument_groups:
+- name: "Inputs"
+  arguments:
+  - type: "file"
+    name: "--input"
+    alternatives:
+    - "-i"
+    description: "Input BAM file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+- name: "Outputs"
+  arguments:
+  - type: "file"
+    name: "--output"
+    alternatives:
+    - "-o"
+    description: "Output BED file."
+    info: null
+    must_exist: true
+    create_parent: true
+    required: true
+    direction: "output"
+    multiple: false
+    multiple_sep: ";"
+- name: "Options"
+  arguments:
+  - type: "boolean_true"
+    name: "--bedpe"
+    description: "Write BEDPE format. Requires BAM to be grouped or sorted by query.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--mate1"
+    description: "When writing BEDPE (-bedpe) format, always report mate one as the\
+      \ first BEDPE \"block\".\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--bed12"
+    description: "Write \"blocked\" BED format (aka \"BED12\"). Forces -split.\nSee\
+      \ http://genome-test.cse.ucsc.edu/FAQ/FAQformat#format1\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--split"
+    description: "Report \"split\" BAM alignments as separate BED entries.\nSplits\
+      \ only on N CIGAR operations.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--splitD"
+    description: "Split alignments based on N and D CIGAR operators.\nForces -split.\n"
+    info: null
+    direction: "input"
+  - type: "boolean_true"
+    name: "--edit_distance"
+    alternatives:
+    - "-ed"
+    description: "Use BAM edit distance (NM tag) for BED score.\n- Default for BED\
+      \ is to use mapping quality.\n- Default for BEDPE is to use the minimum of\n\
+      \  the two mapping qualities for the pair.\n- When -ed is used with -bedpe,\
+      \ the total edit\n  distance from the two mates is reported.\n"
+    info: null
+    direction: "input"
+  - type: "string"
+    name: "--tag"
+    description: "Use other NUMERIC BAM alignment tag for BED score.\nDefault for\
+      \ BED is to use mapping quality. Disallowed with BEDPE output.\n"
+    info: null
+    example:
+    - "SM"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "string"
+    name: "--color"
+    description: "An R,G,B string for the color used with BED12 format.\nDefault is\
+      \ (255,0,0).\n"
+    info: null
+    example:
+    - "250,250,250"
+    required: false
+    direction: "input"
+    multiple: false
+    multiple_sep: ";"
+  - type: "boolean_true"
+    name: "--cigar"
+    description: "Add the CIGAR string to the BED entry as a 7th column.\n"
+    info: null
+    direction: "input"
+resources:
+- type: "bash_script"
+  path: "script.sh"
+  is_executable: true
+description: "Converts BAM alignments to BED6 or BEDPE format."
+test_resources:
+- type: "bash_script"
+  path: "test.sh"
+  is_executable: true
+- type: "file"
+  path: "test_data"
+info: null
+status: "enabled"
+requirements:
+  commands:
+  - "ps"
+keywords:
+- "Converts"
+- "BAM"
+- "BED"
+- "BED6"
+- "BEDPE"
+license: "MIT"
+references:
+  doi:
+  - "10.1093/bioinformatics/btq033"
+links:
+  repository: "https://github.com/arq5x/bedtools2"
+  homepage: "https://bedtools.readthedocs.io/en/latest/#"
+  documentation: "https://bedtools.readthedocs.io/en/latest/content/tools/bamtobed.html"
+  issue_tracker: "https://github.com/arq5x/bedtools2/issues"
+runners:
+- type: "executable"
+  id: "executable"
+  docker_setup_strategy: "ifneedbepullelsecachedbuild"
+- type: "nextflow"
+  id: "nextflow"
+  directives:
+    tag: "$id"
+  auto:
+    simplifyInput: true
+    simplifyOutput: false
+    transcript: false
+    publish: false
+  config:
+    labels:
+      mem1gb: "memory = 1000000000.B"
+      mem2gb: "memory = 2000000000.B"
+      mem5gb: "memory = 5000000000.B"
+      mem10gb: "memory = 10000000000.B"
+      mem20gb: "memory = 20000000000.B"
+      mem50gb: "memory = 50000000000.B"
+      mem100gb: "memory = 100000000000.B"
+      mem200gb: "memory = 200000000000.B"
+      mem500gb: "memory = 500000000000.B"
+      mem1tb: "memory = 1000000000000.B"
+      mem2tb: "memory = 2000000000000.B"
+      mem5tb: "memory = 5000000000000.B"
+      mem10tb: "memory = 10000000000000.B"
+      mem20tb: "memory = 20000000000000.B"
+      mem50tb: "memory = 50000000000000.B"
+      mem100tb: "memory = 100000000000000.B"
+      mem200tb: "memory = 200000000000000.B"
+      mem500tb: "memory = 500000000000000.B"
+      mem1gib: "memory = 1073741824.B"
+      mem2gib: "memory = 2147483648.B"
+      mem4gib: "memory = 4294967296.B"
+      mem8gib: "memory = 8589934592.B"
+      mem16gib: "memory = 17179869184.B"
+      mem32gib: "memory = 34359738368.B"
+      mem64gib: "memory = 68719476736.B"
+      mem128gib: "memory = 137438953472.B"
+      mem256gib: "memory = 274877906944.B"
+      mem512gib: "memory = 549755813888.B"
+      mem1tib: "memory = 1099511627776.B"
+      mem2tib: "memory = 2199023255552.B"
+      mem4tib: "memory = 4398046511104.B"
+      mem8tib: "memory = 8796093022208.B"
+      mem16tib: "memory = 17592186044416.B"
+      mem32tib: "memory = 35184372088832.B"
+      mem64tib: "memory = 70368744177664.B"
+      mem128tib: "memory = 140737488355328.B"
+      mem256tib: "memory = 281474976710656.B"
+      mem512tib: "memory = 562949953421312.B"
+      cpu1: "cpus = 1"
+      cpu2: "cpus = 2"
+      cpu5: "cpus = 5"
+      cpu10: "cpus = 10"
+      cpu20: "cpus = 20"
+      cpu50: "cpus = 50"
+      cpu100: "cpus = 100"
+      cpu200: "cpus = 200"
+      cpu500: "cpus = 500"
+      cpu1000: "cpus = 1000"
+  debug: false
+  container: "docker"
+engines:
+- type: "docker"
+  id: "docker"
+  image: "debian:stable-slim"
+  target_registry: "images.viash-hub.com"
+  target_tag: "main"
+  namespace_separator: "/"
+  setup:
+  - type: "apt"
+    packages:
+    - "bedtools"
+    - "procps"
+    interactive: false
+  - type: "docker"
+    run:
+    - "echo \"bedtools: \\\"$(bedtools --version | sed -n 's/^bedtools //p')\\\"\"\
+      \ > /var/software_versions.txt\n"
+  entrypoint: []
+  cmd: null
+- type: "native"
+  id: "native"
+build_info:
+  config: "src/bedtools/bedtools_bamtobed/config.vsh.yaml"
+  runner: "executable"
+  engine: "docker|native"
+  output: "target/executable/bedtools/bedtools_bamtobed"
+  executable: "target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed"
+  viash_version: "0.9.0"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
+package_config:
+  name: "biobox"
+  version: "main"
+  description: "A collection of bioinformatics tools for working with sequence data.\n"
+  info: null
+  viash_version: "0.9.0"
+  source: "src"
+  target: "target"
+  config_mods:
+  - ".requirements.commands := ['ps']\n"
+  - ".engines += { type: \"native\" }"
+  - ".engines[.type == 'docker'].target_registry := 'images.viash-hub.com'"
+  - ".engines[.type == 'docker'].target_tag := 'main'"
+  keywords:
+  - "bioinformatics"
+  - "modules"
+  - "sequencing"
+  license: "MIT"
+  organization: "vsh"
+  links:
+    repository: "https://github.com/viash-hub/biobox"
+    issue_tracker: "https://github.com/viash-hub/biobox/issues"
--- a/target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed
+++ b/target/executable/bedtools/bedtools_bamtobed/bedtools_bamtobed
--- a/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_bamtofastq/.config.vsh.yaml
@@ -187,9 +187,9 @@ build_info:
  output: "target/executable/bedtools/bedtools_bamtofastq"
  executable: "target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq
+++ b/target/executable/bedtools/bedtools_bamtofastq/bedtools_bamtofastq
@@ -483,9 +483,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var

 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bamtofastq"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:07Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_bed12tobed6/.config.vsh.yaml
@@ -176,9 +176,9 @@ build_info:
  output: "target/executable/bedtools/bedtools_bed12tobed6"
  executable: "target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6
+++ b/target/executable/bedtools/bedtools_bed12tobed6/bedtools_bed12tobed6
@@ -480,9 +480,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var

 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bed12tobed6"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:21Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:09Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_bedtobam/.config.vsh.yaml
@@ -214,9 +214,9 @@ build_info:
  output: "target/executable/bedtools/bedtools_bedtobam"
  executable: "target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam
+++ b/target/executable/bedtools/bedtools_bedtobam/bedtools_bedtobam
@@ -496,9 +496,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var

 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_bedtobam"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:22Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:10Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml
+++ b/target/executable/bedtools/bedtools_genomecov/.config.vsh.yaml
@@ -337,9 +337,9 @@ build_info:
  output: "target/executable/bedtools/bedtools_genomecov"
  executable: "target/executable/bedtools/bedtools_genomecov/bedtools_genomecov"
  viash_version: "0.9.0"
-  git_commit: "52f44f5049606ac655154cf54ed53fa76b49896f"
-  git_remote: "https://x-access-token:ghs_Clbt7tbJqVcfiS3VxySrdzjhMh1FWp3VaTFP@github.com/viash-hub/biobox"
-  git_tag: "v0.2.0-14-g52f44f5"
+  git_commit: "aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
+  git_remote: "https://x-access-token:ghs_9v4VhFt3rgNHA8iZY5HYB5rN6bmxTd2UtBuO@github.com/viash-hub/biobox"
+  git_tag: "v0.2.0-20-gaa43543"
 package_config:
  name: "biobox"
  version: "main"
--- a/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov
+++ b/target/executable/bedtools/bedtools_genomecov/bedtools_genomecov
@@ -591,9 +591,9 @@ RUN echo "bedtools: \"$(bedtools --version | sed -n 's/^bedtools //p')\"" > /var

 LABEL org.opencontainers.image.authors="Theodoro Gasperin Terra Camargo"
 LABEL org.opencontainers.image.description="Companion container for running component bedtools bedtools_genomecov"
-LABEL org.opencontainers.image.created="2024-10-26T13:11:20Z"
+LABEL org.opencontainers.image.created="2024-10-26T18:44:08Z"
 LABEL org.opencontainers.image.source="https://github.com/arq5x/bedtools2"
-LABEL org.opencontainers.image.revision="52f44f5049606ac655154cf54ed53fa76b49896f"
+LABEL org.opencontainers.image.revision="aa43543e1fb609901d09b7a9f0c5e72707cb47a4"
 LABEL org.opencontainers.image.version="main"

 VIASHDOCKER
--- a/Show More
+++ b/Show More